Skip to main content

Full text of "DTIC ADA573347: Ecological Risk Assessment of Explosive Residues in Rodents, Reptiles, Amphibians, and Fish"

See other formats


FY2002 FINAL REPORT 


Ecological Risk Assessment of Explosive Residues in Rodents, 

Reptiles, Amphibians, and Fish 


SERDP Project ER-1235 


March 2004 



Ronald Kendall 
Todd Anderson 
Ernest Smith 
Reynaldo Patino 
Scott McMurry 
James Carr 
Kenneth Dixon 
Angella Gentles 
Philip Smith 
Texas Tech University 


This document has been cleared for public release 





REPORT DOCUMENTATION PAGE 


Form Approved 
OMB No. 0704-0188 


The public reporting burden for this collection of information is estimated to average 1 hour per response, including the time for reviewing instructions, searching existing data sources, 
gathering and maintaining the data needed, and completing and reviewing the collection of information. Send comments regarding this burden estimate or any other aspect of this collection of 
information, including suggestions for reducing the burden, to the Department of Defense, Executive Services and Communications Directorate (0704-0188). Respondents should be aware 
that notwithstanding any other provision of law, no person shall be subject to any penalty for failing to comply with a collection of information if it does not display a currently valid OMB 
control number. 

PLEASE DO NOT RETURN YOUR FORM TO THE ABOVE ORGANIZATION. 


2. REPORT TYPE 


Final Report-FY02 


1. REPORT DATE (DD-MM-YYYY) 

03-2004 


4. TITLE AND SUBTITLE 

Continuation of the Ecological Risk Assessment of Explosive Resides in 
Rodents, Reptiles, Amphibians, Fish and Invertebrates: An Integrated 
Laboratory and Field Investigation Related to Live-Fire Ranges in the 
Department of Defense 


3. DATES COVERED (From - To) 

2003-2004 


5a. CONTRACT NUMBER 


5b. GRANT NUMBER 


5c. PROGRAM ELEMENT NUMBER 


6. AUTHOR(S) 

Ronald Kendall 
George Cobb 
Todd Anderson 
Ernest Smith 
Phil Smith 


5d. PROJECT NUMBER 


ER-1235 


5e. TASK NUMBER 


5f. WORK UNIT NUMBER 


7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) 

The Institute of Environmental and Human Health at Texas Tech University 
1207 Gilbert Drive, Building 555 
Lubbock, Texas 79416 


8. PERFORMING ORGANIZATION 
REPORT NUMBER 


9. SPONSORING/MONITORING AGENCY NAME(S) AND ADDRESS(ES) 

SERDP/ESTCP 

4800 Mark Center Drive, Suite 17D08 
Alexandria, VA 22350-3605 


12. DISTRIBUTION/AVAILABILITY STATEMENT 

Unlimited 


10. SPONSOR/MONITOR'S ACRONYM(S) 

SERDP/ESTCP 


11. SPONSOR/MONITOR'S REPORT 
NUMBER(S) 

ER-1235 



14. ABSTRACT 

Little information is available regarding the uptake kinetics of RDX or HMX by typical wetland ( capable of root penetration into 
anaerobic zones) plants in constructed or real wetland systems. RDX uptake in aquatic and wetland plants has been studied 
previously (e.g. Best et al., 1997) but has not been rigorously explored. Wetlands are a key interface between non-point source 
runoff (e.g. firing ranges) and surface water or groundwater. Uptake kinetics are critical for an overall understanding of exposure as 
real systems are typically transiently loaded and concentration profiles are variable with depth due to microbial degradation. 
Leaching of RDX from simulated rain events and from simulated seasonal or event flooding will also play an important role in 
overall fate and exposure. 



16. SECURITY CLASSIFICATION OF: 

a. REPORT 

b. ABSTRACT 

c. THIS PAGE 


17. LIMITATION OF 
ABSTRACT 


18. NUMBER 19a. NAME OF RESPONSIBLE PERSON 

0F Ronald Kendall 

PAGES - 

19b. TELEPHONE NUMBER (Include area code) 

806-885-2132 


Standard Form 298 (Rev. 8/98) 
Prescribed by ANSI Std. Z39.18 































FINAL REPORT FY2002 
SERDP Project: ER-1235 


TABLE OF CONTENTS 

Topic Page 


IDENTIFICATION OF PERCHLORATE-CONTAMINATED AND REFERENCE SITES 
IN AND AROUND THE NAVAL SURFACE WARFARE CENTER IN INDIAN HEAD, 
MARYLAND (IHM-03-01) 

Study Final Report.1 

EFFECT OF AMMONIUM PERCHLORATE ON THYRIOID FUNCTION OF 
ZEBRAFISH (ZEB-02-01) 

Study Final Report.19 

Study Protocol.43 

PERCHLORATE-INDUCED ALTERATIONS IN METABOLIC RATE AND 
THERMOREGULATION IN PRARIE VOLES ( MICROTUS OCHRAGASTER ) AND 
HOUSE SPARROWS {PASSER DOMESTICUS) (MRT-03-01) 

Study Final Report.55 

Study Protocol.77 

UPTAKE OF PERCHLORATE IN INVERTEBRATES (INV-03-01) 

Study Final Report.92 

Study Protocol.103 

IMMUNE RESPONSES TO PERCHLORATE IN NATIVE AMPHIBIANS (SPEA-03-01) 

Study Final Report.116 

Study Protocol.130 

PERCHLORATE IN INVERTEBRATES, PERIPHYTON, AND DETRITUS AT THE 
NAVAL WEAPONS INDUSTRIAL RESERVE PLANT, MCLENNAN COUNTY, 

TEXAS (AQUA-03-01) 

Study Final Report.138 

Study Protocol.150 

EVALUATION OF PENDRIN EXPRESSION IN THE OFFSPRING OF AMMONIUM 
PERCHLORATE-DOSED DEER MICE (DEMO-03-01) 

Study Final Report.168 

Study Protocol.181 

AVIAN EXPOSURE TO PERCHLORATE—FIELD STUDY (AFS-02-01) 

Study Final Report.188 

Study Protocol.202 

ANALYTICAL EVALUATIONS IN SUPPORT OF TOXICOLOGICAL 
INVESTIGATIONS (ANALYT-03-01) 

Study Final Report.208 

ENVIRONMENTAL MODELING (MOD-03 -01) 

Study Final Report.219 




















Topic 


TABLE OF CONTENTS (Continued) 


Page 


PRELIMINARY ASSESSMENT OF RADIOLABELED IODIDE UPTAKE BY 
BULLFROG TADPOLE THYROID GLAND: A METHOD DEVELOPMENT AND 
FEASABILITY STUDY 

Study Final Report. 


243 




Final Report 

U.S. Air Force Coop. Agreement CU 1235 


T1EHH Project No. T9700 
1HM-03-01 Phase V 


IDENTIFICATION OF PERCHLORATE-CONTAMINATED AND REFERENCE 
SITES IN AND AROUND THE NAVAL SURFACE WARFARE CENTER IN 

INDIAN HEAD, MARYLAND 


STUDY NUMBER: 

IHM-03-01 

SPONSOR: 

Strategic Environmental and Research Development 
Program 

SERDP Program Office 

901 North Stuart Street, Suite 303 

Arlington, VA 22203 


CONTRACT ADMINISTRATOR: The Institute of Environmental and Human Health 

Texas Tech University/TTU Health Sciences Center 



Box 41163 

Lubbock, TX 79409-1163 

TESTING FACILITY: 

The Institute of Environmental and Human Health 
Texas Tech University 

Box 41163 

Lubbock, TX 79409-1163 

TEST SITE: 

The Institute of Environmental and Human Health 
Texas Tech University 

Box 41163 

Lubbock, TX 79409-1163 

ANIMAL TEST SITE: 

Texas Tech University 

Human Sciences Building 

Box 42002 

Lubbock, TX 79409-2002 

RESEARCH INITIATION: 

October 3, 2003 


RESEARCH COMPLETION: 


December 31, 2003 


Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
IHM-03-01 Phase V 


Table of Contents 

List of Tables and Figures.3 

Good Laboratory Practice Statement.4 

I. 0 Descriptive Study Title.5 

2.0 Study Number.5 

3.0 Sponsor.5 

4.0 Testing Facility Name and Address.5 

5.0 Proposed Experiment Start and Termination Dates.5 

6.0 Key Personnel.5 

7.0 Study Summary.5 

8.0 Methods.6 

9.0 Results.6 

10.0 Discussion. 

II. 0 Study Records and Archive 

12.0 References. 


List of Tables and Figures 


2 of 18 


oo 00 oo 
















Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
IHM-03-01 Phase V 


Table 1. Site information for collection of water samples in and around the Naval 
Surface Warfare Center in Indian Head, Maryland Preparations of test 

solutions. 7 

Figure 1. Map of the Naval Surface Warfare Center in Indian Head, Maryland. 8 

Figure 2. Enlarged view of the sites (ARSN, ARSS, AR, and MCNR).9 

Table 2. Physical properties of site IW85. 10 

Table 3. Physical properties of site ARSN.11 

Table 4. Physical properties of site ARSS. 12 

Table 5. Physical properties of site MCNR.13 

Table 6. Physical properties of site AR. 14 

Table 7. Physical properties of site MWC. 15 

Table 8. Physical properties of site SPM. 16 

Table 9. Physical properties of site SA. 17 

Table 10. Physical properties of site MSP. 17 

Table 11. Physical properties of site SPD. 17 

Table 12. Physical properties of site MARINA.17 


3 of 18 
















Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
IHM-03-01 Phase V 


GOOD LABORATORIES PRACTICES STATEMENT 

This study was conducted in accordance with established Quality Assurance 
Program guidelines and in the spirit of Good Laboratory Practice Standards whenever 
possible (40 CFR Part 160, August 17, 1989). 


Submitted By: 



4 of 18 







Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
IHM-03-01 Phase V 


1.0 DESCRIPTIVE STUDY TITLE: Identification of perchlorate-contaminated and 
reference sites in and around the Naval Surface Warfare Center in Indian Head, 
Maryland. 

2.0 STUDY NUMBER: IHM-03-01 
3.0 SPONSOR: 

Strategic Environmental and Research Development Program 

SERDP Program Office 

901 North Stuart Street, Suite 303 

Arlington, VA 22203 

4.0 TESTING FACILITY NAME & ADDRESS: 

The Institute of Environmental and Human Health 
Texas Tech University 

Texas Tech University Health Sciences Center 
Box 41163 

Lubbock, TX 79409-1163 

5.0 PROPOSED EXPERIMENTAL START & TERMINATION DATES: 

Start Date: 10/3/03 
Termination Date: 12/31/03 

6.0 KEY PERSONNEL: 

James A. Carr, Co-Principal Investigator/ DBS Testing Facility Management/Study 
Director 

Mike Wages, Research Associate 

Todd Anderson, Analytical Chemist/ Asst. Director for Science 
Ryan Bounds, Quality Assurance Manager 

Ronald Kendall, Principal Investigator/TIEHH Testing Facility Management 

7.0 STUDY SUMMARY: 

We collected water samples from eleven surface water sites in and around the Indian 
Head NSWC during two trips in October 2003. Water quality parameters of the 
surface waters were determined and samples from all sites were analyzed for 
perchlorate content to determine potential reference and contaminated sites for future 
study. Of the eleven sites examined, five contained measurable perchlorate 
concentrations ranging from 45 to greater than 550 pg/L perchlorate. All of the 
perchlorate contaminated sites were found on the military base; no perchlorate was 
detected offsite. Most of the perchlorate-contmainated sites contained tadpoles. Our 
data suggest that that both reference and perchlorate-contaminated sites exist in the 
vicinity of the Indian Head NSWC, and provide a basis for future basis for future 
investigations on natural amphibian populations inhabiting perchlorate-contaminated 
surface waters. 


5 of 18 


Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
IHM-03-01 Phase V 


8.0 METHODS: 

Sites were selected based on their proximity to perchlorate manufacturing sites within 
the NSWC. At each visit to the field site, we measured various compositional and 
physical parameters, including: 

1. dissolved oxygen 

2. water temperature 

3. conductivity 

4. total dissolved solids 

5. pH 

During each visit, a water sample was collected from the water body. Waters were 
collected by hand in clean glass 20 mL scintillation vials (AQ-3-03) and kept cool 
(i.e. in boxes and/or in shade) during transport to our laboratory where they were 
stored at approximately 4 °C until analyzed for perchlorate (AC-2-11). We attempted 
to visit each site twice during the fall of 2003. 

9.0 RESULTS: 

The Indian Head NSWC is an operational weapons testing and development facility 
that is located approximately 25 miles south of Washington D.C. (Figure 1). The 
Indian Head peninsula is bordered on the west by the Potomac River and on the east 
by Mattawoman Creek. The NSWC continues to mill and bum perchlorate, and was 
the subject of an in-depth study on perchlorate biotransport in 2001 (Parsons 
Engineering Science, Inc., 2001). Our goal was not to systematically sample every 
surface water body at the NSWC, but to focus on those sites with a high probability 
of serving as a habitat for local anurans. Others (Parsons Engineering Science, Inc., 
2001) have compiled a more thorough sampling of flora and fauna associated with 
perchlorate contaminated water bodies at NSWC. Our collections focused around a 
perchlorate milling site in the center of the facility (Low Vulnerability Ordnance 
Ammunition, LVOA, Area) that drains into a series of marshes and beaver ponds 
collectively called the Town Gut Marsh ponds. The Town Gut Marsh ponds drain in 
turn into Mattawoman creek (Figure 2). 

Site IDs and locations are presented in Table 1. The physical characteristics 
of the collection sites are presented in Tables 2-12. Our initial effort focused on the 
LVOA area (IW85), which contained a small pond inhabited by tadpoles. There is a 
perchlorate grinding facility in close proximity to this pond. As shown in Tables 2- 
12, perchlorate was detected in all of these sites, from IW85 south to MCRN, which 
lies at the intersection of Noble road and Mattawoman creek. Moreover, perchlorate 
concentrations were consistently lower at the sites south of IW85, a finding that is 
consistent with the notion that perchlorate moves with surface water drainage from 
the LVOA south to the Town Gut Marsh system and into Mattawoman creek. 

We focused on sites off of the naval base as potential reference sites. These 
included a site at Mattawoman creek off of highway 225 and a boat marina in 
Smallwood State Park. Neither site contained measurable perchlorate. Additionally, 
three sites were identified on base at the NSWC with no measurable perchlorate. 
These were a golf course pond off of Strauss Avenue (SA), the Potomac River at the 
NSWC marina (SPD), and a small holding pond at the marina (MSP). 


6 of 18 


Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEFIH Project No. T9700 
IHM-03-01 Phase V 


Table 1. Site information for collection of water samples in and around the Naval Surface Warfare 
Center in Indian Head, Maryland. _ 


Site ID 

Location 

GPS (UTM) 

Water 

Samples 

A&B 

Water 

Samples 

C&D 

AR 

Atkins Road 

18S 0309714 4272656 

10/3/03 

10/16/03 

ARSN 

Atkins Road Spur - North 

18S 0309811 4272828 

10/3/03 

10/16/03 

ARSS 

Atkins Road Spur - South 

18S 0307910 4272985 

10/3/03 

10/16/03 

IW85 

Adjacent to building 1185 

18S 0311225 4275280 

10/3/03 

10/16/03 

MARINA 

MARINA** *** 

18S 0309898 4274681 

10/3/03 

NC 

MCNR 

Noble Rd & Mattawoman Creek 

18S 0309722 4272352 

10/3/03 

10/16/03 

MSP 

Marina Settling Pond (IW48) 

18S 0309970 4274697 

10/4/03 

10/16/03 

MWC 

Mattawoman Creek & Hwy 225* 

18S 0315689 4273493 

10/4/03 

10/16/03 

SA 

Strauss Ave Golf Pond 

18S 0309875 4273956 

NC 

10/16/03 

SPD 

Potomac River Boat Dock** 

18S 0309269 4270028 

10/4/03 

10/16/03 

SPM 

Sweden Point Marina ** 

18S 0309604 4269939 

10/4/03 

10/16/03 


* Northeast of intersection of Hwy 225 & Hwy 224 

** In Smallwood State Park 

*** In IHDNSWC 


7 of 18 






















Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
IHM-03-01 Phase V 



Figure 1. Map of the Naval Surface Warfare Center in Indian Head, Maryland. The sites IW85, ARSN, ARSS, AR, and MCNR are 
located in the red box and are enlarged in Figure 2. 


8 of 18 















Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
IHM-03-01 Phase V 



Location 1 
LVOA West 
(Not Sampled)" 

B 1190. 


Location 3 
West Creek of N 
town Gut Marsh 

(not sampled) 


Locatlon^^_ 
East CreekVJ 
Town Gut Ma* 
(at IW85 Sampl 


(IW85) 


Location 5 . 

Town Gut Marsh 1 

(ARSN) 


Location^ 
Creek EasKpl 
(Town Gut Ma 

«not sampled) 


location 6 
Town Gut Marsh 2 


Location 7 

Town Gut Marsh 3\ 

(MCNR) 


Naval Surface Warfare Center 
Indian Head, Maryland 
Site and Sample Location Map 


Figure 2. Enlarged view of the sites (ARSN, ARSS, AR, and MCNR) located just south of the 
collection site (IW85) in closest proximity to the low vulnerability ordnance ammunition area 
(LVOA). The buildings in the LVOA area are used for milling perchlorate. Sites IW85, AR, 
ARSS, ARSN, and MCNR are all part of the Town Gut Marsh pond system. Surface water 
flows south from the LVOA through the Town Gut Marsh system into Mattawoman creek. The 
Potomac River lies just west of the facility and is not shown in this enlarged site map. Modified 
from an original map by Parsons Engineering Science, Inc. (2001). 


9 of 18 










Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
IHM-03-01 Phase V 



Table 2. Physical properties of site 1W85 


Grid reference 

18S 0311225 4275280 

Water temperature (°C) 

13.6 


5.85 

Dissolved oxygen (mg/L) 

4.98 

Conductivity (pS/cm) 

329 

Total dissolved solids (g/L) 

0.21 

Perchlorate (pg/L) 

463-555* 


*range of values based on two sampling dates. 


lOof 18 













Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
IHM-03-01 Phase V 



Table 3. Physical properties of site ARSN 


Grid reference 

18S 0309811 4272828 

Water temperature (°C) 

14.3 

pH 

6.55 

Dissolved oxygen (mg/L) 

4.98 

Conductivity (pS/cm) 

277 

Total dissolved solids (g/L) 

0.18 

Perchlorate (pg/L) 

99-131* 


*range of values based on two sampling dates. 


11 of 18 











Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
IHM-03-01 Phase V 



Table 4. Physical properties of site ARSS 


Grid reference 

18S 0307910 4272985 

Water temperature (°C) 

15.9 

pH 

6.56 

Dissolved oxygen (mg/L) 

3.44 

Conductivity (pS/cm) 

223 

Total dissolved solids (g/L) 

0.15 

Perchlorate (pg/L) 

55-64* 


*range of values based on two sampling dates. 


12 of 18 












Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
IHM-03-01 Phase V 



Table 5. Physical properties of site MCNR 


Grid reference 

18S 0309722 4272352 

Water temperature (°C) 

18.1 

pH 

6.91 

Dissolved oxygen (mg/L) 

5.56 

Conductivity (pS/cm) 

129 

Total dissolved solids (g/L) 

0.08 

Perchlorate (pg/L) 

45-121* 


*range of values based on two sampling dates. 


13 of 18 












Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
IHM-03-01 Phase V 



Table 6. Physical properties of site AR. 


Grid reference 

18S 0309714 4272656 

Water temperature (°C) 

16.8 

pH 

7.05 

Dissolved oxygen (mg/L) 

5.43 

Conductivity (pS/cm) 

208 

Total dissolved solids (g/L) 

0.14 

Perchlorate (pg/L) 

57-95* 


*range of values based on two sampling dates. 


14 of 18 













Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
IHM-03-01 Phase V 



Table 7. Physical properties of site IV 

IWC. 

Grid reference 

18S 0315689 4273493 

Water temperature (°C) 

16.1 

pH 

6.23 

Dissolved oxygen (mg/L) 

3.74 

Conductivity (pS/cm) 

54 

Total dissolved solids (g/L) 

0.04 

Perchlorate (pg/L) 

ND* 


* Non-detectable based on two sampling dates. 


15 of 18 














Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
IHM-03-01 Phase V 



Table 8. Physical properties of site S 

PM. 

Grid reference 

18S 0309604 4269939 

Water temperature (°C) 

15.9 

pH 

6.85 

Dissolved oxygen (mg/L) 

2.92 

Conductivity (pS/cm) 

81 

Total dissolved solids (g/L) 

0.05 

Perchlorate (pg/L) 

ND* 


* Non-detectable based on two sampling dates. 


16 of 18 















Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
IHM-03-01 Phase V 


Table 9. Physical properties of site S A. 


Grid reference 

18S 0309875 4273956 

Water temperature (°C) 

15.4 

pH 

6.84 

Dissolved oxygen (mg/L) 

5.09 

Conductivity (pS/cm) 

221 

Total dissolved solids (g/L) 

0.14 

Perchlorate (pg/L) 

ND* 

* Non-detectable based on two sampl 

ing dates. 


Table 10. Physical properties of site 

MSP. 

Grid reference 

18S 0309970 4274697 

Water temperature (°C) 

16.4 

pH 

8.16 

Dissolved oxygen (mg/L) 

6.33 

Conductivity (pS/cm) 

193 

Total dissolved solids (g/L) 

0.13 

Perchlorate (pg/L) 

ND* 

* Non-detectable based on two samp 

ing dates. 


Table 11. Physical properties of site SPD. 


Grid reference 

18S 0309269 4270028 

Water temperature (°C) 

21.5 

pH 

7.16 

Dissolved oxygen (mg/L) 

5.8 

Conductivity (pS/cm) 

119 

Total dissolved solids (g/L) 

0.08 

Perchlorate (pg/L) 

ND* 

* Non-detectable based on two sampl 

ing dates. 


Table 12. Physical properties of site 

Vlarina. 

Grid reference 

18S 0309898 4274681 

Water temperature (°C) 

Not sampled 

pH 

Not sampled 

Dissolved oxygen (mg/L) 

Not sampled 

Conductivity (pS/cm) 

Not sampled 

Total dissolved solids (g/L) 

Not sampled 

Perchlorate (pg/L) 

ND* 

* Non-detectable based on two samp 

ing dates. 


17 of 18 

















































Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
IHM-03-01 Phase V 


10.0 DISCUSSION: 

Our data indicate that surface waters in the vicinity of the LVOA contain 
measurable perchlorate concentrations in the range of 45 pg perchlorate/L to more than 
550 pg perchlorate/L. No perchlorate was detected west of the LVOA in the Potomac 
River, nor was perchlorate detected at any of the surface water sites located in 
Mattawoman creek off of the NSWC. The results for perchlorate levels at site IW85 
agree with a previous report to the degree that in the previous report perchlorate was 
detected in 6 of 6 samples from this site. In the previous study surface water levels of 
perchlorate at this site ranged from 22-24 pg perchlorate/L (Parsons Engineering Science, 
Inc., 2001), whereas in the present study perchlorate levels in surface water at this site 
ranged from 463-555 pg perchlorate/L. Likewise, we detected perchlorate at sites AR, 
ARSN, ARSS, and MCNR, all of which are part of the Town Gut Marsh system. Sites 
ARSN, AR, and MCNR correspond to sampling sites 5, 6 and 7 as reported by Parsons 
Engineering Science (2001), all of which were reported to contain measurable perchlorate 
in surface waters in 1005 of the samples analyzed. In the previous study perchlorate 
concentrations at sites 5,6, and 7 range from 12 pg perchlorate/L at site 7 (the farthest 
away from the LVOA) to 25 pg perchlorate/L at site 6 (Parsons Engineering Science, 

Inc., 2001). Thus, several sites with likely anuran populations at the Indian Head NSWC 
contain measurable perchlorate as determined by two separate analyses in 2001 and 2003. 
We were unable to detect perchlorate in any of the sites located off base, suggesting that 
any of these sites with viable anuran populations may serve as reference sites. 

11.0 STUDY RECORDS AND ARCHIVE: 

Study Records will be maintained at The Institute of Environmental and Human Health 
(TIEHH) Archive for a minimum of one year after study completion date. 

12.0 REFERENCES: 

Parsons Engineering Science, Inc. (2001). Interim final scientific and technical report 
for perchlorate biotransport investigation. A study of perchlorate occurrence in selected 
ecosystems. Report contract #F41624-95-D-9018. 


18 of 18 


Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TTEHH Project No. T9700 
Thyroid Function Phase V 


TITLE: Effect of ammonium perchlorate on thyroid function of zebrafish 


%% \m » 


STUDY NUMBER: ZEB-02-01 

SPONSOR: Strategic Environmental and Research Development 

Program 

SERDP Program Office 

901 North Stuart Street, Suite 303 

Arlington, VA 22203 


CONTRACT ADMINISTRATOR: The Institute of Environmental and Human Health 

Texas Tech University/TTU Health Sciences Center 
Box 41163 

Lubbock, TX 79409-1163 

Texas Cooperative Fish and Wildlife Research Unit 
Texas Tech University 
Box 2120 

Lubbock, TX 79409-2120 

Texas Cooperative Fish and Wildlife Research Unit 
Texas Tech University 
Box 2120 

Lubbock, TX 79409-2120 

Texas Cooperative Fish and Wildlife Research Unit 
Texas Tech University 
Box 2120 

Lubbock, TX 79409-2120 
RESEARCH INITIATION: 06-15-02 

RESEARCH COMPLETION: 12-31-2003 


TESTING FACILITY: 


TEST SITE: 


ANIMAL TEST SITE: 


1 of 24 




Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
Thyroid Function Phase V 


Table of Contents 

List of Tables and Figures..3 

Good Laboratory Practice Statement.4 

Quality Assurance Statement.5 

I. 0 Descriptive Study Title.6 

2.0 Study Number.6 

3.0 Sponsor.6 

4.0 Testing Facility Name and Address.6 

5.0 Proposed Experiment Start and Termination Dates. 6 

6.0 Key Personnel.6 

7.0 Study Objectives/Purpose.6 

8.0 Study Summary.6 

9.0 Test Materials.7 

10.0 Justification of Test System.9 

II. 0 Test Animals..10 

12.0 Procedure for Identifying the Test System.10 

13.0 Experimental Design Including Bias Control.11 

14.0 Methods. 11 

15.0 Results.14 

16.0 Discussion.16 

17.0 Study Records and Archive.19 

18.0 References.19 

19.0 Figures.21 

20.0 Appendices.24 


2 of 24 

























Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
Thyroid Function Phase V 


List of Tables and Figures 

Figure 1. Photomicrographs of thyroid follicles of zebrafish reared in control water or in water 
containing AP-derived perchlorate at measured concentrations of 11480 ppb for 12 weeks. Page 
21 

Figure 2. Changes in hypertrophy and angiogenesis of zebrafish thyroid follicles during 
exposure to AP-derived perchlorate at measured concentrations 0 to 11480 ppb from 2 to 12 
weeks. Page 22 

Figure 3. Changes in hypertrophy and angiogenesis of zebrafish thyroid follicles during recovery 
from exposure to AP-derived perchlorate at measured concentrations 0 to 11480 ppb for 12 
weeks. Page 23 


3 of 24 


Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
Thyroid Function Phase V 


GOOD LABORATORIES PRACTICES STATEMENT 

This study was conducted in accordance with established Quality Assurance Program guidelines 
and in the spirit of Good Laboratory Practice Standards whenever possible (40 CFR Part 160, 
August 17, 1989). 

Submitted By: 



4 of 24 




Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
Thyroid Function Phase V 


QUALITY ASSURANCE STATEMENT 

This study was conducted under The Institute of Environmental and Human Health Quality 
Assurance Program and whenever possible to meet the spirit of the Good Laboratory Practices as 
outlined in 40 CFR Part 160, August 17, 1989. 



5 of 24 




Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
Thyroid Function Phase V 


1. Descriptive Study Title: 

Effect of ammonium perchlorate on thyroid function of zebrafish 

2. Study Number: 

ZEB-02-01 

3. Sponsor: 

Strategic Environmental and Research Development Program 

SERDP Program Office 

901 North Stuart Street, Suite 303 

Arlington, VA 22203 

4. Testing Facility Name and Address: 

Texas Cooperative Fish and Wildlife Research Unit 
Texas Tech University 

Box 42120, 218 Agricultural Science Building 
Lubbock, Texas 79409-2120 

5. Proposed Experiment Start and Termination Dates: 

Start date: 06-15-2002 

Termination Dates: 12-31-2003 

6. Key Personnel: 

Reynaldo Patino, Testing Facility Management 
Sandeep Mukhi, Study Director 
Todd Anderson, Analytical Chemist 
Ryan Bounds, Quality Assurance Manager 
Ronald Kendall, Principal Investigator 

7. Study Objectives/Purpose: 

1. To determine the concentration and time-dependent effects of ammonium perchlorate on 
thyroid follicle histopathology. 

2. To determine the time-course of thyroid histopathological recovery following the 
termination of ammonium perchlorate exposure. 

3. To determine the concentration and time-dependent effects of ammonium perchlorate on 
body growth (weight and fork length) and condition factor. 

4. To determine the effect of perchlorate on whole-body thyroxin content. 

5. To determine the relative usefulness of the measured traits as biomarkers of ammonium 
perchlorate exposure. 

8. Study Summary 

Perchlorate is an environmental contaminant of increasing concern. Its concentration in 
contaminated ground and surface waters is commonly reported to be < 100 ppb. A major source 


6 of 24 





Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
Thyroid Function Phase V 


of environmental perchlorate is ammonium perchlorate (AP). Perchlorate inhibits iodide uptake 
by thyroid follicles and lowers their production of thyroid hormones (e.g., thyroxin). This leads 
to increased secretion of thyroid-stimulating hormone by the pituitary gland, which consequently 
causes hyper-stimulation or hypertrophy of thyroid follicles. Hypertrophy is widely used marker 
of thyroid activity. However, its usefulness as maker of exposure to environmentally relevant 
concentrations of perchlorate for field surveys or laboratory tests has not been fully validated. 
Therefore, the objective of this study is to evaluate and compare several biomarkers of 
perchlorate exposure using zebrafish as animal model. We focused on six different biological 
endpoints as possible markers of perchlorate exposure: thyroid follicle angiogenesis, thyroid 
follicle hypertrophy, thyroid follicle colloid depletion, whole-body thyroxin concentration, body 
growth (weight and fork length), and condition factor. Immature (3-month-old) zebrafish were 
exposed to AP at measured perchlorate concentrations of 0, 10, 90, 1131 and 11480 ppb for 12 
weeks, and then allowed to recover in clean water for an additional 12 weeks. Sampling was 
conducted at 2, 4, 8 and 12 weeks of exposure and at 4 and 12 weeks after exposure. At 2 weeks 
of exposure, thyroid follicle angiogenesis was the only marker for which change was recorded 
with a lowest observed effective level (LOEL) of perchlorate of 90 ppb. Hypertrophy was first 
noted at 4 weeks of exposure with a LOEL of 11480 ppb, and colloid depletion at 8 weeks with a 
LOEL of 11480 ppb. By 12 weeks of exposure, the LOEL for angiogenesis remained at 90 ppb 
and for hypertrophy and colloid depletion had simultaneously decreased to 1131 ppb. Thus, a 
time-dependent decline in LOEL was observed for hypertrophy and colloid depletion but not for 
angiogenesis. At the completion of the 12-week recovery period, residual effects on 
angiogenesis were still present (LOEL, 11480 ppb), whereas hypertrophy and colloid depletion 
were no longer evident. Whole-body thyroxin concentration, body growth and condition factor 
were not affected by AP exposure at any time or at any of the concentrations tested. Also, the 
experimental fish became sexually m ature by the end of the experimental period regardless of 
treatment. In conclusion, this study showed that angiogenesis is a much more sensitive marker 
of perchlorate exposure than the other parameters examined. Namely, angiogenesis not only 
responded faster and at lower concentrations of perchlorate, but also persisted for longer periods 
of time after removal of perchlorate from the water. Further, the LOEL for angiogenesis is 
within the environmentally relevant range of perchlorate concentrations. 

9. Test Materials: 

Test Chemical name: Ammonium perchlorate 

CAS number: 7790-98-9 

Characterization: white powder: specific gravity of 1.950 

Purity: Certificate of analysis will be obtained from the company. This chemical will be 

99.999% pure as indicated by supplier. 

Stability: incompatible with strong reducing agents, strong acids, heat-sensitive. The 

ammonia is a hazardous combustion or decomposition product. 

Source: Aldrich Chemical Co., Inc. 

Reference Chemical name: Calcium Chloride 

CAS number 10035-04-8 

Characterization: coarse white powder or mixture with medium size granules. 

Purity: certificate of analysis or analytical testing will indicate purity. 


7 of 24 



Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
Thyroid Function Phase V 


Stability: stable 
Source: Sigma 

Reference Chemical name: Magnesium Sulfate 
CAS number: 100-34-99-8 
Characterization: colorless crystals 

Purity: certificate of analysis or analytical testing will indicate purity. 

Stability: stable 
Source: Sigma 

Reference Chemical name: Potassium Chloride 

CAS number: 7447-40-7 

Characterization: white crystalline granules 

Purity: certificate of analysis or analytical testing will indicate purity. 

Stability: stable 
Source: Sigma 

Reference Chemical name: Sea Salts 
CAS number: Not applicable 

Characterization: an artificial salt mixture closely resembling the composition of the 
dissolved salts of ocean water. 

Purity: certificate of analysis or analytical testing will indicate purity. 

Stability: stable 

Source: Aquarium Systems, Inc. 

Reference Chemical name: Sodium Bicarbonate 

CAS number: 144-55-8 

Characterization: white crystalline powder 

Purity: certificate of analysis or analytical testing will indicate purity. 

Stability: stable 
Source: Sigma 

Reference Chemical name: Sodium Chloride 
CAS number: 7647-14-5 
Characterization: white crystalline granules 

Purity: certificate of analysis or analytical testing will indicate purity. 

Stability: stable 
Source: Sigma 

Reference Chemical name: Ultrapure water with added salts needed by fish will be used 
as reference solution to which negative reference material or test material will be added 
for treatments. 

CAS Number: Not applicable 

Characterization: water quality will be tested by chemical analysis and pH will be 
monitored regularly. 


8 of 24 


Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
Thyroid Function Phase V 


Purity: ultrapure 
Stability: stable 

Source: City tap water or steam plant deionized water that has been run through a carbon 
filter and a de-ionizer to convert it to ultrapure water. Sea salts (60-240 rag/L) will be 
added to this water, or a modified FETAX will be made. 

Reference Chemical name: L- [ 125 I]-thyroxin 
CAS number: not applicable 

Characterization: In presence of excess antibody total binding of tracer should be 70- 
100%. See SOP IN-2-04-01 for detail. 

Purity: Initially greater than 95% radiochemically pure as determined by HPLC 
(Technical data sheet from manufacturer). 

Stability: half-life-60days 

Source: Perkin-Elmer Life Sciences, Inc. Boston, MA, USA). 

Reference Chemical name: Thyroxin antiserum 
CAS number: not applicable. 

Characterization: 100% reactivity towards L- and D-thyroxin, 1.2% cross reactivity with 
L-triiodothyronine (T 3 ), very low cross reactivity with mono or di-iodo-L-tyrosine 
(<0.001%) at 50% displacement. 

Purity: crude antiserum preparation (rabbit anti-thyroxin BSA serum). 

Source: ICN Biomedicals, Inc. (Costa Mesa, CA, USA). 

10. Justification of Test System: 

Perchlorate alters thyroid gland function by inhibiting sodium-iodide symporters that regulate the 
amount of iodide taken into thyroid follicles (Wolff, 1998). Reduced uptake of iodide suppresses 
the production and consequently the release of thyroid hormones thereby reducing their levels in 
blood. This condition causes the pituitary gland to increase its production of thyroid-stimulating 
hormone (TSH) in an attempt to restore thyroid hormone production and levels. Prolonged 
exposures to perchlorate causes hyper-stimulation of the thyroid gland (Wolff, 1998; Soldin et 
al., 2001). Histopathological studies have revealed that exposure to AP-derived perchlorate 
leads to thyroid follicle hypertrophy, hyperplasia, and colloid depletion in a number of 
vertebrates (Fernandez Rodriguez et al., 1991; Siglin et al., 2000; York et al., 2001b; Goleman et 
al., 2002a), including zebrafish (Patino et al., 2003a). Thyroid follicle angiogenesis has also 
been observed in AP-treated rats (Fernandez Rodriguez et al., 1991) and zebrafish (Patino et al., 
2003a). 

Thyroid follicle hypertrophy is among the most widely used histological markers of thyroid 
activity, but its usefulness as maker of exposure to environmentally relevant concentrations of 
perchlorate for field surveys or laboratory tests has not been fully validated. Similarly, although 
thyroid follicle angiogenesis is a remarkable histological event in adult zebrafish exposed to AP 
(Patino et al., 2003), its behavior as maker of perchlorate exposure has not been explored. The 
objective of this study is to evaluate and compare several markers of perchlorate exposure using 
zebrafish as animal model. We focused on six different biological endpoints as possible markers 


9 of 24 



Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
Thyroid Function Phase V 


of perchlorate exposure: thyroid follicle angiogenesis, thyroid follicle hypertrophy, thyroid 
follicle colloid depletion, whole-body thyroxin concentration, body growth (weight and fork 
length), and condition factor. 

Zebrafish was used as experimental animal because it is a widely used animal model in basic 
toxicological, developmental and reproductive research. This species is also easily and 
economically maintained in the laboratory. Further, our earlier experiments that generated the 
questions being addressed by the present study were conducted with zebrafish. 

11. Test Animals: 

Species: Brachydanio rerio, Zebrafish 

Strain: Wildtype 

Age: Sub-adults (2 months of age at the time of purchase). 

Number: 675, mixed sex population. 

Source: Fish were purchased from Aquatic Research Organisms (Hampton, NH, 

USA) 

12. Procedure for Identifying the Test System: 

Upon arrival from the vendor, 2-month-old zebrafish of unknown sex were randomly assigned to 
pre-cleaned (SOP AF-1-01) 10-gallon glass aquaria filled with 30 liters of zebrafish water at 
approximately 50 fish per tank. They were allowed to acclimatize to the laboratory for 4 weeks 
before the exposures were started, and were therefore approximately 3-month-old at the onset of 
exposures. Tanks were appropriately labeled with a minimum of the following: project number, 
initials, concentration, chemical, replicate number, and date initiated. Treatment solutions were 
added to the appropriate tanks according to SOP AF-1-01. 

The following tasks were conducted: 

Task 1 (exposure and recovery): Fish were exposed to nominal concentrations of 0,10, 100, 

1000 and 10000 ppb of AP according to SOP-AF-1-01. 

Task 2 (histological sample collection): Samples for histological analysis were taken at 2, 4, 8 
and 12 weeks of exposure and at 4 and 12 weeks after removal of AP. 

Task 3 (whole-body thyroxin content): Samples for whole-body thyroxin content analysis were 
taken at 6 and 12 weeks of exposure and at 12 weeks after removal of AP. 

Fork lengths and weights were recorded on all samples taken. Fish were fed with commercial 
diet twice daily. Feeding behavior and general health were monitored by daily observations. 
Water temperature, pH, salinity, and dissolved oxygen were recorded daily. One half of the 
water volume in the aquaria (15L) was replaced once weekly and ammonia level was also 
monitored once weekly. At each sampling time, fish were euthanized in a lethal concentration of 
anesthetic (lg/L MS-222). Following an abdominal incision, fish collected for histological 
analysis were placed in Bouin’s solution, and further processing was followed according to SOP 


10 of 24 


Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
Thyroid Function Phase V 


AQ-2-10. Fish taken for thyroxin content analysis were flash-frozen in liquid nitrogen and 
stored at - 80 °C. 

13. Experimental Design Including Bias Control: 

After the acclimation period, ammonium perchlorate was added to the tanks at final nominal 
concentrations of 0, 10, 100,1000, and 10000 ppb (five treatments). Three replicate aquaria per 
AP concentration were prepared housing a total of 750 fish. At each sampling time, 5 fish were 
sampled from each replicate. There were a total of 6 sampling times during the exposure and 
recovery periods for histological analysis, and 3 sampling times for whole-body thyroid hormone 
content. 

The total fish required for histology is calculated as: 5 treatments X 3 tank replicates per 
treatment X 6 sampling times X 5 fish per sampling time = 450 fish. The total fish required for 
thyroxin analysis is: 5 treatments X 3 tank replicates per treatment X 3 sampling times X 5 fish 
per sampling time = 225. Therefore, the total number of fish sampled for analysis was 675 (50 in 
each of 15 aquaria). 

14. Methods 

14.1 Animal Husbandry 

The use of animals in this study was reviewed and approved by the Texas Tech University 
Animal Care And Use Committee (Lubbock, TX, USA). Two-month-old zebrafish 
(Brachydanio rerio) were obtained from Aquatic Research Organisms (Hampton, NH, USA) and 
acclimatized for 4 weeks in zebrafish water (180 mg of Sea Salt® per liter of deionized water) in 
10-gallon glass aquaria. Each tank was fitted with two hand-made internal biofilters consisting 
of 250-ml glass beakers filled with glass wool and glass beads. The water flow inside the filter 
was maintained by airflow through a glass pipette. 

All physico-chemical water parameters were maintained at optimal conditions for zebrafish 
(temperature, 26-28 °C; dissolved oxygen > 4 ppm; pH, 6.5-8; photoperiod, 14:10-h light:dark, 
unionized ammonia <0.1 ppm). Fish were fed twice daily to satiation with commercial diet 
(Tetramin®, Tetra Sales, Blacksburg, VA, USA). Dissolved oxygen, temperature, conductivity, 
and salinity were measured daily using a YSI® model 85 meter (Yellow Springs, OH, USA), 
and total ammonia was measured with a HACK® spectrophotometer model DR/2000 (Loveland, 
CO, USA) at least once a week. A small volume of water was siphoned from the bottom of the 
tank to remove debris once daily, and one-half of the water volume was removed and replaced 
with clean water once weekly. 

14.2 Experimental Design and Perchlorate Exposure 

Details of the experimental design and exposure protocols can be found in Study Protocol 
T9700/ZEB-02-01. Zebrafish were exposed to nominal AP concentrations of 0,10,100,1000, 
and 10000 ppb. There were three replicate aquaria per treatment. Each experimental tank 


11 of 24 




Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
Thyroid Function Phase V 


contained approximately 50 fish at the beginning of the exposure. Fish were exposed to AP for 
12 weeks and then were allowed to recover in the absence of perchlorate for an additional 12 
weeks. 

At the beginning of the exposure and at the time of each water exchange during the rearing 
period, the appropriate volume of AP stock solution was added to the aquaria to maintain the 
target perchlorate concentration. Water samples were collected for verification of actual 
perchlorate concentrations once every two weeks starting on the first day of exposure. At the 
end of the exposure period, the remaining fish were carefully removed with a net from the 
exposure tanks, briefly rinsed in respective large beakers with aerated clean zebrafish water, 
placed in clean 10-gallon glass aquaria with fresh zebrafish water, and reared for an additional 12 
weeks. Water samples were collected during recovery period at 1, 4 and 12 weeks after transfer. 

Fish for histological observations were collected at 2, 4, 8 and 12 weeks of exposure and at 4 and 
12 weeks of recovery. At each sampling time, fish were allowed to swim (“rinsed”) in three 
consecutive baths of fresh zebrafish water (to minimize contamination of the laboratory), 
euthanized in MS-222 (1 g/L), and placed in Bouin’s fixative after an abdominal incision. 
Samples were also collected at 6 and 12 weeks of exposure and at 12 weeks of recovery for 
analysis of thyroid hormone concentrations in whole fish. For this purpose, fish were rinsed, 
euthanized, wrapped in aluminum foil, snap-frozen in liquid nitrogen, and stored at - 80 °C until 
further analysis. Five fish from each replicate aquarium, irrespective of sex, were randomly 
collected at each sampling. The sex of each fish was later verified by histology (except those for 
hormone analysis, which were frozen). 

14.4 Perchlorate concentration in treatment water 

Perchlorate concentrations in the stock solutions and in experimental tank water were verified by 
ion chromatography (Anderson and Wu 2002). 

14.5 Growth 

To evaluate the effect of AP on growth, body weight and fork length (from tip of snout to the 
point where the caudal fin bifurcate) were measured at each time of sampling. Condition factor 
was also calculated according to the formula, 100000 x body weight (g)/length (mm) 3 . 

14.6 Histology 

Whole fish were kept in Bouin’s solution for 48 h at 4 °C and subsequently processed for 
histology according to procedures described for zebrafish by Patino et al. (2003). The head of 
the fish was separated by incision from the trunk region, and each piece was used to prepare 
separate blocks of paraffin for thyroid histopathology and sex determination, respectively. 
Sections (6 pm) were processed and stained with hematoxylin and eosin. 

All thyroid histopathological analyses were conducted on the same cross-section of the head. 

This section was chosen according to its histological integrity and quality when viewing the first 


12 of 24 




Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
Thyroid Function Phase V 


row of sections on the slide from left to right. Digital images of thyroid follicles were taken with 
an Olympus (DP 10) digital camera attached to Olympus microscope (BH2). Measurements were 
conducted digitally using Image-Pro® Express software (Media Cybernetics, Silver Spring, MD 
USA). The height of the thyroid follicle epithelium was used as index of hypertrophy. This 
height was measured at four predetermined positions (12, 3, 6 , and 9 o’clock) in each of five 
follicles per fish. The average height was calculated for each follicle, and the average of the five 
follicles was determined for each fish. The number of blood vessels around the entire length of 
the follicular epithelium was counted under the microscope, and the perimeter length of the 
follicle was measured digitally. The number of blood vessels was standardized to 100 pm of 
follicular perimeter and used as index of angiogenesis for each follicle. Angiogenesis was 
determined in the same five follicles per fish, and the average of these determinations was 
regarded as the fish value. A semi-quantitative method was used to measure colloid depletion by 
assigning a score for each of the five follicles as follows: 0 , no colloid depletion; 1 , one-third of 
colloid depleted; 2, two-thirds of colloid depleted; and 3, no colloid present in the follicle. The 
average score for the five follicles was used as the fish value. 

The procedures for fixation, processing and staining of the tru nk regions were the same as for the 
head. The purpose of these preparations was simply to determine the sex of the fish by 
inspection of the gonads. 

14.7 Thyroid hormone extraction and radioimmunoassay (RIA) 

All five fish taken from each tank replicate at each sampling period were pooled for extraction. 
The total weight of the pooled fish was recorded, the fish were broken into smaller fragments 
while still frozen, and were then homogenized using a Tekmar® homogenizer in 3-4 volumes of 
ice-cold methanol (HPLC-grade) containing 1 mM propyl thiouracil (PTU). The homogenates 
were sonicated using a Fisher Scientific 50 Sonic Dismembrator at 3 x 20 sec pulses. 
Approximately 1000 counts per minute (CPM) of [ 125 I]-thyroxin (969Ci/mmol; Perkin-Elmer 
Life Sciences, Inc., Boston, MA, USA) in 50 pi of methanol (containing 1 mM PTU) were added 
to each homogenate, and the homogenates were incubated at room temperature for 30 minutes. 
[Immediately before use, free iodine was removed from the radiotracer preparation using Sep- 
Pak Ci 8 cartridges (Waters) according to Denver (1993).] 

Following the incubation, homogenates were centrifuged at 1000 g for 20 min at 4 °C. The 
supernatants were removed and mixed with 2 volumes of CHCL 3 , and back-extracted into an 
aqueous phase with 1 to 3 ml of 2N NH 4 OH followed by centrifugation at 1500 g for 15 min at 4 
°C. The back extraction was repeated two more times. The aqueous fractions were pooled and 
dried in a Jouan centrifugal evaporator overnight. The dried samples were resuspended in 1 ml 
of 2N NH 4 OH, mixed with 2ml CHCL 3 , and centrifuged at 1500 g for 15 min at 4 °C. The 
aqueous phase was collected and purified by ion exchange chromatography as described by 
Morreale de Escobar et al. (1985). Briefly, Polyprep chromatography columns (Bio-Rad, 
Hercules, CA, USA) were prepared with 1.5 ml AG l-x2 resin (200-400 mesh, chloride form, 
Bio-Rad) previously equilibrated with acetate buffer (pH 7). The columns were washed with 2 
ml acetate buffer (pH 7) followed by a series of washes (2 ml each) including 100% ethanol, pH 
4-acetate buffer, pH 3-acetate buffer, 1% acetic acid, and 35% acetic acid. Thyroid hormones 


13 of 24 



Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
Thyroid Function Phase V 


were eluted from the column by passing nine fractions (0.5 ml) of 75% acetic acid through the 
column. The first three fractions were discarded as they contained negligible amounts of [ I] 
thyroxin. The remaining six fractions were pooled, evaporated, reconstituted in RIA buffer (300 
pL), and the recovery of radiotracer was determined in an aliquot using a Cobra 5005 gamma 
counter (Packard, Downers Grove, IL, USA). Under these conditions, the recoveries of 
radiotracer ranged from 32-63 percent (average 44 percent). 

The thyroxin content of reconstituted extract was determined by RIA following the procedure of 
Mackenzie et al. (1978). Briefly, duplicated 50-pL aliquots of each reconstituted extract were 
incubated in the presence of thyroxin rabbit antiserum (ICN Biomedicals, Inc., Costa Mesa, CA, 
USA) at a dilution of 1:1200, and [ 125 I] thyroxin (7000 CPM) for 90 min at 37 °C followed by a 
16-h incubation at room temperature. The reaction was terminated by addition of goat anti¬ 
rabbit gamma globulin in ice-cold 5% polyethylene glycol followed by centrifugation at 4 °C. 
The radioactivity content of the pellet was determined with the gamma counter. Authentic 
thyroxin standards were run in parallel to the samples and in duplicate for each concentration. 
The hormone content of the samples was determined using a four parameter logistic 
transformation of [ 125 I] thyroxin displacement by the authentic standards. The values obtained 
for the two replicates per sample were averaged, and this average was corrected according to the 
estimated recovery for each sample. This RIA procedure was validated for zebrafish by 
performing parallel displacement curve analysis of serially diluted extracts and by determining 
the recovery of exogenously added authentic thyroxin into the extracts. 

14.8 Data analysis 

All analyses were conducted using Statistica® software package (StatSoft, Tulsa, OK, USA) at 
the level of significance a = 0.05. The unit of replication for all treatments was the aquarium 
(fish tank). Thus, fish values within a tank were averaged to obtain tank values, and the sample 
size per treatment per sampling time thus was 3. However, because body size in zebrafish differs 
between sexes, the effects of AP on weight, fork length and condition factor were analyzed 
separately for males and females. Namely, a male and a female tank value were determined for 
each aquarium prior to the analysis. A preliminary analysis of hypertrophy, angiogenesis, and 
colloid depletion conducted on ta nk values calculated for each sex (3-way ANOVA; factors: sex, 
perchlorate concentration, and sampling time) indicated no significant differences between sexes. 
Thus, in the definitive analyses, all male and female fish values were pooled within a tank to 
obtain tank values for hypertrophy, angiogenesis and colloid depletion. 

A tiered approach was followed for the data analysis. The first step was to conduct a 2-way 
ANOVA using perchlorate concentration (treatment) and sampling time as factors. If significant 
treatment or interaction effects were determined by this analysis, the second step was to perform 
a 1-way ANOVA for treatment means at each sampling time. Differences between means at 
each sampling time were determined using Duncan’s multiple range tests. 

15. Results 

Fish tank #7 (100 ppb replicate) was lost during week 6 of exposure due to heater malfunction. 


14 of 24 



Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
Thyroid Function Phase V 


Thus, no data from this replicate was collected for weeks 8 and 12 of exposure or during the 
post-exposure period. 

15.1 Perchlorate concentration in water 

The measured concentrations of perchlorate in tank water were close to the nominal 
concentrations during the exposure period. The mean perchlorate concentrations (± standard 
eiror, n — 7 samples collected from each tank replicate) in the experimental tanks over the 
exposure period were 0 ± 0, 11 ± 0, 90 ± 3,1131 ± 23 and 11480 ± 335 ppb respectively for the 
0, 10,100, 1000 and 10000 ppb nominal concentrations. During the recovery period perchlorate 
was detectable only once, in the first water sample taken (one week after transfer to clean tanks) 
from one of the tank replicates of the 100 ppb-treatment group - the concentration in this tank 
was 24 ppb. There were no traces of perchlorate detected at any other time or in any other tank 
during the recovery period. Although perchlorate levels during recovery were undetectable, for 
treatment identification purposes the results obtained during this period are associated with the 
original perchlorate concentrations in the appropriate results and discussion sections. 

15.2 Animal growth and general behavior and appearance 

The AP-treated zebrafish did not show any behavioral or physical signs of stress, and no 
treatment-related deaths occurred during the exposure or recovery period. The 3-month-old 
experimental fish were immature (juvenile stage) at the onset of the exposures, but had matured 
and showed signs of spawning behavior by the completion of the experiment 24 weeks later. 
Body weight, fork length and condition factor of male and female zebrafish were not affected by 
perchlorate exposure (P > 0.05), but there was an increase in the values of all three parameters 
during the experimental period (2-way ANOVA on each sex separately; P < 0.05). The overall 
weight, fork length and condition factor (mean of all perchlorate treatment groups ± SE) taken at 
2 weeks of exposure were 0.21 ± 0.01 g, 26.8 ± 0.3 mm, and 1.06 ± 0.02 for males, and 0.26 ± 
0.01 g, 27.5 ± 0.5 mm, and 1.23 ± 0.04 for females. The same measurements taken at 12 weeks 
of exposure were 0.51 ± 0.01 g, 38.4 ± 0.2 mm and 1.23 ± 0.01 for males and 0.55 ± 0.02 g, 33.0 
± 0.3 mm, and 1.40 ± 0.03 for females. Finally, at the end of the recovery period the 
measurements were 0.70 ± 0.01 g, 38.4 ± 0.2 mm, and 1.23 ±0.01 for males and 0.84 ± 0.02, 

38.2 ± 0.3 mm, and 1.51 ± 0.02 for females. 

15.3 Thyroid histopathology 

Thyroid follicles normally are lined with a single layer of squamous or cuboidal epithelial cells 
and filled with colloid in their lumen (Fig.l A). Treatment with AP, especially at the higher 
concentrations and longer exposure times, induced the enlargement of the follicular layer 
(hypertrophy; Fig. 1B,C), an increase in the number of blood vessels within the follicular layer 
(Fig. 1B,C), and various degrees of depletion of colloid in individual follicles (Fig. 1C). 

Quantitative analysis indicated that exposure to AP caused dose- (P < 0.05) and time-related (P < 
0.05) responses in thyroid follicle hypertrophy, angiogenesis and colloid depletion (2-way 
ANOVA separately for each variable). At two weeks of exposure, the only variable for which 


15 of 24 




Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
Thyroid Function Phase V 


significant treatment effects were noted was angiogenesis, and the lowest observed effective 
level (LOEL) of measured perchlorate was 90 ppb (1-way ANOVA, P < 0.05; Fig. 2). At 4 
weeks of exposure, hypertrophy became evident, and the LOEL for angiogenesis and 
hypertrophy were 1131 (1-way ANOVA, P < 0.05) and 11480 ppb (1-way ANOVA, P < 0.05), 
respectively (Fig. 2). At 8 weeks of exposure, the LOEL for hypertrophy remained at 11480 ppb 
(1-way ANOVA, P < 0.05) and for angiogenesis was 90 ppb (1-way ANOVA, P < 0.05) Fig. 2). 
At 12 weeks of exposure, the LOEL for hypertrophy had decreased to 1131 ppb (1-way 
ANOVA, P < 0.05) and for angiogenesis remained at 90 ppb (1-way ANOVA, P < 0.05) (Fig. 2). 
At 4 weeks of recovery, the LOEL for hypertrophy remained at 1131 ppb (1-way ANOVA, P < 
0.05) and that for angiogenesis increased to 1131 ppb (1-way ANOVA, P < 0.05) (Fig. 3). At 12 
weeks of recovery, hypertrophy was no longer detectable (1-way ANOVA, P > 0.05) but 
angiogenesis was still recognizable with a LOEL of 11480 ppb (1-way ANOVA, P < 0.05) (Fig. 
3). It should also be noted that the absolute magnitudes of hypertrophy and angiogenesis in 
response to AP exposure tended to increase with time of exposure (Fig. 2) and to decrease with 
length of recovery (Fig. 3). 

Signs of colloid depletion (mean score ± SE) were first noticeable after 8 weeks of exposure to 
perchlorate at 1131 ppb (0.04 ± 0.04) and 11480 ppb (0.24±0.05), but only the latter was 
significantly different from the untreated control (1-way ANOVA and Duncan’s multiple range 
test, P < 0.05). By 12 weeks of exposure, signs of colloid depletion were seen in the fish 
exposed to perchlorate at 1131 ppb (0.17 ± 0.13) and 11480 ppb (1.12 ± 0..20), and in both cases 
they were significantly different from the untreated control (1-way ANOVA and Duncan’s 
multiple range test, P < 0.05). During the recovery phase, thyroid follicles regained their lost 
colloid relatively quickly. Although signs of colloid depletion were noticed at 4 weeks of 
recovery in fish exposed to 1131 ppb perchlorate (0.12 ± 0.10), this effect was not statistically 
significant (1-way ANOVA, P > 0.05). No signs of colloid depletion were observed after 12 
weeks of recovery in any of the treatment groups. 

IS.4 Whole-body thyroxin content 

No significant effects of AP exposure on whole-body thyroxin concentrations (ng/g body weight) 
were observed at any of the sampling times (2-way ANOVA; factors: treatment and sampling 
time; P > 0.05). The mean (± SE) concentration of thyroxine in fish tanks grouped by sampling 
time was 1.37 ± 0.10, 1.37 ± 0.09, and 1.73 ± 0.15 ng/g at 6 and 12 weeks exposure and after 12 
weeks of recovery, respectively. 

16. Discussion 

This study evaluated six different biological endpoints in zebrafish as possible markers of 
perchlorate exposure: thyroid follicle angiogenesis, thyroid follicle hypertrophy, thyroid follicle 
colloid depletion, whole-body thyroxin concentration, body growth (weight and length), and 
condition factor. The results obtained indicated that histological indices of thyroid activity are, 
as a group, the most sensitive markers of AP-derived perchlorate exposure. In fact, zebrafish 
growth and condition factor as well as whole-body thyroxin concentration were not affected by 
perchlorate exposure in the present study. 


16 of 24 



Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
Thyroid Function Phase V 


The occurrence of angiogenesis, hypertrophy, hyperplasia, and colloid depletion in thyroid 
follicles of zebrafish exposed to AP has been previously reported (Patino et al., 2003). However, 
the present study is the first to methodically examine the usefulness of these histological changes 
as markers of perchlorate exposure in zebrafish, and the first to examine angiogenesis as marker 
of perchlorate exposure in any species. Angiogenesis was by far the most sensitive of the 
histological markers examined on either temporal or perchlorate-concentration scales. Namely, 
angiogenesis appeared well before hypertrophy and colloid depletion, and was able to sense 
water concentrations of perchlorate at least one order of magnitude lower than those detected by 
the other parameters. Curiously, the LOEL of perchlorate for angiogenesis did not change with 
exposure time, essentially remaining at 90 ppb from 2 to 12 weeks of exposure. The absolute 
number of blood vessels per unit length of follicular perimeter, however, generally increased 
with time of exposure to the effective concentrations of perchlorate (90-11480 ppb). On a 
temporal scale, hypertrophy was next in order of sensitivity, becoming evident for the first time 
at 4 weeks but only at the highest concentration of perchlorate used (11480 ppb). Colloid 
depletion was not detected until after 8 weeks of exposure, also at 11480 ppb. The LOEL for 
hypertrophy and colloid depletion declined simultaneously from 11480 ppb to 1131 ppb at 12 
weeks of exposure. Although these histological alterations were reversible after the removal of 
AP from tank water, significantly higher levels of thyroid follicle vascularization were still 
observed after 12 weeks of recovery from exposure to the highest concentration of perchlorate 
(11480 ppb). Thus, angiogenesis is also the most persistent of the markers examined in this 
study. Unlike the findings of Patino et al. (2003), hyperplasia was not observed in the present 
study. This difference may be due to the higher concentrations of perchlorate (18000 ppb) used 
by Patino et al. (2003), or to differences in sensitivity to perchlorate between the fish populations 
used by the two studies. Like the findings of Patino et al. (2003), no sex-linked effects of AP 
were noted on the thyroid histology of fish in the present study. 

The effects of perchlorate on thyroid function also have been examined in amphibians and other 
vertebrates. In Xenopus laevis, environmental concentrations of AP-derived perchlorate as low as 
59 ppb caused hypertrophy of thyroid follicles after 10 weeks of exposure (Goleman et al., 
2002a). This finding with amphibians contrasts with the results of the present study with 
zebrafish, where the lowest concentration of perchlorate that induced thyroid follicle hypertrophy 
after 12 weeks of exposure was 1131 ppb. In rats, oral administration of AP at 10 mg/kg/day 
caused significant increases in thyroid gland weight, follicular cell hypertrophy, micro-follicle 
formation, and colloid depletion within 14 to 90 days of exposure (Siglin et al., 2000). Like in 
zebrafish (present study), histological changes of the thyroid were reversible inX. laevis 
(Goleman et al., 2002a) and rats (Siglin et al., 2000) after a 28-30-day period of recovery in the 
absence of perchlorate. 

Increased vascularization (angiogenesis) of the thyroid gland has been reported in rats orally 
treated with 1 percent potassium perchlorate after 2 months of treatment (Fernandez Rodriguez 
et al. 1991). Comparing the phenomenon of angiogenesis between zebrafish and rats is 
complicated because of differences in their thyroid structure. Thyroid follicles of zebrafish and 
other teleost fishes are not encapsulated in a discrete gland like they are in most other vertebrate 
taxa, but are found dispersed among the branchial arterioles of the lower throat region. The 


17 of 24 





Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
Thyroid Function Phase V 


increased vascularization observed in the present study seemed to occur inside the follicles 
within the follicular epithelium, but Patino et al. (2003) also reported a general increase in the 
vascularization of the extrafollicular space around the thyroid follicles of zebrafish exposed to 
AP. In the rat thyroid gland, perchlorate-induced vascularization seems to occur in the 
extrafollicular compartment (Fernandez Rodriguez et al., 1991). Regardless of the 
microanatomical location of the angiogenic response to perchlorate, the increased vascularization 
can be regarded as a physiologically adaptive mechanism to compensate for disruptions in 
thyroid hormone production. Namely, an increase in the number of blood vessels in or around 
thyroid follicles may increase the supply of nutrients (including iodide) to the follicles, and also 
enhance the removal and distribution of thyroid hormones stored in their lumen in order to 
maintain thyroid hormone homeostasis. 

Potassium perchlorate at a nominal concentration of 0.05 percent (approx. 50 ppm perchlorate) 
inhibited the uptake of radioactive iodide in the throat region of zebrafish larvae by 90 percent 
(Brown, 1997). Since iodide is necessary for thyroid hormone synthesis, curtailing its 
availability to the thyroid follicles in hi bits the production of thyroid hormones and presumably 
also their secretion. Direct measurements of circulating or whole-body thyroid hormone 
concentrations, however, have yielded inconsistent results. For example, exposure to a nominal 
concentration of 0.01 percent potassium perchlorate (approx. 10 ppm) caused a reduction in 
serum thyroxin and triiodothyronine levels in sea lamprey (Petromyzon marinus) larvae after 
several weeks of treatment (Manzon and Youson, 1997). Also, AP-derived perchlorate at 14140 
ppb, although not 59 ppb, caused a slight reduction in whole-body thyroxin concentrations of X. 
laevis tadpoles after 70 days of exposure (Goleman et al., 2002a). Decreased production of 
thyroxin, but not triiodothyronine or TSH, was observed in rabbits after about 3 weeks of oral 
administration of AP at > 30 mg/kg/day (York et al., 2001a). Conversely, total thyroxin 
concentrations were significantly increased in deer mice after prolonged oral administration of 1 
nM and 1 pM AP, whereas triiodothyronine concentrations were not affected (Thuett et al., 

2002). Also, the results of the present study showed that whole-body thyroxin concentrations 
were not affected by exposure to perchlorate in zebrafish at concentrations as high as 11480 ppb. 
This variability in the effects of perchlorate on thyroid hormone levels among species may be 
explained by differences in the concentrations of perchlorate used in the various studies. Also, 
thyroid follicles can store significant amounts of hormone with the colloid, and species-specific 
differences may exist in the patterns and rates of depletion of these stores. The results of the 
present study showed that only about one-third of the colloid had been depleted in zebrafish 
exposed to perchlorate at 11480 ppb, even after 12 weeks of treatment. Overall, thyroid 
hormone concentrations, in the circulation or whole-body extracts, seem to be relatively 
insensitive and unreliable markers of perchlorate exposure. 

Exposure to AP had no effect on the growth and condition factor of zebrafish. The fish were 
immature at the onset of the exposures but by the end of the experiment, 24 weeks later, they had 
grown in size and matured (as judged by displays of spawning behavior) irrespective of 
treatment. The time-dependent increase in condition factor of both males and females is likely 
due to the development of their gonads. Indeed, cursory inspection of gonadal sections prepared 
to determine the sex of the fish indicated that they reached reproductive maturity during the 
course of the study. It appears, therefore, that the general health and pubertal development of 


18 of 24 




Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
Thyroid Function Phase V 


zebrafish were not affected by AP exposure. The same conclusion was made by Patino et al. 
(2003), who exposed adult (mature) zebrafish to AP-derived perchlorate at 18000 ppb for 8 
weeks and found that general behavior and reproductive performance were unaffected despite 
drastic changes in thyroid histology. Similar results were obtained in a study with pregnant 
rabbits given AP orally, where fetal growth was unaffected at dosages as high as 100 mg/kg/day 
(York et al., 2001a). In X laevis, however, AP in the ppb range inhibited the growth and 
metamorphosis of young larvae (Goleman et al., 2002b). Although perchlorate at very high 
concentrations (> ppm range) can affect the development of zebrafish embryos and larvae 
(Brown, 1997; Elsalini et al., 2003), the effects of environmentally relevant concentrations of 
perchlorate on larval fishes are unknown. More information is needed to determine if the growth 
and development of amphibians (larval or adults) are more susceptible to perchlorate exposure 
than those of fishes. 

In conclusion, this study showed that angiogenesis is a much more sensitive marker of 
perchlorate exposure than hypertrophy, colloid depletion, whole-body thyroxin levels, body 
growth (weight and fork length), and condition factor. Namely, angiogenesis not only responded 
faster and at lower concentrations of perchlorate, but also persisted for longer periods of time 
after removal of perchlorate from the rearing water. Further, the LOEL for angiogenesis is 
within the environmentally relevant range of perchlorate concentrations. 

17. Study Records and Archive 

Study Records will be maintained at The Institute of Environmental and Human Health (TIEHH) 
Archive for a minimum of one year after study completion date. 

18. References 

Anderson TA, Wu TH. 2002. Extraction, cleanup, and analysis of the perchlorate anion in tissue 
samples. Bull Environ Contam Toxicol. 68:684-691. 

Brown DD. 1997. The role of thyroid hormone in zebrafish and axolotl development. Proc Natl 
AcadSci USA. 94:13011-13016. 

Capen CC. 2001. Toxic response of endocrine system. In Casarett and Doull’s Toxicology: The 
basic Science of poisons. Chapter 21,711-759. 

Denver RJ 1993. Acceleration of anuran amphibian metamorphosis by corticotropin-releasing 
hormone-like peptides. Gen Comp Endocrinol 91:38-51. 

Elsalini OA, von Gartzen J, Cramer M, Rohr KB. 2003.Zebrafish hhex, nk2.1a, and pax2.1 

regulate thyroid growth and differentiation downstream of Nodal-dependent transcription 
factors. Dev Biol 263:67-80. 

Fernandez Rodriguez A, Galera Davidson, H, Salguero Villadiego, M, Moreno Fernandez, A, 
Martin Lacave, I, Fernandez Sanz, J. 1991. Induction of thyroid proliferative changes in 
rats treated with antithyroid compound. Anat Histol Embryol 20:289-298. 

Goleman WL, Carr JA, Anderson TA. 2002a. Environmentally relevant concentrations of 

ammonium perchlorate inhibit thyroid function and alter sex ratios in developing Xenopus 
laevis. Environ Toxicol Chem. 21: 90-597. 

Goleman WL, Urquidi LJ, Anderson TA, Smith EE, Kendall RJ, Carr JA. 2002b. 

Environmentally relevant concentrations of ammonium perchlorate inhibit development 


19 of 24 


Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
Thyroid Function Phase V 


and metamorphosis in Xenopus laevis. Environ Toxicol Chem 21:424-430. 

MacKenzie DS, Licht P, Papkoff H. 1978.Thyrotropin from amphibian (Rana catesbeiana) 
pituitaries and evidence for heterothyrotropic activity of bullfrog luteinizing hormone in 
reptiles. Gen Comp Endocrinol 36:566-574. 

Manzon RG, Youson JH. 1997. The effects of exogenous thyroxin (T4) or triiodothyronine (T3), 
in the presence and absence of potassium perchlorate, on the incidence of metamorphosis 
and on serum T4 and T3 concentrations in larval sea lampreys (Petromyzon marinus L.). 
Gen Comp. Endocrinol 106:211-220. 

Morreale de Escobar G, Pastor R, Obregon MJ, Escobar del Rey F. 1985. Effects of maternal 

hypothyroidism on the weight and thyroid hormone content of rat embryonic tissues, before 
and after onset of fetal thyroid function. Endocrinology 117:1890-1900. 

Patino R, Wainscott MR, Cruz-Li El, Balakrishnan S, McMurry C, Blazer VS, Anderson TA. 
2003. Effects of ammonium perchlorate on the reproductive performance and thyroid 
follicle histology of zebrafish. Environ Toxicol Chem 22:1115-1121. 

Siglin JC, Mattie DR, Dodd DE, Hildebrandt PK, Baker WH. 2000. A 90-day drinking water 
toxicity study in rats of the environmental contaminant ammonium perchlorate. Toxicol Sci 
57:61-74. 

Soldin OP, Braverman LE, Lamm SH. 2001. Perchlorate clinical pharmacology and human 
heath: a review. Therap Drug Monitoring 23:316-331. 

Thuett KA, Roots EH, Mitchell LP, Gentles BA, Anderson T, Kendall RJ, Smith EE. 2002. 
Effects of in utero and lactational ammonium perchlorate exposure on thyroid gland 
histology and thyroid and sex hormones in developing deer mice ( Peromyscus 
maniculatus ) through postnatal day 21. J Toxicol Environ Health A 65:2119-2130. 

Wolff J. 1998. Perchlorate and the thyroid gland. Pharmacol Rev 50:89-105. 

York RG, Brown WR, Girard MF, Dollarhide JS. 2001a. Oral (drinking water) developmental 
toxicity study of ammonium perchlorate in New Zealand White rabbits. Int J Toxicol 
20:199-205. 

York RG, Brown WR, Girard MF, Dollarhide JS. 2001b. Two-generation reproduction study of 
ammonium perchlorate in drinking water in rats evaluates thyroid toxicity. Int J Toxicol 
20:183-197. 


20 of 24 


Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
Thyroid Function Phase V 


19. Figures 



Figure 1. Photomicrographs of thyroid follicles of zebrafish reared in control water (A) or in 
water containing AP-derived perchlorate at measured concentrations of 11480 ppb for 12 weeks 
(B-C). Note the squamous epithelial cell layer in control fish (A, arrows), and the cuboidal-to- 
columnar shape of the cells in fish exposed to perchlorate (B-C, arrows). The follicles of 
perchlorate-exposed fish also contained higher numbers of blood vessels within the epithelial 
layer (B-C, arrowheads), and some follicles in these fish also showed signs of colloid depletion 
(C, asterisk). Hematoxylin-eosin stain. All photographs were taken at the same original 
magnification (x 100). 


21 of 24 
























Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
Thyroid Function Phase V 


Epithelial cell hUl|Pe(rt)ie(atlj()- 2 wk 


6 

5 



0 11 90 1131 11480 

Measured perchlorate (ppb) 


Epithelial cell he! H a XPfrn r M)' " 4 wk 



Measured perchlorate (ppb) 



*0 11 90 1131 11480 

Measured perchlorate (ppb) 



0 11 90 1131 11450 

Measured perchlorate (ppb) 


Number or blood vessels per 100 

Angiogenesis * 2 wk 



Measured perchlorate (ppb) 


Numbe r of blood vessels per 1.00 . 

Angiogenesis - 4 wk 



Measured perchlorate (ppb) 


Number of blood vessels per 100 _ , 

Angiogenesis - 8 wk 



Measured perchlorate (ppb) 


Number of 12 wk 



Measured perchlorate (ppb) 


Figure 2. Changes in hypertrophy and angiogenesis of zebrafish thyroid follicles during 
exposure to AP-derived perchlorate at measured concentrations 0 to 11480 ppb from 2 to 12 
weeks (wk). Bars associated with an asterisk are significantly different from the control (0 ppb) 
bar (Duncan’s multiple range test, P < 0.05). 


22 of 24 






Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
Thyroid Function Phase V 


Hypertrophy -12 wk 
Epithelial cell height (microns) 



0 11 90 1131 11480 

Measured perchlorate (ppb) 


Hypertrophy - 4 wk recovery 
Epithelial cel! height (microns) 



Measured perchlorate (ppb) 


Hypertrophy -12 wk recovery 
Epithelial cell height (microns) 

9 

8 

7- 

6 

5- 



0 11 90 1131 11480 

Measured perchlorate (ppb) 


Number of bloo^Wfe' 12 Wk 


* 



Measured perchlorate (ppb) 


Nu m bcrcl'SB?tP^Sfi5%-rfoV k recovery 



0 11 90 1131 11480 


Measured perchlorate (ppb) 


. , A!79‘99 ene ?‘ s ' recovery 

Number of blood vessels per 1Q0 



Measured perchlorate (ppb) 


Figure 3. Changes in hypertrophy and angiogenesis of zebrafish thyroid follicles during recovery 
from exposure to AP-derived perchlorate at measured concentrations 0 to 11480 ppb for 12 
weeks (wk; upper graphs). Measurements were taken after 4 (middle graphs) and 12 (lower 
graphs) weeks following removal of AP from the water. Bars associated with an asterisk are 
significantly different from the control (0 ppb) bar (Duncan’s multiple range test, P < 0.05). 


23 of 24 






Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
Thyroid Function Phase V 


20. Appendices 

Study Protocol 

Changes to Study Documentation Forms 


24 of 24 




Project No. T9700 


A STUDY PROTOCOL 
ENTITLED 

EFFECT OF AMMONIUM PERCHLORATE ON THYROID FUNCTION OF ZEBRAFISH 


STUDY/PROTOCOL NUMBER: ZEB-02-01 

SPONSOR: United States Air Force 

IERA/RSE 

2513 Kennedy Circle 

Brooks Air Force Base, Texas 78235-5123 

TESTING FACILITY: 

Texas Coop Fish and Wildlife Research Unit - AP 
Texas Tech University 

Box 42120,218 Agricultural Science Building 
Lubbock, Texas 79409-2120 

Dr. Reynaldo Patino 

Mr. Sandeep Mukhi 


06-15-2002 


TEST FACILITY MANAGEMENT: 

STUDY DIRECTOR: 

PROPOSED EXPERIMENTAL 
START DATE: 


Page 1 of 8 






Project No. T9700 


1. DESCRIPTIVE STUDY TITLE 

Effect of ammonium perchlorate on thyroid function of zebrafish 

2. STUDY/PROTOCOL NUMBER ZEB-02-01 

3. SPONSOR 

United States Air Force 

IERA/RSE 

2513 Kennedy Circle 

Brooks Air Force Base, Texas 78235-5123 

4. TESTING FACILITY NAME & ADDRESS 

Texas Coop Fish and Wildlife Research Unit - AP 
Texas Tech University 

Box 42120, 218 Agricultural Science Building 
Lubbock, Texas 79409-2120 

5. PROPOSED EXPERIMENTAL START & TERMINATION DATES 

Start Date: 06-15-2002 
Termination Date: 12-31-2003 


6. KEY PERSONNEL 

Reynaldo Patino, Testing Facility Management 
Sandeep Mukhi, Study Director 
Todd Anderson, Analytical Chemist 
Ryan Bounds, Quality Assurance Manager 
Ronald Kendall, Principal Investigator 



'3~g-OZ Dr. Reynaldo Patino 

Testing Facility Management 

C7-C202 Mr. Sandeep Mukhi 
Study Director 

7- “2-2 Ry an Bounds 

Quality Assurance Manager 


'~7~«2«?'Q? Dr. Todd Anderson 
, Analytical Chemist 

lM/6U dt . Ronald Kendall 
/ Principal Investigator 


Page 2 of 8 




Project No. T9700 


8. REGULATORY COMPLIANCE STATEMENT 
Quality Control and Quality Assurance 

This study will be conducted in accordance with established Quality Assurance program guidelines and in 
compliance, where appropriate and possible, with Good Laboratory Practice Standards (40 CFR Part 160, 
August 17, 1989). 

Document Control Statement 

This document is considered proprietary to Texas Tech University and the Sponsor. Do not copy, quote 
or distribute. For access to this document or authority to release or distribute, please write to: 

Dr. Reynaldo Patifio 

Texas Coop Fish and Wildlife Research Unit 
Texas Tech University 

Box 42120,218 Agricultural Science Building 
Lubbock, Texas 79409-2120 

9. STUDY OBJECTIVES / PURPOSE 

1. To determine dose-response and time-course of ammonium perchlorate effects on thyroid follicle cell 
hypertrophy and thyroid angiogenesis (histopathology) 

2. To determine time-course of thyroid histopathological recovery following termination of ammonium 
perchlorate exposure. 

10. TEST MATERIALS 

Test Chemical name: Ammonium Perchlorate 
CAS number: 7790-98-9 

Characterization: white powder, specific gravity of 1.950. 

Purity: Certificate of analysis will be obtained from the company. This chemical will be 99.999% pure as 
indicated by supplier. 

Stability: incompatible with strong reducing agents, strong acids, heat-sensitive. The ammonia is a hazardous 
combustion or decomposition product. 

Source: Aldrich Chemical Company 

Reference Chemical name: Calcium Chloride 
CAS number 10035-04-8 

Characterization: coarse white powder or mixture with medium size granules. 

Purity: certificate of analysis or analytical testing will indicate purity. 

Stability: stable 
Source: Sigma 

Reference Chemical name: Magnesium Sulfate 
CAS number: 100-34-99-8 
Characterization: colorless crystals 

Purity: certificate of analysis or analytical testing will indicate purity. 

Stability: stable 
Source: Sigma 

Reference Chemical name: Potassium Chloride 
CAS number: 7447-40-7 
Characterization: white crystalline granules 

Purity: certificate of analysis or analytical testing will indicate purity. 

Stability: stable 
Source: Sigma 


Page 3 of 8 



Project No. T9700 


Reference Chemical name: Sea Salts 
CAS number: Not applicable 

Characterization: an artificial salt mixture closely resembling the composition of the dissolved salts of ocean 
water. 

Purity: certificate of analysis or analytical testing will indicate purity. 

Stability: stable 

Source: Aquarium Systems, Inc. 

Reference Chemical name: Sodium Bicarbonate 
CAS number: 144-55-8 
Characterization: white crystalline powder 

Purity: certificate of analysis or analytical testing will indicate purity. 

Stability: stable 
Source: Sigma 

Reference Chemical name: Sodium Chloride 
CAS number: 7647-14-5 
Characterization: white crystalline granules 

Purity: certificate of analysis or analytical testing will indicate purity. 

Stability: stable 
Source: Sigma 

Reference Chemical name: Ultrapure water with added salts needed by fish will be used as reference solution to 
which negative reference material or test material will be added for treatments. 

CAS Number: Not applicable 

Characterization: water quality will be tested by chemical analysis and pH will be monitored regularly. 

Purity: ultrapure 
Stability: stable 

Source: City tap water or steam plant deionized water that has been run through a carbon filter and a de-ionizer to 
convert it to ultrapure water. Sea Salts (60-240 mg/L) will be added to this water, or a modified FETAX will be 
made. 

11. JUSTIFICATION OF TEST SYSTEM 

Ammonium perchlorate is known to prevent accumulation of iodine in thyroid follicles. Since iodine is necessary 
for the synthesis of thyroid hormones (T 3 & T 4 ), AP therefore lowers the production of thyroid hormones and thus 
has a goitrogenic effect via increased synthesis of thyroid stimulating hormone (Capen 2001). Such conditions 
caused thyroid hyperplasia in rat (Patel et al., 1996), increased vascularization in thyroid glands of humans 
(Fenton et al., 2000), and thyroid hypertrophy and inhibition of metamorphosis in South African frog, Xenopus 
laevis (Goleman et al., 2002a, b). Ammonium perchlorate also caused the development of hyperplastic nodules, 
and the formation of small blood vessels (angiogenesis) in thyroid tissue of zebrafish (Patino et al submitted). 

In a study of the effects of AP with zebrafish, Patino et al., (submitted) confirmed that thyroid hypertrophy is a 
reliable marker of perchlorate exposure in this species (DoD/SRDP Project phase I/II). Angiogenesis seemed to be 
as sensitive to AP exposure as hypertrophy. Hypertrophy is caused by relatively rapid changes in the activity of 
thyroid follicle cells whereas angiogenesis involves changes in tissue vascularization patterns. Therefore, 
angiogenesis may require longer exposure times to develop and following removal of AP from water, longer times 
to recover than hypertrophy. This property of angiogenesis could make it an ideal biomarker for field exposures to 
perchlorate or other environmental goitrogens. Since sublethal field exposures to water-soluble contaminants (such 
as AP) are likely to be episodic with variable frequencies depending on discharges, rainfall, et cetera. We therefore 
propose to evaluate angiogenesis as a potentially sensitive and reliable biomarker of field exposure to perchlorate. 
Preliminary observations from field-caught amphibians (J.Carr, pers. comm) are consistent with the general 
applicability of angiogenesis as a biomarker of perchlorate exposure in the field. However, information on the 
time-responses and dose-responses of angiogenesis to AP is currently unavailable and it is needed to validate the 
utility of angiogenesis relative to other biomarkers such as thyroid follicle cell hypertrophy. 


Page 4 of 8 



Project No. T9700 


Zebrafish has been chosen as the experimental animal because they are a widely used animal model in basic 
toxicological, developmental, and reproductive research. Also they are easily and economically maintained. 
Moreover, this fish was used in our earlier experiments that generated the data concerning the effects of AP on fish 
thyroid histopathology. 

12. TEST ANIMALS: 

Species: Danio rerio, Zebrafish 
Strain: Wild type 

Age: Juveniles (over 1-2 month old) in zebrafish water (ultrapure water with 60-180 Mg/L Sea Salt) or modified 
FETAX (SOP AF-1-01). 

Number: Approximately 700 Juveniles consisting of both male and female. 

Source: We will use fish from Aquatic Research Organisms or other appropriate sources. Fish will be received by 
overnight mail and will be allowed at least one week to acclimatize (SOP AF-1-01) before their use in 
experiments. 

13. PROCEDURE FOR IDENTIFYING THE TEST SYSTEM 

Zebrafish will be housed in single 10-gallon aquaria (filled with 28 liters of zebrafish water) containing 
approximately 50 fish per tank. Newly obtained fish will be allowed to acclimatize to their aquaria at least 1-2 
weeks before exposure (same conditions as in SOP AF-1-01). Tanks will be appropriately labeled with a minimum 
of the following: project number, initials, concentration, chemical, replicate number, and date initiated. Treatment 
solutions will be added to the appropriate tanks according to SOP AF-1-01. 

In this experiment we are proposing to do three separate analysis (tasks) but they will all be conducted 
simultaneously from the same experimental groups of fish. The various tasks to be conducted are described below. 

Task-1 (Dose-response): Fish will be exposed to 0,0.01,0.1, 1 and 10 ppm of AP according to the SOP-AF-1-01. 
Task -2 (Time-response): Samples for histological analysis will be taken at 2,4, 8 and 12 weeks of exposure 
Task -3 (Reversal effects after AP exposure termination): Samples for histological analysis will be taken at 2, 4, 8 
and 12 weeks after exposure termination. 

Fish will be fed frozen shrimp or other prepared diet twice daily. Feeding behavior and general animal health will 
be monitored daily. Water temperature, pH, salinity, dissolved oxygen will be recorded daily. One half of the 
water volume in the aquaria (14L) will be replaced twice weekly and ammonium level will be monitored once 
weekly. At each sampling time fish will be euthanized in a lethal concentration of anesthetic (lg/L MS-222) 
following the SOP AC-3-03. The samples will be fixed in Bouin’s fixative, and further histological processing will 
be followed according to SOP AQ-2-10. 

14. EXPERIMENTAL DESIGN INCLUDING BIAS CONTROL 

AP at 0, 0.01, 0.1, 1 and 10 ppm concentrations (or 5 treatments) will be placed into precleaned tanks (SOP AF-1- 
01) housing zebrafish. There will be 3 replicates per concentration of AP. At each sampling time, 5 fish will be 
sampled from each replicate. There will be a total of 8 sampling times including exposure and post exposure (see 
section 13). Therefore, total fish required = 5 dosages X 8 sampling times X 3 tank replicate X 5 fish per replicate 
= 600 fish. Each experimental tank will contain an additional number of 10 zebrafish to compensate normal 
mortalities during the experiment. 


Page 5 of 8 






Project No. T9700 


15. METHODS 

15.1 Test System acquisition, quarantine, and acclimation. 

Zebrafish will be obtained from Aquatic Research Organism or other appropriate sources. Fish will be maintained 
in zebrafish water (ultrapure water with sea salts or modified FETAX according to SOP AIM-01) and under 14- 
light/10 dark cycle, 26-30°C water temperature, pH 6.0-8.5. Fish will be maintained as indicated in the zebrafish 

AP Husbandry SOP AF-1-01. 

15.2 Test Condition Establishment 

Conditions will be set according to zebrafish AP Husbandry SOP AF-1-01 (pH 6.0-8 5, 26-30°C 14/10 light/dark 
cycle) in ultrapure water with salts. Labeling will follow as descnbed in Section 13. (For additional details on 
zebrafish husbandry see SOP AF-1-01). Fish will be placed into experimental tanks for at least 1-2 weeks prior to 
initiation of exposure. A concentrated solution of ammonium perchlorate will be added m the appropriate voiurnc 
to the tanks to obtain the target concentrations. Tanks will be cleaned and maintained as indicated in SOP AF-1-01 
for static renewal. Water removed will be replaced with the appropriate treatment water. 

15.3 Test Material Application 

Test material will be kept in stock solutions. To achieve the desired exposure concentrations (0 0.01 0.1 1 or 10 
ppm of AP), stock solutions will be mixed directly in the fish tanks with zebrafish water as indicated under SOP 
AF-1-01 Treatment solutions will be replaced every third or fourth day (twice a week) as indicated in greater 
detail in the static renewal procedures of SOP AF-1-01. The application will contmue until the experiment is 

concluded. 

Rates/concentrations: 0, 0.01, 0.1,1 and 10 ppm 

Frequency: Continuous exposure for the duration of the experiment, which will be no longer than 12 weeks 
Sampling will continue after termination of exposure for an additional 12 weeks. During post exposure the is 
will no longer be exposed to the contaminant but they will be maintained accordmg standard procedure (SOP AF- 

1 - 01 ). 

Route/Method of Application: Method of application will be immersion. Route of exposure will be via dermal, 
oral, and respiratory as the chemical will be in the beaker/aquaria water. 

Justification for Exposure Route: Exposure by rearing water is most appropriate as run off and sewage effluents 
enter water systems such as lakes and streams. Because fish respire, ingest, and are dermally exposed to the waters 
in which they live, this situation is most representative of field conditions. 

Exposure Verification: A sample of each stock solution will be tested by chemical analysis by analytical 
chemistry manager. 

15.4 Test System Observation 

Histological sections will be randomly chosen from a slide and follicle cell height will be considered as index of 
hypertrophy. Increased blood vessel formation will be ranked positive or negative accordmg to the presence or 
absence of more than five blood vessels whose respective diameter fit within a 50 x 50 pm (Patino et al., 
submitted) 

15.5 Animal Euthanization and Sample Collections 

Fish (5 per replicate) will be euthanized at each sampling time with a 1 g/L buffered MS-222 solution (SOP AC-3- 
03). Subsequently the euthanized fish will be fixed in Bouin’s fixative and histological procedure will be 

conducted according to SOPAQ-2-10. 


Page 6 of 8 


Project No. T9700 


15.6 Endpoint Analysis 

Mortality of the experimental animals will be observed and recorded daily. Histological observation of thyroid 
gland will be our end point of observation. The hypertrophic condition and excess blood vessel development 
among different experimental treatment groups will be compared with that of the control group. 

16. REPORT CONTENT/RECORDS TO BE MAINTAINED 

Records to be maintained include room temperature, water temperature, dissolved oxygen, salinity, pH, 
conductivity, and ammonia concentrations. 

Date, time, and number of feedings per tank will be recorded. Number of expired fish removed prior to 
termination of exposure will be recorded, including date, and tank number. 

Report content will include presentation of data, interpretation, and discussion of the following 

• Differences among treatments in thyroid blood vessel formation and nuclear hypertrophy 

• Discussion of the relevance of findings 

• List of all SOPs used 

• List of all personnel 

17. RECORDS TO BE MAINTAINED / LOCATION 

The final report will be delivered to the Sponsor on or before 12-31-03. Copies of all data, documentation, records 
and protocol information shall be sent to the Sponsor, or designated delivery point upon request (within six months 
of study completion). All data, the protocol and a copy of the final report shall be maintained by the testing 
facility. 

18. QUALITY ASSURANCE 

The Quality Assurance Unit will inspect the study at intervals to insure the integrity of the study. Written records 
will be maintained indicating but not limited to the following: date of inspection, study inspected, phase inspected, 
person conducting the inspection, findings and problems, recommended and taken action, and any scheduled re¬ 
inspections. Any problems likely to effect study integrity shall be brought to the immediate attention of the Study 
Director. The Quality Assurance Unit will periodically submit written status reports on the study to management 
and the Study Director. 

19. PROTOCOL CHANGES / REVISIONS 

All changes and/or revisions to the protocol, and the reasons therefore, shall be documented, signed and dated by 
the Study Director and maintained with the protocol and the Quality Assurance Unit. 

20. REFERENCES 

Capen, CC. 2001. Toxic responses of the endocrine system. In Klaassen CD, ed, Casarett and Doull’s Toxicology: 
The basic Science of Poisons. McGraw-Hil, New Yrk, NY, USA, pp.711-759 

Fenton C, Patel A, Dinauer C, Robie DK, Tuttle RM, Francis GL. (2000) The expression of vascular endothelial 
growth factor and the type 1 vascular endothelial growth factor receptor correlate with the size of papillary thyroid 
carcinoma in children and young adults. Thyroid 2000 Apr; 10(4): 349-57 

Goleman WL, Carr JA, Anderson TA.(2002a) Environmentally relevant concentrations of ammonium perchlorate 
inhibit thyroid function and alter sex ratios in developing Xenopus laevis. Environ Toxicol Chem 2002 Mar; 21(3): 
590-7 


Page 7 of 8 







Project No. T9700 


Goleraan WL, Urquidi LJ, Anderson TA, Smith EE, Kendall RJ, Carr JA. (2002b) Environmentally relevant 
concentrations of ammonium perchlorate inhibit development and metamorphosis in Xenopus laevis Environ 
Toxicol Chem 2002 Feb; 21(2): 424-30 

Patel VA Hill DJ, Eggo MC, Beck s GP, Logan A., (1996) Changes in the immunohistochemical localization of 
fibroblast growth factor -2 transforming growth factor-beta 1 and thrombo spondin -1 are associated with early 
angiogenic events in the hyperplastic rat thyroid. J. Endocrinol 148 (3) 485-99 

Patino R, Wainscott MR, Cruz-Li El, Balakrishnan S, McMurry C, Blazer VS, Anderson TA, Effects of 
ammonium perchlorate on the reproductive performance and thyroid condition of zebrafish (submitted) 


Page 8 of 8 



Dept, of Biological Sciences (DBS) 
Box 43131 

Lubbock, TX 79409-3131 
(806) 742-2715 


Form No. 014 Rev. 3.06/00 
Project No.: T9700/ZEB-02-01 

^Change No:_01_ 

Page: 1 of 1 


Change In Study 
Documentation Form 

The following documents changes in the above referenced study: 

Check One: _Amendment _Deviation _x Addendums 


Document Reference Information 

Check One: _x_Protocol _SOP _Other_ 

Title: Effect of ammonium perchlorate on thyroid function of zebrafish 

Dated:_08/16/02_ 

Document # (if appropriate):_ZEB-02-01_ 

Page #(s): 6_ 

Section #:_15.5_ 

Text to reference: __ 


Change in Document: In study protocol it was not mentioned to take fish samples before 
zebrafish were exposed to the ammonium perchlorate. On the starting date of experiment 
(07/25/02) we had collected 20 samples, out of which 10 numbers were fixed in Bouin’s 
fixative and 10 were frozen in liquid nitrogen. These 20 numbers of sample were polled 
from the stock of zebrafish. 

This is an addendum to the present study protocol. 


Justification and Impact on Study: Our end point of observation of this current study 
protocol is to find the hypertrophy and angiogenesis of experimental animals. The 
samples collected before the start of experiments will be referred as one of the control 
groups and can be compared with the experimental animals at the end of experiment. 


Submitted by: Signature: 




Authorized by: Study Director: 


Received by: Quality Assurance Unit: 



Date: OlMl 
Date: 

Date: 


*sftu 




* Sequentially numbered in order of the dale that the change is effective 


Dept, of Biological Sciences (DBS) 
Box 43131 

Lubbock, TX 79409-3131 
(806) 742-2715 


Form No. 014 Rev. 3.06/00 
Project No.: T9700/ZEB-02-01 

*Change No: _02_ 

Page: 1 of 1 


Change In Study 
Documentation Form 

The following documents changes in the above referenced study: 

Check One: _x_Amendment __Deviation _Addendums 


Document Reference Information 

Check One: _x_Protocol _SOP _Other_ 

Title: Effect of ammonium perchlorate on thyroid function of zebrafish 

Dated:_08/16/02_ 

Document# (if appropriate): ZEB-02-01_ 

Page #(s):_5_ 

Section #:_13_ 

Text to reference: One half of the water volume in the aquaria (14L) will be replaced 

twice weekly. 


Change in Document: In study protocol it was mentioned to replace one half of the 
water volume twice weekly. Now we plan to change the half of the water of the aquaria 
once a week. 


Justification and Impact on Study: Water exchange is done to maintain a good water 
quality and reduce the load of ammonia in the aquarium. We have observed that the water 
quality of the tank remains within the optimal range for zebrafish and the ammonia levels 
remains pretty below the acute level for the zebrafish. Therefore we decided to go for 
water exchange once in a week. This will also help us in reducing the volume of waste 
(ammonium perchlorate in water) generated from the experimental tanks. 


Submitted by: Signature: 


Authorized by: Study Director: 




Received by: Quality Assurance Unit 



Date: 

Date: &%/ ^ 
Date: ft* /&' £ 


* Sequentially numbered in order of the date that the change is effective 






Dept, of Biological Sciences (DBS) 
Box 43131 

Lubbock, TX 79409-3131 
(806) 742-2715 


Form No. 014 Rev. 3.06/00 
Project #.T9700/ZEB-02-01 

*Change No: 03 _ 

Page: 1 of _J 


Change In Study 
Documentation Form 

The following documents changes in the above referenced study: 


Check One: X Amendment 


.Deviation 


Addendums 


SOP 


. Other 


Document Reference Information 

Check One: X_ Protocol __ ___ 

Title: Effect of ammonium perchlorate on thyroid function of zebrafish 

Dated: 11/02/02 _ 

Document # (if appropriate): Zeb-02-01 

Page #(s):_5__ 

Section #: 13 


Text to reference:-Task3 (Reversal effects after AP exposure termination): Samples 

for histological analysis will be taken at 2,4, 8, and 12 weeks after exposure termination. 


Change in Document: Samples for histological observation will be taken at 4 and 12 
weeks after exposure termination . 


Justification and Impact on Study: Due to unavailability of enough fish for four 
s amplings afte r exposure is terminated, we propose to take fish samples at 4th and 
12thweeks post exposure period. 


Submitted by: Signature: __ 

Authorized by: Study Director: _ 

Received by: Quality Assurance Unit: 



Date: u / OX!o 
Date: ^ ~2£ - A 3 
Date: /'/V'27 J 7 


* Sequentially numbered in order of the date that the change is effective 





Dept, of Biological Sciences (DBS) 
Box 43131 

Lubbock, TX 79409-3131 
(806) 742-2715 


Form No. 014 Rev. 3.06/00 
Project #.T9700/ZEB-02-01 

*Change No: 04 _ 

Page: 1 of 1 


Change In Study 
Documentation Form 


The following documents changes in the above referenced study: 

Check One: X Amendment _Deviation _Addendums 


Document Reference Information 

Check One: X Protocol _SOP _Other- 

Title: Effect of ammonium perchlorate on thyroid function of zebrafish 

Dated: 11/02/02 __ 

Document # (if appropriate): Zeb-02-01 

Page #(s):_5_ 

Section #:___13_ 

Text to reference:_One half of the water volume in aquaria (14L) will be replaced 

twice weekly and ammonium level will be monitored once weekly. 


Change in Document: Ammonia level was monitored more than once in a week fo r 
better management of water quality. Water was still changed once a week 


Justification and Impact on Study: Ammonium level in the tank depends upon the pH 
of the water body. Daily fluctuation of pH causes a wide variation of ammonium 
concentration. Ammonia is highly harmful to the living organism (fish in our 
experiment). So we planed to monitor ammonia in the experimental tank more than once, 
(mostly twice in a week). 


Submitted by: Signature:_ 

Authorized by: Study Director: 



Received by: Quality Assurance Unit: 



Date: 1 7 tL - 1 — 
Date: 

Date: / -u-aS 


* Sequentially numbered in order of the date that the change is effective 





Final Report 

U.S. Air Force Coop. Agreement CU1235 


TIEHH Project #T9700 
Metabolic Rate Phase V 


A FINAL REPORT 


£9 MAP m 


Perchlorate-Induced Alterations in Metabolic Rate and Thermoregulation in Prairie Voles 
(Microtus ochragaster) and House Sparrows {Passer domesticus ) 


STUDY NUMBER: MRT-03-01 

SPONSOR: Strategic Environmental and Research 

Development Program 
SERDP Program Office 
901 North Stuart Street, Suite 303 
Arlington, VA 22203 


CONTRACT ADMINISTRATOR: The Institute of Environmental and Human Health 

Texas Tech University/TTU Health Sciences Center 
Box 41163 

Lubbock, TX 79409-1163 

TESTING FACILITY: The Institute of Environmental and Human Health 

Texas Tech University 
Box 41163 

Lubbock, TX 79409-1163 


TEST SITE: The Institute of Environmental and Human Health 

Texas Tech University 
Box 41163 

Lubbock, TX 79409-1163 

ANIMAL TEST SITE: Texas Tech University 

Human Sciences Building 
Box 42002 

Lubbock, TX 79409-2002 


RESEARCH INITIATION: April 2003 

RESEARCH COMPLETION: December 2004 


Page 1 of 22 





Final Report 

U.S. Air Force Coop. Agreement CU1235 


TIEHH Project #T9700 
Metabolic Rate Phase V 


Table of Contents 

List of Tables and Figures.3 

Good Laboratory Practice Statement.4 

Quality Assurance Statement.5 

I. 0 D escriptive Study Title.6 

2.0 Study Number.....6 

3.0 Sponsor. 6 

4.0 Testing Facility Name and Address.6 

5.0 Proposed Experiment Start and Term in ation Dates.6 

6.0 Key Personnel.6 

7.0 Study Objectives/Purpose.6 

8.0 Test Materials.7 

9.0 Justification of Test System.7 

10.0 Test Animals.8 

II. 0 Procedure for Identifying the Test System.8 

12.0 Experimental Design Including Bias Control.9 

13.0 Methods.9 

14.0 Results.....13 

15.0 Discussion.15 

16.0 References.18 

17.0 Figures and Tables. 20 


Page 2 of 22 


























Final Report 

U.S. Air Force Coop. Agreement CU1235 


TIEHH Project #T9700 
Metabolic Rate Phase V 


List of Figures and Tables 


Figure 1. Weekly mean resting metabolic rates (ml g' 1 h' 1 ) of prairie voles exposed to 
perchlorate in the drinking water (n=21). 

Figure 2. Peak metabolic rates (ml g' 1 h'l) of prairie voles exposed to perchlorate for 51 
days. Temperature in metabolic chamber held at 12°C for 20 minutes followed by a drop 
in temperature to 5°C for a maximum duration of 60 minutes. 

Figure 3. Weekly mean resting metabolic rates of house sparrows dosed with perchlorate 
through 21 days of dosing. Experiment terminated after 21 days of dosing due to the high 
occurrence of disease in the sparrow colony, thus compromising the results of the study. 


Table 1. Mean prairie vole plasma thyroxine (ug/dL), triiodothyronine (ng/dL), and liver 
and kidney weights (g/g b.w.) following 51 days of exposure to perchlorate in the 
drinking water (n=20). 

Table 2. Individual and mean house sparrow thyroxine concentrations (ug/dL) and liver 
and kidney masses (g) following 3 weeks of perchlorate dosing. 

Table 3. Mean concentrations (ug/g d.w.) of perchlorate in house sparrow livers and 
kidneys following 3 weeks of perchlorate dosing. 


Page 3 of22 




Final Report 

U.S. Air Force Coop. Agreement CU1235 


TIEHH Project #T9700 
Metabolic Rate Phase V 


GOOD LABORATORIES PRACTICES STATEMENT 

This study was conducted in accordance with established Quality 
Assurance Program guidelines and in the spirit of the Good Laboratory Practice 
Standards whenever possible (40 CFRPart 160, August 17, 1989). 


Submitted By: 







TIEHH Project #T9700 
Metabolic Rate Phase V 

QUALITY ASSURANCE STATEMENT 


Final Report 

U.S. Air Force Coop. Agreement CU1235 


This study was conducted under The Institute of Environmental and Human 
Health Quality Assurance Program and whenever possible to meet the spirit of the Good 
Laboratory Practices as outlined in 40 CFR Part 160, August 17, 1989. 




Page 5 of 22 




Final Report TIEHH Project #T9700 

U.S. Air Force Coop. Agreement CU1235 Metabolic Rate Phase V 

1.0 DESCRIPTIVE STUDY TITLE: Perchlorate-Induced Alterations in Metabolic 
Rate and Thermoregulation in Prairie Voles (Microtus ochragaster) and House 
Sparrows (Passer domesticus) 


2.0 STUDY NUMBER: MRT-03-01 


3.0 SPONSOR: 

Strategic Environmental and Research 
Development Program 
SERDP Program Office 
901 North Stuart Street, Suite 303 
Arlington, VA 22203 


4.0 TESTING FACILITY: The Institute of Environmental and Human Health 

Texas Tech University 
Box 41163 

Lubbock, TX 79409-1163 


TEST SITE: The Institute of Environmental and Human Health 

Texas Tech University 
Box 41163 

Lubbock, TX 79409-1163 

ANIMAL TEST SITE: Texas Tech University 

Human Sciences Building 
Box 42002 

Lubbock, TX 79409-2002 


5.0 PROPOSED EXPERIMENTAL START & TERMINATION DATES: 

Start Date: April 1, 2003 
Termination Date: December 31, 2003 


6.0 KEY PERSONNEL. 

Dr. Philip N. Smith, Study Director / Study Advisor 

Mr. John Isanhart, co-investigator 

Tina Kaviani, lab assistant 

Lisa Perlmutter, research technician 

Mr. Ryan M. Bounds, Quality Assurance Manager 

Dr. Ronald J. Kendall, Testing Facility Management 

7.0 STUDY OBJECTIVES / PURPOSE: 

- To evaluate the effects of perchlorate on metabolic rate and thyroid function 
in prairie voles and house sparrows through analysis of thyroid hormones, 
tissue perchlorate concentrations, and comparison of volume of oxygen 


Page 6 of 22 





Final Report 

U.S. Air Force Coop. Agreement CU1235 


TIEHH Project #T9700 
Metabolic Rate Phase V 


consumed (V02) between treatment and control groups. Previous studies 
have shown elevated metabolic rates in thyroid hormone-administered birds 
and rodents (Banta and Homlcombe, 2002; Burger and Denver, 2002); 
depressed metabolic rates and circulating thyroid hormone concentrations 
coincide with hypothyroidism, which are often effects of perchlorate exposure 

To evaluate thermoregulatory costs associated with perchlorate exposure in 
prairie voles and house sparrows by measuring metabolic rate during cold 
stress experiments. Thyroid hormones are the key controllers of metabolism 
that are necessary for maintenance of constant body temperature in 
homeothermic animals; disruptions of shivering or non-shivering 
thermogenesis in birds or rodents, respectively, may place them at a 
disadvantage when faced with highly variable temperature extremes. 

8.0 TEST MATERIALS: 

Test Chemical name: ammonium perchlorate 
CAS number: 7790-98-9 
Characterization: 99.999% pure 
Source: Sigma Aldrich 

9.0 JUSTIFICATION OF TEST SYSTEM: 

The prairie vole is a ground-burrowing rodent found in the north and central 
plains of the United States and in southern Canada (U.S.EPA, 1993). Voles are 
largely herbivorous, consuming primarily green succulent vegetation, but also 
roots, bark, and seeds as well. These small, non-hibernating mammals living in 
the north temperate and boreal regions are faced with seasonal changes in their 
thermal environment. They must be able to adapt to both hot and cold extremes, 
otherwise, they may be at a disadvantage when stressed with a contrasting season 
or extreme daily temperature fluctuation. Animals need enough insulative and/or 
thermogenic capability to withstand low temperature exposure without becoming 
hypothermic, and they must cope with cold stress by behavioral avoidance and/or 
increased thermogenic capacity (Wunder et al., 1977). Small mammals have a 
limited ability to increase their insulation, therefore behavioral avoidance and 
thermogenesis become the most important means for maintaining a relatively 
narrow range of body temperature (Haim and Izhaki, 1993). 

Perchlorate is known to inhibit the uptake of iodide by the thyroid. This 
limitation of iodide availability may result in decreased production of thyroid 
hormones. Deficiencies in thyroid hormones have been associated with slow heart 
rate and increased sensitivity to cold (Danforth and Burger, 1984). Therefore, 
perchlorate-induced alterations in thyroid hormones may have secondary effects 
on metabolic rate and thermoregulation. 

The house sparrow is a common passerine species that is often used as an avian 
behavioral and toxicological model. Birds, especially passerine species, are often 


Page 7 of 22 





Final Report 

U.S. Air Force Coop. Agreement CU1235 


TIEHH Project #T9700 
Metabolic Rate Phase V 


used as sentinel species when assessing the impacts of chemicals on ecosystems 
and populations. The insulative needs of birds are often met by a combination of 
plumage characteristics, behavioral avoidance of cold exposure, and shivering 
thermogenesis (Marsh and Dawson, 1989). Subcutaneous fat tends to be more 
localized in birds than in mammals, therefore birds cannot rely on fat storage for 
insulation. Incubation in females, as well as males, can also potentially expose 
the incubating parent to extremely demanding thermal conditions (Marsh and 
Dawson, 1989). Altered thyroid hormone concentrations influence the overall 
metabolic energy supply, disrupt liver glycogen storage, and decrease plasma 
glucose levels (Danforth and Burger, 1984). Cold temperatures tend to increase 
thyroid hormone secretion rates, and decreases in iodide transport into the thyroid 
gland from the blood tend to decrease thyroid hormone secretion rates (McNabb, 
1995). Therefore, an association may exist between perchlorate reductions in 
thyroid hormone and decreased metabolic rates in animals. 

Available toxicity data suggests that rodents may be sensitive to low levels of 
perchlorate in the environment (Thuett et al. 2002; Siglin et al. 2000). Past 
research has shown that perchlorate administration at similar concentrations 
increased thyroid weights, decreased thyroid hormone levels, and increased 
thyroid follicular hyperplasia (Siglin et al. 2000). McNabb et al. (in press) has 
noted perchlorate-induced alterations in circulating thyroid hormones and thyroid 
gland hormone of adult and young northern Bobwhite quail. Perchlorate has been 
detected at high concentrations in water, vascular plant tissues, and seeds at 
concentrations ranging from approximately 1 ppm to as high as 5000 ppm (Smith 
et al., 2001; data on file, TIEHH). Small mammal species and passerine birds 
may be found in such contaminated environments; therefore such species 
represent potentially useful models for assessing the ecological impacts of 
perchlorate exposure. 

10.0 TEST ANIMALS: 

Species: Prairie voles (Microtus ochragaster) and House sparrow (Passer 
domesticus ) 

Strain: Prairie voles (laboratory); House Sparrows (free-living) 

Age: voles (21 - >100 days); sparrows (hatching year or after hatching year) 
Number: approximately: voles (51); birds (50) 

Source: voles (Texas Tech University vole breeding colony); birds (captured 
from Lubbock, TX) 

11.0 PROCEDURE FOR IDENTIFYING THE TEST SYSTEM: 

All voles were placed in standard rodent cages and each cage was labeled with a 
note card containing the appropriate identification information for the animal. 
Birds were placed into individual labeled cages containing the appropriate 
identification information for the animal on the front of the cage. All birds were 
color banded, with a unique color code being assigned for each bird. Collected 


Page 8 of 22 



Final Report 

U.S. Air Force Coop. Agreement CU1235 


TIEHH Project #T9700 
Metabolic Rate Phase V 


samples were placed in individually labeled bags/containers and stored 
appropriately according to TIEHH SOP IN-3-02. 

12.0 EXPERIMENTAL DESIGN INCLUDING BIAS CONTROL: 

Oxygen consumption was determined for voles that were exposed to perchlorate 
in drinking water and house sparrows dosed with perchlorate in water, as well as 
for control voles and sparrows. Metabolic rates were determined for animals in a 
resting state and cold-stress conditions. Metabolic rates of perchlorate exposed 
and non-exposed voles and dosed and non-dosed birds were compared to detect 
for physiological responses. Concentrations of thyroid gland hormones were 
examined to evaluate for thyroid hormone imbalance and dose-related responses. 
Vole and sparrow tissue samples were also analyzed for perchlorate. All voles 
and birds were randomly assigned into exposure groups (0, 1.0, and 10.0 mg/kg) 
and dosing groups (0, 12.5, and 25.0 mg/kg), respectively. 


13.0 METHODS: 

Experimental Groups 

Twenty-one male voles were acquired from a breeding colony located at Texas 
Tech University. All voles were housed in acrylic Nalgene rodent cages (25 cm 
long, 15 cm wide, 11 cm high) with Aspen shavings. Purina laboratory chow and 
water were provided ad libitum. Voles were maintained in a temperature 
controlled room at 25-26°C and 30-40% relative humidity on a 12h:12h lightdark 
photoperiod. All animals were weighed daily between 1200 and 1500 hours and 
food and water consumption were monitored on a daily basis during pre-exposure 
and exposure periods. Voles were provided access to water of one of three target 
exposures: control (milli-Q water; n=7), low exposure (1.0 mg perchlorate/kg; 
n=7), or high dose (10.0 mg perchlorate/kg; n~7). 

Adult male house sparrows (Passer domesticus) were captured in mist-nets or 
funnel traps from residential areas in Lubbock, Lubbock County, Texas 
(Scientific Collecting Permit: SPR-1098-984) during September and October 
2003. Following capture, birds were transported to the laboratory and assessed 
for general health. Any birds showing signs of disease or injury were not used in 
the study. Sparrows were held indoors in separate cages (40 cm x 40 cm x 40 cm) 
under controlled temperature (25°C), light (12L:12D) and humidity (30-40% 
relative humidity) before and during all experiments. Birds were provided with 
food (equal mixture of white millet, Purina Mazuri small bird maintenance, and 
black oil sunflower seed), water, and mineral grit for the duration of captivity. 

All sparrows were maintained in captivity for approximately 2 weeks before 
experimentation. For perchlorate dosing, sparrows were divided into three 
treatment groups, control (n=7), low dose (12.5 mg perchlorate/kg; n=7), and high 
dose (25.0 mg perchlorate/kg; n=7). The dosing solution was administered with a 


Page 9 of 22 




Final Report 

U.S. Air Force Coop. Agreement CU1235 


TIEHH Project #T9700 
Metabolic Rate Phase V 


pipette by placing the tip of the pipette on the edge of the lower mandible and 
allowing the bird to drink 100 fxL of the dosing solution. Sparrows were dosed 
once daily between the hours of 1200 and 1500. 

Resting Metabolism 

The metabolic rate of an inactive vole measured during the rest phase of its daily 
cycle was designated as the resting metabolic rate. All animals were allowed free 
access to food and water prior to metabolic experiments. Resting metabolic rate 
(RMR) was the lowest rate of oxygen consumption averaged over a continuous 5- 
minute period at 28°C (within the thermoneutral zone for this species) measured 
between 07:30 and 15:00 hours. 

For all RMR measurements, voles were weighed and then placed in gas-tight 
metabolic chambers (modified plastic rodent cages; volume 2.3 L). Chambers 
were fitted for inlet and outlet tubes. In our system, gas-cylinder air (dry grade; 
20.95% oxygen) was pumped into a climate-controlled chamber, where it was 
then channeled through a mass flow controller and a gas multiplexer (G245 and 
G244, respectively; Qubit Systems, Ontario, Canada). Gas then flowed into the 
chambers and excurrent air was rendered dry by passing it through a dessicant- 
filled column (magnesium perchlorate). A subsample of air (60 mL min'l) from 
the excurrent air stream and was rendered carbon dioxide free by passing through 
a soda lime column, and then routed into a differential oxygen analyzer (DOX) 
(S104; Qubit). The airline entering into the DOX was split to where half of the 
sample air was pulled through a carbon dioxide analyzer (SI54; Qubit) so that the 
sample reached the analyzers simultaneously. Metered air was directed to a single 
respirometry chamber for measurement, while simultaneously flushing air 
through 3 other unmeasured chambers. Air flow rates were adjusted to 850 mL 
min'^standard temperature and pressure conditions) for all vole chambers. 

During each trial, the automated respirometry system was programmed to 
measure oxygen consumption and carbon dioxide production for each vole at 1 
second intervals for 15 minutes per chamber then switch to the next chamber in 
series. All data were collected by Labview 6.0 (National Instruments, Austin, 

TX) and were imported into separate Microsoft Excel files for each gas channel. 
Before beginning measurements on the next vole in series, we allowed for a 15 
minute flush to ensure that residual gases had been removed from the system. 

Gas concentrations were measured in an empty chamber to obtain baseline levels 
passing through experimental chambers. The number of animals that could be run 
simultaneously (three per day) was due to behavioral characteristics (not fully 
diurnal or noctural) of the voles, and thus limited the sample sizes at each 
metabolic rate sampling period. Behavioral criteria and a video camera inside the 
temperature cabinet were used to determine whether animals were inactive during 
measurment of oxygen consumption. At the conclusion of each run, all animals 
were placed back into assigned cages. This type of format continued for 7 weeks 
for perchlorate experiments and 4 weeks for thyroxine experiments. Each animal 
was tested once per week. 


Page 10 of 22 



Final Report 

U.S. Air Force Coop. Agreement CU1235 


TIEHH Project #T9700 
Metabolic Rate Phase V 


Bird resting metabolic rate was measured during the night (20:30-06:30), and 
RMR calculated as the lowest rate of oxygen consumption averaged over a 
continuous 5-minute period at 30°C (within thermoneutrality; Hudson and 
Kimzey, 1966). The basic methods of collecting resting metabolic rates are as 
stated previously, with a few exceptions. Birds were weighed and the beginning 
of the dark cycle and placed into metabolic chambers fashioned from 3.8 L paint 
cans fitted with a perch, inlet and outlet, and sealed with paraffin wax. Flow rates 
were set at 850-900 mL min' 1 (standard temperature and pressure conditions). 
Birds were allowed to acclimate in the chamber approximately 45 minutes prior to 
testing, and excurrent oxygen concentration was then measured at 1 second 
intervals for a 20 minute time period throughout the night. Three birds were 
tested per night and all birds were weighed and returned to cages following 
metabolic measurements. 

Peak Metabolic Rate (cold-stress) 

Maximal oxygen consumption during cold stress was determined using a 
respiratory gas mixture of approximately 80% helium and 20% oxygen (helox; 
Rosenmann and Morrison, 1974). For sliding cold exposure tests, individual 
animals were exposed to a series of declining temperatures in helox. Cold stress 
temperatures were held at 12°C for 20 minutes followed by a continuous drop in 
temperature (~0.5°C per minute) until reaching 5°C. Helox tests were conducted 
for 1 hour or until the vole became hypothermic (indicated by a steady decline in 
oxygen consumption over several minutes). Cold stress tests were conducted 
between 1200 and 1600 h on voles which were allowed free access to food and 
water prior to metabolic tests. Flow rates were maintained at 1000-1050 mL min' 

1 for measurements of peak metabolic rate. The mass flow monitor was calibrated 
for helox gas with the use of a wet cell calibrator (Gilian Gilibrator 2; Sensidyne; 
Clearwater, FL). Voles were weighed to the nearest 0.01 grams before and after 
testing with a electronic balance. Metabolic chambers (volume 850 mL) 
consisted of a borosilicate glass tube capped on both ends fitted with an inlet or 
outlet. One end of the tube contained an electrical fan (velocity of 6.3 ft 3 min' 1 ) 
that aided in circulating air inside the metabolic chamber. One animal from each 
group (control, low dose, or high dose) was tested at a time, instead of three at a 
time for this procedure. Before animals were tested, all chambers (2 blanks and 1 
animal) were flushed with helox for at least 5 minutes at flow rates of 1000- 
1050mL min' 1 . Colonic temperature was taken before cold exposure and within 
60 seconds after being taken out of the chamber. Peak metabolic rates were 
calculated as the average of the highest rate of oxygen consumption over a 2-min 
period. 

Animal Sacrifice and Sample Collections 

Animals were weighed and then anesthetized in a saturated carbon dioxide 
chamber. Blood samples were then collected from each vole and bird, placed into 


Page 11 of 22 


Final Report 

U.S. Air Force Coop. Agreement CU1235 


TIEHH Project #T9700 
Metabolic Rate Phase V 


heparinized microcentrifuge tubes, and centrifuged until plasma had been 
separated. Plasma was then transferred to labeled tubes and frozen at -80°C until 
analysis. Following blood sampling, all animals were euthanized and necropsied. 
Livers, kidneys, and thyroid glands were collected and frozen until further 
analysis. 

Hormone Analysis 

Vole plasma total thyroxine (T4) and total triiodothyronine (T 3 ) were measured 
using clinical radioimmunoassay (RIA) kits (Diagnostic Products Coat-A-Count; 
TKT4X and TKT3X, respectively). The assay procedures for plasma that 
accompaned the kits were followed, except for the inclusion of a additional 
calibration points. Calibration points for the thyroxine standard curve were 0, 0.2, 
0.4, 0.6, 1,4, 10, 16, 24 pg/dL. Plasma samples (35 uL) were analyzed in 
duplicate. Calibration points for the triiodothyronine standard curve were 0, 5, 10, 
15, 20, 50, 100, 200, and 600 ng/dL. Plasma samples (125 uL) were analyzed in 
duplicate. Both total thyroxine and triiodothyronine radioimmunoassay kits were 
validated for prairie vole plasma by testing various volumes of plasma against the 
standard curve for parallelism, and spiking plasma samples of known thyroxine 
concentration with standards from the RIA kit. 

Sparrow total triiodothyronine was not analyzed because there was not enough 
plasma to allow for an adequate sample size. Sparrows were analyzed using the 
RIA kits described above for total thyroxine, however several of the 21 birds had 
died before plasma samples were collected, therefore not allowing statistical 
analysis on sparrow thyroxine concentrations. Calibration points for the T4 
standard curve were 0, 0.2, .05, 1.0, 4.0, and 10.0 ng/dL. Plasma samples (100 
uL) were analyzed in duplicate and the total thyroxine radioimmunoassay kit was 
validated for house sparrow plasma. 

Tissue Perchlorate Analysis 

Ion chromatography was used to analyze vole and sparrow liver and kidney 
tissues for perchlorate. Tissue samples were allowed to thaw, and a wet weight 
for each was recorded. Samples were allowed to air-dry for approximately 48 
hours and reweighed. Perchlorate was extracted from the samples (entire tissue) 
using an Accelerated Solvent Extractor (ASE; ASE 200, Dionex Corporation). 

The following operating conditions were used: Milli-Q water as extraction 
solvent, 1500 psi, 1 cycle, 60% flush, 5 minute preheat, 5 minute static, and 
100°C oven. Total extraction time was 15 minutes per sample. Total volume of 
extract collected (-22 ml) was measured and recorded. A 1:10 dilution of each 
sample extract was prepared. Samples were then cleaned using silica and C18 
solid phase extraction (SPE) cartridges. Extracts were then filtered through 0.45 
pm Acrodisc® filters (Pall Gellman, Ann Arbor, MI). Tissue samples were 
analyzed via a preconcentration / preelution ion chromatography method (Tian et 
al., 2003). Samples were concentrated on a Dionex TAC-LP1 with 10 mM 


Page 12 of 22 





Final Report 

U.S. Air Force Coop. Agreement CU1235 


TIEHH Project #T9700 
Metabolic Rate Phase V 


sodium hydroxide eluent for 2.5 minutes and then injected into the separation 
system. Ion separation occurred on an analytical column (Dionex lonPac AS 16) 
and using 100 mM sodium hydroxide. Total run time was 12.5 minutes with a 
0.92 mL/min flow rate and 1000 pL injection volume. Retention times were used 
to identify perchlorate and the peak area was used for quantification. A standard 
curve was generated from calibration standards of 4, 50, 100, 150, and 300 ppb to 
determine sample concentrations. 

Statistical Methods 

Effects of exposure on liver peak metabolic rates and thyroid hormone 
concentrations were tested using analysis of variance. Any significant 
interactions were analyzed using Tukey’s test. The effect of dosage on oxygen 
consumption rates, body mass, food consumption (g consumed/g b.w.), and water 
consumption (g consumed/g b.w.) over time were tested with repeated measures 
analysis of variance using the general linear model procedure in SAS. Pearson’s 
correlation test was used to assess potential relationships between plasma 
thyroxine and peak metabolic rate in voles. Statistical tests were considered 
significant when p<0.05. There were no deviations from the assumptions of 
normality or equality of variances for any of the analyses. 

14.0 RESULTS 

Voles: 

Perchlorate effects on Metabolism 

There were no significant differences in resting metabolic rate between any of the 
treatment groups during pre-exposure measurements (p-0.6049). There was no 
treatment effect on resting metabolic rate during any of the 6 weeks of exposure 
(Figure 1). The behavior nature of the voles may have obscured differences (see 
conlusions). There were also no significant differences in peak metabolic rate 
between any of the treatment groups on exposure day 51 (p=0.7985). High 
variability if peak metabolic rate between animals of the same treatment and low 
sample sizes may have obscured differences (Figure 2). Circulating T4 levels 
were not significantly correlated with peak metabolic rate (p=0.1464, r 2 =0.1199). 

Thyroid hormones 

Mean thyroxine concentrations from perchlorate exposed voles decreased in a 
dose-dependent manner, however there were no significant differences between 
any of the perchlorate treatment groups (n-21, p-0.0871). Plasma 
triiodothyronine (T3) levels did not differ between any of the treatment groups 
following 51 days of exposure (p=0.6782). The smaller sample size (n=15) for 
T3 analysis probably explains why there is such a large difference between p- 
values for T3 and T4 analyses. Plasma volumes were not adequate for both T4 


Page 13 of 22 





Final Report 

U.S. Air Force Coop. Agreement CU1235 


TIEHH Project #T9700 
Metabolic Rate Phase V 


and T3 analysis for some voles. Plasma thyroid hormone levels were not 
analyzed for voles implanted with thyroxine-releasing pellets. 

Other Physiological Indices 

Mean body mass did not differ among treatment groups for any of the monitored 
weeks, pre-exposure or post-exposure. While food consumption did not vary 
significantly among treatment groups for any of the weeks monitored, water 
consumption was significantly higher for the 10.0 mg/kg treatment than the 
control group during the pre-exposure week and weeks 2,3,4,5, and 6 post¬ 
exposure. Mean water consumption differences between the 10.0 mg/kg and 
control groups remained relatively constant from the pre-exposure period through 
post-exposure weeks, therefore any differences between these groups were not 
likely attributable to perchlorate exposure. 

Tissue Concentrations 

Prairie vole livers and kidneys contained no detectable levels of perchlorate. This 
result is fairly consistent with other laboratory rodent studies that have been 
conducted at Texas Tech University (data on file, TIEHH). 

House Sparrows: 

Following acclimation, 21 out of 24 sparrows were selected to take part in 
experiments assessing perchlorate effects on metabolic rate. Following weeks 2 
and 3 of perchlorate exposure, several birds had become ill and expressed 
symptoms of a bacterial infection {Mycoplasma gallisepticum), resulting in House 
Finch Disease, also referred to as Chronic Respiratory Disease. Most birds with 
the illness would die within 2-3 days after showing first symptoms. Eight of 
twenty-one sparrows became infected with the bacteria. Birds with the disease 
had as high as two-times the metabolic rate of uninfected birds. The results of the 
study were compromised due to this epidemic and the study was terminated after 
the 5 th exposure day of the 3 rd week. The room, cages, and all supplies located in 
the room where sparrows were located were decontaminated and a completely 
new set of birds was brought into the animal facilities center. This time, all birds 
were placed on the recommended mg/kg dosage of Tylan antibiotic (soluble- 
powder) for the recommended dosing period. All birds were monitored for illness 
during this period. Two weeks after treatment with Tylan, 4 more birds showed 
symptoms of House Finch Disease and died within 2 days of first symptoms. At 
this point, it was determined that this species was not going to be a good test 
species for this study, and it was too late in the study to redo the experiment. 
Interestingly, no sparrows showed symptoms of the respiratory disease prior to 
perchlorate dosing experiments (mid-Fail, 2003). 

Circulating thyroxine levels and liver and kidney weights are shown below 
(Table 2). The mean perchlorate concentration detected in livers of house 
sparrows dosed with 12.5 mg/kg of perchlorate was 57.41 ±68.77 ug/g (d.w.) 


Page 14 of 22 






Final Report 

U.S. Air Force Coop. Agreement CU1235 


TIEHH Project #T9700 
Metabolic Rate Phase V 


(Table 3). The mean perchlorate concentrations detected in kidneys from this 
group were 34.85 ± 42.83 ug/g (d.w.). Mean perchlorate concentrations detected 
in the liver and kidneys of the 25.0 mg/kg treatment group were 234.48 ± 258.26 
ug/g (d.w.) and 362.98 ± 337.18 ug/g (d.w.), respectively. Metabolic rates of 
perchlorate-dosed birds through day 21 are shown below as well (Figure 3). 
Statistical analyses were not performed on any of the sparrow data due to the 
confounding factor of disease. In general, birds with the respiratory disease had 
increased liver and kidney wet weights. Another significant finding was that 4 of 
the 6 perchlorate-dosed sparrows had plasma T4 levels below detection limit 
(0.067 ng/dL), while all of the control animals analyzed had detectable T4 levels 
(Table 2). 

15.0 DISCUSSION 

The lack of a detectable energetic cost associated with perchlorate exposure in 
prairie voles is evidenced by relatively unchanged resting metabolic rates in 
exposed voles. If there were added costs, the sensitivity of our methodology or 
instrumentation did not allow for detection, or perchlorate exposure had no effect 
on the amount of energy allocated for maintenance costs. Added costs could have 
been compensated by the hypothalamus-pituitary-thyroid (HPT) axis or perhaps 
the exposure dose was not high enough or exposure duration not long enough for 
there to be an impact on metabolic function. To our knowledge, there have been 
no other studies investigating perchlorate effects on metabolic rate in endothermic 
organisms; however other endocrine disruptors acting on the thyroid gland have 
yielded results similar to our own (French et al., 2001). The indication of no 
difference in RMR among treatments groups and the large variability among 
weeks within a treatment group may have been attributable to an increase in 
activity wit hin the metabolic chamber. In some cases, test voles may have rested 
a total of 30 minutes in the metabolic chamber per 7-8 hour test period. The 
configuration of the respirometry system and confounding factors such as long 
wash times (time taken for recirculation of gas in a chamber) made the process of 
collecting metabolic rates relatively difficult. Most voles expressed circadian 
rhythms when not taking part in metabolic experiments, however, these rhythms 
seemed to be disrupted during testing periods. Some voles may not have reached 
a true resting state, therefore not yielding a true resting metabolic rate. Other 
species, such as some passerine birds or deer mice, may be a better model to use 
when investigating contaminant effects on metabolic function. Animals that are 
more diurnal or nocturnal (e.g. deer mice) usually produce much more stable 
resting metabolic rates and allow for more than one stable reading per test period 
(data on file, TIEHH). 

Initially we expected to see an increase in metabolic rate in the two exposed vole 
groups over the first 2-3 weeks, followed by a gradual drop in metabolic rate 
during the last weeks of exposure. We hypothesized that initial exposure would 
cause the HPT axis to compensate for any reductions in thyroid hormone 
secretion from the thyroid gland. An increase in circulating thyroid hormones 


Page 15 of 22 




Final Report 

U.S. Air Force Coop. Agreement CU1235 


TIEHH Project #T9700 
Metabolic Rate Phase V 


usually results in increased metabolic rate. With severe and/or prolonged 
perchlorate exposure and/or iodine deficiency in thyroid, HPT activation will be 
unable to maintain euthyroid status, causing decreased levels of circulating 
thyroid hormones and eventually reduced metabolic rate. This trend was not 
evident in our data over the six-week exposure period (Figure 1). 

Since there have been no reports of any species of Microtus showing torpor either 
on a seasonal basis or for a shorter term, they must always expend energy for 
thermoregulation. Therefore, thermoregulation is a major maintenance cost for 
voles, as well as other rodent species with similar behavior (Tamarin, 1985). 
Perchlorate exposure had no effect on resting metabolic rate in this study, but that 
did not necessarily mean that it would have no effect on metabolic rate under 
conditions of cold exposure. The data do not show a marked reduction in the 
ability of exposed animals to deal with cold-stress tests. Again, it may require a 
higher dose or longer duration of exposure to see such an effect on cold-tolerance. 
Some of the voles in the high exposure group showed signs that they were able to 
deal with cold temperatures as well as control animals. Three of the seven voles 
in the high exposure group had metabolic rates higher than those of the mean 
control vole metabolic rate. 

Reductions in thyroid hormones are often related to perchlorate exposure and 
thyroid hormones are key players in metabolic capacity, however, we found no 
relationship between peak metabolic rate and thyroxine concentrations and no 
significant differences in T 4 levels among groups; therefore, it may be possible 
that these animals were able to overcome any potential effects of exposure. 

Iodine was not limited in the rodent diet, as the rodent chow contains an average 
value of 1.1 ±0.17 ppm iodine (Purina Mills International website). With 
sufficient iodine or iodide in the diet, the HPT axis should be able to maintain a 
euthyroid status (McNabb, 1992). Prairie voles also show a higher weight- 
specific rate of oxygen consumption in winter than in summer which may allow 
tolerance to lower thermal exposures (Wunder et al., 1977). 

Our data did not show a marked reduction in plasma triiodothyronine. Our results 
are somewhat consistent for lower levels of perchlorate exposure (1.0 mg/kg), 
however our results contradict other studies that used a similar high exposure 
(10.0 mg/kg) for a different species (Siglin et al., 2000). Although the results 
were not statistically significant, we did find a dose-response pattern in plasma T 4 
levels. Despite a reduction in T 4 , T 3 is the biologically thyroid hormone and any 
reduction in T 4 may not have an impact on T 3 concentrations. A change in T 4 
concentration that does not have an impact on deiodination processes would not 
impact the levels of T 3 (Hulbert et al., 1985). Cellular metabolism and the 
generation of ATP are tied to concentrations of T 3 , which were not effected by 
perchlorate exposure. It should seem logical that resting metabolic rates as well 


Page 16 of 22 



Final Report 

U.S. Air Force Coop. Agreement CU1235 


TIEHH Project #T9700 
Metabolic Rate Phase V 


as peak metabolic rates would not be affected either. More exposure/dosing 
studies are needed with other rodent species, multiple treatments, and longer 
exposure times to determine if perchlorate can alter metabolic rates in 
endo therms. 

Overall, this study did not provide evidence for energetic costs associated with 
perchlorate exposure at the individual level. Several issues must be taken into 
consideration before drawing any conclusions on whether or not perchlorate 
exposure can induce alterations in metabolic rate, and more importantly 
thermoregulatory capabilities. Before we can fully understand any mechanisms of 
perchlorate-induced alterations in metabolic rate in homeotherms, we must first 
understand how the HPT axis responds to perchlorate exposure at varying levels. 
One of the most popular indices of exposure has been plasma thyroid hormone 
level, which are probably the most variable measure of thyroid function. This is 
most likely due to the dynamic adjustment ability of the HPT axis (McNabb, 
1992). Current research is proving that there are better techniques, such as 
thyroidal T content, for assessing perchlorate exposure, at least in avian species 
(McNabb et al., in press). Because animals often have the ability to adapt 
behaviorally or physiologically under conditions of toxicant stress, there should 
be an emphasis on the need for further evaluation of the interaction between 
perchlorate exposure and adaptive strategies. For instance, small mammals in 
temperate climates often compensate for thermal stress in winter by increasing 
their resting metabolic rate and activity of nonshivering thermogenesis (Tomasi et 
ah, 1994). Rodents also respond to cold exposures by inducing growth of brown 
adipose tissue (BAT), the tissue that is responsible for the generation of 
nonshivering thermogenesis (Heldmaier, 1975). Given that rodents have these 
physiologically controlled adaptive responses to cold-conditions, it is possible that 
low, environmentally-relevant concentrations of perchlorate exposure will have 
little or no effect on an animal’s ability to deal with cold-stress. However, avian 
species do not have BAT as an energy reserve for the production of heat in times 
of cold-stress. Birds that are most at risk, such as waterfowl and ground-dwelling 
birds, experiencing marked decreases in thyroidal hormone stores may be more at 
risk under cold-conditions than mammals. Given that endothermic organisms 
increase the rate of thyroid hormone secretion and sometimes the rate of thyroid 
hormone utilization under cold-stress (McNabb, 1994), severe depletion of 
thyroidal hormone stores would indicate that these animals would have little 
capability to respond to the condition. 


Page 17 of 22 




Final Report 

U.S. Air Force Coop. Agreement CU1235 


TIEHH Project #T9700 
Metabolic Rate Phase V 


16.0 References: 

Banta, M.R. and D.W. Holcombe. 2002. The effects of thyroxine on metabolism and 
water balance in a desert-dwelling rodent, Merriam’s kangaroo rat (Dipodomys 
Merriamx). Journal of Comparative Physiology Part A. 185: 463-470. 

Burger, M.F. and Denver, R.J. (2002). Plasma thyroid hormone concentrations in a 
wintering passerine bird: Their relationship to geographic variation, environmental 
factors, metabolic rate, and body fat. Physiological and Biochemical Zoology. 
75(2): 187-199. 

Danforth, E. and Burger, A. (1984). The role of thyroid hormones in the control of 
energy expenditure. Clinics in Endocrinology and Metabolism. 13(3): 581-595. 

French JB, Volturea MB, Tomas TE. 2001. Effects of pre-and postnatal 

polychlorinated biphenyl exposure on metabolic rate and thyroid hormones of 
white-footed mice. Environmental Toxicology and Chemistry Vol 20(8): 1704- 
1708. 

Haim, A. and Izhaki, I. (1993). The ecological significance of resting metabolic rate 
and non-shivering thermogenesis for rodents. J. Therm. Biol. 18(2): 71 -81. 

Heldmaier, G. (1975). The effect of short daily cold exposures on development of 
brown adipose tissue in mice. J. Comp. Physiol. 98: 161-168. 

Hudson, J.W. and Kimzey, S.L. (1966). Temperature regulation and metabolic 

rhythms in Population of the house sparrow, Passer domesticus. Comp. Biochem. 
Physiol. 17:203-217. 

Hulbert, A.J., D.S. Hinds, and MacMillen, R.E. (1985). Minimal metabolism, summit 
metabolism and plasma thyroxine in rodents from different environments. Comp. 
Biochem. Physiol. 81, 687-693. 

Marsh, R.L. and Dawson, W.R. (1989). Avian adjustments to cold. Advances in 
Comparative and Environmental Physiology. 4: 206-253. 

McNabb, F.M.A. (1992). Thyroid hormones. Prentice Hall, Englewood Cliffs, NJ, 
USA. 

McNabb, F.M.A. (1994). Thyroids. In Sturkie’s Avian Physiology. 5 th ed. 

McNabb, F.M.A. (1995). Thyroid hormones, their activation, degradation, and 
effects on metabolism. Journal of Nutrition. 125:1773-1776. Invited Symposium 
paper presented as part of the 59 th Annual Poultry Nutrition Conference: 

Metabolic Modifiers, 78 th FASEB meeting, April, 1994 


Page 18 of 22 



Final Report 

U.S. Air Force Coop. Agreement CU1235 


TIEHH Project #T9700 
Metabolic Rate Phase V 


McNabb, F.M.A, Larsen,C.T., and Pooler, P.S. (2004). Ammonium perchlorate 
effects on thyroid function and growth in bobwhite quail chicks. Envir Toxicol & 
Chem (in press). 

Rosenmann M. and Morrison P, (1974). Maximum oxygen consumption and heat loss 
facilitation in small homeotherms by He-Cb. Am. J. Physiol. 226, 490-495. 

Siglin JC, Matie DR, Dodd DE, Hildebrandt PK, Baker WH. 2000. A 90-day 
drinking water study in rats of the environmental contaminant ammonium 
Perchlorate. Toxicological Sciences. 57:61-74. 

Smith, P.N., Theodorakis, C.W., Anderson, T.A., and Kendall, R.J. 2001. 

Preliminary Assessment of Perchlorate in Ecological Receptors at the Longhorn 
Army Ammunition Plant (LHAAP), Kamack, TX. Ecotoxicology, 10: 305-313. 

Tamarin, RH. 1985. Biology of New World Microtus. Special Publication No. 8. 

The American Society of Mammalogists. 

Thuett KA, et al. 2002. In utero and lactational exposure to ammonium perchlorate 
in drinking water: effects on developing deer mice at postnatal day 21. Journal 
of Toxicology and Environmental Health. Part A. 65: 1061-1076. 

Tomasi, T.E. and Mitchell, D.A. (1994). Seasonal shifts in thyroid function in the 
cotton rat, (Sigmodon hispidus ). Jounal of Mammalogy, 75(2), 520-528. 

United States Environmental Protection Agency. (1993). Wildlife Exposure Factors 
Handbook. Vol I. pp. 2-311-2-322. 

Wunder BA, Dobkin DS, Gettinger RD. 1977. Shifts of thermogenesis in the prairie 
vole (.Microtus ochrogaster ), strategies for survival in a seasonal environment 
Oecologia 29: 11-26. 


Page 19 of 22 









Final Report 

U.S. Air Force Coop. Agreement CU1235 


TIEHH Project #T9700 
Metabolic Rate Phase V 



Days Post Dose 


Figure 1. Weekly mean resting metabolic rates (ml g" 1 IF 1 ) of prairie voles exposed to 
perchlorate in the drinking water (n=21). 



exposure day 51 

Figure 2. Peak metabolic rates (ml g' 1 h‘l) of prairie voles exposed to perchlorate for 51 
days. Temperature in metabolic chamber held at 12°C for 20 minutes followed by a drop 
in temperature to 5°C for a maximum duration of 60 minutes. 


Page 20 of 22 









Final Report 

U.S. Air Force Coop. Agreement CU1235 


TIEHH Project #T9700 
Metabolic Rate Phase V 



dayO day7 day 14 day21 


Figure 3. Weekly mean resting metabolic rates of house sparrows dosed with perchlorate 
through 21 days of dosing. Experiment terminated after 21 days of dosing due to the high 
occurrence of disease in the sparrow colony, thus compromising the results of the study. 


Table 1. Mean prairie vole plasma T4 (ug/dL), T3 (ng/dL), and tissue weights (g/g b.w.) 
following 5 1 days of exposure to perchlorate in the drinking water. 


Treatment 

Plasma T4 

PlasmaT3* 

Liver (w.w.) 

Kidney (w.w.) 

0 mg/kg 

3.01(0.83) 

109.29(30.10) 

0.045(0.006) 

0.010(0.007) 

1 .Omg/kg 

2.74(1.36) 

94.83(32.71) 

0.042(0.009) 

0.010(0.007) 

10.0 mg/kg 

1.70(0.91) 

95.57(13.23) 

0.046(0.004) 

0.011(0.001) 


Numbers in parentheses are S.D. 
*n=16 


Page 21 of 22 





















Final Report 

U.S. Air Force Coop. Agreement CU1235 


TIEHH Project #T9700 
Metabolic Rate Phase V 


Table 2. Individual and mean bouse sparrow thyroxine 


concentrations (ug/dL) and liver and kidney masses (g) following 
3 weeks of perchlorate dosing._ 


Treatment 

ID 

Plasma T4 a 

Liver (w.w.) 

Kidney (w.w.) 

control 

1c 

0.2224 

0.60 

0.19 


2c 

0.1647 

0.79 

0.18 


3c^ 

0.4229 

0.67 

0.15 


4c 

0.3988 

1.38 

0.25 


5c 

0.3465 

0.59 

0.18 


6c ^ 

NA 

NA 

NA 


7c 

NA 

1.06 

0.18 




0.85(0.31) 

0.19(0.03) 

12.5ma/ka 

lid 

NA 

0.69 

0.19 


2ld 

NA 

0.44 

0.15 


3ld 

ND 

0.60 

0.16 


4ld 

0.0736 

0.79 

0.2 


5W 

NA 

0.82 

0.18 


6ld 

NA 

0.80 

0.24 


7ld* 






NA 

1.18 

0.25 




0.76(0.23) 

0.20(0.04) 

25.0ma/ka 

Ihd 

NA 

0.56 

0.15 


2hd 

ND 

0.60 

0.18 


3hd 

ND 

0.54 

0.15 


4hd 

ND 

0.57 

0.2 


5hd 4 

0.1061 

0.57 

0.16 


6hd 

NA 

0.66 

0.17 


7hd b 

NA 

NA 

NA 




0.58(0.04) 

0.17(0.02) 


Numbers in parentheses are S D 
* diseased bird (House Finch Disease) 

** death due to injury 

a missing values for plasma T4 are due to lack of plasma or death before blood sampling 
b tissues and plasma not collected 
NA= not available 
ND= not detectable 


Table 3. Mean concentrations (ug/g d.w.) of perchlorate in house sparrow 
livers and kidneys following 3 weeks of perchlorate dosing._ 


T reatment 

Liver CI04 

Kidney CI04 

0 mg/kg 

0 

0 

12.5 mg/kg 

57.41(68.77) 

34.85(42.83) 

25.0 mg/kg 

234.48(258.26) 

362.98(337.18) 


Numbers in parentheses are S.D. 


Page 22 of 22 



Project No.T9700 


A STUDY PROTOCOL 
ENTITLED 


Perchlorate-Induced Alterations in Metabolic Rate and Thermoregulation in Small Mammals and 

Birds 


STUDY/PROTOCOL NUMBER: MRT-03-01 


SPONSOR: 

Strategic Environmental and Research Development Program 

SERDP Program Office 

901 North Stuart Street, Suite 303 

Arlington, VA 22203 


TESTING FACILITY: 

Name/Address: 

The Institute of Environmental & Human Health 
Texas Tech University / TTU Health Sciences Center 
Box 41163 

Lubbock, TX 79409-1163 

Test Facility Management: 

Dr. Ronald J. Kendall 
Director, TIEHH 

Study Director: 

Philip N. Smith 


PROPOSED EXPERIMENTAL 
START DATE: APRIL 1, 2003 


Page 1 of 11 









Project No. T9700 


1. DESCRIPTIVE STUDY TITLE: 

Perchlorate-Induced Alterations in Metabolic Rate and Thermoregulation in prairie voles 
(Microtus ochragaster) and house sparrows (Passer domesticus) 

2 . STUDY NUMBER: MRT-03-01 

3. SPONSOR: 

Strategic Environmental and Research Development Program 

SERDP Program Office 

901 North Stuart Street, Suite 303 

Arlington, VA 22203 

4. TESTING FACILITY NAME & ADDRESS: 

The Institute of Environmental and Human Health 

Texas Tech University / Texas Tech University Health Sciences Center 

Box 41163 

Lubbock, TX 79409-1163 

5. PROPOSED EXPERIMENTAL START & TERMINATION DATES: 

Start Date: April 1, 2003 

Termination Date: December 31, 2003 

6. KEY PERSONNEL: 

Dr. Philip N. Smith, Study Director / Study Advisor 

Mr. John Isanhart, co-investigator 

Miss Jaclyn Canas, co-investigator 

Mr. Ryan M. Bounds, Quality Assurance Manager 

Dr. Ronald J. Kendall, Testing Facility Management 

7. DATED SIGNATURES: 


Dr. PhilipN. Smith 

S'/il/oZ Dr. Ron Kendall 

Testing Facility Management 



Page 2 of 11 


Project No. T9700 


f'!H1 Mr. Ryan Bounds 

Quality Assurance Manager 

8. REGULATORY COMPLIANCE STATEMENT 
Quality Control and Quality Assurance 

This study will be conducted in accordance with established Quality Assurance 
program guidelines and in compliance, where appropriate and possible, with 
Good Laboratory Practice Standards (40 CFR Part 160, August 17, 1989). 

Document Control Statement 

This document is considered proprietary to TIEHH and the Sponsor. Do not copy, 
quote or distribute. For access to this document or authority to release or 
distribute, please write to: 

Dr. Philip N. Smith 

TIEHH 

Box 41163 

Lubbock, TX 79409-1163 

9. STUDY OBJECTIVES / PURPOSE: 

To evaluate the effects of perchlorate on metabolic rate and thyroid function in prairie 
voles and house sparrows through analysis of thyroid hormones, tissue perchlorate 
concentrations, and comparison of VO 2 between treatment and control groups; 
previous studies have shown elevated metabolic rates in thyroid hormone- 
administered birds and rodents (Banta and Homlcombe, 2002; Burger and Denver, 
2002); depressed metabolic rates and circulating thyroid hormone concentrations 
coincide with hypothyroidism, which are often effects of perchlorate exposure 
- To evaluate thermoregulatory costs associated with perchlorate exposure in prairie 
voles and house sparrows by measuring metabolic rate during cold stress experiments; 
thyroid hormones are the key controllers of metabolism that are necessary for 
maintenance of constant body temperature in homeothermic animals; any disruption 
of shivering or non-shivering thermogenesis in birds or rodents, respectively, may 
place them at a disadvantage when faced with highly variable temperature extremes 

10. TEST MATERIALS: 

Test Chemical name: ammonium perchlorate 
CAS number: 7790-98-9 
Characterization: 99.999% pure 
Source: Sigma Aldrich 



Page 3 of 11 





Project No. T9700 


Reference Chemical name (positive control): L-thyroxine 
CAS number: 51-48-9 

Characterization: 1.0 and 2.0 mg thyroxine-releasing pellets for birds; 0.5 and 1.5 mg 
thyroxine-releasing pellets for voles 
Source: Innovative Research of America 

11. JUSTIFICATION OF TEST SYSTEM 

The prairie vole is a ground-burrowing rodent found in the north and central plains of the 
United States and in southern Canada. Voles are largely herbivorous, consuming 
primarily green succulent vegetation, but also roots, bark, and seeds as well. These small, 
non-hibernating mammals living in the north temperate and boreal regions are faced with 
seasonal changes in their thermal environment. They must be able to adapt to both hot 
and cold extremes, otherwise, they may be at a disadvantage when stressed with a 
contrasting season or extreme daily temperature fluctuation. Animals need enough 
insulative and/or thermogenic capability to withstand low temperature exposure without 
becoming hypothermic, and they must cope with cold stress by behavioral avoidance 
and/or increased thermogenic capacity (Wunder et al. 1977). Small mammals have a 
limited ability in increasing their insulation, therefore behavioral avoidance and 
thermogenesis become the most important means for maintaining a relatively narrow 
range of body temperature. Deficiencies in thyroid hormones have been associated with a 
loss of mental alertness, slow heart rate, and increased sensitivity to cold. Therefore, 
perchlorate-induced alterations in thyroid hormones may have secondary effects on 
metabolic rate and thermoregulation. 

The house sparrow is a common passerine species that is often used as an avian 
behavioral and toxicological model. Birds, especially passerine species, are often used as 
sentinel species when assessing the ecological impacts of chemicals on ecosystems and 
populations. The insulative needs of birds are often met by a combination of plumage 
characteristics, behavioral avoidance of cold exposure, and shivering thermogenesis 
(increased metabolic rate). Subcutaneous fat tends to be more localized in birds than in 
mammals, therefore birds cannot rely on fat storage for insulation. Incubation in females, 
as well as males, can also potentially expose the incubating parent to extremely 
demanding thermal conditions. Altered thyroid hormone concentrations influence the 
overall metabolic energy supply, disrupt liver glycogen storage, and decrease plasma 
glucose levels. Cold temperatures tend to increase thyroid hormone secretion rates, and 
decreases in iodide transport into the thyroid gland from the blood tend to decrease 
thyroid hormone secretion rates (McNabb, 1995). Therefore, an association may exist 
between perchlorate reductions in thyroid hormone, as well as the blocking of iodide 
uptake into the thyroid gland by perchlorate, and decreased metabolic rates in animals. 


Page 4 of 11 






Project No. T9700 


Available toxicity data suggests that rodents may be sensitive to low levels of perchlorate 
in the environment (Thuett et al. 2002; Siglin et al. 2000). The United States 
Environmental Protection Agency also noted a need for the determination of the effects of 
dietary exposure to perchlorate in birds. Past research has shown that perchlorate 
administration at similar concentrations increased thyroid weights, decreased thyroid 
hormone levels, and increased thyroid follicular hyperplasia (Siglin et al. 2000). Dr. 

An ne McNabb of Virginia Tech has noted perchlorate-induced alterations in circulating 
thyroid hormones of adult and young northern Bobwhite quail (studies ongoing). Not 
only has perchlorate been detected by Texas Tech University researchers at high 
concentrations in water, but it has also been reported in plant vascular tissues and seeds at 
concentrations ranging from approximately 1 ppm to as high as 5000 ppm (Smith et al. 
2001; data on file, TIEHH). Small mammal species and passerine birds maybe found in 
such contaminated environments; therefore such species represent potentially useful 
models for assessing the ecological impacts of perchlorate exposure. 

12. TEST ANIMALS (Where applicable provide number, body weight range, sex, source of 
supply, species, strain, sub-strain, and age of test system): 

Species: Prairie voles (Microtus ochragaster) and House sparrow (Passer domesticus ) 
Strain: 

Age: voles (21 - >100 days); birds (hatching year or after hatching year) 

Number: approximately: voles (51); birds (50) 

Source: voles (Texas Tech University vole breeding colony); birds (captured from 
Lubbock, TX) 

13. PROCEDURE FOR IDENTIFYING THE TEST SYSTEM: 

All voles will be placed in standard rodent cages and each cage will be labeled with a 
note card containing the appropriate identification information for the animal. Birds will 
be placed into individual labeled cages containing the appropriate identification 
information for the animal on the front of the cage. All birds will also be color banded, 
with a unique color code being assigned for each bird. Collected samples will be placed 
in individually labeled bags/containers and stored appropriately according to TIEHH SOP 
IN-3-02. 


Page 5 of 11 



I 


Project No. T9700 


14. EXPERIMENTAL DESIGN INCLUDING BIAS CONTROL: 

Oxygen consumption and carbon dioxide respiration will be determined for voles and 
sparrows that have been dosed with perchlorate in the drinking water and in perchlorate- 
injected worms, respectively, as well as for control groups. A positive control experiment 
will involve implanting thyroid hormone pellets into animals and comparing metabolic 
rates between groups. Metabolic rates will be compared between perchlorate dosing 
groups to detect for physiological responses. Concentrations of thyroid gland hormones 
and blood and tissue perchlorate will also be examined to evaluate for thyroid hormone 
imbalance and dose-related responses. Abilities of animals to deal with cold-exposure 
will be related to perchlorate exposure and thyroid hormone concentrations. Animals will 
be randomly assigned into dosing groups, as well as randomly assigned to a chamber for 
metabolic rate measurements. Voles and birds will be will assigned to an unlabeled cage 
and a random number table will be read, with every third number being considered. The 
number 1 will designate a control animal, a number 2 will designate an animal in the low 
dose group, and a number 3 will designate an animal in the high dose group. When a 
dosing group becomes filled, that number designating that group will no longer be 
considered and only the two remaining numbers will count. Numbers will be read until 
all animals are assigned to dose groups. 

15. METHODS: 

Metabolic Rate 

The procedure for collecting oxygen consumption rates (acclimation period, positive 
control and perchlorate experiment) is as follows: One animal from each group (control, 
low dose, and high dose) will be placed in a respirometry chamber. Tests will be 
conducted between 0800 and 2200 hours. A 4-channel respirometry instrument (Qubit 
Systems, Ontario, Canada) with an open-flow configuration will be used. Individuals will 
be weighed at the beginning and end of testing. Animals will be disturbed as little as 
possible, as our whole purpose is to have them as calm as possible at the time of testing. 
Animals will then be placed in a cylindrical respirometry chamber. These chambers 
provide the animal with space to position itself without being cramped, while restricting 
it so it is not able to hurt itself. The chamber is made of borosilicate glass with each end 
consisting of a plastic end cap, one with a built-in electrical fan, the other with a small 
hole for the insertion of a temperature probe. Chambers will be placed in a temperature- 
controlled cabinet and animals will be allowed an initial 30 minutes to one-hour 
acclimitization period in the chamber to allow them to achieve a resting state. Air will be 
passing through each chamber at a rate of approximately 250-1000 ml/min during this 
period, as well as the test period. Testing will commence by collecting carbon dioxide 
and oxygen measurements at 20 minute intervals per channel, with a reference channel 
measurement between each sample measurement. Total run time (high estimate)^ 60 


Page 6 of 11 


Project No. T9700 


minutes acclimitization + (20 minutes per channel x 6 samples per round)=180 minutes. 
Behavioral criteria will be used to determine whether animals are inactive during 
measurment of oxygen consumption to insure consistency of animals. Activity levels will 
also be monitored on the computer screen, with an increase in activity resulting in 
increased oxygen consumption. At the conclusion of each run, all animals will be placed 
back into assigned cages. This type of format will continue for 3-8 weeks (depending on 
which experiment), once a week, for all animals. Some sessions will be video-taped. 

Summit Metabolic Rate (cold-stress) 

Cold stress tests will be performed at the conclusion of resting metabolic testing. Tests 
will be performed on the same individuals that were used in the resting metabolic testing 
part of the perchlorate experiment. Lighting conditions will be kept constant throughout 
the study, and the major procedures will be conducted as stated previously, with the 
exception of a few minor adjustments. Tests will be performed between 0800 and 2200 
hours. Initial core body temperatures will be taken by inserting a copper-constantan 
thermocouple into the colon/cloaca of the animal. Summit metabolic rate will be 
measured using helox gas (80% He, 20% oxygen) at a temperature of 5-15 C, or by 
placing animals in an environmental chamber that has been cooled to a temperature near 
freezing. One animal from each group (control, low dose, or high dose) will be tested at a 
time, instead of three at a time for this procedure. Each animal will be tested for a 
maximum of 60 minutes at a time. Those animals that become hypothermic relatively 
quickly and have uncharacteristically low metabolic rates will be removed from the 
chamber and monitored for signs of distress. Hypothermia is determined by a steady state 
decline in the volume of oxygen consumed over several minutes. Upon removal from the 
chamber, colonic/cloacal temperature will be measured with a thermocouple and animals 
will be placed back into assigned cages. 

15.1 Test System acquisition, quarantine, acclimation 

Voles will be acquired from the vole colony at the Human Sciences Laboratory Animal 
Facilities at TTU. Voles will be provided with adequate care and be given a 1-2 week 
acclimation period to determine how they will adjust to their new environment and 
procedures of taking oxygen consumption measurements. 

Birds will be captured from various locations in the Lubbock, TX area, transferred to 
animal facilities, and individually housed in cages. Sparrows will be provided with 
adequate food, water, etc. and treated for parasites. All animals will be allowed 1-2 
weeks to acclimate to their new environment, and daily observations will be made for any 
unusual behavior or illness. 


Page 7 of 11 



Project No. T9700 


15.2 Test Material Application 

Concentrations, Frequency, Method of Application: 

Thyroxine: 

A L-thyroxine hormone releasing pellet (1.5 mm diameter) will be subcutaneously 
implanted into the lateral side of the neck (between ear and shoulder, or ear and base of 
neck) in each animal involved in the positive control dosing experiment for both birds 
and rodents. Before implantation, animals will be sedated with a Halothane soaked 
cotton ball in a desiccating chamber. After determining that the animal is sedated, it will 
be removed from the chamber and the pellet implanted before the animal awakens. 

Pellets are implanted with a 10 gauge trochar, which is a stainless steel precision tool 
with a regular medical point needle and rounded stylet protruding 1/8” from needle point 
for easy implantation of small pellets up to 3mm in diameter. Trochars will be 
appropriately sterilized by dipping them into a 2% chlorhexidine solution between 
animals and then rinsing the trochar with milli-Q water to remove any of the disinfectant 
residue. The pellets release hormone continuously over a 21 day period. Voles in the low 
dose group will receive a 0.5 mg pellet (daily dose = 0.0238 mg/day), and the high dose 
group will receive a 1.5 mg pellet (daily dose = 0.0714 mg/day). Control groups will 
receive a placebo pellet. Birds in the low dose group will receive a 1.0 mg pellet, the 
high dose group will receive a 2.0 mg pellet, and the control group a placebo pellet. 

Perchlorate: 

Voles will be given perchlorate dissolved in drinking water at doses of 1.0 mg/kg (low 
dose group) and 10 mg/kg (high dose group). Birds will be given two waxworms or 
mealworms injected with perchlorate at a daily dose of 12.5 (low dose) and 25.0 mg/kg 
bird body weight (high dose). Birds will receive one worm in the morning and one in the 
afternoon. Control birds will receive worms injected with milli-Q water. Dosing will be 
carried out for a total of 6-8 weeks for both voles and birds. 

Justification for Exposure Route: 

The advantages of thyroxine releasing pellets include reduction in animal handling and 
trauma, enhancement of experimental efficiency, and insurance of proper dosing. 

The problem with putting thyroxine in water or food is contamination of food and cage 
surfaces leading to difficult clean-up. Injection or intubation would be too stressful on 
such small animals. 

For voles, perchlorate will be dissolved in the drinking water as this allows for the least 
stressful and easiest type of administration. There is of course individual variation in the 


Page 8 of 11 




Project No. T9700 


perchlorate dose this way, but along with exposure from contaminated food, it is probably 
the approach closest to what happens in the wild. 

Birds will be exposed by being fed perchlorate-injected worms. This route provides the 
most precise and accurate method for exposing birds to perchlorate. This method has the 
advantage of no handling effects and no spreading of perchlorate around the cage area. 

Exposure Verification: 

Each dosing solution will be verified for ammonium perchlorate concentration by ion 
chromatography (TIEHH SOP GW-02-03). 

15.5 Animal Sacrifice and Sample Collections 

Animals will be weighed and anesthetized in a saturated carbon dioxide chamber. Blood 
samples will then be collected from each vole (TIEHH SOP ET 03-19) and bird 
(TIEHH SOP IN 3-08-01), placed into heparinized microcentrifuge tubes, and 

centrifuged until plasma has been separated. Plasma will then be 

transferred to labeled tubes and frozen until analysis. All animals will then be euthanized 
(TIEHH SOP AF-01-03) and necropsied (TIEHH SOP IN-03-01). All animals will 
be monitored until respiration and cardiac function has ceased. Tissue samples collected 
(e.g. liver, kidney, etc.) will be frozen and may be used for residue analysis. Thyroids will 
be collected, digested, and processed for the collection of thyroid hormones. 

15.6 Endpoint Analysis 

The main study endpoint is to determine if perchlorate-related reductions in 
thyroid hormones elicit changes in metabolic rate in animals. Study endpoints consistent 
with behavioral effects include general ability of animals to deal with cold exposure, adult 
composure, and time of conversion from normal behavior to any noticeable change. 
Biochemical endpoints may include circulating thyroid hormones in animal plasma 
(TIEHH SOP MT-02-02), thyroidal hormone content, and concentrations of perchlorate in 
specific tissues (TIEHH SOP AC-02-15). SOPs for measurement of metabolic rate (RMR 
and summit), thyroidal hormone content, and measurement of internal body temperature 
will be developed after these procedures have been optimized. Other endpoints include 
measurement of oxygen consumption rate, carbon dioxide production, and internal body 
temperature after cold exposure. 


Page 9 of 11 





Project No. T9700 


PROPOSED STATISTICAL METHODS 

Effects of dosage on body mass, tissue mass, tissue-perchlorate concentrations, and 
hormone concentrations will be tested with analysis of variance. Fisher s protected least- 
square difference procedure will be used a posteriori to look at the differences between 
group means. The effect of dosage on oxygen consumption rates and temperature 
regulation over time will be tested with repeated measures analysis of variance. 

REPORT CONTENT/RECORDS TO BE MAINTAINED: 

Records to be maintained include daily food and water consumption data, morphological 
measurements, sample collection logs, analytical data, and hormone analysis data. 


Report content will include presentation of data, interpretation, and discussion of the 
following endpoints: 

- thyroid hormone concentrations 

- metabolic rate measurements 

- plasma and tissue perchlorate concentrations 

- general abilities of animals to deal with cold exposure 

- internal body temperatures after cold exposure 
Interpretation of all data, including statistical results 
Discussion of the relevance of findings 

List of all SOPs used 
List of all personnel 

RECORDS TO BE MAINTAINED / LOCATION: 

A final report will be delivered to the Department of Defense/Strategic Environmental 
Research and Development Program. Copies of all data, documentation, records, 
protocol information, and the specimens shall be sent to the Sponsor, or designated 
delivery point upon request (within six months of study completion). All data, the 
protocol and a copy of the final report shall be maintained by the testing facility. 

QUALITY ASSURANCE: . 

The Quality Assurance Unit will inspect the study at intervals to insure the integrity of the 
study. Written records will be maintained indicating but not limited to the following: 
date of inspection, study inspected, phase inspected, person conducting the inspection, 
findings and problems, recommended and taken action, and any scheduled reinspections. 
Any problems likely to effect study integrity shall be brought to the immediate attention 
of the Study Director. The Quality Assurance Unit will periodically submit written status 
reports on the study to management and the Study Director. 



Project No. T9700 


20. PROTOCOL CHANGES / REVISIONS: 

All changes and/or revisions to the protocol, and the reasons therefore, shall be 
documented, signed and dated by the Study Director and maintained with the protocol 
and the Quality Assurance Unit. 


21. REFERENCES: 

Banta, M.R. and D.W. Holcombe. 2002. The effects of thyroxine on metabolism and 
water balance in a desert-dwelling rodent, Mariam’s kangaroo rat (Dipodomys 
Merriami). Journal of Comparative Physiology Part A. 185:463-470. 

Burger, M.F. and Robert J. Denver. 2002. Plasma Thyroid Hormone Concentrations in a 
Wintering Passerine Bird: Their relationship to Geographic Variation, 

Environmental Factors, Metabolic Rates, and Body Fat. Physiological 
and Biochemical Zoology. 75(2): 187-199. 

McNabb, F.M.A. 2000. Thyroids. In Sturkie’s Avian Physiology, 5 th ed. Editor G. 
Causey Whittow. Pg. 461-471. 

Siglin JC, Matie DR, Dodd DE, Hildebrandt PK, Baker WH. 2000. A 90-day drinking 
water study in rats of the environmental contaminant ammonium 
Perchlorate. Toxicological Sciences. 57: 61-74 

Smith, P.N., Theodorakis, C.W., Anderson, T.A., and Kendall, R.J. 2001. Preliminary 
Assessment of Perchlorate in Ecological Receptors at the Longhorn Army 
Ammunition Plant (LHAAP), Kamack, TX. Ecotoxicology, 10: 305-313. 

U.S. EPA. 2002. Perchlorate Environmental Contamination: Toxicological Review 
and Risk Characterization. 

Wunder BA, Dobkin DS, Gettinger RD. 1977. Shifts of thermogenesis in the prairie 
vole (Microtus ochrogaster), strategies for survival in a seasonal environment 
Oecologia 29: 11-26. 


Page 11 of 11 



Form No. 014 Rev. 3.06/00 

Project No. rTTloo _ 

* Change No: __ 

Page: _j_ of_3 _ 

Change In Study 
Documentation Form 

The following documents changes in the above referenced study: 

Check One: __x_ Amendment _Deviation __Addendums 


TEEHH 
Box 41163 

Lubbock, TX 79409-1163 
(806)885-4567 
qa@tiehh.ttu.edu 


Document Reference Information 

Check One: x Protocol _SOP _Other 

Title. Perchlorate-Induced Alterations in Metabolic Rate and Thermoregulation in Small 
Mammals and Birds 
Dated: 1/27/04 

Document # (if appropriate): MRT-03-01 
Page #(s): 6-10 
Section #: 15.0 
Text to reference: 

1. “Tests will be conducted between 0800 and 2200 hours.” 

2. “Animals will then be placed in a cylindrical respirometry chamber.” “The chamber is 
made of borosilicate glass with each end consisting of a plastic end cap, one with a built- 
in electric fan, the other with a small hole for the insertion of a temperature probe.” 

3. “Air will be passing through each chamber at a rate of approximately 250-1000 ml/min 
during this period as well as the test period.” 

4. “Testing will commence by collecting carbon dioxide and oxygen measurements at 20 
minute intervals per channel, with a reference channel measurement between each sample 
measurement.” 

5. “Total run time (high estimate) = 60 minutes acclimatization + (20 minutes per channel 
x 6 samples per round) = 180 minutes.” 

6. “Tests with be performed between 0800 and 2200 hours.” 

7- Lighting conditions will be kept constant throughout the study, and the major 
procedures will be conducted as stated previously, with the exception of a few minor 
adjustments.” 


Change in Document: 

1. “Tests will be conducted between 0730 and 1700 hours for voles and 2030 and 0630 
for sparrows.” 

2. “Voles will be placed into a modified plastic rodent cage with a volume of 
approximately 2.3 liters, and birds will be placed into 2.89 liter paint cans that have been 
modified into respirometry chambers.” 

3. “Air will be passing through each chamber at a rate of approximately 850-1000 ml/min 
during this period, as well as the test period.” 


* Sequentially numbered in order of the date that the change is effective 



TIEHH 
Box 41163 

Lubbock, TX 79409-1163 
(806)885-4567 
qa@tiehh.ttu.edu 

Change In Study 

__ Documentation Form 

4. “Testing will commence by collecting carbon dioxide and oxygen measurements at 15 
minute intervals per channel, with a reference channel measurement between each sample 
measurement.” 

5. “For voles, total run time (high estimate) = 60 minutes acclimatization + (15 minutes 
per channel x 6 samples per round x 5 rounds) = 510 minutes. For birds, total run time 
will be a maximum of 10 hours.” 

6. “Tests will be performed at times previously stated.” 

7. “Voles will be placed into a borosilicate glass chamber with each end consisting of a 
plastic end cap, one with a built-in electrical fan, the other with a small hole for the 
insertion of a temperature probe. Birds will be placed in the same chambers used for 
resting metabolic rate experiments. Each animal will be tested for a maximum of 60 
minutes at a time.” 

Section #: 15.2 

Text to reference: 

8. “A L-thyroxine hormone releasing pellet (1.5 mm diameter) will be subcutaneously 
implanted into the lateral side of the neck (between ear and shoulder, or ear and base of 
neck) in each animal involved in the positive control dosing experiment for both birds 
and rodents.” 

9. “Birds in the low dose group will receive a 1.0 mg pellet; the high dose group will 
receive a 2.0 mg pellet, and the control group a placebo pellet.” 

10. “Birds will be given two waxworms or mealworms injected with perchlorate at a 
daily dose of 12.5 (low dose) and 25.0 mg/kg bird body weight (high dose). Birds will 
receive one worm in the morning and one in the afternoon. Control birds will receive 
worms injected with milli-Q water.” 

Change in Document: 

8. “A L-thyroxine hormone releasing pellet (1.5 mm diameter) will be subcutaneously 
implanted into the lateral side of the neck (between ear and shoulder, or ear and base of 
neck) in each vole involved in the positive control dosing experiment.” 

9. Procedure no longer in use. 

10. “Birds will be dosed with perchlorate in the drinking water at a daily dose of 12.5 
(low dose) and 25.0 mg/kg bird body weight (high dose). A 200 uL (Gilson Pipetman) 
pipette will be used to dose birds with 100 uL of the appropriate dosing solution. The 
birds will be orally dosed by placing the solutions on the side of the bill and allowing for 
ingestion. Control voles and sparrows will receive milli-Q water.” 


Form No. 014 Rev. 3.06/00 
Project No.: ~T Tloo 

* Change No:_ 

Page: 3. of 3 


* Sequentially numbered in order of the date that the change is effective 


< 




TffiHH 
Box 41163 

Lubbock, TX 79409-1163 
(806)885-4567 
qa@tiehh.ttu.edu 


Form No. 014 Rev. 3.06/00 
Project No.: 

*Change No:_ 

Page: 3 of 3 


Change In Study 
Documentation Form 


Section #: 15.3 
Text to reference: 

11. “Birds will be exposed by being fed perchlorate-injected worms. This route provides 
the most precise and accurate method for exposing birds to perchlorate. This method has 
the advantage of no handling effects and no spreading of perchlorate around the cage 
area.” 


Change in Document: 

11. “Dosing birds by the previously stated method is the most precise way to orally dose 
a bird without over-stressing it. Each bird is handled for less than 30 seconds, and the 
proposed dosing is less stressful than gavage.” 

Section #: 17 

Text to reference: 

12. “- thyroid hormone concentrations” 

13. “- plasma and tissue perchlorate concentrations” 


Change in Document: 

12. “- thyroid hormone concentrations (plasma and thyroid)” 

13. “- tissue perchlorate concentrations” 


Justification and Impact on Study: 

The proposed changes in the study are necessary as several methods needed improvement 
or added steps, as the original methods stated in the first draft of the study protocol would 
not suffice. Data collection procedures are now more efficient and provide more precise 
data, and the avian dosing methods have been improved because original methods did not 
work. Birds were not given thyroxine-releasing pellets because implantation procedures 
were too dangerous on such a small bird. Other methods of dissolving the thyroxine free 
acid proved to be ineffective as the solvent affected the bird metabolic rate as well. 


Submitted by: Signature: 


Authorized by: Study Director: 



Date: o\ 


Jso/ o\ 


Received by: Quality Assurance Unit: 


Date: '/&>/& Z 
Date: 1 1 3o/5 V 


* Sequentially numbered in order of the date that the change is effective 


Form No. 014 Rev. 3.06/00 

Project No.:_ 

* Change No:_ 

Page:_of_ 


Change In Study 
Documentation Form 

The following documents changes in the above referenced study: 


Check One: x Amendment _Deviation _Addendums 



Document Reference Information 

Check One: x Protocol _SOP _Other_ 

Title: Perchlorate -Induced Alterations in Metabolic Rate and Thermoregulation in Small 

Mammals and Birds 

Dated: 08 October 2003 

Document # (if appropriate): MRT -3-01 

Page #(s): page 8 of 11 

Section#: 15.2 

Text to reference: Birds will be given two waxworms or mealworms injected with 
perchlorate at a daily dose of 12.5 (low dose) and 25.0 mg/kg bird body weight (high 
dose). Birds will receive one worm in the morning and one in the afternoon. Control 
birds will receive worms injected with milli-Q water. 


TIEHH 
Box 41163 

Lubbock, TX 79409-1163 
(806) 885-4567 
qa@tiehh.ttu.edu 


Change in Document: Birds will be given an oral dose of ammonium perchlorate 
water_at 12.5 and 25.0 mg/kg bird body weight. Liquid will be administered with a 
pipette and placed on the edge of the lower mandible, thus allowing the bird to drink the 
dosing solution. Birds will be dosed twice daily, once in the morning and once in the 
afternoon. Control birds will receive milli-Q water. 


Justification and Impact on Study: After initial experiments, we discovered that birds 
may stop eating mealworms after several days of dosing. This presents problems with 
the dosing regimen; therefore the best alternative is to dose the birds using the pipette 
method described above. 



* Sequentially numbered in order of the date that the change is effective 

















Final Report 

U.S. Air Force Coop. Agreement CU1235 


TIEHH Project No. T9700 
Aquatic toxicology Phase V 


A FINAL REPORT 
ENTITLED 


mar 2004 


Uptake of Perchlorate in Invertebrates 


STUDY NUMBER: INV-03-01 


SPONSOR: Strategic Environmental and Research Development Program 

SERDP Program Office 

901 North Stuart Street, Suite 303 

Arlington, VA 22203 


TESTING FACILITY 
Name/Address: 

The Institute of Environmental and Human Health 
Texas Tech University/TTU Health Sciences Center 
Box 41163 

Lubbock, Texas 79409-41163 


Test Facility Management: Dr. Ronald Kendall 
Study Director: Dr. Christopher Theodorakis 


RESEARCH INITIATION: 02/28/2003 

RESEARCH COMPLETION: 12/31/2003 


Page 1 of 11 


Final Report 

U.S. Air Force Coop. Agreement CU1235 


TIEHH Project No. T9700 
Aquatic toxicology Phase V 


Table of Contents 

List of Tables and Figures.3 

Good Laboratory Practices Statement.4 

Quality Assurance Statement.5 

1. Descriptive Study Title.6 

2. Study Number.6 

3. Sponsor. 6 

4. Testing Facility Name and Address.6 

5. Proposed Experimental Start and Termination Dates.6 

6. Key Personnel. 6 

7. Study Summary.6 

8. Study Obj ective/Purpose.6 

9. Test Materials.7 

10. Justification of Test S ystem.7 

11. Test Animals.7 

12. Procedure for Identifying the Test System.8 

13. Experimental Design Including Bias Control.8 

14. Methods.8 

15. Statistical Methods.10 

16. Results. 10 

17. Discussion.10 

18. Study Records and Archive.11 

19. References.11 

20. Appendices.11 


Page 2 of 11 




























TIEHH Project No. T9700 
Aquatic toxicology Phase V 


Final Report 

U.S. Air Force Coop. Agreement CU1235 

List of Tables and Figures 

Figure 1. .Perchlorate concentrations in ramshom snails and blackworms after 1-5 days of 
exposure. 


10 


Page 3 of 11 




Final Report 

U.S. Air Force Coop. Agreement CU1235 

GOOD LABORATORIES PRACTICES STATEMENT 


TIEHH Project No. T9700 
Aquatic toxicology Phase V 


Project AQUA 03-01, entitled " Perchlorate in Invertebrates, Periphyton, and Detritus at the Naval 
Weapons Industrial Reserve Plant, McLennan County, Texas", was performed whenever possible in 
the spirit of the Good Laboratory Practices as outlined in 40 CFR Part 160, August 19, 1989 


Submitted By: 



Page 4 of 11 



Final Report 

U.S. Air Force Coop. Agreement CU1235 

QUALITY ASSURANCE STATEMENT 

This study was conducted under the Institute of Environmental and Human Health’s Quality 
Assurance Program and whenever possible to meet the spirit of the Good Laboratory Practices as 
outlined in 40 CFR Part 160, August 19, 1989. 


TIEHH Project No. T9700 
Aquatic toxicology Phase V 



Date ' 


Page 5 of 11 


Final Report TIEHH Project No. T9700 

U.S. Air Force Coop. Agreement CU1235 Aquatic toxicology Phase V 

1. DESCRIPTIVE STUDY TITLE: Uptake of Perchlorate in Invertebrates 

2. STUDY NUMBER: INV-03-01 

3. SPONSOR: 

Strategic Environmental and Research Development Program 

SERDP Program Office 

901 North Stuart Street, Suite 303 

Arlington, VA 22203 

4. TESTING FACILITY NAME & ADDRESS: 

The Institute of Environmental and Human Health 
Texas Tech University 
Box 41163 

Lubbock, Texas 79409-41163 


5. PROPOSED EXPERIMENTAL START & TERMINATION DATES: 

Start Date: (date of chemical application) June 25, 2003 

Termination Date: (date of last data collected) December 31, 2003 

6. KEY PERSONNEL: 

Christopher Theodorakis, Study Director 
Ronald Kendall, Testing Facility Management 
Todd Anderson, Analytical Chemist 
Ryan Bounds, Quality Assurance Manager 

7. STUDY SUMMARY: 

Ramshom snails (Heliosoma spp.) and blackworms (Lumbriculus variegatus) were 
exposed to 100 mg/L sodium perchlorate for 1-5 days. Perchlorate concentrations were 
then determined in both of these species after various periods of time. The snails reached 
steady state concentrations within 1 day, and the bioconcentration factor was 0.26. In 
contrast, blackworms reached steady state by 3 days, and the bioconcentration factor was 
0.84. However, the steady state concentration for blackworms was not significantly 
different from 100 mg/L (the water concentration), so the bioconcentration factor may 
indeed be 1.0 for this species. These data indicate that fish that feed upon snails may not 
be exposed to as much perchlorate from food as do fish that feed on L variegatus. 

8. STUDY OBJECTIVES / PURPOSE: 

To determine kinetics of uptake of perchlorate in invertebrate species. 


Page 6 of 11 





Final Report TIEHH Project No. T9700 

U.S. Air Force Coop. Agreement CU1235 Aquatic toxicology Phase V 

9. TEST MATERIALS: 

Test Chemical name: Sodium perchlorate 
CAS number: 7601-89-0 

Characterization: determination of strength, purity, stability, homogeneity, etc 
Source: Aldrich Chemical Company 

Reference Chemical name: 

ultrapure water with added sea salts (“Instant Ocean®” or any other brand of sea salts with 
identical or nearly identical composition). 

CAS Number: Not applicable 

Characterization: determination of strength, purity, stability, homogeneity, etc 
Source: City tap water that has been run through reverse osmosis and a de-ionizer to 
convert it to ultrapure water. 60 mg/L salts were added. 

10. JUSTIFICATION OF TEST SYSTEM: 

Ionic perchlorate alters thyroid homeostasis in worms, snails, and amphibians as well as 
other vertebrates (Miranda et al., 1996; Manzon and Youson, 1997). Comparative 
analysis of perchlorate accumulation in fish and water from field-collected specimens 
indicates that perchlorate levels may be higher in fish than in water, but laboratory 
analysis indicates that perchlorate does not bioconcentrate in fish. This suggests that 
worms and snails in the field are being exposed by some route other than direct 
absorption from the water. Possibly fish are being exposed through the food chain. In 
addition, many fish in stream habitats, especially the ones that have been analyzed so far, 
feed on aquatic invertebrates. Uptake and possible accumulation from the water has not 
yet been addressed in invertebrates. 

11. TEST ANIMALS (Where applicable provide number, body weight range, sex, source of 
supply, species, strain, substrain, and age of test system): 

Species: Blackworms (Lumbriculus Variegatus), ramshom snails {Heliosoma spp .) 
Strain: Feral organisms or bred in hatcheries 
Age: Adults. 

Number: Approximately 100 grams, wet weight, of each species 

Source: Purchased from hatcheries, Carolina Biological Supply or other commercial 
suppliers 


Page 7 of 11 


Final Report TIEHH Project No. T9700 

U.S. Air Force Coop. Agreement CU1235 Aquatic toxicology Phase V 

12. PROCEDURE FOR IDENTIFYING THE TEST SYSTEM: 

The test system consisted of laboratory exposures constructed according to the 
experimental design described below. Beakers or glass jars were labeled with the project 
number, test system, date of collection, concentration, and person responsible. 

13. EXPERIMENTAL DESIGN INCLUDING BIAS CONTROL: 

Worms and snails were exposed to 100 ppm sodium perchlorate in precleaned beakers. 
Beakers were cleaned by washing each aquarium according to SOP AQ-1-02 “Cleaning 
Glassware and Beakers for Perchlorate Assays”. For exposures, beakers were located on 
shelves capable of supporting such weight. The experimental design consisted of a 
randomized block design, with each shelf constituting a block. The arrangement of the 
beakers within each block was randomized in order to avoid effects due to gradients in 
light, temperature, volatile chemicals in the laboratory, etc. Determination of the 
arrangement of the beakers within each block was determined by a random number 
generator, random number table or by rolling dice. Each block contained at least 1 
container of each treatment. Worms and snails were placed in the beakers in random 
order, within blocks, using the procedure described below. Worms and snails were 
exposed in separate beakers. 

14. METHODS: 

14.1 Test System acquisition, quarantine, acclimation 

Worms and snails were obtained from commercial vendors. Upon arrival to the lab, they 
were acclimated in clean aquarium water for 2 days. Clean water consisted of reverse 
osmosis (RO) water supplemented with 60 mg/L Instant Ocean sea salts or other brands 
of identical composition. Once acclimated, worms and snails were exposed to sodium 
perchlorate dissolved in water. One hundred percent water changes were carried out 
every other day by pouring the water out and adding fresh clean water. 

14.2 Test Material Application 

Exposures began after worms and snails were acclimatized. Worms and snails were 
placed into beakers or beakers containing 100 ppm sodium perchlorate, with 
approximately 5 g of worms or snails per aquarium and 5 replicate beakers per treatment. 
A stock solution of 100 g/L perchlorate in reconstituted fresh water was used to dose the 
worms and snails. The beakers were filled with 1.5 L water, and 1.5 ml of stock solution 
were added according to the desired concentration of the aquarium water. Every other 
day, debris 100% of the water were replaced in each tank with undosed water (as 
described in 15.1), and perchlorate stock solution were added to maintain the desired 
concentration. 


Page 8 of 11 








Final Report TIEHH Project No. T9700 

U.S. Air Force Coop. Agreement CU1235 Aquatic toxicology Phase V 

Rates/concentrations: Worms and snails were exposed to 100 ppm perchlorate in water. 

Frequency: Five replicate beakers of each concentration for each species were 
continually exposed for 1, 2, 3,4 (snails only) and 5 days. 

Route/Method of Application: Route was via dermal, oral and respiratory exposure as 
the chemical were in the beaker/beakers water. 

Stock solutions for the study were mixed in precleaned glass beakers as indicated in SOP 
AQ-1-02. Stock solutions were made by dissolving sodium perchlorate in reconstituted 
fresh water (60 mg/L Instant Ocean® sea salts or equivalent, in ultrapure water, pH 
adjusted to 7.4 with IN HC1 or IN NaOH, as appropriate). The appropriate amount of 
sodium perchlorate compound were weighed on a calibrated balance, and mixed into 
reconstituted fresh water. The pH were checked on a calibrated pH meter (calibrate 
according to SOP IN-4-06) and adjusted, if necessary, as above. 

Justification for Exposure Route: Exposure by environmental waters is most 
appropriate because worms and snails respire, ingest, and are dermally exposed to 
chemicals in the waters in which they live. 

14.3 Test System Observation 

Beakers were observed on a daily basis. The number of individuals that expire each day 
were recorded for each perchlorate concentration. In addition, pH, dissolved oxygen, 
conductivity, temperature, and any other water chemistry parameters deemed appropriate 
by the project manager were determined at least 3 times per week. 

14.4 Animal Sacrifice and Sample Collections 

Invertebrates were killed by immersion in 100% ethanol until dead. Individuals used for 
perchlorate analysis were air-dried for at least 3 days and stored in plastic storage bags. 
Perchlorate concentration in tissues were extracted according to SOP AC-2-15 
“Extraction and Cleanup of Tissue Samples to be Analyzed for Perchlorate”. Animals 
were pooled to obtain sufficient tissue for analysis (a minimum of approximately 5 g for 
perchlorate). 

Labeling: samples were labeled with a unique ID number according to the following 
scheme: 

Species (2 letter abbreviation) - trial number - exposure duration (days)- sample number. 
Species abbreviations will by HS for ramskom snails ( Heliosoma ) and LV for 
blackworms 


Page 9 of 11 


Final Report TIEHH Project No. T9700 

U.S. Air Force Coop. Agreement CU1235 Aquatic toxicology Phase V 

E.g., LV-1 -2-3 blackworm sample #3,2-day exposure, trial # 1. 

14.5 Endpoint analysis 

Perchlorate in tissues was extracted according to SOP AC-2-15 “Extraction and Cleanup 
of Tissue Samples to be Analyzed for Perchlorate”. Analysis and quantification of 
perchlorate in aquarium water or extracted from tissues was according to SOP AC-2-11 
“Analysis of Perchlorate by IC”. 

15 STATISTICAL METHODS 

All data were checked for normality using the Shapiro-Wilk W test. Homogeneity of 
variances wad checked using Bartlett’s or Lavine’s test. Comparisons between treatments 
was accomplished by Analysis of Variance (ANOVA) for multiple mean comparisons. 

16 RESULTS 

The body burdens of the snails were not statistically different between days (Fig. 1). 

These data indicate that the snails reached steady state concentrations within 1 day, and 
the bioconcentration factor was 0.26. In contrast, blackworms reached steady state by 3 
days, and the bioconcentration factor was 0.84. However, the steady state concentration 
for blackworms was not significantly different from 100 mg/L (the water concentration; p 
> 0.05, Student’s t-test), so the bioconcentration factor may indeed be 1.0 for this species. 


c 



Day 1 Day 2 Day 3 Day 4 Day 5 


Exposure duration 

Figure 1 - Perchlorate concentrations in ramshom snails and blackworms after 1-5 days of 
exposure. 

17 DISCUSSION 

The results reported herein indicate that perchlorate can be taken up by invertebrates from the 
water, but, contrary to field studies, perchlorate steady state concentrations were less than that 


Page 10 of 11 



Final Report TIEHH Project No. T9700 

U.S. Air Force Coop. Agreement CU1235 Aquatic toxicology Phase V 

found in the water. Thus, these data provide no additional insight as to the findings that 
concentrations of perchlorate in fish or their invertebrate prey are often greater than 
concentrations found in the water in field situations (e.g., Smith et al. 2001). The alternative 
hypothesis to explain these findings is that 1) perchlorate water concentrations in contaminated 
streams are hig hl y variable, and may consist of pulses of higher concentrations followed by 
periods of low or no perchlorate release into the water and 2) the elimination of perchlorate from 
biological tissues lags behind the rate of clearance of perchlorate from the water column, so that 
perchlorate may be found in biological tissues after it has decreased to non-detectable levels in 
the water. 

These data also indicate that there may be species-specific differences as to the rate of uptake and 
steady state bioconcentration factors. In snails, steady-state is reached fairly rapidly and the 
steady-state concentrations in the tissues are about !4 that in the water. In the worms, on the 
other hand, steady state is reached after 3 days, and the steady-state concentrations are about 4 
times higher than in snails. This may result in greater food-chain exposures to fish that feed on 
benthic worms than those that feed on snails. 

18 STUDY RECORDS AND ARCHIVE: 

Study Records will be maintained at The Institute of Environmental and Human Health 
(TIEHH) Archive for a minimum of one year after study completion date. 


19 REFERENCES: 

Smith, N.S., Theodorakis, C.W., Anderson, T.A., and Kendall, R.J., 2001. Preliminary 
assessment of pechlorate in ecological receptors at the Longhorn Army Ammunition 
Plant (LHAAP), Kamack, Texas. Ecotoxicology 10: 305-313. 

20 APPENDICES: 

Study Protocol 

Changes to Study Documentation 


Page 11 of 11 






Project No. T9700 


A STUDY PROTOCOL 
ENTITLED 


Uptake of Perchlorate in Invertebrates 


STUDY NUMBER: INV-03-01 

SPONSOR: Strategic Environmental and Research Development Program 

SERDP Program Office 

901 North Stuart Street, Suite 303 

Arlington, VA 22203 


TESTING FACILITY 
Name/Address: 

The Institute of Environmental and Human Health 
Texas Tech University/TTU Health Sciences Center 
Box 41163 

Lubbock, Texas 79409-41163 


Test Facility Management: Dr. Ronald Kendall 
Study Director: Dr. Christopher Theodorakis 


PROPOSED EXPERIMENTAL 
START DATE: June 25,2003 


Page 1 of 8 





Project No. T9700 


DESCRIPTIVE STUDY TITLE: Uptake of Perchlorate in Invertebrates 

STUDY NUMBER: INV-03-01 

SPONSOR: 

Strategic Environmental and Research Development Program 

SERDP Program Office 

901 North Stuart Street, Suite 303 

Arlington, VA 22203 

TESTING FACILITY NAME & ADDRESS: 

The Institute of Environmental and Human Health 
Texas Tech University 
Box 41163 

Lubbock, Texas 79409-41163 


PROPOSED EXPERIMENTAL START & TERMINATION DATES: 

Start Date: (date of chemical application) June 25,2003 

Termination Date: (date of last data collected) December 31, 2003 

KEY PERSONNEL: 

Christopher Theodorakis, Study Director 
Ronald Kendall, Testing Facility Management 
Todd Anderson, Analytical Chemist 
Ryan Bounds, Quality Assurance Manager 





Dr. Christopher Theodorakis 
Study Director 

Dr. Ronald Kendall 
Testing Facility Management 




Mr. Ryan Bounds 
Quality Assurance Manager 


6 "o?3'C?3 Dr. Todd Anderson 
Analytical Chemist 


Page 2 of 8 



Project No. T9700 


8. REGULATORY COMPLIANCE STATEMENT: 

Quality Control and Quality Assurance 

This study will be conducted in accordance with established Quality Assurance 
program guidelines and in compliance, where appropriate and possible, with Good 
Laboratory Practice Standards (40 CFR Part 160, August 17, 1989). 

Document Control Statement 

This document is considered proprietary to and the Sponsor. Do not copy, quote 
or distribute. For access to this document or authority to release or distribute, 
please write to: 

Dr. Ronald Kendall 

The Institute of Environmental and Human Health 
Texas Tech University 
PO Box 41163 

Lubbock, Texas 79409-211163 

9. STUDY OBJECTIVES / PURPOSE: 

To determine kinetics of uptake of perchlorate in invertebrate species. 

10. TEST MATERIALS: 

Test Chemical name: Sodium perchlorate 
CAS number: 7601-89-0 

Characterization: determination of strength, purity, stability, homogeneity, etc 
Source: Aldrich Chemical Company 

Reference Chemical name: 

ultrapure water with added sea salts (“Instant Ocean®” or any other brand of sea salts with 
identical or nearly identical composition). 

CAS Number: Not applicable 

Characterization: determination of strength, purity, stability, homogeneity, etc 
Source: City tap water that has been run through reverse osmosis and a de-ionizer to 
convert it to ultrapure water. 60 mg/L salts will be added. 

11. JUSTIFICATION OF TEST SYSTEM: 

Ionic perchlorate alters thyroid homeostasis in worms, snails, and amphibians as well as 
other vertebrates (Miranda et al., 1996; Manzon and Youson, 1997). Comparative 
analysis of perchlorate accumulation in fish and water from field-collected specimens 
indicates that perchlorate levels may be higher in fish than in water, but laboratory 
analysis indicates that perchlorate does not bioconcentrate in fish. This suggests that 


Page 3 of 8 



Project No. T9700 


worms and snails in the field are being exposed by some route other than direct 
absorption from the water. Possibly fish are being exposed through the food chain. In 
addition, many fish in stream habitats, especially the ones that have been analyzed so far, 
feed on aquatic invertebrates. Uptake and possible accumulation from the water has not 
yet been addressed in invertebrates. 


12. TEST ANIMALS (Where applicable provide number, body weight range, sex, source of 
supply, species, strain, substrain, and age of test system): 

Species: Blackworms (Lumbriculm Variegatus), ramshom snails ( Planorbis spp.) 
Strain: Feral organisms or bred in hatcheries 
Age: Adults. 

Number: Approximately 100 grams, wet weight, of each species 

Source: Purchased from hatcheries, Carolina Biological Supply or other commercial 
suppliers 

13. PROCEDURE FOR IDENTIFYING THE TEST SYSTEM: 

The test system will consist of laboratory exposures constructed according to the 
experimental design described below. Beakers or glass jars will be labeled with the 
project number, test system, date of collection, concentration, and person responsible. 

14. EXPERIMENTAL DESIGN INCLUDING BIAS CONTROL: 

Worms and snails will be exposed to 100 ppm sodium perchlorate in precleaned beakers 
or mason jars (“containers”). Containers will be cleaned by washing each aquarium 
according to SOP AQ-1-02 “Cleaning Glassware and Containers for Perchlorate Assays”. 
For exposures, containers will be located on shelves capable of supporting such weight. 
The experimental design will consist of a randomized block design, with each shelf 
constituting a block. The arrangement of the containers within each block will be 
randomized in order to avoid effects due to gradients in light, temperature, volatile 
chemicals in the laboratory, etc. Determination of the arrangement of the containers 
within each block by a random number generator, random number table or by rolling 
dice. Each block will contain at least 1 container of each treatment. Worms and snails 
will be placed in the containers in random order, within blocks, using the procedure 
described below. Worms and snails will be exposed in separate containers. 


Page 4 of 8 



Project No. T9700 


15. METHODS: 

15.1 Test System acquisition, quarantine, acclimation 

Worms and snails will be obtained from commercial vendors. Upon arrival to the lab, 
they will be acclimated in clean aquarium water for 2 days. Clean water will consist of 
reverse osmosis (RO) water supplemented with 60 mg/L Instant Ocean sea salts or other 
brands of identical composition. Once acclimated, worms and snails will be exposed to 
sodium perchlorate dissolved in water. One hundred percent water changes will be 
carried out every other day by pouring the water out and adding fresh clean water. 

15.2 Test Condition Establishment 

Exposures will begin after worms and snails have become acclimatized. 

15.3 Test Material Application 

Worms and snails will be placed into beakers or containers containing 100 ppm sodium 
perchlorate, with approximately 5 g of worms or snails per aquarium and 5 replicate 
containers per treatment. A stock solution of 100 g/L perchlorate in reconstituted fresh 
water will be used to dose the worms and snails. The containers will be filled with 1.5 L 
water, and 1.5 ml of stock solution will be added according to the desired concentration 
of the aquarium water. Every other day, debris 100% of the water will be replaced in 
each tank with undosed water (as described in 15.1), and perchlorate stock solution will 
be added to maintain the desired concentration. 


Rates/concentrations: Worms and snails will be exposed to 100 ppm perchlorate in 
water. 

Frequency: Five replicate tanks of each concentration will be continually exposed for 1, 
2, 5, and 10 days. 

Route/Method of Application: Route will be via dermal, oral and respiratory exposure 
as the chemical will be in the beaker/containers water. 

Stock solutions for study will be mixed in precleaned glass containers as indicated in SOP 
AQ-1-02. Stock solutions will be made by dissolving sodium perchlorate in reconstituted 
fresh water (60 mg/L Instant Ocean® sea salts or equivalent, in ultrapure water, pH 
adjusted to 7.4 with IN HCI or IN NaOH, as appropriate). The appropriate amount of 
sodium perchlorate compound will be weighed on a calibrated balance, and mixed into 
reconstituted fresh water. The pH will be checked on a calibrated pH meter (calibrate 
according to SOP IN-4-06) and adjusted, if necessary, as above. 


Page 5 of 8 



Project No. T9700 


Justification for Exposure Route: Exposure by environmental waters is most 
appropriate because worms and snails respire, ingest, and are dermally exposed to 
chemicals in the waters in which they live. 

Exposure Verification: A sample of each concentration of treated water will be collected 
whenever animals are removed from the aquarium for analysis. The concentration of 
perchlorate in the water will be tested using ion chromatography. 

15.4 Test System Observation 

Containers will be observed on a daily basis. The number of individuals that expire each 
day will be recorded for each perchlorate concentration. In addition, pH, dissolved 
oxygen, conductivity, temperature, and any other water chemistry parameters deemed 
appropriate by the project manager will be determined at least 3 times per week. 

15.5 Animal Sacrifice and Sample Collections 

Invertebrates will be killed by immersion in 100% ethanol until dead. Individuals 
used for perchlorate analysis will be wrapped in aluminum foil or placed in cryogenic 
tubes suitable for liquid-phase liquid nitrogen and will be frozen by immersion in liquid 
nitrogen. Alternatively, dead animals may be air-dried for at least 3 days and stored in 
plastic storage bags. Perchlorate concentration in tissues will be extracted according to 
SOP AC-2-15 “Extraction and Cleanup of Tissue Samples to be Analyzed for 
Perchlorate”. Animals may be pooled to obtain sufficient tissue for analysis (a minimum 
of approximately 5 g for perchlorate). 


Labeling: samples will be labeled with a unique ID number according to the following 
scheme: 

LP (laboratory perchlorate exposure) — species (2 letter abbreviation) - sample number. 
Species abbreviations will by SN for ramshom snails and BW for blackworms 

E.g., LP- SN- 0001- is the liver sample from snail sample # 0001. 


Page 6 of 8 





Project No. T9700 


If samples are to be divided into subsamples, then a suffix is attached. E.g., if the liver 
sample above is divided into 3 subsamples, these subsamples will be labeled: 

LP-SN-0001.1 

LP-SN-0001.2 

LP-SN-0001.3 

If samples are to be composited, then the prefix will be LPC. (e.g., LPC-BW-001 is worm 
composite # 1). The number of individual samples (snails only) and weight of 
individuals comprising the composite should be indicated on the dissection/tissue 
collection form and/or in a bound laboratory notebook. 

Minimum information to be included on the label is project number and unique ID (SOP 
IN-03-02 Sample Labeling/Logging Procedure). Additional information can include 
species, date collected and sex (if known), in decreasing order of importance. The 
number of days for which each sample was exposed to perchlorate will also be included 
on the form on in the laboratory notebook. 

15.6 Endpoint Analysis 

Perchlorate concentration in tissues will be extracted according to SOP AC-2-15 
“Extraction and Cleanup of Tissue Samples to be Analyzed for Perchlorate”. Analysis 
and quantification of perchlorate in aquarium water or extracted from tissues will be 
according to SOP AC-2-11 “Analysis of Perchlorate by IC”. 

16. PROPOSED STATISTICAL METHODS: 

To statistically determine the differences between treatments in terms of histological 
endpoints, thyroid hormone or perchlorate body concentrations, 2-way ANOVA will be 
used to determine effects of concentration and time of exposure. Correlation and 
regression analysis may also be used to determine the relationship between response 
(body burden, thyroid function) vs. dose or vs. time. 

17. REPORT CONTENT/RECORDS TO BE MAINTAINED: 

Records to be maintained include: Room temperature and water temperature, dissolved 
oxygen, salinity, and pH will be collected. Date, time, and amount of feedings per tank 
will be recorded. Relative tissue distribution in bullhead catworms and snails, relationship 
between perchlorate body burden and exposure concentration, and preliminary data on 
thyroid function and/or histology will be included in the report. 

Report content will include presentation of data, interpretation, and discussion of the 

following endpoints: 


Page 7 of8 



Project No. T9700 


List individual endpoints and analyses: 

Interpretation of all data, including statistical results 
Discussion of the relevance of findings 
List of all SOPs used 
List of all personnel 

18. RECORDS TO BE MAINTAINED / LOCATION: 

The final report will be delivered to the Sponsor on or before March 20,2004. Copies of 
all data, documentation, records, protocol information, as well as the specimens shall be 
sent to the Sponsor, or designated delivery point, upon request. All data, the protocol and 
a copy of the final report shall be archived at the testing facility. 

19. QUALITY ASSURANCE: 

The Quality Assurance Unit will inspect the study at intervals to insure the integrity of the 
study. Written records will be maintained indicating but not limited to the following: 
date of inspection, study inspected, phase inspected, person conducting the inspection, 
findings and problems, recommended and taken action, and any scheduled re-inspections. 
Any problems likely to effect study integrity shall be brought to the immediate attention 
of the Study Director. The Quality Assurance Unit will periodically submit written status 
reports on the study to management and the Study Director. 

20. PROTOCOL CHANGES / REVISIONS: 

All changes and/or revisions to the protocol, and the reasons therefore, shall be 
documented, signed and dated by the Study Director and Test Facility Manager and 
maintained with the protocol and the Quality Assurance Unit. 


21. REFERENCES: 

Manzon RG and Youson JH. 1997. Immunocytochemical and morphometric study of 
TSH, PRL, GH, and ACTH cells in Bufo arenarum larvae with inhibited thyroid 
function. Gen. Comp. Endocrinol. 98: 166-176. 

Miranda, LA, Paz,DA, Dezi, RE and Pisano, A. 1996. Immunocytochemical and 

morphometric study of TSH, PRL, GH, and ACTH cells in Bufo arenarum larvae 
with inhibited thyroid function. Gen. Comp. Endocrinol. 98: 166-176. 


Page 8 of 8 




TIEHH 
Box 41163 

Lubbock, TX 79409-1163 
(806) 885-4567 
qa@tiehh.ttu.edu 


Form No. 014 Rev. 3.06/00 

Project No.:_T9700.11_ 

* Change No:_1_ 

Page:_1_of_1_ 


Change In Study 
Documentation Form 


The following documents changes in the above referenced study: 


Check One: _Amendment x Deviation Addendums 


Document Reference Information 

Check One: x Protocol _SOP _Other_ 

Title:_Perchlorate Uptake in Invertebrates 

Dated:_ 

Document # (if appropriate):_INV 03-01_ 

Page #(s):_5_ 

Section #:_15_ 

Text to reference:_ 

Five replicate tanks of each concentration will be continually exposed for 1,2, 5, and 10 
days _ 


Change in Document:__ 

_- Invertebrates were exposed for 1-5 days, the 10-day exposure was not 

carried out. 


Justification and Impact on Study: 


Preliminary data suggested that steady state was reached in less than 5 days, thus 
the 10- day exposure was deemed unnecessary. This did not significantly impact 
the study. 

£ 


Submitted by: Signature 


Authorized by: Study Director: 



Received by: Quality Assurance Unit: /d* 


Date: 2L(?/ ots 

Date: y 

Date: 5 j l Oc./ 


* Sequentially numbered in order of the date that the change is effective 


TIEHH 
Box 41163 

Lubbock, TX 79409-1163 
(806) 885-4567 
qa@tiehh.ttu.edu 


Form No. 014 Rev. 3.06/00 

Project No.:_T9700.11_ 

*Change No:_2_ 

Page: __1_of 2 


Change In Study 
Documentation Form 


The following documents changes in the above referenced study: 


Check One: _Amendment x_Deviation Addendums 


Document Reference Information 

Check One: _x_Protocol _SOP __Other_ 

Title:_Perchlorate Uptake in Invertebrates 

Dated:____ 

Document # (if appropriate): __INV 03-01_ 

Page #(s):_6 

Section #:_15_ 

Text to reference:_ 

Labeling: samples will be labeled with a unique ID number according to the 
following scheme: 


LP (laboratory perchlorate exposure)- species (2 letter abbreviation)- sample number. 
Species abbreviations will by SN for ramshom snails and BW for blackwoms 


E.g., LP- SN- 0001- is the liver sample from snail sample # 0001. 


Change in Document:__ 

_Labeling: samples were labeled with a unique ID number according to 

the following scheme: 

Species (2 letter abbreviation) - trial number - exposure duration (days)- sample 
number. Species abbreviations will by HS for ramshom snails ( Heliosoma ) and LV 
for blackworms 


E.g., LV-1 -2-3 blackworm sample #3,2-day exposure, trial # 1. 


Justification and Impact on Study:__ 

The labeling system was changed to facilitate identification of samples. 


* Sequentially numbered in order of the date that the change is effective 






















TIEHH 
Box 41163 

Lubbock, TX 79409-1163 
(806) 885-4567 
qa@tiehh.ttu.edu 


Form No. 014 Rev. 3.06/00 

Project No.: _JT9700.11_ 

* Change No: 2 _ 

Page:_1_of 2 


Change In Study 


Submitted by: Signature: 


JPocun^entati^i Form 


Authorized by: Study Director: 


x _Date: 3 / ~2 b/ tf 

_ Date: 3/ 2 - £ /oy 


Received by: Quality Assurance Unit: 




H9ate: 3)/ ^o/ p <7 


* Sequentially numbered in order of the date that the change is effective 





TIEHH 
Box 41163 

Lubbock, TX 79409-1163 
(806) 885-4567 
qa@tiehh.ttu.edu 


Change In Study 
Documentation Form 


Form No. 014 Rev. 3.06/00 

Project No.:_T9700.11_ 

^Change No:_3_ 

Page:_1_of_1_ 


The following documents changes in the above referenced study: 

Check One: _Amendment x Deviation Addendums 


Document Reference Information 

Check One: x Protocol _SOP _Other_ 

Title:_Perchlorate Uptake in Invertebrates 

Dated:_ 

Document # (if appropriate):_INV 03-01_ 

Page #(s):_6_ 

Section #:_15_ 

Text to reference:_ 

“PROPOSED STATISTICAL METHODS: 

To statistically determine the differences between treatments in terms of 
histological endpoints, thyroid hormone or perchlorate body concentrations, 2- 
way ANOVA will be used to determine effects of concentration and time of 
exposure. Correlation and regression analysis may also be used to determine the 
relationship between response (body burden, thyroid function) vs. dose or vs. 
time. “ 


Change in Document:_ 

_All data were checked for normality using the Shapiro-Wilk W test. 

Homogeneity of variances wad checked using Bartlett’s or Lavine’s test. 
Comparisons between treatments was accomplished by Analysis of Variance 
(ANOVA) for multiple mean comparisons. 


Justification and Impact on Study: 


The statistical methodologies listed in the protocol were incorrect and changed to 
reflect correct analyses.This did not significantly impact the study. 


Submitted by: Signature: 


Authorized by: Study Director: 



Received by: Quality Assurance Unit: <_ 


Date: 3/3 7 

Date: ^7 

Date: 7?/j.Q/£ »V 


* Sequentially numbered in order of the date that the change is effective 













TEEHH 
Box 41163 

Lubbock, TX 79409-1163 
(806) 885-4567 
qa@tiehb.ttu.edu 


Form No. 014 Rev. 3.06/00 

Project No.:_T9700.11_ 

^Change No: 4 

Page:_1__ of_1_ 


Change In Study 
Documentation Form 


The following documents changes in the above referenced study: 

Check One: Amendment x Deviation _Addendums 


Document Reference Information 

Check One: x Protocol _SOP _Other_ 

Title:_Perchlorate Uptake in Invertebrates 

Dated:_ 

Document # (if appropriate):_INV 03-01_ 

Page #(s): 7 _ 

Section #:_16_ 

Text to reference:_ 

“PROPOSED STATISTICAL METHODS: 

To statistically determine the differences between treatments in terms of 
histological endpoints, thyroid hormone or perchlorate body concentrations, 2- 
way ANOVA will be used to determine effects of concentration and time of 
exposure. Correlation and regression analysis may also be used to determine the 
relationship between response (body burden, thyroid function) vs. dose or vs. 
time. “ 


Change in Document: __ 

_All data were checked for normality using the Shapiro-Wilk W test. 

Homogeneity of variances wad checked using Bartlett’s or Lavine’s test. 
Comparisons between treatments was accomplished by Analysis of Variance 
(ANOVA) for multiple mean comparisons. 


Justification and Impact on Study: 


The statistical methodologies listed in the protocol were incorrect and changed to 


reflect correct analyses.This did not sigi 

nificantly impact the study. 

....... n> t 

0 F -f# 

j™- • 


Authorized by: Study Director: 


Received by: Quality Assurance Unit: 


Date: ^^6 /oy 
_Date: S_J_£o/o£/ 


* Sequentially numbered in order of the date that the change is effective 







Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
Amphibian Immune Responses Phase V 


Immune Responses to Perchlorate in Native Amphibians 

STUDY NUMBER: SPEA-03-01 


is m 


SPONSOR: Strategic Environmental and Research Development 

Program 

SERDP Program Office 

901 North Stuart Street, Suite 303 

Arlington, VA 22203 

CONTRACT ADMINISTRATOR: The Institute of Environmental and Human Health 

Texas Tech University/TTU Health Sciences Center 
Box 41163 

Lubbock, TX 79409-1163 

TESTING FACILITY: The Institute of Environmental and Human Health 

Texas Tech University 
Box 41163 

Lubbock, TX 79409-1163 

TEST SITE: The Institute of Environmental and Human Health 

Texas Tech University 
Box 41163 

Lubbock, TX 79409-1163 

ANIMAL TEST SITE: Texas Tech University 

Human Sciences Building 
Box 42002 

Lubbock, TX 79409-2002 
RESEARCH INITIATION: July 1 st , 2003 

Feb 29 th , 2004 


RESEARCH COMPLETION: 






Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
Amphibian Immune Responses Phase V 


Table of Contents 

List of Tables and Figures.....3 

Good Laboratory Practice Statement..4 

Quality Assurance Statement.5 

I. 0 Descriptive Study Title.6 

2.0 Study Number.6 

3.0 Sponsor. 6 

4.0 Testing Facility Name and Address.6 

5.0 Proposed Experiment Start and Termination Dates.6 

6.0 Key Personnel.6 

7.0 Study Objectives/Purpose..6 

8.0 Study Summary. 6 

9.0 Test Materials.7 

10.0 Justification of Test System.7 

II. 0 Test Animals.7 

12.0 Procedure for Identifying the Test System.8 

13.0 Experimental Design Including Bias Control.9 

14.0 Methods.9 

15.0 Results.10 

16.0 Discussion. 12 

17.0 References. 14 


2 of 14 





























Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
Amphibian Immune Responses Phase V 


List of Tables and Figures 

Tables Page 

Table 1. Nominal and analytically detected concentrations 10 

of perchlorate in the tadpole exposure media. 

Table 2. Mean (±SEM) values for morphometric and 11 

immunological indices in spadefoot toads exposed to 
different concentrations of sodium perchlorate as tadpoles. 

Table 3. Results of non-parametric analysis of the 12 

morphometric and immunological indices (p< 0.05 
was considered to be significant). 

Figures 

Figure 1. Percent of the final number of tadpoles 11 

present for analysis that had metamorphed by a 
given day. 


3 of 14 





Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
Amphibian Immune Responses Phase V 


GOOD LABORATORIES PRACTICES STATEMENT 

This study was conducted in accordance with established Quality Assurance 
Program guidelines and in the spirit of the Good Laboratory Practice Standards whenever 
possible (40 CFRPart 160, August 17,1989). 

Submitted By: 



4 of 14 



Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
Amphibian Immune Responses Phase V 


QUALITY ASSURANCE STATEMENT 


This study was conducted under The Institute of Environmental and Human Health 
Quality Assurance Program and whenever possible to meet the spirit of the Good Laboratory 
Practices as outlined in 40 CFR Part 160, August 17, 1989. 





5 of 14 





Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
Amphibian Immune Responses Phase V 


1.0 DESCRIPTIVE STUDY TITLE: 

Immunotoxicity, as measured by lymphocyte proliferation, white blood cell 
counts, splenocytes, and spleen weight of sodium perchlorate to wild-caught tadpoles 
(Spea bombifrons and Spea multiplicata ) exposed in the lab. 

2.0 Study Number 

SPEA-03-01 

3.0 Sponsor 

Strategic Environmental and Research Development Program 

SERDP Program Office 

901 North Stuart Street, Suite 303 

Aldington, VA 22203 

4.0 Testing Facility Name and Address 

The Institute of Environmental and Human Health 
Texas Tech University 
Box 41163 

Lubbock, TX 79409-1163 

5.0 Proposed Experiment Start and Termination Dates 

Start: July 1 st , 2003 
Termination: Feb 29 th , 2004 

6.0 Key Personnel 

Dr. Scott T. McMurry, Study Director 

Mrs. Amy R. Hensley, Co-Investigator 

Ms. Mary B. Gutierrez, Co-Investigator 

Mr. Ryan Bounds, Quality Assurance Officer 

Dr. Ronald J. Kendall, Testing Facility Management 

7.0 Study Objectives/Purpose 

To evaluate the immune response effects of sodium perchlorate exposure to 
native species of toads {Spea bombifrons and Spea multiplicata ). 

8.0 Study Summary 

Spea tadpoles were caught in a Lubbock-area playa lake and brought into the 
lab. In the lab, the tadpoles were divided into 4 groups and their water was dosed with 
0, 20 ppb, 150 ppb, or 100 ppm sodium perchlorate. As the tadpoles metamorphed 
they were removed from the water and put into tanks containing soil, ending their 
exposure. The toads were then allowed to grow to a size that was large enough to 
provide enough spleen cells to perform the lymphycyte proliferation assay. In two 
batches, on consecutive days, the toads were euthanized and tested for immune 


6 of 14 


Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
Amphibian Immune Responses Phase V 


system effects. Information such as spleen weight, spleen cellularity, red blood cells, 
white blood cells, animal weight, splenocytes responsiveness to a mitogen, and 
animal mass were recorded to give insight into the animals’ immune health. 

9.0 Test Materials 

Test Chemical name: 

CAS number: 

Characterization: 

Source: 

10.0 Justification of Test System 

The plains spadefoot toad, Spea bombifrons, and the New Mexico spadefoot 
toad, Spea multiplicata, are both native species to Lubbock-area playa lakes (Behler 
et al. 1979). After hibernating through the winter, the toads awaken with the arrival of 
spring rain showers. This is followed by an intense period of breeding. Their tadpoles 
are abundant in playas for a couple of weeks during the summer months. Because 
these toads or closely related toads inhabit large portions of the Great Plains of the 
United States, they are likely to inhabit areas that are known to be contaminated with 
perchlorate. This contamination has been found in numerous states, including Texas, 
Arizona, Nevada, Utah, Pennsylvania, New York, and others. Even if these species do 
not live in these areas, it is likely that very similar species of toads do inhabit 
contaminated areas. Using the New Mexico spade foot toad and the plains spadefoot 
will allow for the assessment of the risk of perchlorate exposure to the immune 
systems of native amphibian species. 

Additionally, amphibians are likely to be very susceptible to impairment from 
perchlorate exposure. Perchlorate is a potent thyroid inhibitor of both mammals and 
amphibians (Wolff 1998). Because amphibian’s metamorphosis is largely regulated 
by thyroid hormones (Shi 2000), perchlorate exposure has been found to inhibit or 
prevent metamorphosis of tadpoles (Goleman et al. 2001). Amphibians that do not go 
through metamorphosis are at a severe disadvantage; likely to succumb to predators, 
illness, or the upcoming stresses of winter. 

As the metamorphosis of amphibians is affected by perchlorate, their immune 
systems are indirectly affected. The immune system undergoes extensive 
reorganization during metamorphosis, theoretically to prevent an autoimmune 
response to the newly forming, adult-specific molecules (Rollins-Smith et al. 1992). 
With the inhibition of metamorphosis, the reorganization processes have the potential 
to be adversely affected. Perchlorate has been found to be an immunotoxic chemical 
in amphibians as its effects on metamorphosis indirectly affect immunity (Rollins- 
Smith 1992). When metamorphosis and possibly the immune system are inhibited as 
with perchlorate exposure there is significant risk to the recruitment of adults and the 
maintenance of a viable amphibian population. 

11.0 Test Animals 

Species: New Mexico spadefoot toad (Spea multiplicata ) and the Plains 

spadefoot toad (Spea bombifrons ) 

Age: tadpoles when caught, raised to adulthood in the lab 


Sodium perchlorate 
7601-89-0 
minimum 99% 
Sigma Aldrich 


7 of 14 



Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
Amphibian Immune Responses Phase V 


Number: 300 Spea 

Source: playa lakes of the South Plains area surrounding Lubbock 

12.0 Procedure for Identifying the Test System 

When the tadpoles were caught from a playa lake they were placed into 
buckets that were labeled with playa name, playa location, date of capture. Once in 
the lab, the toads were randomly divided into separate aquaria, 25 to a tank. Each 
aquarium was labeled with all pertinent information (AUP number, species, 
emergency contact information, testing substance, investigator, project number, date 
of capture, dosing group). 

13.0 Experimental Design Including Bias Control 

The immunocompetence of metamorphed toads that had been exposed to 
different concentrations of perchlorate (including a control group) as tadpoles was 
assessed using a lymphocyte proliferation assay, white blood cell counts, splenocyte 
number, and spleen weight. Tadpoles captured in the wild (TIEHH SOP AQ-3-05) 
were brought in the lab and randomly assigned to dose groups. Each dose group 
received a different concentration of perchlorate (20 ppb, 150 ppb, 100 ppm, 0 ppm), 
one being a control group. Each dose was tested in triplicate (3 identical tanks) and in 
each tank there were 25 tadpoles. The groups were maintained in their exposure 
concentration until they had completed metamorphosis. They were then sacrificed so 
as to assess them for immune effects. Lymphocyte proliferation, spleen cellularity, 
white blood cell counts, and spleen weight were used to assess the amphibians’ 
immune health. After the groups had completed metamorphosis and had reached an 
adequate size, they were euthanized. The immunoassays could only be performed 
once the amphibians had completed metamorphosis and had grown to a size that was 
large enough for their spleens to provide sufficient splenocytes. 

14.0 Methods 

14.1 Test System acquisition, quarantine, acclimation 

300 tadpoles (Spea multiplicata and Spea bombifrons) were caught in 
a Lubbock-area playa lake with the use of nets attached to long poles. When 
caught, the tadpoles were placed into 5 gallon buckets containing playa water 
that were labeled with the location in which they were found. The buckets 
were transported to the lab at TIEHH in the back of a truck where they were 
well secured with rope and shaded from too much sunlight. When brought to 
the lab at TIEHH, the tadpoles were divided randomly into dose groups and 
placed into their tanks. For 3 days before testing begins, the amphibians were 
allowed to acclimatize. The tadpoles were cared for following the Xenopus 
laevis husbandry (TIEHH SOP AQ-1-06) and fed rabbit chow. 

14.2 Test Material Application 

Rates/concentrations, frequency, route: The tadpoles are aquatic, so they 
were housed in water containing 20 ppb, 150 ppb, 100 ppm, or 0 ppm sodium 


8 of 14 


Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
Amphibian Immune Responses Phase V 


perchlorate starting 3 days after their capture and ending when they completed 
metamorphosis. 

Justification for Exposure Route: This exposure route mimics the manner 
in which they would be exposed to perchlorate in the wild. 

Exposure Verification: Samples of the water were taken approximately 
every week to verify that the needed concentration of perchlorate was present. 
Ion chromatography was used to measure the level of perchlorate (TEEHH 
SOP GW-02-03) 

14.3 Test System Observation 

Tadpoles were monitored daily. Metamorphs were removed and 
housed in aquaria containing soil and a dish of water. These metamorphs were 
fed mealworms. 

14.4 Animal Sacrifice and Sample Collections 

The toads were euthanized in a MS-222 solution as in TIEHH SOP 
AQ-1-03 and then weighed. The toads were then decapitated and whole blood 
samples were collected from the trunk of the toad. Their spleens were 
removed and spleen weight recorded, aseptically. Each spleen was used 
immediately in the immunoassay, so no storage was needed. 

14.5 Endpoint Analysis 

The general study endpoint was to detect a difference in the immune 
responses of perchlorate treated tadpoles and non-exposed tadpoles. The 
lymphocyte proliferation assay measures lymphocyte’s ability to proliferate as 
they would in response to cytokines signaling that an infection is present. 
White blood cell counts, spleen weight, and spleen cellularity also give insight 
into the status of the immune system’s cells. 

Lymphocyte Proliferation Assay 

All procedures were done under sterile conditions. A spleen was 
obtained aseptically and its mass recorded. The splenocytes was dispersed into 
amphibian phosphate buffered saline (APBS) with a sterile glass 
homogenizer. The cell suspension was then centrifuged at 1100 rpm for 7 
minutes at 10°C and the supernatant discarded. The pellet was resuspended in 
APBS (HPLC grade water, sodium chloride, sodium phosphate, and 
potassium phosphate). These two steps were repeated twice more and then the 
number of cells were counted in a 1:2 dilution of Trypan blue. Only viable 
white blood cells were recorded. After this the cell suspension was centrifuged 
and brought up to the proper volume in Leibovitz-15 media (L-15) so that the 
concentration was 5xl0 4 white blood cells /100 pi L-15. The L-15 was 
supplemented with hepes, antibiotics, L-glutamine, 10% fetal bovine serum, 
and Na pyruvate and brought to amphibian osmolality (200 mOsm). 100 pi of 
the cell solution was placed into each well of a 96 well plate. The mitogen was 


9 of 14 




Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
Amphibian Immune Responses Phase V 


lymphpolysaccharide (LPS) as it had been found to be most effect at 
stimulating proliferation in Spea. Stock solutions of the appropriate 
concentration of mitogen in L-15 were prepared ahead of time. The 
concentrations used were 20, 10, 5, and 2.5 pg / ml media. Priority was given 
to 20 pg / ml media for each toad as there were often times not enough 
splenocytes to test multiple concentrations of mitogen. 20 pi of the 
appropriate mitogen was added to each appropriate well. A minimum of 
duplicates was used for each concentration of mitogen, triplicates when 
possible. One set did not receive any mitogen (cell suspension only) to 
provide blank wells to assess background proliferation. The well plates were 
then put into an incubator with 5% CO 2 at 27°C for 48 hours. Pulsing included 
adding 20 pi of a 50 pCi/ml solution of 3 H-thymidine to each well (1 pCi / 
well). Then, after a 24-hour incubation, the cells were harvested using a 
Brandel® cell harvester. The level of radioactivity was measured with a 
scintillation counter (count time = 1 min/sample). As a tool for analyzing the 
results of the proliferation assay a stimulation index (SI) was calculated. The 
SI is equals to the cpm of the wells that received some concentration of LPS 
divided by the cpm of the wells that did not receive any mitogen, the blanks. 

15.0 Results 

In July 2003, 300 Spea tadpoles were captured from a Lubbock-area playa lake and in 
the subsequent months of exposure and development there were many mortalities due to 
factors such as the emergence of camiibal morphs among the tadpoles, water quality issues, 
and other unknown reasons. The toads were susceptible both before and after metamorphosis. 
The final sample size for the control group was 13, 1 in the 20 ppb dose group, 9 in the 150 
ppb dose group, and 6 in the 100 ppm dose group. The mortality was not dependent on the 
dose. The 20 ppb dose group was removed from further analysis because it consisted of only 
one animal. 


Table 1. Nominal and analytically detected 
concentrations of perchlorate in the tadpole 
exposure media. _ 



Nominal Concen 

Detected 


(PPb) 

Concen (ppb) a 

Control 

0 

11 

150 ppb 

150 

263 

100 ppm 

100,000 

96,553 


a The mean perchlorate concentration in the water 
samples taken from the tadpoles’ tanks during exposure. 

Although care was taken to dose the tadpoles with specific concentrations of 
perchlorate, there was some variation from the nominal concentrations (Table 1). In two out 
of three cases the perchlorate concentrations were found to be slightly greater than expected. 
With concentrations of 11 ppb, 263 ppb, and 97 ppm rather than 0, 150 ppb, and 100 ppm, 
the analytically detected concentrations were essentially equivalent to the nominal 
concentrations. These detected concentrations were comprised of a low, medium, and a very 


10 of 14 




Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
Amphibian Immune Responses Phase V 


high concentration, achieving the range that was intended. From this point on the nominal 
concentrations will be referred to although they differed somewhat from what was found. 


Percent Morphed by a Given Day 



Day 

Fig. 1 Percent of the number of tadpoles that lived through 
metamorphosis that had metamorphed by a given day. 


Metamorphosis rates appear to have been affected by the perchlorate (Fig. 1). The 
tadpoles exposed to 100 ppm metamorphed the slowest out of the three groups followed by 
the control group and then the 150 ppb dose group. Statistical analysis has not yet been 
performed on these metamorphosis rates. 


Table 2. Mean (±SEM) values for morphometric and immunological indices in spadefoot toads 
exposed to different concentrations of sodium perchlorate as tadpoles. 


Variable _ _ Control _ _ 150 ppb _ _ 100,000 ppb 



n 


mean 

n 


mean 

n 


mean 

Body Weight (g) 

13 

2.7 

± 

0.34 

9 

3.5 

± 

0.38 

6 

3.3 

± 

0.85 

SVL a (mm) 

13 

27 


0.9 

9 

29 

± 

1.2 

6 

29 

± 

2.3 

WL b (mm) 

13 

52 

± 

1.7 

9 

55 

± 

1.9 

6 

55 

± 

4.4 

Spleen Weight (mg) 

13 

10.23 

± 

2.581 

9 

8.21 

± 

1.412 

6 

7.81 

± 

1.833 

Splenocyte Number (xlO 3 ) 

13 

394.2 

± 

230.95 

9 

145.8 

± 

45.64 

6 

200.7 

± 

118.02 

Blank (cpm) 

12 

240.8 

± 

34.34 

8 

435.3 

± 

167.60 

4 

248.3 

± 

131.96 

20pg/ml LPS (SI C ) 

7 

3.9 


1.21 

4 

4.0 

± 

1.71 

2 

4.9 

i 

1.83 

WBC (xlO 3 ) 

12 

7.65 

± 

0.992 

8 

8.57 

± 

1.625 

6 

8.06 

± 

1.709 

RBC (xlO 6 ) 

12 

0.99 

i 

0.063 

9 

0.87 

± 

0.059 

6 

1.04 

i 

0.067 

PCV (%) 

5 

29 


3.2 

4 

25 

± 

2.4 

5 

33 

± 

2.7 


a SVL = snout vent length 
b WL = whole toad length 
C SI = stimulation index 


11 of 14 





Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
Amphibian Immune Responses Phase V 


Table 3. Results of non-parametric analysis of the 
morphometric and immunological indices (p< 0.05 
was considered to be significant). _ 


Variable 

F 

Statistic 

P-value 

Body Weight (g) 

1.54 

0.2340 

SVL :l (mm) 

0.79 

0.4660 

WL b (mm) 

0.88 

0.4271 

Spleen Weight (mg) 

0.05 

0.9490 

Splenocyte Number (xlO 3 ) 

0.07 

0.9309 

Blank (cpm) 

0.69 

0.5130 

20 pg/ml LPS (SI C ) 

0.15 

0.8621 

WBC (xlO 3 ) 

0.16 

0.8531 

RBC (xlO 6 ) 

2.02 

0.1542 

PCV (%) 

1.36 

0.2974 


a SVL = snout vent length 
b WL ~ whole toad length 
C SI = stimulation index 


There were no statistically significant differences found between the dose groups. P- 
values of less than 0.05 were considered to be significant. No differences were evident either 
with preliminary evaluation of the means or after statistical analysis among the morphometric 
indices; body weight, snout-vent length, whole length, or spleen weight (table 3). It did 
appear, though, that there was a possible difference between dose group means for 
splenocyte numbers (394,148, and 200 xlO 3 cells) but statistical analysis showed no 
significant difference. This lack of significance is explained by the fact that the sample sizes 
were small (13, 9, and 4) with large standard errors (231,46, and 118 cpm). From the 
lymphocyte proliferation assay differences were also suspected after looking at the means of 
the blank wells (241, 435, and 248 cpm), however, these were also not significant as the 
sample sizes were small (12, 8, and 4) while standard errors were high (34, 168, and 132). 

The wells to which 20pg/ml of LPS were added exhibited no differences as did each of the 
hematological data (RBC, WBC, and PCV). Among all of the endpoints, a few possible 
differences were found when the means were calculated and evaluated, however, the small 
sample sizes combined with large variability masked any such possible differences. 

16.0 Discussion 

In this experiment there were interesting differences between what was expected and 
what was found. In several cases there were differences that appeared when the means were 
evaluated but were so masked by variability and small sample sizes that no significant 
differences were found in the statistical analysis. This draws attention to some of the indices, 
perhaps indicating that there were effects from the perchlorate exposure, but does not allow 
for statistically sound conclusions of effects from the exposure to be made. It should be noted 
that all expectations were drawn from research done on Xenopus or Rana exposed to 
perchlorate. These species’ effects from perchlorate exposure may not necessarily be seen in 
Spea as it was assumed in this research. 


12 of 14 





Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
Amphibian Immune Responses Phase V 


The metamorphosis rates of the tadpole dose groups did not entirely fit predicted 
patterns (fig. 1). As perchlorate inhibits metamorphosis in amphibians (Goleman et ah, 2002) 
due to its inhibitory effects on the thyroid hormones that regulate metamorphosis (Galton, 
1988), the higher concentrations of perchlorate were expected to delay metamorphosis. 
Goleman et al. also found the effects of perchlorate to be dose-dependent so supporting 
expectations of greater metamorphosis inhibition with greater doses of perchlorate. 

Therefore, it was somewhat unexpected for the 150 ppm dose group to metamorph the 
quickest. The control group metamorphed slower than the 150 ppb group, but quicker than 
the 100 ppm group. So, the 100 ppm and the control group exhibit the expected pattern with 
respect to each other while the 150 ppb’s swift metamorphosis is inexplicable. 

Morphometric indices such as animal mass, snout-vent length, whole length, and 
spleen weight were not necessarily expected to be affected by the perchlorate exposure. This 
expectation stems from research that found Xenopus snout-vent lengths of exposed and 
unexposed animals to converge given enough recovery time (Goleman et al., 2002). As there 
were several months between the exposure and the analysis, there was ample time for 
differences in these indices to diminish. Preliminary evaluation of the means did not draw 
attention to possible significant differences in any of these endpoints, so there is probably no 
masking occurring. This leaves two possible explanations for why there were no 
morphometric differences found between dose groups. There may not have been any 
differences at any point in the experiment due to perchlorate exposure or any differences that 
existed during perchlorate exposure diminished after exposure was terminated. 

As a result of the thyroidal effects of perchlorate, immune effects have been found in 
amphibians dosed with perchlorate (Kinney et al. 1996, Rollins-Smith and Blair 1990, 
Miranda and Dezi 1997, Kanki and Wakahara 2000, and Rollins-Smith et al. 1992). 
Endpoints such as splenocyte number, background proliferation of splenocytes, splenocyte 
response to LPS, and number of WBC’s in the blood are indicators of immune effects from 
exposure (Gilbertson et al., 2003, Christin et al., 2003). In this experiment no immune effects 
from exposure to perchlorate were detected. No statistical significance was found in any 
case. Although there may be differences that were being masked, there is also a possibility 
that the immune system had recovered from any effects that were present while exposure was 
occurring. If wild toads were exposed with perchlorate as tadpoles and managed to 
metamorph, these possible immune effects may not significantly decrease their fitness if they 
are able to recover as adults that live mostly out of the perchlorate contaminated water. That 
is if they did not succumb to an illness before they are able to recover. 

Overall, there were no significant differences in any endpoint tested between the dose 
groups of toads. There are possibly no effects from the exposure seen in Spea. There is also a 
strong possibility that small sample sizes and extensive variability are concealing some 
effects. As immune effects have the potential to drastically reduce the survivorability of an 
organism, it is a possibility that should not be disregarded and perhaps studied further. 


13 of 14 




Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
Amphibian Immune Responses Phase V 


17.0 References 

Behler, JL. 1979. National Audobon Society Field Guide to North American Reptiles 
and Amphibians. Alfred A Knopf, New York. 

Christin MS, Gendron AD, Brousseau P, Menard L, Marcogliese DJ, Cyr D, Ruby S, 
Fournier M. Effects of agricultural pesticides on the immune system of Rana pipiens 
and on its resistance to parasitic infection. Environmental Toxicology and Chemistry 
22(5): 1127-1133. 

Galton, VA. 1988. The role of thyroid hormone on amphibian development. 
American Zoology 28:309-318. 

Gilbertson MK, Haffner GD, Drouillard KG, Albert A, Dixon B. 2003. 
Immunosuppression in the northern leopard frog (Ranapipiens ) induced by pesticide 
exposure. Environmental Toxicology and Chemistry 22(1): 101-110. 

Goleman WL, Uruidi LJ, Anderson TA, Smith EE, Kendall RJ, Carr JA. 2002. 
Environmentally relevant concentrations of ammonium perchlorate inhibit 
development and metamorphosis in Xenopus laevis. Environmental Toxicology and 
Chemistry 21:424-430. 

Kinney et al. 1996 

Kanki K, Wakahara M. 2000. Spatio-temporal expression of TSH beta and FSH beta 
genes in normally metamorphosing, metamorphosed, and metamorphosis-arrested 
Hynobius retardatus. General and Comparative Endocrinology. 119(3):276-86. 

Miranda LA, Pisano A, Casco V. 1996. Ultrastructural study on thyroid glands of 
Bufo arenarum larvae kept in potassium perchlorate solution. Biocell 20(2): 147-153. 

Rollins-Smith LA, Blair P. 1990. Expression of class II major histocompatibility 
complex antigens on adult t-cells in Xenopus is metamorphosis-dependent. 
Developmental Immunology 1:97-104. 

Rollins-Smith LA, Blair PJ, Davis AT. 1992. Thymus ontogeny in frogs: t-cell 
renewal at metamorphosis. Developmental Immunology 2:207-213. 

Shi, Yun-Bo. 2000. Amphibian metamorphosis. John Wiley and Sons, Inc. New 
York, New York. 

Wolff J. 1998. Perchlorate and the thyroid gland. Pharmacological Reviews 50(1):89- 
105. 


14 of 14 





Project No. T9700 


A STUDY PROTOCOL 
ENTITLED 


Immune System Responses to Perchlorate Exposure in Native Species of Toads, Spea 

bombifrons and Spea multiplicata 


STUDY/PROTOCOL NUMBER: SPEA-03-01 


SPONSOR: Strategic Environmental and Research Development Program 

SERDP Program Office 

901 North Stuart Street, Suite 303 

Arlington, VA 22203 


TESTING FACILITY: 

Name/Address: The Institute of Environmental and Human Health 

Texas Tech University/TTU Health Sciences Center 
Box 41163 

Lubbock, TX 79409-1163 

Test Facility Management: Dr. Ronald J. Kendall 

Director, TIEHH 

Study Director: Dr. Scott T. McMurry 


PROPOSED EXPERIMENTAL 
START DATE: JULY 1, 2003 






Project No. T9700 
SPEA-03-01 


1. DESCRIPTIVE STUDY TITLE: 

Immunotoxicity, as measured by lymphocyte proliferation and white blood cell counts, of 
sodium perchlorate to wild-caught tadpoles {Spea bombifrons and Spea multiplicata ) 
exposed in the lab 

2. STUDY NUMBER: SPEA-03-01 

3. SPONSOR: Strategic Environmental and Research Development Program 

SERDP Program Office 

901 North Stuart Street, Suite 303 

Arlington, VA 22203 

4. TESTING FACILITY NAME & ADDRESS: 

The Institute of Environmental and Human Health 
Texas Tech University/TTU Health Sciences Center 
Box 41163 

Lubbock, TX 79409-1163 

5. PROPOSED EXPERIMENTAL START & TERMINATION DATES: 

Start Date: July 01, 2003 

Termination Date: March 31, 2004 

6. KEY PERSONNEL: 

Dr. Scott T. McMurry, Study Director 

Mrs. Amy R. Hensley, Co-Investigator 

Ms. Mary B. Gutierrez, Co-Investigator 

Mr. Ryan Bounds, Quality Assurance Officer 

Dr. Ronald J. Kendall, Testing Facility Management 

7. DATED SIGNATURES: 




Dr. Scott T. McMurry 
Study Director 

Dr. Ron Kendall 

Testing Facility Management 


Page 2 of 8 




2-iw 


Project No. T9700 
SPEA-03-01 

Mr. Ryan Bounds 
Quality Assurance Manager 


3-A3-oy Dr. Todd Anderson 

Asst. Dir. For Science 


8. REGULATORY COMPLIANCE STATEMENT 

Quality Control and Quality Assurance 

This study will be conducted in accordance with established Quality Assurance 
program guidelines and in the spirit of Good Laboratory Practice Standards (40 CFR 
Part 160, August 17, 1989). 

Document Control Statement 

This document is considered proprietary to TIEHH and the Sponsor. Do not copy, 
quote or distribute. For access to this document or authority to release or 
distribute, please write to: 

Dr. Scott T. McMurry 

TIEHH 

Box 41163 

Lubbock, TX 79409-1163 


9. STUDY OBJECTIVES / PURPOSE: 

To evaluate the immune response effects of sodium perchlorate exposure to native 
species of toads (Spea bombifrons and Spea multiplicata ) 

10. TEST MATERIALS: 

Test Chemical name: Sodium perchlorate 

CAS number: 7601-89-0 

Characterization: minimum 99% 

Source: Sigma Aldrich 

11. JUSTIFICATION OF TEST SYSTEM 

The plains spadefoot toad, Spea bombifrons, and the New Mexico spadefoot toad, Spea 
multiplicata, are both native species to Lubbock-area playa lakes (Behler et al. 1979). 
After hibernating through the winter, the toads awaken with the arrival of spring rain 
showers. This is followed by an intense period of breeding. Their tadpoles are abundant 
in playas for a couple of weeks during the summer months. Because these toads or closely 
related toads inhabit large portions of the Great Plains of the United States, they are likely 
to inhabit areas that are known to be contaminated with perchlorate. This contamination 
has been found in numerous states, including Texas, Arizona, Nevada, Utah, 


Page 3 of 8 









Project No. T9700 
SPEA-03-01 

Pennsylvania, New York, and others. Even if these species do not live in these areas, it is 
likely that very similar species of toads do inhabit contaminated areas. Using the New 
Mexico spade foot toad and the plains spadefoot will allow for the assessment of the risk 
of perchlorate exposure to the immune systems of native amphibian species. 

Additionally, amphibians are considered the most susceptible to impairment from 
perchlorate exposure. Perchlorate is a potent thyroid inhibitor of both mammals and 
amphibians (Wolff 1998). Because amphibian’s metamorphosis is largely regulated by 
thyroid hormones (Shi 2000), perchlorate exposure has been found to inhibit or prevent 
metamorphosis of tadpoles (Goleman et al. 2001). Amphibians that do not go through 
metamorphosis are at a severe disadvantage; likely to succumb to predators, illness, or the 
upcoming stresses of winter. 

As the metamorphosis of amphibians is affected by perchlorate, their immune systems are 
indirectly affected. The immune system undergoes extensive reorganization during 
metamorphosis, theoretically to prevent an autoimmune response to the newly forming, 
adult-specific molecules (Rollins-Smith et al. 1992). With the inhibition of 
metamorphosis, the reorganization processes have the potential to be adversely affected. 
Perchlorate has been found to be an immunotoxic chemical in amphibians as its effects 
on metamorphosis indirectly affect immunity (Rollins-Smith 1992). When 
metamorphosis and possibly the immune system are inhibited as with perchlorate 
exposure there is significant risk to the recruitment of adults and the maintenance of a 
viable amphibian population. 

12. TEST ANIMALS (Where applicable provide number, body weight range, sex, source of 
supply, species, strain, sub-strain, and age of test system): 

Species: New Mexico spadefoot toad (Spea multiplicata ) and the Plains spadefoot toad 
{Spea bombifrons ) 

Age: tadpoles when caught, raised to adulthood in the lab 
Number: 300 Spea 

Source: playa lakes of the South Plains area surrounding Lubbock 

13. PROCEDURE FOR IDENTIFYING THE TEST SYSTEM: 

When the tadpoles are caught from a playa lake they will be placed into buckets that are 
labeled (playa name, playa location, date of capture). Once in the lab, the toads will be 
randomly divided into separate aquaria, 25 to a tank. Each aquarium will be labeled with 
all pertinent information (AUP number, species, emergency contact information, testing 
substance, investigator, project number, date of capture, dosing group). 


Page 4 of 8 




Project No. T9700 
SPEA-03-01 


14. EXPERIMENTAL DESIGN INCLUDING BIAS CONTROL: 

The immunocompetence of metamorphed toads that have been exposed to different 
concentrations of perchlorate (including a 0 concentration control group) as tadpoles will 
be assessed using a lymphocyte proliferation assay and white blood cell counts. Tadpoles 
captured in the wild (TIEHH SOP AQ-3-05) will be brought in the lab and randomly 
assigned to dose groups. Each dose group will receive a different concentration of 
perchlorate (20 ppb, 150 ppb, 100 ppm, 0 ppm), one being a control group. The groups 
will be maintained in their exposure concentration until after they have completed 
metamorphosis. Then, they will be sacrificed so as to run the immunoassay on them. 
Lymphocyte proliferation, spleen cellularity, white blood cell counts, and spleen weight 
will be used to assess the amphibians’ immune health. Exposure to perchlorate should 
inhibit metamorphosis, so metamorphosis will proceed, but at a slower pace. After the 
groups have completed metamorphosis, they will be euthanized. The immunoassays can 
only be performed once the amphibians have completed metamorphosis and have grown 
to a size that is large enough for their spleens to provide sufficient splenocytes. 

15. METHODS: 

15.1 Test System acquisition, quarantine, acclimation 

300 tadpoles (Spea multiplicata and Spea bombifrons) will be caught in Lubbock- 
area playa lakes with the use of nets attached to long poles. When caught, the 
tadpoles will be placed into 5 gallon buckets containing water from the playa that 
are labeled with the location in which they were found. The buckets will be 
transported to the lab at TIEHH in the back of a truck where they will be well 
secured with rope and shaded from too much sunlight. When brought to the lab at 
TIEHH, the tadpoles will be divided randomly into dose groups and placed into 
tanks. For 3 days before testing begins, the amphibians will be allowed to 
acclimatize. The tadpoles will be cared for following the Xenopus laevis 
husbandry (TIEHH SOP AQ-1-06) and fed fresh spinach (they are vegetarian) 
every two days. 

15.2 Test Material Application 

Rates/concentrations, frequency, and route: The tadpoles are aquatic, so they 
will be housed in water containing 20 ppb, 150 ppb, 100 ppm, or 0 ppm sodium 
perchlorate starting 3 days after their capture and ending at the appropriate life 
stage. 

Justification for Exposure Route: This exposure route mimics the manner in 
which they would be exposed to perchlorate in the wild. 


Page 5 of 8 




Project No. T9700 
SPEA-03-01 

Exposure Verification: Samples of the water will be taken every week to verify 
that the needed concentration of perchlorate is present. Ion chromatography will 
be used to measure the level of perchlorate (TIEHH SOP GW-02-03) 

15.3 Test System Ob s ervation 

Tadpoles will be monitored daily. Metamorphs will be removed and housed in 
aquaria containing soil and a dish of water. These metamorphs will be fed 
mealworms every two days. 

15.4 Animal Sacrifice and Sample Collections 

The toads will be euthanized in a MS-222 solution (TIEHH SOP AQ-1-03) and 
then weighed. Their spleens will be removed and spleen weight recorded, 
aseptically. Each spleen will be used immediately in the immunoassay, so no 
storage is needed, Whole blood samples will be collected from the heart of the 
toad. The liver will also be removed and weighed for possible metals residue 
analysis at a later date in a separate study. The liver and carcass will be frozen 
together in the meantime. 

15.5 Endpoint Analysis 

The main study endpoint is to detect a difference in the immune responses of 
perchlorate treated tadpoles and non-exposed tadpoles. The lymphocyte 
proliferation assay measures lymphocytes ability to proliferate as they would in 
response to cytokines signaling that an infection is present. White blood cell 
counts, spleen weight, and spleen cellularity will each give insight into the status 
of the immune system’s cells. 

16. PROPOSED STATISTICAL METHODS 

We will use standard testing methods, to include regression and analysis of variance, with 
a significance value of 5%, using the JMP software by SAS. 

17. REPORT CONTENT/RECORDS TO BE MAINTAINED: 

Records to be maintained include dosing schedule, metamorphosis rate, when water 
samples are taken, number of animals that have metamorphed and been moved to soil 
aquaria, feeding schedule, deaths, and any abnormal behavior. 


Page 6 of 8 







Project No. T9700 
SPEA-03-01 

Report content will include presentation of data, interpretation, and discussion of the 
following endpoints: 

Whole animal weight 

- Animal length (snout-vent and whole body) 

- Spleen weight 

- Number of splenocytes 

Level of lymphocyte proliferation in response to mitogens 
White blood cell counts 

Interpretation of all data, including statistical results 
Discussion of the relevance of findings 
List of all SOPs used 
List of all personnel 

18. RECORDS TO BE MAINTAINED / LOCATION: 

A final report will be delivered to the Sponsor on or before March 31 st , 2004. Copies of 
all data, documentation, records, protocol information, and the specimens shall be sent to 
the Sponsor, or designated delivery point upon request (within six months of study 
completion). All data, the protocol and a copy of the final report shall be maintained by 
the testing facility. 

19. QUALITY ASSURANCE: 

The Quality Assurance Unit will inspect the study at intervals to insure the integrity of the 
study. Written records will be maintained indicating but not limited to the following: 
date of inspection, study inspected, phase inspected, person conducting the inspection, 
findings and problems, recommended and taken action, and any scheduled reinspections. 
Any problems likely to effect study integrity shall be brought to the immediate attention 
of the Study Director. The Quality Assurance Unit will periodically submit written status 
reports on the study to management and the Study Director. 

20. PROTOCOL CHANGES / REVISIONS: 

All changes and/or revisions to the protocol, and the reasons therefore, shall be 
documented, signed and dated by the Study Director and maintained with the protocol 
and the Quality Assurance Unit. 


21. REFERENCES: 

Behler, JL. 1979. National Audobon Society Field Guide to North American Reptiles and 
Amphibians. Alfred A Knopf, New York. 


Page 7 of 8 




Project No. T9700 
SPEA-03-01 

Goleman WL, Uruidi LJ, Anderson TA, Smith EE, Kendall RJ, Carr JA. 2002. 
Environmentally relevant concentrations of ammonium perchlorate inhibit development 
and metamorphosis in Xenopus laevis. Environmental Toxicology and Chemistry 21:424- 
430. 

Rollins-Smith LA, Blair PJ, Davis AT. 1992. Thymus ontogeny in frogs: t-cell renewal at 
metamorphosis. Developmental Immunology 2:207-213. 

Shi, Yun-Bo. 2000. Amphibian metamorphosis. John Wiley and Sons, Inc. New York, 
New York. 

Wolff J. 1998. Perchlorate and the thyroid gland. Pharmacological Reviews 50(1):89-105. 


Page 8 of 8 


Final Report 

U.S. Air Force Coop. Agreement CU1235 


TIEHH Project No. T9700 
Aquatic toxicology Phase V 


A FINAL REPORT 
ENTITLED 


*» m wi 


PECHLORATE IN INVERTEBRATES, PERIPHYTON, AND DETRITUS AT THE NAVAL 

WEAPONS INDUSTRIAL RESERVE PLANT, 

MCLENNAN COUNTY, TEXAS 


STUDY NUMBER: AQUA 03-01 

SPONSOR: Strategic Environmental and Research Development 

Program SERDP Program Office 
901 North Stuart Street, Suite 303 
Arlington, VA 22203 


CONTRACT ADMINISTRATOR: The Institute of Environmental and Human Health 

Texas Tech University / TTU Health Sciences Center 
Box 41163 

Lubbock, Texas 79409-1163 


TESTING FACILITY: 


TEST SITE: 


ANALYTICAL TEST SITE: 


RESEARCH INITIATION: 
RESEARCH COMPLETION: 


The Institute of Environmental and Human Health 
Texas Tech University 
Box 41163 

Lubbock, Texas 79409-1163 

The Institute of Environmental and Human Health 
Texas Tech University 
Box 41163 

Lubbock, Texas 79409-1163 

The Institute of Environmental and Human Health 
Texas Tech University / TTU Health Sciences Center 
Box 41163 

Lubbock, Texas 79409-1163 

02/07/2003 

12/31/2003 


1 of 12 




Final Report 

U.S. Air Force Coop. Agreement CU1235 


TIEHH Project No, T9700 
Aquatic toxicology Phase V 


Table of Contents 

List of Tables and Figures.3 

Good Laboratory Practices Statement.4 

Quality Assurance Statement.5 

1. Descriptive Study Title.6 

2. Study Number.6 

3. Sponsor.6 

4. Testing Facility Name and Address.6 

5. Proposed Experimental Start and Termination Dates. ; .6 

6. Key Personnel. 6 

7. Study Summary.6 

8. Study Obj ecti ve/Purpo se.7 

9. Test Materials..7 

10. Justification of Test System.7 

11. Test Animals.8 

12. Procedure for Identifying the Test System.8 

13. Experimental Design Including Bias Control.8 

14. Methods.8 

15. Statistical Methods.10 

16. Protocol Changes/Revisions.10 

17. Results.10 

18. Discussion.11 

19. Study Records and Archive.12 

20. References. 12 

21. Appendices.12 


2 of 12 



























Final Report 

U.S. Air Force Coop. Agreement CU1235 


TIEHH Project No. T9700 
Aquatic toxicology Phase V 


List of Tables and Figures 


Table 1. Perchlorate concentrations in water, periphyton and detritus collected near the 
NWIRP in April 2003. nd = not detected.10 

Table 2. Perchlorate concentration in water, periphyton, detritus, and invertebrates collected 
near the NWIRP in June 2003. nd = not detected.11 


3 of 12 




Final Report 

U.S. Air Force Coop. Agreement CU1235 


TIEHH Project No. T9700 
Aquatic toxicology Phase V 


GOOD LABORATORIES PRACTICES STATEMENT 

Project AQUA 03-01, entitled " Perchlorate in Invertebrates, Periphyton, and Detritus at the Naval 
Weapons Industrial Reserve Plant, McLennan County, Texas", was performed whenever possible in 
the spirit of the Good Laboratory Practices as outlined in 40 CFR Part 160, August 19,1989 


Submitted By: 



Date 


4 of 12 


Final Report 

U.S. Air Force Coop. Agreement CU1235 


TIEHH Project No. T9700 
Aquatic toxicology Phase V 


QUALITY ASSURANCE STATEMENT 

This study was conducted under the Institute of Environmental and Human Health’s Quality 
Assurance Program and whenever possible to meet the spirit of the Good Laboratory Practices as 
outlined in 40 CFR Part 160, August 19,1989. Any changes in protocol and SOPs were documented 
in writing and signed by the study director. 



Date 


5 of 12 




Final Report 

U.S. Air Force Coop. Agreement CU1235 


TIEHH Project No. T9700 
Aquatic toxicology Phase V 


1. DESCRIPTIVE STUDY TITLE: 

Perchlorate in Invertebrates, Periphyton, and Detritus at the Naval Weapons Industrial 
Reserve Plant, McLennan County, Texas 

2. STUDY NUMBER: 

AQUA 03-01 

3. SPONSOR: 

Strategic Environmental and Research Development Program 

SERDP Program Office 

901 North Stuart Street, Suite 303 

Arlington, VA 22203 

4. TESTING FACILITY NAME AND ADDRESS: 

The Institute of Environmental and Human Health 
Texas Tech University 
Box 41163 

Lubbock, Texas 79409-1163 

5. EXPERIMENTAL START & TERMINATION DATES: 

Start: 03/28/2003 
Termination: 12/31/2003 

6. KEY PERSONNEL: 

Ron Kendall, Principal Investigator 
Christopher Theodorakis, Study Director 
Todd Anderson, Analytical Chemist 
Ryan Bounds, Quality Assurance Officer 
Richard Hanson, Quality Assurance Officer 
Les McDaniel, Graduate Student 
Fujun Liu, Graduate Student 

7. STUDY SUMMARY: 

In April and June, 2003, samples of water, periphyton (filamentous green algae), detritus, and 
invertebrates (snails, crayfish, clams, insects, and insect larvae) were collected from 5 creeks 
in and around the Texas Naval Weapons Industrial Reserve Plant (NWIRP). Harris Creek, 
North Fork South Bosque, South Fork South Bosque and Station Creek all originated on the 
NWIRP. Wasp creek does not originate on the NWIRP but a portion of the creek runs 
through it. Perchlorate was detected in water samples all creeks originating on the NWIRP. 
In the April 2003 sampling trip, perchlorate was detected in several periphyton samples, one 
detritus sample, and in only one invertebrate sample (snail). In the June 2003 sampling trip, 
perchlorate was detected in periphyton and several invertebrates. In many instances, the 
concentrations of perchlorate in periphyton and invertebrates was greater than that in the 
water, and perchlorate was often detected in these samples when it was not detected in the 


6 of 12 






Final Report 

U.S. Air Force Coop. Agreement CU1235 


TIEHH Project No. T9700 
Aquatic toxicology Phase V 


water. 

8. STUDY OBJECTIVES / PURPOSE: 

To determine comparative body burdens of perchlorate in detritus, periphyton, and 
invertebrates collected from surface waters at the Naval Weapons Industrial Reserve Plant 
(NWIRP). 

9. TEST MATERIALS: 

Test Chemical: Perchlorate anion 
CAS Number: 7601-89-9 

Characterization: Determination of concentration in environmental samples 

Source: Wastewater effluent discharge, groundwater seepage, runoff from or percolation 

through contaminated soil. 

10. JUSTIFICATION OF TEST SYSTEM: 

Preliminary surveys of NWIRP have revealed that measurable levels of ammonium 
perchlorate have been found in surface waters of aquatic systems (i.e., streams, lakes, and 
rivers) within and adjacent to NWIRP. Comparative analysis of perchlorate accumulation 
in fish and water from field-collected specimens indicates that perchlorate levels may be 
higher in fish than in water, but laboratory analysis indicates that perchlorate does not 
bioconcentrate in fish. This suggests that fish in the field are being exposed by some 
route other than direct absorption from the water. Possibly fish are being exposed 
through the food chain. In the stream ecosystem that have been studied so far, there is 
little phytoplankton, unlike lakes and larger rivers. Thus the primary productivity 
(“bottom of the food chain”) comes from periphyton (algae film growing on rocks and 
other solid objects) or introduction of detritus (dead and decaying leaf litter) from 
terrestrial sources, and the associated saprobes (decomposers: bacteria and fungi) that 
grow on the detritus. Thus, one possible route of exposure of the fish is via accumulation 
of perchlorate by the periphyton or saprobes. Also, previous research has found that 
perchlorate accumulates in terrestrial plants, and most detritus in stream systems comes 
from fallen leaves of terrestrial plants in the riparian zone (i.e. streamside). 

In addition, many fish in stream habitats, especially the ones that have been analyzed so 
far, feed on aquatic invertebrates. Uptake and possible accumulation from the water has 
not yet been addressed in invertebrates. Many invertebrates also feed upon detritus, and 
so could accumulate perchlorate from the detritus, which could then be passed on to fish, 
but the degree to which invertebrates accumulate perchlorate is currently unknown. 

The uptake and bioaccumulation of perchlorate in invertebrates, periphyton, and detritus 
at perchlorate-contaminated sites has not been studied to date. There is also little 
information related to the possible uptake of perchlorate via ingestion of contaminated 
food. Therefore, the purpose of this study is to examine the levels of perchlorate in 
periphyton, detritus, invertebrates. 


7 of 12 



Final Report 

U.S. Air Force Coop. Agreement CU1235 


TIEHH Project No. T9700 
Aquatic toxicology Phase V 


11. TEST ANIMALS: 

Species: Detritus, periphyton, and invertebrates 
Strain: Wild 
Age: Various 

Number: Maximum of 5 composite samples per species per site. 

Source: Captured from natural waters at NWIRP. 

12. PROCEDURE FOR IDENTIFYING THE TEST SYSTEM: 

The test system consisted of natural waters within NWIRP. TTU and private contractors have 
identified contaminated sites in previous surveys. Reference sites were selected based on 
proximity to NWIRP and similarity to NWIRP water bodies, and were found not to contain 
detectible levels of perchlorate. Each sampling location was labeled with its whole name or a 
4-letter abbreviation. Five sites have been identified on NWIRP. Their names (and 4 letter 
abbreviations) are Harris Creek (HARC), North Fork South Bosque River (NFSB), South 
Fork South Bosque River (SFSB), Wasp Creek (WASP), and Station Creek (STAC 

13. EXPERIMENTAL DESIGN INCLUDING BIAS CONTROL: 

Samples were collected from sites of known perchlorate contamination. As many individuals 
as could be collected were taken from each site, up to 30 individuals per species per site. 
Each composite sample was composed of specimens collected along an approximately 50 m 
stretch of stream, and these stretches were located at least 50 m apart from each other. 

14. METHODS 

14.1. Test System acquisition, quarantine, acclimation 

Water Sampling 

At each location where samples (detritus, periphyton, & invertebrates) were captured, 60 ml 
of water was also taken for perchlorate analysis, according to SOP AQ-3-03. Water was 
collected before collection of samples. Water samples were collected at either end of the 
section of the stream from which samples were collected, plus at least one sample in between 
these two points. Samples were taken at least 10 m apart, unless the section of stream to be 
sampled was less than 10 m long. Water samples were collected in precleaned glass vials 
(Wheaton), and were collected from just under the water surface. Water samples were stored 
away from direct sunlight and excessive heat (> 50° C). Before samples were taken, the pH, 
dissolved oxygen, conductivity, and temperature was measured according to SOP IN-2-01 
and recorded on TIEHH Form 181. 

14.2. Test Material Application 

Rates/concentrations: Concentration determined by laboratory analysis. 

Frequency: Perchlorate is discharged into surface waters in NWIRP continuously from 
ground water or wastewater effluent, or is discharged into surface waters after rainfall events 
via runoff or percolation of rainwater through soil. 


8 of 12 


Final Report 

U.S. Air Force Coop. Agreement CU1235 


TIEHH Project No. T9700 
Aquatic toxicology Phase V 


Route/Method of Application: Ingestion of absorption of perchlorate from water and 
natural food items. 

Justification for Exposure Route: The animals and plants were exposed to perchlorate in 
water and food items in their natural enviro nm ent. 

Exposure Verification: Water samples were collected for determination of perchlorate 
concentrations wherever biota samples were collected. 

14.3. Test System Observation 

At every location from which water samples were taken, the following environmental 
parameters were evaluated: water temperature, pH, salinity, dissolved oxygen, and 
conductivity. 

14.4. Animal Sacrifice and Sample Collections 

Data Recording and Sample Labeling 

Prior to processing any samples, they were given a unique ID number and species and weight 
were recorded on sample collection/dissection forms, as well as tissues collected and method 
of preservation. According to the SOP IN-3-02, the information to be recorded on labels was 
the project number and unique ID. We also included on labels the tissue collected, the 
species, as well as the date of collection. The unique ID, species, date of collection, sex and 
tissue were also recorded on a sample processing form (e.g. forms 027 “Multiple 
Fish/Amphibian Dissection/Collection Form” or 182 “Fish Dissection Form”). The unique 
ID followed the following format: For samples collected from NWIRP, the ID was 4-letter 
abbreviation of the sampling site)-X-(sample [or composite] number), where X was “D” if 
the sample was detritus, “P” for periphyton, “C” for crayfish, “SN” for snail, “CL” for clam, 
or “F’ for other invertebrate. If more than one species of invertebrate was collected, it was 
given an additional designation of A, B, C.. .eg. IA, IB, IC for “invertebrate A, invertebrate 
B, invertebrate C,” etc. 

Perchlorate Analysis 

Various species of different trophic levels were collected for perchlorate body burden 
analysis. Composite samples were placed into Ziploc freezer bags and stored on ice until 
transport back to the laboratory. After transport to the laboratory, samples were stored in the 
freezer (temperature -20°C) until analysis. Water samples also were transported back to the 
laboratory for perchlorate analysis. Once in the laboratory, they were stored in a refrigerator 
(4°C) until analysis. 

14.5. Endpoint Analysis 

Perchlorate concentration in the detritus, periphyton, and invertebrate samples were extracted 
according to SOP AC-2-15 “Extraction and Cleanup of Tissue Samples to be Analyzed for 
Perchlorate”. Analysis and quantification of perchlorate in water or extracted from tissues 
were performed according to SOP AC-2-11 “Analysis of Perchlorate by IC”. 


9 of 12 



Final Report 

U.S. Air Force Coop. Agreement CU1235 


TIEHH Project No. T9700 
Aquatic toxicology Phase V 


15. STATISTICAL METHODS 

This project was a survey, rather than hypothesis testing, so no statistical methods were 
implemented. 

16. PROTOCOL CHANGES/REVISIONS: 

Initially, fish were collected form NWIRP streams and stomach contents were collected 
for perchlorate analysis. Unfortunately, because of interfering ions and other compounds, 
perchlorate could not be quantified in these samples. Resources were then diverted to 
analysis of other samples. No invertebrates were observed on the detritus, so they were 
not collected. 

17. RESULTS 

Several species of invertebrates were collected during April 2003. These included fishing 
spiders, clams, dragonfly larvae, and snails. Perchlorate was not detected in any of these 
samples. Perchlorate was found in composite samples of periphyton and one composite 
sample of detritus (Table 1). 


Table 1- Perchlorate concentrations in the water (ng/ml) 


Sampling Site 

Sample type 

Concentration 

and detritus or periphyton (ng/g) 

Harris Creek 

Water 

7 

in samples collected 


Periphyton 

237 

from TNWIRP. 

South Fork South 




Bosque 

Water 

ND* 



Periphyton 

ND* 


Wasp Creek 

Water 

ND* 



Detritus 

ND* 



Periphyton 

10 


North Fork South 




Bosque 

Water 

6 



Detritus 

ND* 


Station Creek 

Water 

8 



Detritus 

25.8 



*Not detected. 

Analysis of the samples collected during June 2003 indicated that perchlorate was 
consistently detected in crayfish and periphyton, even if perchlorate was not detected in the 
water. Perchlorate was also detected in other arthropods such as terrestrial isopods (pillbugs) and 
damselfly (odonate) larvae. Perchlorate was not detected in detritus. 


10 of 12 




Final Report 

U.S. Air Force Coop. Agreement CU1235 


TIEHH Project No. T9700 
Aquatic toxicology Phase V 


Table 2 - Perchlorate concentrations in the water (ng/ml) and detritus or periphyton (ng/g) in 
samples collected from TNWIRP. 


Sampling site 

Sample type 

N 

Mean +/- SD (Range) 
perchlorate concentration 
(ng/g) 

South Fork South Bosque 

Water 

5 

ND* 


Crayfish 

3 

30.8±48.7 (0-87.0) 


Periphyton 

5 

44.1±79.9 (0-185) 


Diving beetle 

1 

ND* 


Snail 

1 

ND* 


Terrestrial isopod (pillbug) 

2 

74.6±95.6 (7-142) 


Detritus 

2 

ND* 

North Fork South Bosque, downstream site 

Water 

3 

ND* 


Periphyton 

3 

ND* 


Clam 

1 

12.7 


Snail 

1 

ND* 

North Fork South Bosque, upstream site 

Water 

4 

5±1.8 


Crayfish 

1 

ND* 


Periphyton 

2 

26.2±37.1 (0-52) 


Snail 

1 

ND* 


Detritus 

1 

ND* 

Wasp Creek 

Water 

4 

ND* 


Damselfly larvae 

1 

55.3 


Periphyton 

3 

33.2±44 (1.39-14.8) 


Water Strider 

1 

16.7 


Snail 

1 

2.1 


Detritus 

1 

ND* 

Station Creek 

Water 

4 

10±0.4 


Macrophyte 

1 

ND* 


Periphyton 

3 

0.5±0.8 (0-1.39) 


Crayfish 

2 

23.2±15 (13-33.8) 


Clam 

1 

ND* 


Detritus 

1 

ND* 

Harris 

Water 

4 

ND* 


Periphyton 

2 

1.4±0.4(1.1-1.7) 


Detritus 

2 

ND* 


18. DISCUSSION 

The present study indicates that perchlorate is taken up by periphyton and 
invertebrates at NWIRP. Perchlorate concentrations in water invertebrates were similar to 
those reported at the Longhorn Army Ammunition Plant, Kamack, TX (Smith et al., 2001). 
Although perchlorate is sporadically found in the detritus, it may not represent a major 
pathway of exposure, due to the low occurrence of perchlorate in detritus. It would seem that 
monitoring perchlorate in periphyton is a more reliable indicator of perchlorate exposure in 
streams than would monitoring water concentrations themselves. 


11 of 12 





Final Report 

U.S. Air Force Coop. Agreement CU1235 


TIEHH Project No. T9700 
Aquatic toxicology Phase V 


Comparative analysis of perchlorate accumulation in biota and water from field 
collected specimens indicates that perchlorate levels maybe higher in biota than in water, but 
laboratory analysis indicates that perchlorate does not bioconcentrate in fish (Theodorakis et 
al., unpublished data). This suggests that fish collected in the field are being exposed by 
some routes other than direct absorption from the water. One possible route of uptake in fish 
may be through the food chain. In the stream ecosystems, the primary productivity is due to 
periphyton (algae fi l m growing on rocks and other solid objects). Therefore, one possible 
route of exposure of fish is via accumulation of perchlorate by the periphyton. The data 
presented here support the hypothesis that periphyton may be a source of perchlorate in these 
contaminated streams. Herbivorous fish, such as stonerollers ( Campostoma anomalum ) may 
be exposed to perchlorate through this route. The invertebrates also take up perchlorate, 
although it is uncertain whether they take it up primarily from water or from periphyton. 
Crayfish seem more prone to accumulate perchlorate above water concentrations than other 
invertebrates. Terrestrial arthropods such as isopods collected from the waters edge also 
accumulate perchlorate. This may represent a possible pathway of perchlorate exposure to 
fish, such as green sunfish ( Lepomis cyanellus) and largemouth bass ( Micropeterus 
salmoides ), that regularly feed on crayfish and terrestrial arthropods (terrestrial insects and 
isopods have been found in the stomachs of green sunfish collected from these streams; pers. 
obs.). In addition, certain species of wildlife, such as raccoons (Procyon lotor ), watersnakes 
(Natrix spp.), and herons (Ardea spp .) may also feed upon crayfish. Thus, there are possible 
food-chain pathways for not only transport of perchlorate from the terrestrial to the aquatic 
compartments, but vice versa as well. 

19. STUDY RECORDS AND ARCHIVE: 

Study Records will be maintained at The Institute of Environmental and Human Health 
(TIEHH) Archive for a minimum of one year after study completion date. 

20. REFERENCES: 

Smith, N.S., Theodorakis, C.W., Anderson, T.A., and Kendall, R.J., 2001. Preliminary 
assessment of pechlorate in ecological receptors at the Longhorn Army Ammunition 
Plant (LHAAP), Kamack, Texas. Ecotoxicology 10: 305-313. 

21. APPENDICES: 

Study Protocol 

Changes to Study Documentation 


12 of 12 





Project No. T9700 


A STUDY PROTOCOL 
ENTITLED 


PECHLORATE IN INVERTEBRATES, PERIPHYTON, DETRITUS, AND FISH STOMACH 
CONTENTS AT THE NAVAL WEAPONS INDUSTRIAL RESERVE PLANT, 

MCLENNAN COUNTY, TEXAS 


STUDY/PROTOCOL NUMBER: AQUA-03-01 


SPONSOR: US Air Force 

AFIERA/RSRE 

2513 Kennedy Cir 

Brooks AFB, TX 7235-5123 


ADMINISTRATOR: The Institute of Environmental and Human Health 

Texas Tech University/TTU Health Sciences Center 
Box 41163 

Lubbock, TX 79409-41163 


TESTING FACILITY: 

Name/Address: The Institute of Environmental and Human Health 

Texas Tech University/TTU Health Sciences Center 
Box 41163 

Lubbock, TX 79409-41163 


Test Facility Management: Dr. Ronald Kendall 

Study Director: Dr. Christopher Theodorakis 


PROPOSED EXPERIMENTAL 
START DATE: 2/07/03 

Page 1 of 11 




Project No. T9700 


r- 

1 


1. DESCRIPTIVE STUDY TITLE: 

Perchlorate in Invertebrates, Periphyton, Detritus, and Fish Stomach Contents at the Naval 
Weapons Industrial Reserve Plant, McLennan County, Texas 

2. STUDY NUMBER: AQUA-03-01 

3. SPONSOR: 

United States Air Force 

IERA/RSE 

2513 Kennedy Circle 

Brooks Air Force Base, Texas 78235-5123 

4. TESTING FACILITY NAME & ADDRESS: 

Texas Tech University 

The Institute of Environmental and Human Health 
Box 41163 

Lubbock TX 79406-1163 

5. PROPOSED EXPERIMENTAL START & TERMINATION DATES: 

Start Date: 2/07/03 
Termination Date: 12/31/03 

6. KEY PERSONNEL: 

Dr. Christopher Theodorakis, Study Director 
Dr. Todd Anderson, Analytical Chemist 

Dr. Ronald Kendall, Testing Facilities Management/Principal Investigator 

Ryan Bounds, Quality Assurance Manager 

Fujun Liu, Technician 

Leslie McDaniel, Technician 

June-Woo Park, Technician 

7. DATED SIGNATURES: 


Dr. Christopher Theodorakis 
Study Director 



Page 2 of 11 






Project No. T9700 


Dr. Ronald Kendall 
Testing Facility 
Management/PI 

Ryan Bounds 

Quality Assurance Manager 

Dr. Todd Anderson 
Analytical Chemist 

8. REGULATORY COMPLIANCE STATEMENT 

Quality Control and Quality Assurance 

This study will be conducted in accordance with established Quality Assurance 
program guidelines and in compliance, where appropriate and possible, with 
Good Laboratory Practice Standards (40 CFR Part 160, August 17, 1989). 

Document Control Statement 

This document is considered proprietary to TEEHH and the Sponsor. Do not copy, 
quote or distribute. For access to this document or authority to release or 
distribute, please write to: 

Dr. Ronald J. Kendall 
Texas Tech University 

The Institute of Environmental and Human Health 
Lubbock, TX 79409-1163 USA 

9. STUDY OBJECTIVES / PURPOSE: 

-To determine accumulation of perchlorate in invertebrates, detritus, and periphyton from 
the Texas Naval Weapons Industrial Reserve Plant (NWIRP). 

-To determine concentrations of perchlorate in stomach contents of fish collected from 
NWIRP. 

10. TEST MATERIALS: 

Test Chemical name: Perchlorate anion 
CAS number: 7790-98-9 

Characterization: Determination of concentration in environmental samples. 

Source: Wastewater treatment effluent discharge. 

11. JUSTIFICATION OF TEST SYSTEM 

Preliminary surveys of NWIRP have revealed that measurable levels of ammonium 
perchlorate have been found in surface waters of aquatic systems (i.e., streams, lakes, and 



r __ 


hilLo 3 

v-v-03 


Page 3 of 11 





Project No. T9700 


12 . 


rivers) within and adjacent to NWIRP. Comparative analysis of perchlorate accumulation 
in fish and water from field-collected specimens indicates that perchlorate levels may be 
higher in fish than in water, but laboratory analysis indicates that perchlorate does not 
bioconcentrate in fish. This suggests that fish in the field are being exposed by some 
route other than direct absorption from the water. Possibly fish are being exposed 
through the food chain. In the stream ecosystem that have been studied so far, there is 
little phytoplankton, unlike lakes and larger rivers. Thus the primary productivity 
( bottom of the food chain”) comes from periphyton (algae film growing on rocks and 
other solid objects) or introduction of detritus (dead and decaying leaf litter) from 
terrestrial sources, and the associated saprobes (decomposers: bacteria and fungi) that 
grow on the detritus. Thus, one possible route of exposure of the fish is via accumulation 
of perchlorate by the periphyton or saprobes. Also, previous research has found that 
perchlorate accumulates in terrestrial plants, and most detritus in stream systems comes 
from fallen leaves of terrestrial plants in the riparian zone (i.e. streamside). 

In addition, many fish in stream habitats, especially the ones that have been analyzed so 
far, feed on aquatic invertebrates. Uptake and possible accumulation from the water has 
not yet been addressed in invertebrates. Many invertebrates also feed upon detritus, and 
so could accumulate perchlorate from the detritus, which could then be passed on to fish, 
but the degree to which invertebrates accumulate perchlorate is currently unknown. 

The uptake and bioaccumulation of perchlorate in invertebrates, periphyton, and detritus 
at perchlorate-contaminated sites has not been studied to date. There is also little 
information related to the possible uptake of perchlorate via ingestion of contaminated 
food. Therefore, the purpose of this study is to examine the levels of perchlorate in 
periphyton, detritus, invertebrates, and stomach contents in fish from NWIRP 

TEST ORGANISMS (Where applicable provide number, body weight range, sex, source 
of supply, species, strain, sub-strain, and age of test system): 


Species. Carp ( Cyprinus carpio) , sunfish and bass ( Lepomis spp., Pomoxis spp, 

Micropterus spp.) catfish ( Ictalurus spp., Amerius ssp.), or any other fish species 
deemed suitable as determined by abundance of specific aspects of their biology 
(to be determined on-site); periphyton and invertebrates (species dependant upon 
what is present and collected on site). 

Strain: Wild animals. 

Age: Various 

Number: Maximum of 300 per species, taxon (invertebrates) or matrix (detritus). 

Source: Captures from natural waters at NWRP. 


Page 4 of 11 








Project No. T9700 


13. PROCEDURE FOR IDENTIFYING THE TEST SYSTEM: 

The test system will consist of natural waters within NWIRP. TTU has identified 
contaminated sites in previous surveys. Reference sites were selected based on proximity 
to similarity to NWIRP water bodies, and were not found to contain detectible levels of 
perchlorate. Each sampling location will be labeled with its whole name or a 4-letter 
abbreviation. To date, six sites have been identified. Their names (and 4 letter 
abbreviations) are Harris Creek (HARC), North Fork South Bosque River (NFSB), South 
Fork South Bosque River (SFSB), Wasp Creek (WASP), Coryell Creek (CORC), and 
Station Creek (STAC). Any other sites that may be added will be referenced either by 
their full name of the 4 letter abbreviation, determined as follow: the names of ponds, 
creeks, etc, will be abbreviated with the 1 st three letters of the name followed by P (pond), 
C (creek), R (river), L (lake), or B (bayou) (e.g., Jim’s Bayou = JIMB, Caddo Lake = 
CADL). If the name of the creek, lake, etc has only 4 letters, this may be used in place of 
a 4-letter abbreviation (Star Pond = STAR). If the water body consists of 2 or more 
words, the last letter of the abbreviation will indicate type of water body (P=pond, etc.), 
and the other letters will at least represent the first letter of each word of a compound 
name, and additional letters in the name may be added to total 4 letters, if needed (e.g.. 
Little Cypress Bayou may be abbreviated LCYB or LICB, provided the same abbreviation 
is used for all samples; East Fork Poplar Creek would be abbreviated EFPC). If the name 
of the water body contains more than 4 words, the abbreviation of the last word may be 
omitted (e.g., for North Fork South Bosque River the “R” for river is omitted), All 
samples taken from the same waterbody within 100 meters may be counted as a single 
sample. If 2 or more samples are taken at intervals greater than 100 meters, or if a series 
of samples are taken from a stretch of lake, creek, etc, that is more than 100 meters long; 
the samples will be suffixed with numbers (e.g., HAGC-1, HAGC-2, etc.). If a pond, 
lake, creek does not have a name associated with it, it will be labeled with a letter, e.g.. 
Pond A, Pond B, Lake A, Creek A, Creek B, Creek C, etc. The 1 st 3 letters of the’ 
abbreviation will be PND (pond), CRK (creek), LKE (Lake), BYU (bayou) or RIV 
(river), followed by A, B, C, etc. (e.g.. Pond A = PNDA). All names and abbreviations 
must be recorded on data sheets and sample tracking forms and/or in the field notebook 
for future reference. 

14. EXPERIMENTAL DESIGN INCLUDING BIAS CONTROL: 

Fish will be collected from sites of known perchlorate contamination and at least 1-2 
reference sites. As many individuals as can be collected will be taken from each site, up 
to 20 individual fish, large invertebrates, or composite samples per site [NOTE: herein, 
composite samples of detritus, invertebrates, or periphyton will be referred to as 
composite samples ]. Individuals will be temporarily held in a bucket until processed. 


Page 5 of 11 







Project No. T9700 


Different buckets will be used for each site, if possible, or else buckets will be washed 
between sampling sites. Reference sites will be chosen so as to be as similar as possible 
to the contaminated site(s) in terms of habitat structure and stream characteristics. The 
same species, taxa, or matrices will be collected from contaminated and reference sites. 
Fish and composite samples will be weighed prior to processing and weight will be 
recorded on sampling form. 

15. METHODS: 

15.1 Test System acquisition, quarantine, acclimation 

Water Sampling 

At each location where fish are captured, 60 ml of water will also be taken for perchlorate 
analysis, according to SOP AQ-3-03. Water should be collected before collection of fish 
or composite samples, if at all possible. Water samples should be collected at either end 
of the section of the stream from which fish were collected, plus at least one sample in 
between these two points. Samples should be taken at least 10 m apart, unless the section 
of stream to be sampled is less than 10 m long. Water samples will be collected in 
precleaned glass vials (Wheaton), and will be collected from just under the water surface. 
Water samples should be stored away from direct sunlight and excessive heat (> 50° C). 
Before samples are taken, the pH, dissolved oxygen, conductivity, and temperature 
should be measured according to SOP IN-2-01 and recorded on TIEHH Form 181. 

Fish Collection 

Fish may be collected with backpack electroshocker set at a current of 2-4 amps and a 
frequency of 30-60 cps; or they may be collected with a seine, dip net or baited traps as 
described in SOP AQ-3-05 “Fish and Amphibian Field Collection Methods”. Traps 
should be placed at least 1 m. apart and checked at most every 24 hours. Traps should be 
anchored to a non-movable object on the shore with highly visible nylon twine or firmly 
attached to a highly visible floating buoy and anchored to the bottom. Placement of traps 
may be regularly spaced, or concentrated in habitats where target species are known to 
occur. If the water is too deep for backpack shocking, shocking may be done by boat. In 
smaller water bodies, the backpack shocker generator and power supply may be 
disconnected from the backpack frame and secured on the boat. In larger bodies of water, 
a boat electroshocking device may be used. Any captured fish will be placed in plastic 
buckets with aeration until processing. 

Periphyton/detritus collection 

Samples of detritus and periphyton will be collected by grab sampling. At least three 
samples will be collected from each water body sampled. Each sample will weigh at least 


Page 6 of 11 


Project No. T9700 


5 g and each sample will be collected at least 5 m apart. Samples will be placed in plastic 
bags or wrapped in aluminum foil, labeled according to SOP IN-3-02, and will be kept on 
ice or frozen in liquid nitrogen until transport back to the laboratory. 

Invertebrate collection 

Aquatic, benthic, or emergent insects will be captured with kick nets, seines, dip nets, or 
minnow traps (depending upon habitat structure). Kicknets or seines will be used to 
sample aquatic vegetation, sand, or gravel substrates, if present. Dipnets will be used to 
sweep aquatic vegetation, if present. Dipnet/kicknet sweeps will cover an area of at least 
1 m by 1 m, and there will be at least three sweeps per sampling site (if appropriate 
habitat is present), with each sweep being at least 5 m apart. 

Minnow traps will be used to sample crayfish, using chicken livers or other animal-based 
baits. Traps will be set and checked as described for fish. Each minnow trap will be 
placed at least 10 m apart, with at least 3 minnow traps per sampling site. 

If at least 50 g of detritus can collected, any invertebrates present will also be collected 
from the detritus. Grab samples of detritus will be collected from at least 3 locations per 
sampling site, with each location being at least 5 m apart. If the detritus has not been 
frozen, it will first be soaked in 70 % ethanol to kill any invertebrates, after which the 
detritus will be washed in plastic buckets to dislodge dead organisms. The detritus will 
be removed from the bucket, and the remaining water will be sieved through window 
screening to collect any dislodged invertebrates. All collected invertebrates will be 
placed in plastic bags or wrapped in aluminum foil and stored on wet ice or frozen in 
liquid nitrogen until further analysis. 


15.2 Test Material Application 

Rates/concentrations: Concentration determined by laboratory analysis. 

Frequency: Perchlorate is discharged into surface waters in NWRP continuously from 
ground waters or runoff from rainfall events. 

Route/Method of Application: Ingestion of absorbtion of perchlorate from water and 
natural food items. 


Justification for Exposure Route: The organisms are exposed to perchlorate in water 
and food items in their natural environment. 


Page 7 of 11 




Project No. T9700 


Exposure Verification: Water samples will be collected for determination of perchlorate 
concentrations wherever biota samples are collected. 

15.3 Test System Observation 

At every location from which water samples are taken, the following environmental 
parameters will be evaluated: water temperature, pH, salinity, dissolved oxygen, and 
conductivity. 

15.4 Animal Sacrifice and Sample Collections 

Data Recording and Sample Labeling 

Prior to processing any samples, they will be given a unique ID number. Species and 
weight will be recorded on sample collection/dissection forms, as well as tissues collected 
and method of preservation. Fish length is also an optional parameter than can be 
recorded. Fish or sample weight will be measured on a portable balance to the nearest 
gram (if the fish weighs 10 grams or more) of the nearest 1/10 gram if it weighs less than 
10 grams. 

Prior to use, the scale needs to be calibrated according to IN-4-01, “Field Scale 
Operations and Maintenance” and calibration should be recorded on TIEHH Form 60, or 
in bound field notebook. 

According to the SOP IN-3-02, the minimum information to be recorded on labels is the 
project number and unique ID. The unique ID will contain enough information to be able 
to identify the species and tissue. Date of collection, species, sex and tissue may also be 
included on the label. Pre-printed labels may be used, but if they are used on samples to 
be frozen or chilled on ice, the project number and unique ID must also be printed on the 
container with indelible ink. 

The unique ID will follow the following format: The ID will be W-(4-letter abbreviation 
of the species [see SOP IN-1-06]) - (2-letter abbreviation of the sampling site) - (sample 
number). For example, W-YLBH-SB-1 is the unique ID for yellow bullhead #1 collected 
from the South Fork South Bosque River. For detritus, invertebrate, and periphyton 
composite samples, the 4-letter species abbreviation will be replaced by DETR, INVT, 
and PERI, respectively. Any crayfish or freshwater clams that are large enough to 
analyze individually will be designated by the 4 letter abbreviation CRAY and CLAM, 
respectively. The letter W will precede all samples ID, signifying “Waco”, the closest 
major town to NWRP. The 2-letter abbreviation of the sampling site will be derived from 
the 1 st and last letters of the 4-letter abbreviation. If this designation is already used, the 


Page 8 of 11 





Project No. T9700 


2 nd and last letters of the 4-letter abbreviation shall be used. The abbreviations will be 
recorded in the field notebook and/or the data record forms. Sample numbers will be 
assigned in the order in which they are processed. If a sample is a composite, then the 
letter C will be added to the ID. For example: W-YLBH-SB-C-1 is a composite sample 
of yellow bullhead catfish collected from South Fork South Bosque River. If a sample is 
divided into subsamples, a suffix consisting of a decimal point and a number will be 
assigned. For example, if W-YLBH-SB-C-1 and is divided into 2 subsamples, the IDs 
for these subsamples would be W-YLBH-SB-C-1.1 and W-YLBH-SB-C-1.2. If a fish is 
dissected into constituent organs, the label of each sample will be suffixed with a 2-letter 
abbreviation designating the organ, as follows: 

Tissue Abbreviation 

Fillet FL 

Head HD 

GI tract GI 

Stomach contents SC 

For example, W-YLBH-SB-I-HD would be head sample from fish W-YLBH-SB-1, and 
W-LMBA- SB -C -1.2-FL would be subsample #2 from the fillet of largemouth bass #1. 
Labels for whole bodies do not need to contain a suffix (e.g., W-YLBH-SB-1 implies this 
sample is a yellow bullhead whole body). 

Perchlorate Analysis: 

Largemouth bass, carp, catfish, and/or sunfish will be collected for perchlorate stomach 
content and body burden analysis. Fish collected will be anesthetized with an overdose 
of MS222 (0.5 g/L). The stomach contents and/or GI tract, as well as the head and/or at 
least a 5 g sample of the fillet will be collected and frozen in liquid nitrogen for 
perchlorate analysis. Alternatively, fish may be chilled on wet ice until transport back to 
the laboratory. Fish should not chilled on wet ice for more than 5 days before processing 
or being frozen. Individual fish will be wrapped in aluminum foil and labeled prior to 
freezing or chilling. 

Composite samples of periphyton, detritus, and invertebrates (or individual crayfish) will 
be frozen in liquid nitrogen or stored on wet ice until transport to the laboratory. 

After transport to the laboratory, samples will be stored in the freezer (temperature -20° C 
or colder) until analysis. The samples will then be analyzed for perchlorate according to 
SOP AC-2-15 “Extraction and Cleanup of Tissue Samples to be Analyzed for 
Perchlorate”. 


Page 9 of 11 


Project No. T9700 


Water samples also are transported back to the laboratory for perchlorate analysis. Once 
in the laboratory, they will be stored in a refrigerator (4° C) until analysis. They will then 
be analyzed for perchlorate according to SOP AC-2-11 “Analysis of Perchlorate by IC”. 

15.5 Endpoint Analysis 

Analysis of samples for perchlorate will be according to SOP AC-2-11 “Analysis of 
Perchlorate by IC”. 

16. PROPOSED STATISTICAL METHODS 

All data will be checked for normality using the Shapiro-Wilk W test. Homogeneity of 
variances will be checked using (Bartlett’s or Lavine’s test. Comparisons between sites 
will be accomplished by Analysis of Variance (ANOVA) for multiple mean comparisons. 
Correlation coefficients will be used to determine if residue levels correlate with 
biomarkers, reproductive, and/or population data. 

17. REPORT CONTENT/RECORDS TO BE MAINTAINED: 

Records to be maintained include information entered on Form No. 181 “Aquatic 
Sampling Form”; Form No. 182 “Fish Dissection Form” or Form No. 027 “Multiple 
Fish/Amphibian Dissection/Collection Form”. Data on these forms will include identity, 
number, mass, sex and location of animals captured; and identity, amount and location or 
water or sediment samples collected. Alternatively, this information may be recorded in 
QA-approved, bound field notebooks. Additional records to be maintained include Form 
No. 026 “Aquatic Sample Tracking Log”; Form No. Scale calibration log; Form no. 64 b 
and 64c “Batched Sample tracking log”; any entries in laboratory and field notebooks; 
and raw data from perchlorate analysis, thyroid hormone analysis and thyroid histology. 

Report content will include presentation of data, interpretation, and discussion of the 
following endpoints: 

Perchlorate concentrations in biota collected and water concentrations of 
■ perchlorate at sites from which these biota were collected. 

Thyroid hormone concentrations in plasma and/or whole bodies of biota collected. 
Description and enumeration of alterations of thyroid hormone structure as 
revealed by histological analysis. 

Interpretation of all data, including statistical results 
Discussion of the relevance of findings 
List of all SOPs used 
List of all personnel 


Page 10 of 11 




Project No. T9700 


18. RECORDS TO BE MAINTAINED/LOCATION: 

A final report will be delivered to the Sponsor on or before 31 March 2001. Copies of all 
data, documentation, records, protocol information, as well as the specimens shall be sent 
to the Sponsor, or designated delivery point upon request. All data, the protocol and a 
copy of the final report shall be archived at the testing facility. 

19. QUALITY ASSURANCE: 

The Quality Assurance Unit will inspect the study at intervals to insure the integrity of the 
study. Written records will be maintained indicating but not limited to the following: 
date of inspection, study inspected, phase inspected, person conducting the inspection, 
findings and problems, recommended and taken action, and any scheduled re-inspections. 
Any problems likely to effect study integrity shall be brought to the immediate attention 
of the Study Director. The Quality Assurance Unit will periodically submit written status 
reports on the study to management and the Study Director. 

20. PROTOCOL CHANGES / REVISIONS: 

All changes and/or revisions to the protocol, and the reasons therefore, shall be 
documented, signed and dated by the Study Director and maintained with the protocol 
and the Quality Assurance Unit. 


Page 11 of 11 





TIEHH 
Box 41163 

Lubbock, TX 79409-1163 
(806) 885-4567 
qa@tiehh.ttu.edu 


Form No. 014 Rev. 3.06/00 
Project No.: T9700 / AQUA-03-01 
* Change No: 1 
Page 1 of 3 


Change In Study 
Documentation Form 


The following documents changes in the above referenced study: 


Check One: X Amendment _Deviation _Addendums 


Document Reference Information 

Check One: __X_ Protocol SOP _Other-_ 

Tide: Pechlorate in Invertebrates, Periphyton, Detritus, and Fish Stomach Contents at the 
Naval Weapons Industrial Reserve Plant. McLennan County, Texas _ 

Dated: 02-07-03 _ 

Document # (if appropriate): AQUA-03-01 
Page #(s): 1-6. 9 
Section #: Title 

Text to reference: Pechlorate in Invertebrates. Periphyton. Detritus, and Fish Stomach 
Contents at the Naval Weapons Industrial Reserve Plant. McLennan County, Texas 


Change in Document: Pechlorate in Invertebrates. Periphyton, and Detritus at the Naval 
Weapons Industrial Reserve Plant, McLennan County. Texas 


Justification and Impact on Study: Because of interfering ions and other compounds, 
perchlorate could not be quantified in fish tissue samples. 

Section #: 9 

Text to Reference: To determine accumulation of perchlorate in invertebrates, detritus, 
and periphyton from the Texas Naval Weapons Industrial Reserve Plant (NWIRPL 

Change in Document: To determine comparative body burdens of perchlorate in 
detritus, periphyton, and invertebrates collected from surface waters at the Naval 
Weapons Industrial Reserve Plant fNWIRPL 

Justification and Impact on Study: Because fish tissue samples could not be anal wed 
for perchlorate, resources were diverted to analysis of other samples 


* Sequentially numbered in order of the date that the change is effective 











































TIEHH Form No. 014 Rev. 3.06/00 

Box 41163 Project No.: T9700 / AQUA-03-01 

Lubbock, TX 79409-1163 *Change No: 

(806) 885-4567 Page 2 of 3 

qa@tiehh.ttu.edu 

Change In Study 
Documentation Form 

Section#: 9 

Text to Reference: To determine concentrations of perchlorate in stomach contents of 
fish collected from NWIRP 


Change in Document: This portion of the study was deleted. 

Justification and Impact on Study: Because of interfering ions and other compounds, 

perchlorate could not be quantified in fish tissue samples. 

Section #: 12 

Text to Reference: Carp (Cvprinus carvio) . sunfish and bass (Lepomis spy., Pomoxis 

spp. Microvterus spy.) catfish (Ictalurus spy.. Amerius ssp .), or any other 
fish species deemed suitable as determined by abundance of specific 
aspects of their biology (to be determined on-site): periphyton and 
invertebrates (species dependant upon what is present and collected on 
site). 

Change in Document: Detritus, periphyton and invertebrates (species dependant upon 
what is present and collected on site - ). 


Justification and Impact on Study: Because of interfering ions and other compounds, 
perchlorate could not be quantified in fish tissue samples. 


Section #: 14 

Text to Reference: Fish will be collected from sites of known perchlorate contamination 
and at least 1-2 reference sites. As many individuals as can be collected will be taken 
from each site, up to 20 individual fish, large invertebrates, or composite samples per site 
[NOTE: herein, composite samples of detritus, invertebrates, or periphyton will be 
referred to as “composite samples”!. Individuals will be temporarily held in a bucket 
until processed. Different buckets will be used for each site, if possible, or else buckets 
will be washed between sampling sites. Reference sites will be chosen so as to be as 
similar as possible to the contaminated sitefs ) in terms of habitat structure and stream 
characteristics. The same species, taxa, or matrices will be collected from contaminated 
and reference sites. Fish and composite samples will be weighed prior to processing and 
weight will be recorded on sampling form. 

Change in Document: Samples were collected from sites of known perchlorate 
contamination. As many individuals as could be collected were taken from each site, up 


* Sequentially numbered in order of the date that the change is effective 



























TIEHH Form No. 014 Rev. 3.06/00 

Box 41163 Project No.: T9700 / AQUA-03-01 

Lubbock, TX 79409-1163 * Change No: 1 

(806) 885-4567 Page 3 of 3 

qa@tiehh.ttu.edu 

Change In Study 
Documentation Form 

to 30 individuals per species per site. Each composite sample was composed of 
specimens collected along an approximately 50 m stretch of stream, and these stretches 
were located at least 50 m apart from each other. 


Justification and Impact on Study: Because of interfering ions and other compounds, 
perchlorate could not be quantified in fish tissue samples. 

Section #: 15.1 

Text to Reference: Fish Collection 

Fish may be collected with backpack electroshocker set at a current of 2-4 amps and a 
frequency of 30-60 cps: or they may be collected with a seine, dip net or baited traps as 
described in SOP AQ-3-05 “Fish and Amphibian Field Collection Methods”. Traps 
should be placed at least 1 m. apart and checked at most every 24 hours. Traps should be 
anchored to a non-movable object on the shore with highly visible nylon twine or firmly 
attached to a highly visible floating buoy and anchored to the bottom. Placement of traps 
may be regularly spaced, or concentrated in habitats where target species are known to 
occur. If the water is too deep for backpack shocking, shocking may be done by boat. In 
smaller water bodies, the backpack shocker generator and power supply maybe 
disconnected from the backpack frame and secured on the boat. In larger bodies of 
water, a boat electroshocking device may be used. Any captured fish will be placed in 
plastic buckets with aeration until processing. 

Change in Document: This section was deleted. 


Justification and Impact on Study: Because of interfering ions and other compounds, 
perchlorate could not be quantified in fish tissue samples. 


Submitted by: Signature: 


Authorized by: Study Director: 


Received by: Quality Assurance Unit: 



Date: -V 2 ^/ ptf 
Date: 


Date 


* Sequentially numbered in order of the date that the change is effective 
























TIEHH 
Box 41163 

Lubbock, TX 79409-1163 
(806) 885-4567 
qa@tielili.ttu.edu 


Form No. 014 Rev. 3.06/00 

Project No.:_T9700.11_ 

^Change No:_2_ 

Page 1 of2 


Change In Study 
Documentation Form 


The following documents changes in the above referenced study: 

<g> 

Deviation 


Check One: i /'Amendment 


Addendums 


Document Reference Information 

Check One: _x_Protocol _SOP _Other_ 

Title:_Perchlorate in Invertebrates, Periphyton, Detritus, and Fish Stomach Contents 

at the Naval Weapons Industrial Reserve Plant, McLennan County, Texas 

Dated:_ 

Document # (if appronriate):_AQUA 03-01_ 

Page #(s): / % _ 

Section #:_15Aj_ 

Text to reference:_ 

“The unique ID will follow the following format: The ID will be W-(4-letter 
abbreviation of the species [see SOP IN-1-06]) - (2-letter abbreviation of the 
sampling site) - (sample number). For example, W-YLBH-SB-1 is the unique ID 
for yellow bullhead #1 collected from the South Fork South Bosque River. For 
detritus, invertebrate, and periphyton composite samples, the 4-letter species 
abbreviation will be replaced by DETR, INVT, and PERI, respectively. Any 
crayfish or freshwater clams that are large enough to analyze individually will be 
designated by the 4 letter abbreviation CRAY and CLAM, respectively. The 
letter W will precede all samples ID, signifying “Waco”, the closest major town 
to NWRP. The 2-letter abbreviation of the sampling site will be derived from the 
1 st and last letters of the 4-letter abbreviation. If this designation is already used, 
the 2 nd and last letters of the 4-letter abbreviation shall be used. The abbreviations 
will be recorded in the field notebook and/or the data record forms. Sample 
numbers will be assigned in the order in which they are processed. If a sample is 
a composite, then the letter C will be added to the ID. For example: W-YLBH- 
SB-C-1 is a composite sample of yellow bullhead catfish collected from South 
Fork South Bosque River. If a sample is divided into subsamples, a suffix 
consisting of a decimal point and a number will be assigned. For example, if W- 
YLBH-SB-C-1 and is divided into 2 subsamples, the IDs for these subsamples 
would be W-YLBH-SB-C-1.1 and W-YLBH-SB-C-1.2. If a fish is dissected into 
constituent organs, the label of each sample will be suffixed with a 2-letter 
abbreviation designating the organ, as follows: 

Tissue Abbreviation 

Fillet FL 

Head HD 

GI tract GI 


* Sequentially numbered in order of the date that the change is effective 







TIEHH 
Box 41163 

Lubbock, TX 79409-1163 
(806) 885-4567 
qa@tiehli.ttu.edu 


Stomach contents 


Form No. 014 Rev. 3.06/00 

Project No.:_T9700.11_ 

^Change No:_2_ 

Page 2 of 2 


Change In Study 
Documentation Form 

SC 


For example, W-YLBH-SB-l-HD would be head sample from fish W-YLBH-SB- 
1, and W-LMBA- SB -C -1.2-FL would be subsample #2 from the fillet of 
largemouth bass #1. Labels for whole bodies do not need to contain a suffix (e.g., 
W-YLBH-SB-1 implies this sample is a yellow bullhead whole body). 


Change in Document:__ 

__ The unique ID followed the following format: For samples collected 

from NWIRP, the ID was 4-letter abbreviation of the sampling site)-X-(sample 
[or composite] number), where X was “D” if the sample was detritus, “P” for 
periphyton, “C” for crayfish, “SN” for snail, “CL” for clam, or “I” for other 
invertebrate. If more than one species of invertebrate was collected, it was given 
an additional designation of A, B, C...eg, IA, IB, IC for “invertebrate A, 
invertebrate B, invertebrate C,” etc. 


Justification and Impact on Study: 


This was deemed to be a more efficient method of labeling the samples. It 


made the study more efficient. 


Submitted by: Signature 


Authorized by: Study Director: 


Received by: Quality Assurance Unit: 



Date: fry^T 


Date: & y 

Date: ^'f &'' & V 


* Sequentially numbered in order of the date that the change is effective 





TIEHH 
Box 41163 

Lubbock, TX 79409-1163 
(806) 885-4567 
qa@tiehh.ttu.edu 


Form No. 014 Rev. 3.06/00 

Project No.:_T9700.11_ 

* Change No:_2_ 

Page 1 of 1 


Change In Study 
Documentation Form 


The following documents changes in the above referenced study: 

<£§ M * * v 

Check One: y Amendment Deviation _Addendums 


Document Reference Information 

Check One: x Protocol _SOP _Other_ 

Title: _____ Perchlorate in Invertebrates, Periphyton, Detritus, and Fish Stomach Contents 
at the Naval Weapons Industrial Reserve Plant, McLennan County, Texas 

Dated:_ 

Document # (if appropriate):_AQUA 03-01_ 

Page #(s):_7_ 

Section #:_15_ 

Text to reference:_ 

“If the detritus has not been frozen, it will first be soaked in 70 % ethanol to kill any 
invertebrates, after which the detritus will be washed in plastic buckets to dislodge dead 
organisms. The detritus will be removed from the bucket, and the remaining water will 
be sieved through window screening to collect any dislodged invertebrates.” 


Change in Document: __ 

No invertebrates were collected from detritus 


Justification and Impact on Study:_ 

_No invertebrates were observed on the detritus, so they were not collected. 

This had no impact on the study, as invertebrates were collected more efficiently 
by other means. 


Submitted by: Signature 



Authorized by: Study Director: 


Received by: Quality Assurance Unit: 




* Sequentially numbered in order of the date that the change is effective 













TIEHH 
Box 41163 

Lubbock, TX 79409-1163 
(806) 885-4567 
qa@tiehh.ttu.edu 


Form No. 014 Rev. 3.06/00 

Project No.:_T9700.11_ 

*Change No: 4 

Page 1 of 1 


Change In Study 
Documentation Form 


The following documents changes in the above referenced study: 

/ S2 

Check One: V Amendment Deviation 


Addendums 


Document Reference Information 

Check One: _x_Protocol _SOP _Other__ 

Title:_Perchlorate in Invertebrates, Periphyton, Detritus, and Fish Stomach Contents 

at the Naval Weapons Industrial Reserve Plant, McLennan County, Texas 

Dated: ___ 

Document # (if appropriate):_AQUA 03-01 __ 

Page #(s):_10__ 

Section #:_16_ 

Text to reference: __ 

“All data will be checked for normality using the Shapiro-Wilk W test. 
Homogeneity of variances will be checked using (Bartlett’s or Lavine’s test. 
Comparisons between sites will be accomplished by Analysis of Variance 
(ANOVA) for multiple mean comparisons. Correlation coefficients will be used 
to determine if residue levels correlate with biomarkers, reproductive, and/or 
population data.” 


Change in Document:__ 

_No statistical analyses were performed.. 


Justification and Impact on Study: 


_This project was a survey, rather than hypothesis testing, so no statistical 

methods were implemented 


Submitted by: Signature: 


Authorized by: Study Director: 


Received by: Quality Assurance Unit 



Date: V 

Date: 3 

Date: 3f /# / W 


* Sequentially numbered in order of the date that the change is effective 



Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
AP Molecular Toxicity: Phase V 


£ 9 MAR 

Evaluation of Pendrin Expression in the Offspring of Ammonium Perchlorate- 

Dosed Deer Mice 

STUDY NUMBER: DEMO-03-01 

SPONSOR: Strategic Environmental and Research Development 

Program 

SERDP Program Office 

901 North Stuart Street, Suite 303 

Arlington, VA 22203 

CONTRACT ADMINISTRATOR: The Institute of Environmental and Human Health 

Texas Tech University/TTU Health Sciences Center 
Box 41163 

Lubbock, TX 79409-1163 

The Institute of Environmental and Human Health 
Texas Tech University 
Box 41163 

Lubbock, TX 79409-1163 

The Institute of Environmental and Human Health 
Texas Tech University 
Box 41163 

Lubbock, TX 79409-1163 

Texas Tech University 
Human Sciences Building 
Box 42002 

Lubbock, TX 79409-2002 
RESEARCH INITIATION: July 2, 2003 

RESEARCH COMPLETION: December 31, 2003 


TESTING FACILITY: 


TEST SITE: 


ANIMAL TEST SITE: 


Page 1 of 13 







Final Report TIEHH Project No. T9700 

U.S. Air Force Coop. Agreement CU 1235 AP Molecular Toxicity: Phase V 

Table of Contents 

List of Tables and Figures.3 

Good Laboratory Practice Statement.4 

Quality Assurance Statement. 5 

I. 0 Descriptive Study Title.6 

2.0 Study Number.6 

3.0 Sponsor.6 

4.0 Testing Facility Name and Address.6 

5.0 Proposed Experiment Start and Termination Dates.6 

6.0 Key Personnel.6 

7.0 Study Objectives/Purpose. 6 

8.0 Study Summary. 6 

9.0 Test Materials.7 

10.0 Justification of Test System.7 

II. 0 Test Animals.7 

12.0 Procedure for Identifying the Test System.7 

13.0 Experimental Design Including Bias Control.8 

14.0 Methods.8 

15.0 Results. 9 

16.0 Discussion. 10 

17.0 Study Records and Archive.11 

18.0 References.12 


Page 2 of 13 
























Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
AP Molecular Toxicity: Phase V 


List of Tables and Figures 

Figure 1. Relative pendrin gene expression in deer mice kidney following exposure 
to ammonium perchlorate. Page 10. 


Page 3 of 13 



Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
AP Molecular Toxicity: Phase V 


GOOD LABORATORIES PRACTICES STATEMENT 

This study was conducted in accordance with established Quality 
Assurance Program guidelines and in the spirit of Good Laboratory Practice Standards 
whenever possible (40 CFR Part 160, August 17, 1989). 


Submitted By: 



Page 4 of 13 


Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
AP Molecular Toxicity: Phase V 


QUALITY ASSURANCE STATEMENT 


This study was conducted under The Institute of Environmental and Human 
Health Quality Assurance Program and whenever possible to meet the spirit of the Good 
Laboratory Practices as outlined in 40 CFR Part 160, August 17, 1989. 



dcd, 2<r Z WY 

Date ' 


Page 5 of 13 



Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
AP Molecular Toxicity: Phase V 


1.0 DESCRIPTIVE STUDY TITLE: 

Evaluation of Pendrin Expression in the offspring of Perchlorate-dosed Deer Mice 

2.0 STUDY NUMBER: DEMO-03-01 


3.0 SPONSOR: 

Strategic Environmental and Research Development Program 

SERDP Program Office 

901 North Stuart Street, Suite 303 

Arlington, VA 22203 

4.0 TESTING FACILITY NAME & ADDRESS: 

The Institute of Environmental and Human Health 
Texas Tech University 
Box 41163 

Lubbock, TX 79409-1163 

5.0 PROPOSED EXPERIMENTAL START & TERMINATION DATES: 

Start Date: July 2,2003 

Termination Date: December 31, 2003 

6.0 KEY PERSONNEL: 

Ernest Smith, CO-PI 
Angella Gentles, CO-PI 
Bharath Ramachandran, Study Director 
Ryan Bounds, Quality Assurance Officer 

Ron Kendall, Principal Investigator and Testing Facility Management 

7.0 STUDY OBJECTIVES / PURPOSE: 

The objective of this study was to determine the effect of perchlorate on the 
expression of pendrin in the deer mouse kidney. 

8.0 STUDY SUMMARY: 

In this study deer mice pups were exposed to ammonium perchlorate at 3 
concentrations: Oppm, 58.9 ppm, and 117.9 ppm. The pups were euthanized at 
postnatal day 21 and the kidneys quickly removed and placed in liquid nitrogen. 
They were then processed to isolate total RNA, which was used in reverse 
transcription polymerase chain reaction (PCR) to generate the cDNA for pendrin. 
A parial deer mice specific cDNA sequence was obtained. The cDNA was used 
to generate deer mice specific probe and a set of reverse and forward primers 
thate were utilized in real time PCR to quantitate the relative pendrin gene 
expression in the kidney of treated and control animals. The results show that AP 
at concentrations of 117ppm and 58.9ppm, significantly (P < 0.05) reduced 
pnedrin relative gene expression in the kidney of the deer mouse. Exposure to 
AP at 117.9 ppm did not appear to decrease relative pendrin gene expression 


Page 6 of 13 




Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
AP Molecular Toxicity: Phase V 


compared to AP at the 58.9 ppm dose level. This represents the first 
indentification of pendrin in the deer mice and indicate that perchlorate and or the 
secondary effects of perchlorate on the thyroid hormone axis may have signifcant 
effects on other organ systems at the molecular level. 


9.0 TEST MATERIALS: 

Test Chemical: Ammonium Perchlorate 99.999% pure 

Source: Sigma-Aldrich 

Characterization: Oxidizer; explodes when heated 

Test Medium: Deionized Water 


10.0 JUSTIFICATION OF TEST SYSTEM 

Deer mice were used in this project because they are ubiquitous, opportunistic and 
are sentinel for wildlife. They are also easily handled, permit large sample sizes, 
and are more economically feasible in a study of this nature. 

Live animals are necessary because culture and computer models cannot simulate 
changes in general homeostasis. In addition, culture and computer models would 
not provide pertinent scientific data for future use in risk assessment. 

11.0 TEST ANIMALS: 

Species: Deer Mice 

Strain: Wild type 

Age: Postnatal day (PND) 0-21) 

Sex: Males and Females 

Number: Deer mice = 23 pups and 18 pairs of adults 

Source: In house breeding colony 


12.0 PROCEDURE FOR IDENTIFYING THE TEST SYSTEM: 

Each cage was labeled as indicated in TIEHH SOP IN-3-06; label included genus 
and species name; common name; project name, number, and start date; and the 
name of the person responsible for animal care. Each cage was labeled to include 
sex of the individuals (if appropriate), date of birth of pups, date of exposure, the 
name of the test substance and its concentration. Rodents were ear marked with 
unique identification numbers according to SOP ET-3-18. 


Page 7 of 13 




Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
AP Molecular Toxicity: Phase V 


13.0 EXPERIMENTAL DESIGN INCLUDING BIAS CONTROL: 

This experiment consisted of 3 treatment groups: Control, 58.9ppm AP andl 17.9ppm AP. 
Each treatment group had 6 pairs of adult animals. 


14.0 METHODS 

14.1 Test System acquisition, quarantine, and acclimation. 

Adult deer mice were obtained from our breeding colony at Texas Tech 
University. They were maintained in standard cages lined with sani-chip 
bedding and kept on a 16L: 8D light regimen. 

14.2 Assignment of Animals to Study Group and Identification 

Animals were arbitrarily assigned to 1 of 3 treatment groups upon 
selection from the colony. 

14.3 Test Material Application 

The adult mice were exposed to AP via drinking water. AP was dissolved 
in deionized water at the prescribe rate. The pups were exposed 
gestationally and lactationally. 

Rates/concentrations: 

AP was given at concentrations of Oppm, 58.9ppm, and 117.9 ppm in 
water. 

Frequency: AP-treated drinking water was provided ad libitum . 

Route/Method of Application: The pups were exposed gestationally and 
lactationally. 

14.4 Daily Observations 

Animals were monitored daily for changes in general health. If any 
changes were observed, animals were treated according to the University 
Veterinarian. 

14.5 Animal Euthanasia and Sample Collections 

On PND 21, the pups were euthanized using carbon dioxide asphyxiation 
and selected tissues including the kidneys were quickly extirpated, 
wrapped in pre-labeled foil, and placed in liquid nitrogen. 

RNA Isolation 

Total RNA was extracted, according to manufacturer’s procedure, from 
control and ammonium perchlorate-treated kidney using Trizol Reagent 
(BRL, Gaithersburg, MD). The tissues were homogenized in Trizol 
Reagent ( 0.5 mg tissue/ml Trizol) and incubated at room temperature 
(RT) for 5 min. Chloroform (0.2 ml/ml Trizol) was then added to each 


Page 8 of 13 





Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
AP Molecular Toxicity: Phase V 


tube. After this, the tubes were then shaken and incubated at RT for 3 min. 
They were then centrifuged at 12,000-x g for 15 min at 4 C. The aqueous 
phase was transferred to a new tube and 0.5 ml isopropyl alcohol (per ml 
supernatant) and incubated for 10 min at RT. These were then centrifuged 
at 12,000 x g for 10 min at 4 C. The supernatant was removed and the 
pellet washed with 75% ethanol. The pellets were air dried for 5-10 min 
and dissolved in 50pi nuclease-free water. The RNA concentration was 
then determined spectrophotometrically at 260nm. 

cDNA Cloning. Sequencing and RT-PCR analysis of the deer mice 
mRNA 

An aliquot of total mRNA (2ug) of Deer mouse kidney mRNA was 
reverse transcribed, using an oligodT-primed first-strand kit (Ambion, TX) 
to generate deer mice cDNA for amplification and gene isolation. 

For PCR amplification, reverse and forward oligonucleotide primers were 
designed according to the sequence for pendrin in Mus musculus. PCR 
was carried out using a Failsafe kit (Epicentre, WI). PCR was conducted 
for 40 cycles of denaturation (92 C, 30 sec), annealing (53 C, 30 sec.) and 
extension (72 C, 45 sec.), with a 5 min final extension. The deer mouse- 
pendrin PCR product was sequenced for identification and verification 
using an ABI (Perkin Elmer) DNA sequencer by Texas Tech Biotechnolgy 
Center. 

Subsequently, the deer mice specific cDNA sequence was submitted to 
ABI primer design software for the development of Taqman specific 
probes and primers for Real Time PCR quantification of mRNA 
equivalents (Smith et al., 2002). 

Sense primer sequence - GTCCCCAAAGTGCCAATCC; anti-sense 
primer - ACTCCTACCACATCCAGGAAGGA; 

Taqman probe - AGCCTGGTGCTGGACTGTGGAGCT. 

Data was standardized against GAPDH and analyzed for statistical 
difference with ANOVA and a multi-comparisons test using MiniTab 
statistical software. 


15.0 Results 

mRNA isolated from deer mice kidney was successfully transcribed to 
cDNA. A partial cDNA sequence for pendrin was generated by PCR and 
using deer mice specific primers. The PCR product was sequence and 
compared to Genbank sequence. The deer mice specific sequence was 
determined to be 97% similarity to the cDNA sequence posted for human 
pendrin gene. Deer mice specific real time primer set and probe generated 
from the deer mice specific sequence were subsequently used successfully 
in real-time PCR to determine the effect of exposure AP on transcriptional 
expression of pendrin. The result is shown in Figure 1. Ammonium 


Page 9 of 13 



Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
AP Molecular Toxicity: Phase V 


perchlorate at 58.9 and 117.9 ppm, significantly suppressed transcriptional 
expression of pendrin in the kidneys relative to control animals. 
Ammonium perchlorate-treated kidneys had approximately one half the 
level of pendrin expressed in the control kidneys. 


Relative pendrin gene expression in deer mice kidney following 
exposure to ammonium perchlorate 



16 
14 
12 
10 
8 
6 
4 
2 
0 

Perchlrate Exposure Concentration 



Figure 1 


16.0 Discussion 

The kidney plays a major role in maintaining and controlling systemic acid-base 
homeostasis by reabsorbing bicarbonate and secreting protons and acid- 
equivalents, respectively. During postnatal kidney development and adaptation 
to changing diets, plasma bicarbonate levels are increasing, the capacity for 
urinary acidification maturates, and the final morphology and distribution of 
intercalated cells is achieved (Bonnici and Wagner 2004). Variation in pendrin 
expression has been reported in the kidney during postnatal maturation. Pendrin 
is an anion exchanger expressed along the apical plasma membrane and apical 
cytoplasmic vesicles of type B and of non-A, non-B intercalated cells of the 
distal convoluted tubule, connecting tubule, cortical collecting duct, the thyroid 
and a few other tissues (Verlander et al., 2003; Frische et ah, 2003; Wagner, et 
ah, 2002; Wall et ah, 2003). Pendrin is involved in iodide, chloride, and 
HCO(3)(-) secretion. Recently, Wall et ah, (2003) reported that pendrin mRNA 
expression in the cortex is at least fivefold higher in CCD and the connecting 
tubule (CNT) than in the other segments and concluded that pendrin is 
expressed in the mouse distal convoluted tubule, CCD, and CNT along the 
apical plasma membrane of non-A-non-B intercalated cells and in subapical 
cytoplasmic vesicles of type B intercalated cells. 


In this experiment, a partial sequence for pendrin was isolated from the kidney 
of the deer mouse. Submission of this cDNA sequence to GenBank revealed a 
97% similarity to that of human. Real time PCR was used to determine the 


Page 10 of 13 






























Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
AP Molecular Toxicity: Phase V 


relative expression of pendrin mRNA in the kidney of deer mice exposed to 
ammonium perchlorate. The result of this experiment shows that exposure to 
AP at 58.9 and 117.9 ppm, significantly suppressed transcriptional expression of 
pendrin in the kidneys. Ammonium perchlorate-treated kidneys had 
approximately one half the level of pendrin expressed in the control kidneys. 
Because pendrin transport HC03- and Cl-anions, exposure to perchlorate could 
induce abnormalities in the acid-base and NaCl balance as well as blood 
pressure, and body weight. Furthermore, the altered regulation of pendrin 
suggests that metabolic alkalosis could be severely affected as has been 
demonstrated in pendrin-null transgenic mice (Verlander, et al., 2003) and could 
be critical in the pathogenesis of xenobiotic-induced hypertension. Further 
research in this area will help to elucidate the role of perchlorate and its effect 
on pendrin protein expression in the well-established regulation of HCO(3)(-) 
secretion in the CCD in response to chronic changes in acid-base balance and 
suggest that regulation of pendrin expression may be clinically important in the 
correction of acid-base disturbances (Frische, et ah, 2003). 

In the thyroid gland pendrin gene, localizes to the apical membrane of thyroid 
follicular cells and is thought to enable efflux of iodide into the follicle lumen, a 
process that genetic and/or environmental factors can influence in the thyroid as 
well as the kidney (Taylor et al., 2002). Ammonium perchlorate interference 
with the regulation of pendrin may also have pertinent implication in AP- 
thyrotoxicosis and the regulation of iodide metabolism. One contemporary 
mechanism for the toxicity of perchlorate anion, is that it competitively inhibits 
iodide transport via the sodium/iodide symporter in the thyroid follicular cells. 
The results from this study suggest that AP may inhibit thyroid hormone 
synthesis at the molecular level by suppressing pendrin; a gateway molecule 
involved in thyroid hormone synthesis. 


Page 11 of 13 




Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
AP Molecular Toxicity: Phase V 


Reference List 

1. Bonnici, B. and Wagner, C. A. (2004). Postnatal expression of transport proteins 
involved in acid-base transport in mouse kidney. Pflugers Arch. 

2. Everett, L. A., Morsli, H., Wu, D. K., and Green, E. D. (1999). Expression pattern 
of the mouse ortholog of the Pendred's syndrome gene (Pds) suggests a key role for 
pendrin in the inner ear. Proc Natl Acad Sci U S A 96, 9727-32. 

3. Frische, S., Kwon, T. H., Frokiaer, J., Madsen, K. M., and Nielsen, S. (2003a). 
Regulated expression of pendrin in rat kidney in response to chronic NH4C1 or 
NaHC03 loading. Am J Physiol Renal Physiol 284, F584-93. 

4. Frische, S., Kwon, T. H., Frokiaer, J., Madsen, K. M., and Nielsen, S. (2003b). 
Regulated expression of pendrin in rat kidney in response to chronic NH4C1 or 
NaHC03 loading. Am J Physiol Renal Physiol 284, F584-93. 

5. Lacroix, L., Mian, C., Caillou, B., Talbot, M., Filetti, S., Schlumberger, M., and 
Bidart, J. M. (2001). Na(+)/I(-) symporter and Pendred syndrome gene and protein 
expressions in human extra-thyroidal tissues. Eur J Endocrinol 144, 297-302. 

6. Scott, D. A., Wang, R„ Kreman, T. M„ Sheffield, V. C., and Kamiski, L. P. (1999). 
The Pendred syndrome gene encodes a chloride-iodide transport protein. Nat Genet 
21, 440-3. 


7. Taylor, J. P., Metcalfe, R. A., Watson, P. F., Weetman, A. P., and Trembath, R. C. 
(2002). Mutations of the PDS gene, encoding pendrin, are associated with protein 
mislocalization and loss of iodide efflux: implications for thyroid dysfunction in 
Pendred syndrome. J Clin Endocrinol Metab 87, 1778-84. 

8. Verlander, J. W., Hassell, K. A., Royaux, I. E., Glapion, D. M., Wang, M. E., 
Everett, L. A., Green, E. D., and Wall, S. M. (2003a). Deoxycorticosterone 
Upregulates PDS (Slc26a4) in Mouse Kidney. Role of Pendrin in 
Mineralocorticoid-Induced Hypertension. Hypertension. 

9. Verlander, J. W., Hassell, K. A., Royaux, I. E., Glapion, D. M., Wang, M. E., 
Everett, L. A., Green, E. D., and Wall, S. M. (2003b). Deoxycorticosterone 
upregulates PDS (Slc26a4) in mouse kidney: role of pendrin in mineralocorticoid- 
induced hypertension. Hypertension 42, 356-62. 

10. Wagner, C. A., Finberg, K. E., Stehberger, P. A., Litton, R. P., Giebisch, G. H., 
Aronson, P. S., and Geibel, J. P. (2002). Regulation of the expression of the Cl- 
/anion exchanger pendrin in mouse kidney by acid-base status. Kidney Int 62, 2109- 
17. 


Page 12 of 13 


Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
AP Molecular Toxicity: Phase V 


11. Wall, S. M., Hassell, K. A., Royaux, I. E., Green, E. D., Chang, J. Y., Shipley, G. 
L., and Verlander, J. W. (2003). Localization of pendrin in mouse kidney. Am J 
Physiol Renal Physiol 284, F229-41. 


Page 13 of 13 




Project No.: T9700 



A STUDY PROTOCOL 
ENTITLED 

Evaluation Of Pendrin Expression In The Offspring Of Ammonium Perchlorate-Dosed Deer 

Mice 


STUDY NUMBER: DEMO-03-01 


SPONSOR: Strategic Environmental and Research Development Program 

SERDP Program Office 

901 North Stuart Street, Suite 303 

Arlington, VA 22203 


TESTING FACILITY 
Name/Address: 


Test Facility Management: 
Study Director: 


The Institute of Environmental and Human Health 
Texas Tech University 

Texas Tech University Health Sciences Center 
Box 41163 

Lubbock, TX 79409-1163 
Dr. Ronald J. Kendall 
Bharath Ramachadran 


Proposed Experimental Start Date: July 2,2003 


Page 1 of 6 



Project No.: T9700 


DESCRIPTIVE STUDY TITLE: 

Evaluation of Pendrin Expression in the offspring of Perchlorate-dosed Deer mice 

STUDY NUMBER: 

DEMO-03-01 

SPONSOR: 

Strategic Environmental and Research Development Program 

SERDP Program Office 

901 North Stuart Street, Suite 303 

Arlington, VA 22203 

TESTING FACILITY NAME & ADDRESS: 

The Institute of Environmental and Human Health 
Texas Tech University 

Texas Tech University Health Sciences Center 
Box 41163 

Lubbock, TX 79409-1163 

PROPOSED EXPERIMENTAL START & TERMINATION DATES: 

Start Date: July 2, 2003 

Termination Date: December 31, 2003 

KEY PERSONNEL: 

Ernest E. Smith, Co-Principal Investigator 

Angella Gentles, Co-PI 

Bharath Ramachandran, Study Director 

Lance Williams, Animal Care 

Ryan Bounds, Quality Assurance Manager 

James Surles, Statistical support 

Ron Kendall, Principal Investigator and Testing Facility Management 


Dr. Ernest Smith 
Co-Principal Investigator 

Dr. Angella Gentles 
Co-PI 

Bharath Ramachandran, 
Study Director 

Mr. Ryan Bounds 
Quality Assurance 
Manager 





Project No.: T9700 


Zl 


—y ^^- 

-!~3-ca 




Dr. James Surles 
Statistical Support 

Dr. Todd Anderson 
Asst. Director - TEEHH 

Dr. Ron Kendall 
Testing Facility 
Management 


8. REGULATORY COMPLIANCE STATEMENT 
Quality Control and Quality Assurance 

This study will be conducted in accordance with established Quality Assurance 
program guidelines and in the spirit of Good Laboratory Practice Standards 
(40 CFR Part 160, August 17, 1989). 

9. STUDY OBJECTIVES / PURPOSE: 

To determine the effect of gestational and lactational exposure to ammonium 
perchlorate (AP) on pendrin expression in offspring of AP-treated deer mice. 

10. STUDY SUMMARY: 

In this study, adult deer mice will be exposed to AP and the effect of exposure on the 
expression of pendrin in their offspring will be analyzed. This experiment provides a 
realistic assessment of exposures that are likely to occur in environments 
contaminated with perchlorate. 


II. TEST MATERIALS: 

Test Chemical: Ammonium Perchlorate 99.999% pure 

Source: Sigma-Aldrich 

Characterization: Oxidizer; explodes when heated 

Test Medium: Deionized Water 


12. JUSTIFICATION OF TEST SYSTEM 


This project is intended to evaluate risks of perchlorate exposure among organisms 
consuming perchlorate-contaminated water. Deer mice will be used as sentinels to 
wildlife and livestock (the most likely exposed organisms) because they permit large 
sample sizes and are economically and easily maintained. 

This study represents the second phase of an ongoing project that requires live animals 
for each experiment and cannot be substituted with culture or computer generated 
models. Culture and computer models cannot simulate changes in general homeostasis 
and thyroid hormone alteration. In addition, they would not provide pertinent 
scientific data for furture use in risk assessment. 


13. TEST ANIMALS: 

Species: Deer mice 


Page 3 of 6 





Project No.: T9700 


4 - r - 


Strain: 

Wild type 

Age: 

Weanlings 

Sex: 

Male and Female 

Number: 

Approximately 40 

Source: 

In house breeding colony 


14. PROCEDURE FOR IDENTIFYING THE TEST SYSTEM: 

Each cage will be labeled as indicated in TIEHH SOP IN-3'06, which includes genus 
and species name; common name; project name, number, and start date; and the name 
of the person responsible for animal care. Each cage will also be labeled to include 
sex of the individuals (if appropriate), date of birth, date of exposure, the name of the 
test substance and its concentration. Deer mice will be ear marked with unique 
identification numbers according to SOP ET-3-18. 

15. EXPERIMENTAL DESIGN INCLUDING BIAS CONTROL: 

This experiment will consist of 2 treatment groups; Oppm AP (control) and 117ppm 
AP. Each treatment group will have 4 breeding pairs of animals. 

16. METHODS: 

Rodent Selection, Procurement and treatment group assignment: Sexually mature 
male and female deer mice will be selected from colonies housed in the AAALAC- 
accredited animal facility at Texas Tech University Human Sciences and randomly 
assigned to control or perchlorate-contaminated water. The effects of exposure to 
perchlorate will be evaluated at postnatal day 21 and 45 following gestational 
exposure. 

Dosing rodents: Eight breeding pairs of deer mice will be arbitrarily assigned to 
control or perchlorate treatment group (ie 4 pairs per treatment). They will be housed 
in standard rodent cages (11 1/2 x 7 x 5 1/2) lined with aspen sani-chips. Exposure 
will be initiated the same day the animals will be paired. Water and food will be 
provided ad libitum throughout the experiment. Daily observations will be made on 
all deer mice. Animals showing signs of distress or disease will be treated according 
to the instructions of the University Vetemarian. 

Necropsy: At PNDs 21 and 45, pups will be narcosed by CO 2 and euthanization will 
be ensured by cervical dislocation. Blood samples will be collected by cardiac 

o 

puncture. The plasma will be aliquoted and frozen (-80 C) until hormone analysis. 
Gonads, thyroid and kidneys will be removed, trimmed and weighed. The collected 
tissue will be frozen for molecular analysis of pendrin mRNA levels. Liver samples 
will be removed and used for perchlorate exposure verification. 

All deer mice handling will be done according to Standard Operating Procedures. 


Page 4 of 6 


Project No.: T9700 


16.1 Test System acquisition, quarantine, and acclimation. 

Adult deer mice will be obtained from our breeding colony at Texas Tech 
University. They will be maintained in standard cages lined with sani-chip 
bedding and kept on a 16L: 8D light regimen. 

16.2 Assignment of Animals to Study Group and Identification 

Animals will be assigned arbitrarily to treatment groups upon selection from 
the pool. 

16.3 Test Material Application 

Ammonium perchlorate will be dissolved in the drinking water of deer mice 
(SOP IN 3-05) at a concentration 117 ppm. Deer mice in the control group 
will be given untreated deionized water 
Rates/concentrations: perchlorate (117 ppm) or no treatment. 

Frequency: Test substances will be supplied ad libitum and renewed every 3 
days. 

Route/Method of Application: Adult deer mice will be exposed to AP orally 
via drinking water. The offsprings will be exposed to AP gestationally and 
lactationally. 

16.4 Daily Observations 

Animals will be monitored daily for changes in general health. Based on 
previous studies, no dead or moribund animals are expected to result from 
this exposure. 

16.5 Evaluations 

Selected organs (SOP ET-3-19) will be collected for evaluation of pendrin 
expression. 

17. PROPOSED STATISTICAL METHODS 

Organ weight and hormone concentration will be subjected to ANOVA and multi¬ 
comparison analysis. 

18. REPORT CONTENT/RECORDS TO BE MAINTAINED: 

Records to be maintained include animal receipt, animal care, test material preparation 
and application, animal observations, sex ratio results and facility records for 
personnel, equipment, etc. 

Report content will include presentation of data, interpretation, and discussion of the 
following endpoints: 

Study Methods 

Survival of treatment animals 

Chemical analysis results 

Interpretation of all data, including statistical results 
Discussion of the relevance of findings 

Page 5 of 6 







Project No.: T9700 


List of all SOPs used 

19. RECORDS TO BE MAINTAINED LOCATION: 

A final report containing the results of the dosing studies will be delivered to the 
Sponsor on or before March 20, 2004.. Copies of all data, documentation, records, 
protocol information, as well as the specimens shall be sent to the Sponsor, or 
designated delivery point upon request (within six months of study completion). All 
data, the protocol and a copy of the final report shall be maintained by the testing 
facility for up to 3 years. 

20. QUALITY ASSURANCE: . . . 

The Quality Assurance Unit will inspect the study at intervals to insure the integrity ot 
the study. Written records will be maintained indicating but not limited to the 
following: date of inspection, study inspected, phase inspected, person conducting the 
inspection, findings and problems, recommended and taken action, and any scheduled 
reinspections. Any problems likely to affect study integrity shall be brought to the 
immediate attention of the Study Director. The Quality Assurance Unit will 
periodically submit written status reports on the study to management and the Study 
Director. 

21. PROTOCOL CHANGES / REVISIONS: 

All changes and/or revisions to the protocol, and the reasons therefore, shall be 
documented, signed and dated by the Study Director and maintained with the protocol 
and the Quality Assurance Unit. 

22. REFERENCES: 

Thuett et al., 2002. Journal of Environmental Toxicology and Health 


Page 6 of 6 








TIEHH 
Box 41163 

Lubbock, TX 79409-1163 
(806) 885-4567 
qa@tiehh.ttu.edu 


Form No. 014 Rev. 3.06/00 

Project No.: T9700_ 

*Change No.: _1_ 

Page: 1 of 1 


Change In Study 
Documentation Form 


The following documents changes in the above referenced study: 

Check One: Amendment X Deviation _Addendums 


Document Reference Information 

Check One: X Protocol _SOP _Other_ 

Title: Evaluation of Pendrin Expression in the Offspring of Ammonium Perchlorate-Dosed Deer 
Mice 

Dated: July 2,2003 
Document # (if appropriate): 

Page #(s): 

Section #: 

Text to reference: 


Change in Document: 

It was indicated in the study protocol that 2 concentrations of AP would be used for this 
experiment. Three concentrations were used. 


Justification and Impact on Study: 

We need to determine if there was a dose-response relation; 2 levels of dosing could not provide 
such information. 


Submitted by: Signature:_ 

Authorized by: Study Director: _ 

Received by: Quality Assurance Unit: 



Date: oiiz3j oif. 
Date: 

Date: Q3\?-s\ o4 


























Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
(AFS-02-01) Phase V 


A Final Report 

Avian Exposure to Perchlorate - Field Study 

STUDY NUMBER: AFS-02-01 

SPONSOR: Strategic Environmental and Research 

Development Program 
SERDP Program Office 
901 North Stuart Street, Suite 303 
Arlington, VA 22203 



CONTRACT ADMINISTRATOR: The Institute of Environmental and Human Health 

Texas Tech University/TTU Health Sciences Center 
Box 41163 

Lubbock, TX 79409-1163 

TESTING FACILITY: The Institute of Environmental and Human Health 

Texas Tech University 
Box 41163 

Lubbock, TX 79409-1163 


TEST SITE: The Institute of Environmental and Human Health 

Texas Tech University 
Box 41163 

Lubbock, TX 79409-1163 


ANIMAL TEST SITE: Longhorn Army Ammunition Plant 

Kamack, Texas 


RESEARCH INITIATION: October 1, 2002 

RESEARCH COMPLETION: December 31, 2003 


Page 1 of 14 








Final Report TIEHH Project No. T9700 

U.S. Air Force Coop. Agreement CU 1235 (AFS-02-01) Phase V 


Table of Contents 

List of Tables and Figures.3 

Good Laboratory Practice Statement.4 

Quality Assurance Statement.....5 

I. 0 Descriptive Study Title.6 

2.0 Study Number.6 

3.0 Sponsor.6 

4.0 Testing Facility Name and Address.6 

5.0 Proposed Experiment Start and Termination Dates...6 

6.0 Key Persomiel. 6 

7.0 Study Objectives/Purpose.6 

8.0 Study Summary.6 

9.0 Test Materials.7 

10.0 Justification of Test System.7 

II. 0 Test Animals...8 

12.0 Procedure for Identifying the Test System.8 

13.0 Experimental Design Including Bias Control.8 

14.0 Methods. 8 

15.0 Results.9 

16.0 Discussion.12 

17.0 Study Records and Archive.13 

18.0 References.13 


Page 2 of 14 

























Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
(AFS-02-01) Phase V 


List of Tables and Figures 

Table 1. Summary statistics for nesting activity of wood ducks in 2002 at the Longhorn Army 
Ammunition Plant (LHAAP), Kamack, Texas. 

Table 2. Perchlorate concentrations in potential wood duck forage items collected from the 
LHAAP in Kamack, Texas in 2002. 

Table 3. Summary for nesting activity of wood ducks in 2003 at the LHAAP, Kamack, Texas. 


Page 3 of 14 





Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
(AFS-02-01) Phase V 


GOOD LABORATORIES PRACTICES STATEMENT 

This study was conducted in accordance with established Quality Assurance 
Program guidelines and in the spirit of the Good Laboratory Practice Standards whenever 
possible (40 CFR Part 160, August 17,1989). 

Submitted By: 



Page 4 of 14 


Filial Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
(AFS-02-01) Phase V 


QUALITY ASSURANCE STATEMENT 


This study was conducted under The Institute of Environmental and Human Health 
Quality Assurance Program and whenever possible to meet the spirit of the Good Laboratory 
Practices as outlined in 40 CFR Part 160, August 17,1989. 



'3- Zt-oH 

Date 


Page 5 of 14 



Final Report 

U.S. Air Force Coop. Agreement CU 1235 

1.0 DESCRIPTIVE STUDY TITLE: 

Avian exposure to perchlorate—field studies 

2.0 STUDY/PROTOCOL NUMBER: 

AFS-02-01 

3.0 SPONSOR: 

Strategic Environmental and Research 
Development Program 
SERDP Program Office 
901 North Stuart Street, Suite 303 
Arlington, VA 22203 

4.0 TESTING FACILITY NAME & ADDRESS: 

The Institute of Environmental and Human Health 

Texas Tech University / Texas Tech University Health Sciences Center 

Box 41163 

Lubbock, Texas 79409-1163 

5.0 PROPOSED EXPERIMENTAL START & TERMINATION DATES: 

Start Date: October 1, 2002 
Termination Date: December 31, 2003 

6.0 KEY PERSONNEL: 

Dr. Scott T. McMurry, Project Manager 
Dr. Philip N. Smith, Project Manager 
Mr. Ryan Bounds, Quality Assurance Officer 

Dr. Ronald J. Kendall, Principle Investigator / Testing Facility Management 

7.0 STUDY OBJECTIVES /PURPOSE: 

The data collected in 2003 was a continuation of the 2002 project designed to assess 
exposure to perchlorate in avian species. The focus of the study in 2003 was to obtain a 
more robust data set on perchlorate exposure in wood ducks (especially eggs) at the 
LHAAP. Objectives of the field studies in 2003 were to determine: 

> The reproductive success of wood ducks (aquatic avian model) nesting at the 
LHAAP and survival and growth of their chicks. 

> The level of perchlorate in wood duck eggs as an index of maternal transfer of 
perchlorate. 

8.0 STUDY SUMMARY: 

The Interagency Perchlorate Steering Committee (IPSC) identified avian exposure 
studies as a data gap in research efforts involving perchlorate. Given the lack of research 
on exposure and effects of perchlorate in avian species, several specific areas were 
identified as data gaps. These included assessing endpoints in birds such as levels of, and 
relationships between, perchlorate residues and hormone concentrations in adults. Also, 
the level of perchlorate transfer into eggs, reproductive success (e.g., number of clutches, 


TIEHH Project No. T9700 
(AFS-02-01) Phase V 


Page 6 of 14 




Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
(AFS-02-01) Phase V 


clutch size, egg viability, hatching rates), and recruitment of viable chicks (e.g., survival, 
growth, development) were all identified as data gaps. Other data gaps included 
evaluating food items as sources of exposure in birds, determining safe perchlorate levels 
in birds using controlled laboratory studies, and developing PBPK models for avian 
species. Our purpose is to aid in the filling of these data gaps. 

In this study, we proposed to study avian exposure to perchlorate using aquatic and 
terrestrial avian species. Recent analyses of perchlorate residues in various plant and 
animal matrices indicates that significant exposure can occur from ingestion of aquatic 
invertebrates and aquatic and terrestrial plants (Smith et al, 2002). For example, 
composites of damselfly larvae averaged 1.5 ppm (+0.3, n=3 composite samples) 
perchlorate in contaminated impoundments at the LHAAP. Bulrush samples (n=4) from 
the same site averaged 7.6+1.4 and 4.4+2.2 ppm in above and below waterline samples, 
respectively. Sediment samples from this site averaged 25.1+6,8ppm perchlorate. 
Terrestrial plant samples (n=l for each sample type) collected in 2002 near building 25C 
showed even higher concentrations of perchlorate, ranging from 6 ppm in stems of 
goldenrod to 5,557 ppm in blades of crabgrass. Seeds of these plants also contained 
significant amounts of perchlorate, with 1,880 ppm in crabgrass seeds and 184 ppm in 
goldenrod seeds. These data, although of limited sample size, indicate the potential for 
exposure through food chains by omnivorous wildlife. Based on the data presented 
above, we believe that avian species that consume both animal and plant material are at 
risk of exposure to perchlorate at contaminated sites. Avian species that use aquatic 
habitats are at risk of exposure to perchlorate through ingestion of aquatic invertebrates 
and aquatic plants. Likewise, terrestrial avian species are at similar risk of exposure. 

9.0 TEST MATERIALS: 

The test material is perchlorate in the environment. 

10.0 JUSTIFICATION OF TEST SYSTEM: 

Wood ducks {Aix sponsa ) are year-round residents throughout the southeastern United 
States. They occur in abundance throughout Caddo Lake and its backwaters associated 
with the LHAAP, and are easily cultured in the field by erecting nest boxes in study 
areas. They consume a variety of plant and animal foods including the seeds, fruits, and 
vegetative material of aquatic and terrestrial plants (Landers et ah, 1977; Drobney and 
Fredrickson, 1979; Delnicki and Reinecke, 1986). In addition, wood ducks consume a 
diverse number 

of aquatic invertebrate species (Landers et al., 1977). Diet composition varies between 
males and females and breeding versus non-breeding females (Drobney and Fredrickson, 
1979). In general, plant material comprises 50 to 60% of the diet for males and females, 
with the balance consisting of animal material. The major exception is egg-laying 
females that consume nearly 80% animal material. 

Water and food consumption rates for wood ducks are unclear, but estimates can be 
derived from similar waterfowl such as mallards and lesser scaup, that consume about 6% 
of their body mass in water, and 8% (scaup) in food, each day. Given the variability in 
perchlorate concentrations in water, plant, and invertebrates at the LHAAP, clear 


Page 7 of 14 




Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
(AFS-02-01) Phase V 


estimates of exposure are difficult to determine. However, water concentrations have 
been documented at 500ppb in Harrison Bayou-fed ponds. Concentrations of perchlorate 
for plant and animal samples were provided above. Based on these concentrations, a 600g 
wood duck could consume as much as 18 jag of perchlorate per day from water 
consumption, and 46 pg to 231 mg of perchlorate per day from food consumption. 

11.0 TEST ANIMALS: 

Species: Wood duck 

Strain: Wild 
Age: Adult 

Number: 20 wood duck eggs (collected in 2002 stored at -20°C and assayed in 2003), 8 
wood duck eggs (collected and assayed in 2003). 

1 merganser egg. 

Source: Collected from perchlorate contaminated sites within the Longhorn Army 
Ammunition Plant, Texas. 

12.0 PROCEDURE FOR IDENTIFYING THE TEST SYSTEM: 

Non-viable and early incubation wood duck eggs were collected and placed into uniquely 
identified bags including, but not limited to, date and nest box ID. 

13.0 EXPERIMENTAL DESIGN INCLUDING BIAS CONTROL: 

Fields studies included monitoring of wood ducks on the LHAAP. Wood duck studies 
involved establishing artificial nesting structures through Harrison Bayou, extending 
from the INF pond toward Caddo Lake. Fifty nest boxes were initially established 
according to established methods (Bellrose and Holm, 1994). Spacing of the nest boxes 
was determined after initial site visits and identification of appropriate habitat. Wood 
ducks do not actively defend territories so they are amendable to nesting in high densities 
when provided artificial nest structures in clumped arrangements (Haramis, 1990). 
Exposure was monitored via perchlorate residues in eggs and diet items. 

14.0 METHODS: 

Sample Collection and Field Procedures 

Longhorn Army Ammunition Plant (LHAAP), Texas 

Wood duck nest boxes were erected at the LHAAP in late December 2001. Forty-nine 
boxes were initially established for the study, however in March 2003 the three boxes 
from the INF pond were removed from the study and one in Harrison Bayou was taken 
over by honey bees. Boxes distributed throughout Harrison Bayou, Goose Prairie Creek, 
Central Creek, and Star Ranch Pond were monitored in March and April of 2003. Nest 
box condition was monitored and recorded as to the presence of nesting material, eggs, 
adult birds, and chicks as well as other inhabitants. 


Page 8 of 14 





Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
(AFS-02-01) Phase V 


Eggs were collected from all boxes with wood duck nesting activity. Since wood duck 
boxes were only monitored twice this year, the number of eggs collected was determined 
by the number of eggs in the box and nest box activity. All eggs were placed in plastic 
bags, labeled (nest box number, date) and frozen at -20°C until residue analysis was 
performed. 


Sample analysis 

In 2002, egg shells were opened and whole egg contents were analyzed without 
separating fetus from egg content. In 2003, egg shells were opened and the contents 
placed in a lOOOmL beaker. If there was a developing fetus inside the egg, then it was 
analyzed separately from the rest of the egg contents. Eggs were analyzed for perchlorate 
content using standard tissue extraction and analysis techniques developed in the 
analytical core of this project (Anderson et al, 2002). 

Statistical Methods 


Data are typically presented as the mean and standard error. Detectable concentrations of 
perchlorate were scant and therefore we were unable to perform any significance tests. 

15.0 RESULTS: 

LHAAP. Texas: year 1 12002) 

Forty-nine wood duck nest boxes were monitored during the course of the breeding 
season in 2002 (Table 1). Of these, only six boxes showed any nesting activity by wood 
ducks. Other species seen in nest boxes included a hooded merganser, owls, and 
squirrels. However, these species were rare occurrences and most nest boxes had no 
activity. Of the six nest boxes with activity, one box was a single clutch, four boxes had 
double clutches, and one box had three clutches, for a total of twelve wood duck nests 
during the season. Mean clutch size was about fifteen eggs with an average of about four 
eggs hatched from each clutch, and a mean hatching rate of almost 36%. Virtually all of 
the nesting activity occurred in boxes in the Star Ranch Pond. Exceptions included a 
double clutch nest along Goose Prairie Creek, and a single clutch nest along Central 
Creek. 


Page 9 of 14 





Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
(AFS-02-01) Phase V 


Table 1 . Summary statistics for nesting activity of 
wood ducks in 2002 at the Longhorn Army 


Ammunition Plant, Kamack, Texas. _ 

Total number of nest boxes 49 

Nest boxes with wood duck activity 6 

No. of boxes with single clutches 1 

No. of boxes with double clutches 4 

No. of boxes with triple clutches 1 

Mean (+SE) clutch size 14.9+1.3 

Mean (+SE) number of eggs hatched 4.3+1.4 

Mean (+SE) percent hatch rate_35.6+10.5 


A total of thirteen wood duck eggs, representing clutches from Star Ranch Pond, Central 
Creek, and Goose Prairie Creek, was analyzed for perchlorate in 2002. Two eggs, one 
each from the Central Creek and Goose Prairie Creek nests, had detectable concentrations 
of perchlorate, at 855 and 7,187 ppb (wet weight), respectively. All other eggs were non- 
detectable for perchlorate. 

A total of twenty wood duck eggs, representing clutches from Star Ranch Pond, Central 
Creek, and Goose Prairie Creek that were collected in 2002 were analyzed for perchlorate 
in 2003. Five of the twenty analyzed were from the Central Creek and Goose Prairie 
Creek clutches that had detectable concentrations as reported in 2002. However, none of 
the twenty eggs collected in 2002 and assayed in 2003 had detectable concentrations of 
perchlorate. 

Potential diet items of wood ducks were collected and analyzed for perchlorate (Table 2). 
In general, perchlorate was either not detected or found in trace amounts in most samples, 
including invertebrates, fish, tadpoles, crustaceans, and plants. Exceptions included 514 
ppb perchlorate in fish from Harrison Bayou, and a range from 379 to 2,442 ppb in plants 
from a variety of sites including Harrison Bayou, Star Ranch Pond, and Central Creek. 
Logistical difficulties precluded collection of diet items from Goose Prairie Creek, but 
previous data indicate similar residue patterns from that area (Smith et al., 2001). These 
authors noted perchlorate concentrations approximately 100 ppb in fish from Goose 
Prairie Creek. 


Page 10 of 14 







Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
(AFS-02-01) Phase V 


Table 2. Perchlorate concentrations in potential wood duck forage items collected from the LHAAP in Kamack, 
Texas in 2002. ___ 

_ Concentration of perchlorate (ppb) _ 

Sample 


ID 

Location 

Invertebrates 

Fish 

Tadpoles 

Crustaceans 

Misc. plants 

Aquatic plants 

FA-1 

SRP1 

trace 

trace 

trace 

— 

ND 

ND 

FA-2 

SRP 

ND 

ND 

ND 

ND 

ND 

trace 

FA-3 

HB 11/122 

— 

— 

-- 

— 

ND 

— 

FA-4 

Boat ramp3 

— 

~ 

— 

— 

ND 

— 

FA-5 

SRP 

ND 

trace 

ND 

— 

— 

trace 

FA-6 

CC4 

ND 

trace 

trace 

— 

— 

2442 

FA-7 

SRP 

ND 

trace 

trace 

— 

ND 

1292 

FA-8 

CC 

trace 

ND 

trace 

— 

ND 

722 

FA-9 

SRP creek5 

ND 

ND 

— 

Trace 

ND 

ND 

FA-10 

HB6 

trace 

trace 

ND 

Trace 

trace 

trace 

FA-11 

HB 

ND 

514 

— 

Trace 

390 

ND 

FA-12 

HB 

— 

— 

— 

— 

trace 

379 


1SRP = Star Ranch Pond 

2HB 11/12 = Harrison Bayou nest box numbers 11 and 12 

3Boat ramp = Boat ramp on Caddo Lake northeast of SRP on the LHAAP. 

4CC = Central creek 

5SRP creek = tributary connecting SRP with Caddo Lake 
6HB = Harrison Bayou 


Page 11 of 14 






Final Report TIEHH Project No. T9700 

U.S. Air Force Coop. Agreement CU 1235 (AFS-02-01) Phase V 


LHAAP. Texas: year 2 f2003) 


Four nest boxes were eliminated from the study in 2003. Three nest boxes located 
at the INF pond were taken down due to no nest box activity and loss of water at 
the site. Box HB18 in Harrison Bayou is now inhabited by honey bees, and was 
not monitored for wood duck activity in 2003. Forty-five wood duck nest boxes 
were monitored during the course of the breeding season in 2003 (Table 3). Of 
these, only four boxes indicated any nesting activity by wood ducks. Other 
species seen in nest boxes included a hooded merganser (CC01), a screech owl 
(GP03), several flying squirrels (HB), and a couple of gray squirrels. Our March 
observations were as follows: CC01 was inhabited by a Merganser with twelve 
eggs and one was collected from the clutch; SRP3 had four warm eggs but no hen 
present at the tune of observation; a total of five wood ducks were sighted during 
this two-day observation period. Our April monitoring was slightly inhibited by 
severe thunderstorms and lightning. April observations are as follows: SRP1 had 
fifteen eggs of which two eggs were collected, no hen was present but nest 
appeared to be tended; SRP2 had a wood duck incubating eighteen eggs of which 
two were collected; SRP3 became a dump nest with approximately forty eggs of 
which three were collected; SRP4 had one egg that was cold to the touch; a total 
of three wood ducks were sighted during this two-day observation period. All of 
the wood duck nesting activity occurred in nest boxes at Star Ranch Pond. 


Table 3. Summary statistics for nesting activity of 
wood ducks in 2003 at the LHAAP, Kamack, Texas. 

Total number of nest boxes 45 

Nest boxes with wood duck activity_4 


Eight eggs were collected from LHAAP during the spring of 2003. The one egg 
collected from the Merganser clutch and assayed in 2003 from the Central Creek 
nest (CC01) had a fetus inside of it. The egg contents had a detectable 
concentration of perchlorate, at 41 ppb (wet weight) but the fetus was non- 
detectable for perchlorate. All other eggs collected in 2003 were from wood ducks 
and were non-detectable for perchlorate. 


16.0 DISCUSSION: 

Birds represent a broad group of wildlife with a long history as sentinel species 
for assessing exposure to contaminants. The primary goal in the second year of 
this study was to obtain a more robust data set on wood ducks at the LHAAP. We 
expected this to be a feasible task given that the nest box array was in place 
throughout the preceding year, offering ample opportunity for wood ducks to 


Page 12 of 14 




Final Report TIEHH Project No. T9700 

U.S. Air Force Coop. Agreement CU 1235 (AFS-02-01) Phase V 

locate the boxes and establish nests. However, box occupancy rates were as 
equally low in the second year as the first year. The most likely explanation for 
low rates of box occupancy is high levels of available natural cavities throughout 
the LHAAP area and Caddo Lake site, which directly compete against artificial 
nest structure. Regardless of the cause, nest boxes in both years suffered from low 
occupancy rates despite being distributed throughout excellent wood duck habitat. 
The lack of occupancy had obvious ramifications on our ability to collect a range 
of samples from throughout the study site. 

We attempted to alleviate the lack of available samples in 2003 by analyzing 
additional samples from 2002, as well as egg samples from 2003. The majority of 
our egg samples collected in either year did not show any detectable levels of 
perchlorate. Only two wood duck eggs and one merganser egg had any 
perchlorate. It is not completely surprising that only a few eggs (or one in these 
cases) would have measurable contaminant concentrations out of the entire clutch. 
Similar observations have been observed in other oviparous species (Wu, 2000). 
This observation in contaminant variation among eggs is probably linked to the 
temporal dynamics of exposure in the female coupled with the temporal process 
of egg development (i.e. exposure in the hen occurring at the proper time for 
incorporation of the contaminant in the egg). Nonetheless, perchlorate is capable 
of moving from the hen into her eggs. A similar study on a site with more 
widespread and higher levels of perchlorate would likely result in a greater 
number of eggs with detectable levels of the contaminant. During much of the 
2002 and 2003 field seasons, perchlorate was being actively removed from the 
LHAAP site, effectly eliminating much of the potential exposure. As reported in 
our 2002 report, birds inhabiting other perchlorate-contaminated sites where 
remediation is not occurring readily showed detectable concentrations of 
perchlorate in their tissues. 

Overall, a variety of different species of birds are capable of accumulating 
perchlorate from the environment. The effects of these exposures are unclear at 
this time. Comparison of the residue levels observed in this study with controlled 
laboratory studies will be instrumental in estimating the potential risk of 
perchlorate exposure to wild species of birds. 

17.0 STUDY RECORDS AND ARCHIVE: 

Study Records will be maintained at The Institute of Environmental and Human 
Health (TIEHH) Archive for a minimum of one year after study completion date. 


18.0 REFERENCES: 

Anderson TA, Wu TH. 2002. Extraction, cleanup, and analysis of the perchlorate 
anion in tissue samples. Bull Environ Contain and Toxicol. 68:684-691. 

Bellrose FC and Holm DJ. 1994. Ecology and management of the Wood Duck. 
Stackpole Books, Harrisburg, PA. 


Page 13 of 14 








Final Report TIEHH Project No. T9700 

U.S. Air Force Coop. Agreement CU 1235 (AFS-02-01) Phase V 


Delnicki D Jr. and Reinecke KJ. 1986. Mid-winter food use and body weights of 
Mallards and Wood Ducks in Mississippi. J. Wildl. Manage. 50: 43-51. 

Drobney RD and Fredrickson LH. 1979. Food selection by Wood Ducks in 
relation to breeding status. J. Wildl. Manage. 43: 109-120. 

Haramis GM. 1990. Breeding ecology of the Wood Duck: a review. Pp 45-60 in 
Proc. 1988 N. Am. Wood Duck symp. St. Louis, MO. 

Landers JL, Fendley TT, and Johnson AS. 1977. Feeding ecology of Wood Ducks 
in South Carolina. J. Wildl. Manage. 53: 378-382. 

Smith PN, Theodorakis CW, Anderson TA, and Kendall RJ. 2001. Preliminary 
Assessment of perchlorate in ecological receptors at the Longhorn Army 
Ammunition Plant (LHAAP), Kamack, Texas. Ecotoxicology. 10: 305- 
313. 

Tian K, Dasgupta PK, and Anderson TA. 2003. Determination of trace 

Perchlorate in high-salinity water samples by ion chromatography with 
line preconcentration and preelution. Analytical Chemistry. 75: 701-706. 

Wu, T. 2000. Evaluation of organochlorine residues in Morelet’s and American 
crocodile eggs from Belize. M.S. thesis, Texas Tech University, Lubbock, 
Texas. 120pp. 


Page 14 of 14 


Project No. T9700 


A STUDY PROTOCOL 
ENTITLED 

Avian Exposure to Perchlorate—Field Studies 


STUDY/PROTOCOL NUMBER: AFS-02-01 

SPONSOR: Strategic Environmental and Research 

Development Program 
SERDP Program Office 
901 North Stuart Street, Suite 303 
Arlington, VA 22203 


TESTING FACILITY: 

Name/Address: 

The Institute of Environmental & Human Health (TIEHH) 
Texas Tech University / TTU Health Sciences Center 
Box 41163 

Lubbock, Texas 79409-1163 

Test Facility Management: 

Dr. Ronald J. Kendall 
Director, TIEHH 

Study Director: 

Dr. Scott T. McMurry 
Dr. Phil N. Smith 


PROPOSED EXPERIMENTAL 

START DATE: JANUARY 1, 2002 


Page 1 of 6 



Project No. T9700 


DESCRIPTIVE STUDY TITLE: 

Avian exposure to perchlorate—field studies 

STUDY NUMBER: AFS-02-01 
SPONSOR: 

Strategic Environmental and Research 
Development Program 
SERDP Program Office 
901 North Stuart Street, Suite 303 
Arlington, VA 22203 

TESTING FACILITY NAME & ADDRESS: 

The Institute of Environmental & Human Health (TIEHH) 

Texas Tech University / Texas Tech University Health Sciences Center 
Box 41163 

Lubbock, Texas 79409-1163 

PROPOSED EXPERIMENTAL START & TERMINATION DATES: 

Start Date: January 1, 2002 

Termination Date: September 30, 2 0 0 - 2 * 0-ec^M3]^ 2Oo3 

KEY PERSONNEL: 

Dr. Scott T. McMurry, Study Director 
Dr. Philip N. Smith, Co-Investigator 
Dr. Todd Anderson, Analytical Chemist, 

Mr. Ryan M. Bounds, Quality Assurance Manager 

Dr. Ronald J. Kendall, Primary Investigator / Testing Facility Management 
DATED SIGNATURES: 



Dr. Scott T. McMurry 
Study Director 

Dr. Ron Kendall 

Testing Facility Management 

Mr. Ryan Bounds 
Quality Assurance Manager 


Page 2 of 6 






Project No. T9700 



Dr. Todd Anderson 
Analytical Chemist 


8. REGULATORY COMPLIANCE STATEMENT 

Quality Control and Quality Assurance 

This study will be conducted in accordance with established Quality Assurance 
program guidelines and in compliance, where appropriate and possible, with 
Good Laboratory Practice Standards (40 CFRPart 160, August 17, 1989). 

Document Control Statement 

This document is considered proprietary to TIEHH and the Sponsor. Do not copy, 
quote or distribute. For access to this document or authority to release or 
distribute, please write to: 

Dr. Scott T. McMurry 

TIEHH 

Box 41163 

Lubbock, Texas 79409-1163 

9. STUDY OBJECTIVES / PURPOSE: 

The focus of this study is to obtain a more robust data set on perchlorate exposure in 
wood ducks (especially eggs) at the LHAAP. Objectives of the field studies are to 
determine: 

> The reproductive success of wood ducks (aquatic avian model) nesting at the 
LHAAP and survival and growth of their chicks. 

> The level of perchlorate in wood duck eggs as an index of maternal transfer of 
perchlorate. 

10. JUSTIFICATION OF TEST SYSTEM 

Wood ducks (Aix sponsa ) are year-round residents throughout the southeastern United 
States. They occur in abundance throughout Caddo Lake and its backwaters associated 
with the LHAAP, and are easily cultured in the field by erecting nest boxes in study areas. 
They consume a variety of plant and animal foods including the seeds, fruits, and 
vegetative material of aquatic and terrestrial plants (Landers et al., 1977; Drobney and 
Fredrickson, 1979; Delnicki and Reinecke, 1986). In addition, wood ducks consume a 
diverse number of aquatic invertebrate species (Landers et al., 1977). Diet composition 
varies between males and females and breeding versus non-breeding females (Drobney 


Page 3 of 6 



Project No. T9700 


and Fredrickson, 1979). In general, plant material comprises 50 to 60% of the diet for 
males and females, with the balance consisting of animal material. The major exception is 
egg-laying females that consume nearly 80% animal material. 

Water and food consumption rates for wood ducks are unclear, but estimates can be 
derived from similar waterfowl such as mallards and lesser scaup, that consume about 6% 
of their body mass in water, and 8% (scaup) in food, each day. Given the variability in 
perchlorate concentrations in water, plant, and invertebrates at the LHAAP, clear 
estimates of exposure are difficult to determine. However, water concentrations have 
been documented at 500ppb in Harrison Bayou-fed ponds. Concentrations of perchlorate 
for plant and animal samples were provided above. Based on these concentrations, a 600g 
wood duck could consume as much as 18pg of perchlorate per day from water 
consumption, and 46pg to 231mg of perchlorate per day from food consumption. 


11. TEST ANIMALS: 

Species: Wood duck 
Strain: Wild 
Age: Eggs 

Number: Approximately 50 wood duck eggs 

Source: Collected from perchlorate contaminated sites within the Longhorn Army 
Ammunition Plant, Texas. 

12. PROCEDURE FOR IDENTIFYING THE TEST SYSTEM: 

Non-viable and early incubation wood duck eggs will be collected and placed into 
uniquely identified bags including, but not limited to, date and nest box ID. 

13. EXPERIMENTAL DESIGN INCLUDING BIAS CONTROL: 

Fields studies include monitoring of wood ducks on the LHAAP. Wood duck studies 
involve establishing artificial nesting structures through Harrison Bayou, extending from 
the INF pond toward Caddo Lake. Fifty nest boxes will be initially established according 
to established methods (Bellrose and Holm, 1994). Spacing of the nest boxes will be 
determined after initial site visits and identification of appropriate habitat. Wood ducks 
do not actively defend territories so they are amendable to nesting in high densities when 


Page 4 of 6 




Project No. T9700 


provided artificial nest structures in clumped arrangements (Haramis, 1990). Exposure 
will be monitored via perchlorate residues in eggs and diet items. 


14. METHODS: 

Sample Collection and Field Procedures 

Longhorn Army Ammunition Plant (LHAAP), Texas 

Wood duck nest boxes will be erected at the LHAAP. Forty-nine boxes will be initially 
established for the study. Nest box condition will be monitored and recorded as to the 
presence of nesting material, eggs, adult birds, and chicks as well as other inhabitants. 

Non-viable eggs will be collected from all boxes with wood duck nesting activity. All 
eggs will be placed in plastic bags, labeled (nest box number, date) and frozen at -20°C 
until residue analysis can be performed. 

Sample Analysis 

Residue analysis will be attempted on eggs, but given the high level of organic 
constituents in eggs, extraction procedures are expected to be difficult. Currently, we are 
using ion exchange methods to clean biologic samples, and significant amounts of 
organics (as found in eggs) may foul ion membranes. We will attempt to analyze 
perchlorate by extracting homogenates of yolk, albumin, and yolk and albumin combined. 

15. PROPOSED STATISTICAL METHODS 

Analysis of variance techniques may be used to evaluate differences in embryonic 
development among areas considered contaminated and those designated as clean. 

16. REPORT CONTENT/RECORDS TO BE MAINTAINED: 

Records to be maintained include field capture data, sample collection and handling logs, 
GPS coordinates of all collections, analytical data, embryonic growth and development. 

Report content will include presentation of data, interpretation, and discussion of the 
following endpoints: 

• Collection success 

• Serum perchlorate concentrations 


Page 5 of 6 



Project No. T9700 


• Developmental anomalies 

• Embryonic growth and development 

List individual endpoints and analyses. 

Interpretation of all data, including statistical results 
Discussion of the relevance of findings 
List of all SOPs used 
List of all personnel 

17. RECORDS TO BE MAINTAINED / LOCATION: 

A final report will be delivered to the Sponsor on or before March 31, 2004. Copies of all 
data, documentation, records, protocol information, and the specimens shall be sent to the 
Sponsor, or designated delivery point upon request (within six months of study 
completion). All data, the protocol and a copy of the final report shall be maintained by 
the testing facility. 

18. QUALITY ASSURANCE: 

The Quality Assurance Unit will inspect the study at intervals to insure the integrity of the 
study. Written records will be maintained indicating but not limited to the following: 
date of inspection, study inspected, phase inspected, person conducting the inspection, 
findings and problems, recommended and taken action, and any scheduled reinspections. 
Any problems likely to effect study integrity shall be brought to the immediate attention 
of the Study Director. The Quality Assurance Unit will periodically submit written status 
reports on the study to management and the Study Director. 

19. PROTOCOL CHANGES / REVISIONS: 

All changes and/or revisions to the protocol, and the reasons therefore, shall be 
documented, signed and dated by the Study Director and maintained with the protocol 
and the Quality Assurance Unit. 


20. REFERENCES: 

Delnicki and Reinecke, 1986 
Drobney and Fredrickson, 1979 
Hepp and Belrose, 1995 
Landers et al., 1977 
Haramis, 1990 
Smith, 2000 


Page 6 of 6 






Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
PERCHLORATE ANALYTICAL Phase V 


ANALYTICAL EVALUATIONS IN SUPPORT OF \ 

TOXICOLOGICAL INVESTIGATIONS 

STUDY NUMBER: ANALYT-03-01 

SPONSOR: Strategic Environmental Research and Development 

Program 

SERDP Program Office 

901 North Stuart Street, Suite 303 

Arlington, VA 22203 

CONTRACT ADMINISTRATOR: The Institute of Environmental and Human Health 

Texas Tech University/TTU Health Sciences Center 
Box 41163 

Lubbock, TX 79409-1163 

TESTING FACILITY: The Institute of Environmental and Human Health 

Texas Tech University 
Box 41163 

Lubbock, TX 79409-1163 

TEST SITE: The Institute of Environmental and Human Health 

Texas Tech University 
Box 41163 

Lubbock, TX 79409-1163 

ANIMAL TEST SITE: Texas Tech University 

Human Sciences Building 
Box 42002 

Lubbock, TX 79409-2002 
RESEARCH INITIATION: 9/1/2002 

RESEARCH COMPLETION: 12/31/2003 


lofll 





Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
PERCHLORATE ANALYTICAL Phase V 


Table of Contents 

List of Tables and Figures. 3 

Good Laboratory Practice Statement.4 

Quality Assurance Statement.5 

I. 0 Descriptive Study Title.6 

2.0 Study Number.6 

3.0 Sponsor. 6 

4.0 Testing Facility Name and Address.6 

5.0 Proposed Experiment Start and Termination Dates.6 

6.0 Key Personnel..6 

7.0 Study Objectives/Purpose.6 

8.0 Study Summary.6 

9.0 Test Materials.7 

10.0 Justification of Test System.7 

II. 0 Test Animals. 7 

12.0 Procedure for Identifying the Test System.7 

13.0 Experimental Design Including Bias Control.7 

14.0 Methods.8 

15.0 Results.8 

16.0 Discussion.10 

17.0 Study Records and Archive.11 

18.0 References.11 


2 of 11 

























Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
PERCHLORATE ANALYTICAL Phase V 


List of Tables and Figures 

Figure 1. Chromatograms obtained by PC/PE and EPA Method 314.0,1.0 mL samples 


3 of 11 





Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
PERCHLORATE ANALYTICAL Phase V 


GOOD LABORATORIES PRACTICES STATEMENT 

This study was conducted in accordance with established Quality Assurance Program 
guidelines and in the spirit of Good Laboratory Practice Standards whenever possible (40 CFR 
Part 160, August 17, 1989). 

Submitted By: 




Todd A. Anderson, Ph.D. 


Date 


4 of 11 







Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
PERCHLORATE ANALYTICAL Phase V 


QUALITY ASSURANCE STATEMENT 


This study was conducted under The Institute of Environmental and Human Health 
Quality Assurance Program and whenever possible to meet the spirit of the Good Laboratory 
Practices as outlined in 40 CFR Part 160, August 17, 1989. 



Qualit^&ssurance Manager Date 


5 of 11 






Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
PERCHLORATE ANALYTICAL Phase V 


1.0 DESCRIPTIVE STUDY TITLE: 

Analytical Evaluations in Support of Toxicological Investigations 

2.0 STUDY NUMBER: 

ANALYT-03-01 

3.0 SPONSOR: 

Strategic Environmental and Research Development Program 

SERDP Program Office 

901 North Stuart Street, Suite 303 


4.0 TESTING FACILITY NAME AND ADDRESS: 

The Institute of Environmental and Human Health 

Texas Tech University I? 

Box 41163 1 

Lubbock, Texas 79409-1163 j 

5.0 PROPOSED EXPERIMENTAL START & TERMINATION DATES: 

Start: 9/1/02 
Termination: 12/31/03 

6.0 KEY PERSONNEL: 

Todd Anderson, Analytical Chemist 
Ryan Bounds, Quality Assurance Officer 
Ron Kendall, Principal Investigator 

I. 

!• 

7.0 STUDY OBJECTIVES / PURPOSE: 

The focus of the subproject outlined here was to provide analytical support for ongoing 
toxicological evaluations of perchlorate in fish, amphibians, and mammals. In addition, 
because of the paucity of relevant food chain data on perchlorate, basic environmental 
analyses of potential food items (vegetation and seeds) were also carried out. Our goal 
was to support laboratory and field studies by measuring and quantifying potential 
perchlorate exposure among organisms. 

8.0 STUDY SUMMARY: 

Perchlorate concentrations in various samples were determined using ion 
chromatography. Samples submitted for analysis included soil, sediment, water, plant 
and vegetable matter, seeds, and various biological tissues and fluids. These analyses 
utilized equipment and analytical methods developed and validated during previous 
studies on perchlorate carried out by this laboratory. 

A variety of tests were used throughout the course of sample analysis to ensure optimum 
performance of the analytical instrument as well as the data generated. These tests 


6 of 11 








Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
PERCHLORATE ANALYTICAL Phase V 


included calibration on the days of sample analysis, blank samples (DI Water), check 
standards, sample carryover analysis, and sample replicates among others. 

9.0 TEST MATERIALS: 

Test Material: Laboratory and Environmental Samples 

Test Chemical: Sodium Perchlorate 
CAS Number: 7601-89-0 
Characterization: NIST-Certified. 

Source: AccuStandard, Inc. 

Test Chemic al: S odium Perchlorate 
CAS Number: 7601-89-0 
Characterization: ACS-Certified. 

Source: Fisher Scientific, Inc. 

Test Chemical: Amm onium Perchlorate 
CAS Number: 7790-98-9 
Characterization: ACS-Certified. 

Source: Aldrich, Inc. 

Reference Chemical: deionized water (18Mf2) 

CAS Number: NA 

Characterization: The quality of the water was confirmed by analytical tests. 

Source: Milli-Q 

10.0 JUSTIFICATION OF TEST SYSTEM: 

Evaluating tissue levels and identifying possible sources of perchlorate contamination are 
critical in determining toxicological and ecological exposure. The unique characteristics 
of perchlorate make accurate quantitation in biological matrices difficult (Ellington and 
Evans, 2000). The presence of additional ions, proteins, lipids, and other biomolecules 
that can foul ion exchange columns further confounds accurate determination of 
perchlorate concentrations in biological tissues and fluids. 

11.0 TEST ANIMALS: 

NA. 

12.0 PROCEDURE FOR IDENTIFYING THE TEST SYSTEM: 

Samples were logged in at the time of receipt and logged out at the time of analysis. As 
the samples were not provided in any particular order (chronologically), they were not 
analyzed in any particular order. Sample tracking numbers and dates were included in 
log sheets. 

13.0 EXPERIMENTAL DESIGN INCLUDING BIAS CONTROL: 

A variety of tests were used throughout the course of sample analysis to ensure optimum 
performance of the analytical instrument as well as the quality of the data generated 


7 of 11 




Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
PERCHLORATE ANALYTICAL Phase V 


(Skoog and Leary, 1992). These tests included calibration on the days of sample 
analysis, blank samples (DI Water), check standards, sample carryover analysis, and 
sample replicates among others. 

14.0 METHODS: 

Dionex Corp. (1998) originally developed an ion chromatography method which allowed 
detection of perchlorate in water down to 1 pg/L (ppb). We have used this method for 
analysis with modifications as necessary for extraction, cleanup, and detecting 
perchlorate in tissue and vegetation samples (Anderson and Wu, 2002; Tian et al., 2003). 
Ion chromatography is the technique most widely used for the determination of 
perchlorate because of its sensitivity, ability to separate perchlorate from other ions, and 
its availability in many laboratories. Nevertheless, trace determination of almost any 
analyte by IC in the presence of high concentrations of other anions can be difficult. The 
case of perchlorate is a little more favorable than the typical ionic analyte because 
perchlorate is more strongly retained than most anions. Still, high salinity samples cause 
a high signal background from tailing peaks of the less retained ions and lead to poor 
analyte recovery. In many cases, the matrix peak(s) will totally overlap the perchlorate 
response. In EPA Method 314.0, serial pretreatment by Ag + -, Ba 2+ -, and PT-loaded 
cation exchangers are recommended for removal of chloride, sulfate, and carbonate. This 
approach is at best partially effective in our experience and is not easily automated. 
Moreover, this treatment is of little value with biological tissue and fluid samples. 

Earlier, we developed an online preconcentration/preelution (PC/PE) approach for 
improved IC analysis of the more difficult samples (Tian et al., 2003). A short 
hydrophilic column is used to preconcentrate perchlorate. A dilute NaOH solution is 
used to prewash the sample loaded in the preconcentrator column to remove the less 
strongly held anions prior to switching the preconcentration column to the main 
separation column. We have previously evaluated the operational conditions, linear 
dynamic range, LOD, applicable sample volume, and effects of sample conductivity, as 
well as comparing the performance of the system with EPA Method 314.0 (Figure 1). 

General operation of the ion chromatograph (DX-500, Dionex Corp.) is described in SOP 
AC-4-03. The operation of the ion chromatograph for perchlorate analysis is described in 
SOP AC-2-11 and SOP AC-2-15. These SOPs provided the basis for determining 
perchlorate in dosing solutions used in the toxicological tests. As described in SOP AC- 
2-11, the analysis of perchlorate using the Dionex instrument is controlled by PeakNet 
software using a method entered and saved within the software package. 

15.0 RESULTS: 

A variety of tests were used throughout the course of sample analysis to ensure optimum 
performance of the analytical instrument as well as the data generated (Skoog and Leary, 
1992). These tests included calibration on the days of sample analysis, blank samples (DI 
Water), check standards, sample carryover analysis, and sample replicates among others. 
A summary of the individual data quality tests are described below. 


8 of 11 




Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
PERCHLORATE ANALYTICAL Phase V 



Time, min Time, min 

Figure 1. Chromatograms obtained by PC/PE and EPA Method 314.0,1.0 mL samples (a) 25 pg/L perchlorate spiked into 
groundwater sample (k = 4.7 mS/cm), present method prewash 2.3 mL 10 mM NaOH, (b) 25 gg/L perchlorate spiked into 
matrix containing 2000 mg/L each of Cl', SO4 2 ' and CO3 2 ' (k = 14.7 mS/cm), present method prewash 2.7 mL 10 mM NaOH. 


9 of 11 





Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
PERCHLORATE ANALYTICAL Phase V 


As a calibration curve is run each time a set of samples is analyzed, we routinely include 
an analysis of the calibration curves as part of our evaluation. We use a certified 
perchlorate standard (100 pg/mL) to determine possible dilution errors as well as to 
prepare calibration curve standards. These calibration curves represent the analysis of 
identical calibration standards on different days as well as different calibration standards 
(calibration standards expire after 60 days). Overall, variation in detector response for 
the calibration standards is low. As expected, the lowest calibration standard (2.5 ppb) 
has the highest %CV. This concentration is also our typical method limit of quantitation. 
The calibration curves are very linear over the range of calibration standards. The 
regression coefficient (r 2 ) for all of the calibration runs (> 2000) has never been below 
0.995. This represents the r 2 from the untransformed data. 

Throughout the analyses, we include check standards (calibration standards of known 
concentrations treated as samples) to ensure the performance of the calibration curve in 
calculating sample concentrations. In addition, we also perform individual check 
standard tests in which 2 perchlorate standards are analyzed repeatedly. This test also 
included DI water blanks in between each check standard. The results of these tests 
indicate low standard deviations and coefficient of variation. The values of SD and %CV 
for the check standards are typical for analytical measurements and represent the 
precision of the analytical method. The % differences between the actual and analytically 
determined concentrations are indicative of method accuracy expressed in terms of 
relative error. 

As part of our analysis of sample reproducibility, we conduct tests using environmental 
samples. These tests also allow us to determine potential matrix effects for the aqueous 
samples. The %CV (precision) from these tests are always similar to those obtained in 
the check standard test described above. 

As part of our analysis of sample reproducibility, we also conduct tests to determine 
possible dilution errors with calibration standards. For example, a 100 ppb perchlorate 
standard is diluted with DI water to make the following perchlorate sample array: 100 
ppb, 50 ppb, 20 ppb, 10 ppb, 5 ppb, and 2.5 ppb. A perchlorate calibration curve is then 
used to determine the concentrations of the samples and these analytically determined 
concentrations are compared to the expected concentrations. The results of these tests 
indicate that analytically determined concentrations agree with expected concentrations 
indicating no dilution errors. The % differences (accuracy expressed in terms of relative 
error) from one test ranged from -6.56% to 2.43%. These values are typical and 
consistent with our check standard and replicate sample analyses. 

16.0 DISCUSSION 

More than 500 samples were analyzed for perchlorate in 2003. These samples included 
laboratory dosing solutions and exposure tank waters as well as environmental samples 
(water, vegetation, biological tissues). Samples were received from several research 
investigators (E. Smith, J. Carr, P. Smith, C. Theodorakis). 


10 of 11 





Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
PERCHLORATE ANALYTICAL Phase V 


In summary, the perchlorate analyses we have conducted in support of toxicological 
investigations have been critically evaluated for precision and accuracy. These analyses 
were conducted utilizing equipment and analytical methods developed and validated 
during previous studies on perchlorate carried out by this laboratory. 

17.0 STUDY RECORDS AND ARCHIVE: 

Study Records will be maintained at The Institute of Environmental and Human Health 
(TIEHH) Archive for a minimum of one year after study completion date. 

18.0 REFERENCES: 

Anderson, T. A., and T. H. Wu. 2002. Extraction, cleanup, and analysis of the 
perchlorate anion in tissue samples. Bulletin of Environmental Contamination and 
Toxicology. 68:684-691. 

Dionex. 1998. Application Note 121. Dionex Corp. Sunnyvale, CA. 

Ellington, J. J., and J. J. Evans. 2000. Determination of perchlorate at parts-per-billion 
levels in plants by ion chromatography. Journal of Chromatography. 898:193-199. 

Skoog, D. A., and J. J. Leary. 1992. Principles of Instrumental Analysis. 4th Ed. 
Harcourt Brace and Company. Orlando, FL. 

Tian, K., P. K. Dasgupta, and T. A. Anderson. 2003. Simple determination of trace 
perchlorate in high salinity water samples by ion chromatography with online 
preconcentration and preelution. Analytical Chemistry. 75:701-706. 


11 of 11 



Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
Environmental Modeling Phase V 


ENVIRONMENTAL MODELING ^AR 2CC 

STUDY NUMBER: MOD-03-01 

SPONSOR: Strategic Environmental and Research Development 

f Program 

SERDP Program Office 

901 North Stuart Street, Suite 303 

Arlington, VA 22203 


CONTRACT ADMINISTRATOR: The Institute of Environmental and Human Health 

Texas Tech University/TTU Health Sciences Center 
Box 41163 

Lubbock, TX 79409-1163 

The Institute of Environmental and Human Health 
Texas Tech University 
Box 41163 

Lubbock, TX 79409-1163 

The Institute of Environmental and Human Health 
Texas Tech University 
Box 41163 

Lubbock, TX 79409-1163 

Texas Tech University 
Human Sciences Building 
Box 42002 

Lubbock, TX 79409-2002 
RESEARCH INITIATION: 10/1/02 

RESEARCH COMPLETION: 12/31/03 


TESTING FACILITY: 


TEST SITE: 


ANIMAL TEST SITE: 


1 of 24 







Draft - Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
ENVIRONMENTAL MODELING Phase V 


Table of Contents 

List of Tables and Figures.3 

Good Laboratory Practice Statement...4 

Quality Assurance Statement...5 

I. 0 Descriptive Study Title. 6 

2.0 Study Number.6 

3.0 Sponsor. 6 

4.0 Testing Facility Name and Address. 6 

5.0 Proposed Experiment Start and Termination Dates.....6 

6.0 Key Personnel. 6 

7.0 Study Objectives/Purpose. 6 

8.0 Methods. 7 

9.0 Results.15 

10.0 Discussion.23 

II. 0 Study Records and Archive.23 

12.0 References.23 


2 of 24 


















Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
ENVIRONMENTAL MODELING Phase V 


List of Tables and Figures 

Figure 1. Flow Diagram of the PBTK model for perchlorate uptake in fish 
Figure 2. Flow diagram of macrophyte model 

Figure 3. Computer simulation for the transient temperature and vasomotor responses of 
a subject when exposed to a 16°C decrease in ambient temperature (28°C to 12°C) at 150 
hrs {pf= 1.0). 

Figure 4. Computer simulation for the transient temperature and vasomotor responses of 
a subject when exposed to a 16°C decrease in ambient temperature (28°C to 12°C) at 150 
hrs (pf= 0.60). 

Figure 5. Simulated tissue concentrations based on a 975 ppb dose of perchlorate 

Figure 6. Simulated thyroid tissue concentrations based on a 975 ppb dose of perchlorate 

Figure 7. Simulated tissue concentrations based on a 975 ppb dose of perchlorate with 
juvenile ingestion term 

Figure 8. Simulated thyroid tissue concentrations based on a 975 ppb dose of 
perchlorate with juvenile ingestion term 

Figure 9. Simulated hormone inhibition based on a 975 ppb dose of perchlorate starting 
at hour 1000 

Figure 10. Observed and predicted perchlorate concentrations in mulberry plant parts 

Table 1. Thyroid hormone inhibition based on a 975 ppb dose of perchlorate starting at 
hour 1000 


3 of 24 



Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
ENVIRONMENTAL MODELING Phase V 


GOOD LABORATORIES PRACTICES STATEMENT 

This study was conducted in accordance with established Quality Assurance 
Program guidelines and in the spirit of Good Laboratory Practice Standards whenever 
possible (40 CFR Part 160, August 17,1989). 

Submitted By: 



4 of 24 


Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
ENVIRONMENTAL MODELING Phase V 


QUALITY ASSURANCE STATEMENT 


This study was conducted under The Institute of Environmental and Human 
Health Quality Assurance Program and whenever possible to meet the spirit of the Good 
Laboratory Practices as outlined in 40 CFR Part 160, August 17, 1989. 




5 of 24 






Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
ENVIRONMENTAL MODELING Phase V 


1.0 DESCRIPTIVE STUDY TITLE: ENVIRONMENTAL MODELING 
2.0 STUDY NUMBER: MOD-03-01 

3.0 SPONSOR: Strategic Environmental Research and Development Program 
SERDP Program Office 
901 North Stuart Street, Suite 303 
Arlington, VA 22203 

4.0 TESTING FACILITY NAME AND ADDRESS: 

The Institute of Environmental and Human Health 
Texas Tech University 
Box 41163 

Lubbock, Texas 79409-1163 

5.0 PROPOSED EXPERIMENT START AND TERMINATION DATES: 

Start date: 10/01 /02 

Termination date: 12/31/03 

6.0 KEY PERSONNEL 

Kenneth R. Dixon 
Eric P. Albers 
Randy L. Apodaca 
Srivatsa Patangi 

7.0 STUDY OBJECTIVES/PURPOSE 

Modeling and GIS will utilize the previously developed models to simulate the 
movement and effects of perchlorate at the LHAAP. A suite of models has been 
developed to simulate the transport, uptake, and effects of perchlorate in aquatic and 
terrestrial ecosystems. The emphasis in model development to date has been on uptake 
and distribution of perchlorate in mammal, fish, amphibian, bird, and plant species. Little 
information has been available on the effects of perchlorate on these species. The lab and 
field studies in this continuation will provide data that can enhance the effects aspects of 
these models. 

We also will complete the implementation of the suite of models to provide for large- 
scale simulations, including estimates of risk for a risk assessment of the LHAAP site. 
This integrated suite of models will be available to assess perchlorate effects at other 
contaminated sites, and with modification, the effects of other contaminants. 

Small Mammal Model . Basal metabolic and heart rate will be added as state variables in 
these models. Temperature will be added as a forcing function to predict the effects of 
perchlorate exposure on thermoregulation. 


6 of 24 




Fish Model . Food items for fish species and the perchlorate concentration in those items 
will be added to the fish model. The model will be calibrated using data collected at the 
LHAAP site. 


Plant Model . Little is known about perchlorate transport mechanisms in plants. Lab and 
field studies on perchlorate exposure in plants will provide data to incorporate more 
mechanistic transport processes in the plant models. Measured perchlorate 
concentrations in different plant tissues will provide data for model calibration and 
validation. 


8.0 METHODS 

Small Mammal Model. To maintain body temperature, the physiological and 
metabolic reactions that produce heat must be balanced against those that radiate or 
conduct it away. Except within a range of ambient temperatures called the thermoneutral 
zone, maintaining a constant body temperature makes a steady demand either on the 
biochemical processes of heat production and/or the physical mechanisms for heat loss. 
When ambient temperatures fall below the thermoneutral zone (lower critical temperature 
or LCT), heat production must increase and/or heat loss must decrease. Above the other 
end of the thermoneutral zone (upper critical temperature or UCT), heat loss must 
increase (Ricklefs 1993). 

The dynamics of the temperature regulation in mammals is a complex physiological 
process involving many factors. Am bient temperature is the predominant factor to trigger 
the regulation of metabolic rate and body temperature. Additionally, some drugs or 
environmental chemicals, such as perchlorate, also can affect the metabolic rate and body 
temperature in small mammals (Machle and Hatch. 1947). There have been several 
models to simulate temperature regulation in man exposed to various environmental 
conditions (e.g., Wyndham 1960 and Wissler 1961) have made some attempts by 
assuming the man to be a cylindrical physical model. We adapted a model by Crosbie 
(1961) who developed a model to simulate the regulation for cold responses in man. In 
this model, man was divided into three layers: surface (skin), middle (muscle), and core 
(rectal). Each layer was assumed to have a temperature which has a single value 
throughout its thickness. A separate ordinary differential equation was written for each 
layer in which time was the independent variable. 

Each layer of Crosbie’s model was considered to have uniform thermal properties, and 
the basal metabolic heat was considered to be generated in the inner-most layer. This 
latter is a necessary requirement since the core temperature, T 2 , (all symbols and 
definition were listed in table 1) has a basal value higher than the more superficial 
temperatures in the body. Additional heat, caused by shivering or exercising, was 
considered to be generated in the middle layer that was comparable to the musculature of 
the body. The thickness of the layers was chosen to give a temperature difference 


7 of 24 


between core and skin sufficient to have a linear temperature gradient which would equal 
the basal metabolism. Heat flow was assumed to be unidirectional, and the core was 
assumed to be ideally insulated except from heat flow to the surface. Equations (2-4) give 
the amount of heat which was stored per unit time, per unit cross-sectional area, in the 
outer, middle, and inner layers, respectively. 



K 


pc AX sl AX 


0.1 *h 

<T x ~T s ) -— (T s 

pcAX s 


T a )~ 


0.1*F 

pd±X s 


( 1 ) 


dT\ 

dt 


K 

pcXX n AX x 


(T 2 -t x )~ 


K 


pcAX sX M s 


Vx-T.)- 


A M 
pcAX x 


( 2 ) 


dT 2 _ M 0 300 *K _ T 

dt pcAX 2 pcAX u AX 2 { 2 1 


( 3 ) 


Note that the heat lost by radiation, convection, and vaporization are surface effects only 
and, therefore, occur only in Eq. (1). Also, the variation in the internal heat source AM, 
caused by shivering or exercising, originates in the middle or muscular layer and, 
therefore, occurs only in Eq.(2). 

The average temperature of the body was calculated on a veighted basis, according to 
layer thickness as shown in Eq.(4). 

T ax s t s +^t 1+ ax 2 t 2 

s AX s +AX x +AX 2 


To compare the physical model to the physiological situation that involves regulation, 
relations must be established between heat loss and body temperature. A study of steady- 
state data revealed that the thermal conductance of the peripheral tissues (which is related 
not only to specific tissue conductance but to blood flow and hence vasomotor activity) 
increases or decreases within limits as the body temperature rises or falls (Eqs. 5-6). 


jrp 

K = K 0 {l + ak+AT g +yk^- }< 1.7K 0 ;AT B > 0 (5) 

dt 

Jrp 

K = K Q {l + ak-AT B +yk-^ L }>0.56K 0 ;AT B <0 (6) 


8 of 24 






The steady-state data also show that the vaporization loss increases rapidly as the body 
temperature rises above its neutral value, but maintains a rather constant value as the 
body was cooled below this neutral temperature (Eqs. 7-8). 


V = V 0 +S E (a o AT B +Z u AT B *)<50V 0 ;AT B >0 


( 7 ) 


V = V 0 ;AT b <0 


( 8 ) 


The steady-state data further revealed that the body metabolism increases in proportion to 
the body temperature decrease when exposed to a cold environment. The body 
metabolism will also increase during exercise (Eqs. 9-10). Based on the effects of 
perchlorate on the metabolic rate, the metabolic rate coefficient of proportional control 
(a m ) was replaced by perchlorate factor (pf) in Eq. 11. 


AM = E;AT B > 0 (9) 

AM = -a m AT B + E;AT b <0 (10) 

AM =-pf*AT B +E;AT B <0 (11) 


The surface conductance h was defined in Eq. 12 as being the sum of a radiation and a 
convection term. The convection term was further shown to vary as the square root of the 
surface air velocity. When v=o o, h=ho. 


h = h 0 + Ah = h r + h c 



( 12 ) 


Table 1. List of symbols and Definitions. 

p density of the tissue 
c specific heat of tissue 
pc = 1 cal/cc°C 

T temperature in degrees centigrade 
Ts temperature of surface layer, Tso - 33.6°C 
Ti temperature of middle layer, T !0 = 34.7°C 


9 of 24 



T 2 temperature of core layer, T 20 =37.0°C 
Tb average body temperature, Tbo = 35.8°C 
T a temperature of surface layer, T a o = 28 °C 
t time 

K specific thermal conductivity of wet tissue; 

K()= 1.1*10" 3 cal/cm/°C = 0.4 kcal/m/hr/°C 
ak + thermal conductivity coefficient of proportional control for UTb > 0 = 0.147/°C 
ak thermal conductivity coefficient of proportional control for D2g < 0 = 0.066/°C 
yk thermal conductivity coefficient of rate control in sec/°C ~ 3.5 sec/°C 
X distance in cm from the surface 
A Xs thickness of surface layer = 0.8 cm 
AX] thickness of middle layer = 1.6 cm 
AX 2 thickness of core layer = 3.2 cm 
A Xs, = YziOXs + ax } ) 

A Xs 2 = 'A{UX] + CX 2 ) 

M’ metabolic rate per unit volume 
M metabolic rate per unit area; Mo = 37 kcal/m /hr 
aM thermal conductivity coefficient of proportional control; Tb < 0 
R ’ heat loss due to radiation effect per unit volume 
R heat loss due to radiation effect per unit area 

V’ heat loss due to vaporization per unit volume 
V heat loss due to vaporization per unit are; Vo = 7 kcal/m /hr 
o.v vaporization coefficient of proportional control = 11 kcal/m 2 /hr/°C; Tb> 0 
h> vaporization coefficient of 4 th power proportional control = 53 kcal/m 2 /hr/°C 4 ; Tb> 0 
h heat transfer coefficient (skin to air) also known as surface conductance; 
ho = kcal/m 2 /hr/°C 

h r heat transfer coefficient of radiation = 0.48 ho 
h c heat transfer coefficient of convection = 0.52 ho 
v velocity of air at skin surface; v# = 7.6 cm/sec 
E exercise kcal/m 2 /hr 

3e increase in vaporization coefficient due to violent exercise 


Fish Model. PBTK Model Description. A physiologically based toxicokinetic (PBTK) 
model was developed to simulate the movement of perchlorate within channel catfish. 
Contaminant movement was governed by a series of mass-balanced differential equations 
programmed in Matlab®. Model compartments and blood flow can be seen in Figure 1. 
General equations used in the model were taken from PBTKs developed for rainbow 
trout by Nichols et al. (1990, 1991) and channel catfish (Nichols, et al. 1993). Fish gill 
physiology was kept biologically accurate by accounting for countercurrent chemical 
flux, including both flow and diffusion limitations (Erickson and McKim 1990). 
Distribution was assumed to be flow-limited, i.e. chemical equilibrium existed between 


10 of 24 



the tissues and blood leaving the compartment. Additionally portal blood flow was 
incorporated into the kidney and liver from poorly perfused tissue and richly perfused 
tissue respectively. Portal blood flow to the kidney was set as 60% of blood flow to skin 
and muscle compartments, with portal flow to the liver equal to blood flow to the GI tract 
(Nichols et al. 1990). Finally an ingestion term was included to allow for the 
incorporation of multiple food sources of varying levels of toxicity. The ability to 
incorporate a variety of food items is very important since the catfish diet changes 
dramatically as it ages. Commonly feeding near the bottom of the water body juvenile 
catfish feed primarily on aquatic insects while adults are more opportunistic going for 
small crustaceans, aquatic vegetation, and small fish. Fish become a major part of the 
diet in larger catfish (greater than 18 inches), which can grow to 50 inches (127 cm). 
Two separate ingestion terms were programmed, one for juveniles and one for adults. 
Perchlorate levels in food items at Caddo Lake were based on limited data from Smith et 
al. (2001), however no crustacean data were available. Resulting from a lack of lab and 
field data for calibration and verification we are unable to test these terms. Appropriate 
data on ingestion rates, feeding preference, and food item contamination are needed. 



I 


Liver 


4 Thyroid 


* 


Figure 1. Flow Diagram of the PBTK model for perchlorate uptake in fish. 

A six-compartment model of combined T 3 and T 4 kinetics originally developed for 
mammals (DiStefano 1986; Bianchi et al. 1987; Pilo et al. 1990; Hershman et al. 1986) 
and later applied to rainbow trout (Sefkow et al. 1996) was used to simulate the secretion 
of T 3 and T 4 in channel catfish, as well as the impacts of perchlorate on secretion rates. 
The six compartments represented included: T 4 slow exchange tissue pool, T 4 rapid 
exchange tissue pool, T 4 plasma pool, T 3 slow exchange tissue pool, T 3 rapid exchange 
tissue pool, and T 3 plasma pool. The thyroid model was first calibrated by comparing the 
steady-state mass-balance distribution by percentage to those reported by Sefkow et al. 


11 of 24 




(1996). Plasma T 3 and T 4 compartments were then adjusted, keeping the same 
percentage distribution with other compartments, to meet levels reported by Gaylord et 
al. ( 2001 ) in channel catfish. 

Hormone inhibition by perchlorate was calculated from data on mosquitofish dosed with 
sodium perchlorate for 2, 10, or 30 days at doses of 0, 0.1, 1, 10, 100, and lOOmg/L 
(ppm) (Bradford 2002). Whole body T 4 concentrations were determined by 
radioimmunoassay for pooled groups of fish. A regression curve was fit to the data to 
derive the inhibition equation based on the concentration of perchlorate in the thyroid 
tissue. A sensitivity analysis performed on the inhibition term, identified all 
compartments as insensitive to an increase or decrease of 15%. 

Plant Model. The model includes uptake in both terrestrial and aquatic macrophytes. 
Both models were programmed in Matlab using difference equations. To simulate and 
predict the uptake and transport of perchlorate in various terrestrial and aquatic plants, we 
developed new uptake and distribution components that are specific to perchlorate and 
modified CERES by incorporating these new components (Figure 2). Additionally, an 
internal hydrological component was added to simulate environmental soil and water 
conditions. 


12 of 24 






Figure 2. Flow diagram of macrophyte model 


13 of 24 















































































For the macrophyte model governing equations, we used those described by Dixon, et al. 
(1978). 


The plant’s water uptake is the product of the plant’s ability to take up water, its leaf area, 
and the volume of water available to the plant in its growing soil horizon: 

u; = /o£ ( „ow. 


where, 

Ut = incremental water uptake at time (t) 

/= water flow constant (h" 1 ) 

L ’ = Leaf Area Index 

SM a = Mass of water in Soil Horizon A (g*m ' 2 land area/hour) 

Distribution of water and perchlorate between compartments is defined by the difference 
in water and perchlorate between compartments: 



\K-W b )/r ab tl <t<t 4 
0 otherwise 


where, 

F = flux from compartment a to compartment b (g*m “ 2 land area/hour) 
W~ amount of water in a given compartment (g*m ‘ 2 land area) 
r a b = water flux constant 


The amount of perchlorate in individual compartments is defined by: 



= w 00 

C/04" 


Q0“ 3 


where 

• *2 

M a = amount of perchlorate in compartment a at time t (pg*nT land area) 

W a , t = mass of water in compartment a at time t (g*m' 2 ) 

Ccio 4 ~ CIO 4 ' concentration in the incoming water 

The ratio of the amount of perchlorate in the compartment to the biomass (wet weight) of 
the compartment determines the perchlorate concentration: 


14 of 24 





B., + W„ 


a,t 


a,t 


where, 

Q a , t = concentration of perchlorate in compartment a at time t (pg’g’ 1 ) 

M a ,t = amount of perchlorate in compartment a at time t (pg*m" 2 ) 

B a ,t = biomass of a given compartment (g*m 2 ) 

W aJ = mass of water in compartment a at time t (g*m 2 ) 

Plant biomass is calculated by summing the soluble and insoluble photosynthate fractions 
(Dixon, et al. 1978): 



= , + ST 


a,t 


a,t 


where, 

B ajt — biomass of compartment a at time t (g*m 2 ) 

S a ,t= sugar substrate in compartment a at time t (g*m 2 ) 

ST a , t = plant storage tissue in compartment a at time t (g*m 2 ) 


Model Assumptions: 

• transport between leaves and stems occurs from the time of bud formation to the 
time of abscission. 

• transport between stems and fruits occurs from the time of net photosynthesis to 
the time of abscission. 

• transport between the stems and roots is assumed to occur throughout the year. 


9.0 RESULTS 
Small Mammal Model. 

We conducted simulations to reflect the lab experiments in MRT-03-01. We assumed 
that study subjects were exposed to initial ambient temperature for 150 hours, and then 
were suddenly moved to a cold environment (12°C) and kept there for 50 hours. Air 
velocity was thought of as zero. A perchlorate correcting coefficient was introduced into 
the model to estimate the effect of perchlorate on the regulation of metabolic rate and 
body temperature. 

Cold stress: 

The predicted results indicate that the individual body regulates its skin temperature 
to reach equilibrium the fastest (Figure 3). Rectal temperature increased initially when 


15 of 24 


suddenly moving to cold temperature, and then decreased very slowly to reach 
equilibrium. At the same time, the sudden cold stress lead to the increase of metabolic 
rate and the decrease of average body temperature. 






Time (hours) Time (hours) 

Figure 3. Computer simulation for the transient temperature and vasomotor responses of 
a subject when exposed to a 16°C decrease in ambient temperature (28°C to 12°C) at 150 
hrs (pf=l.O). 


Perchlorate factor: 

Reducing the value of perchlorate factor from 1.0 to 0.6 did not significantly affect 
the regulation of body temperature, but obviously changed the metabolic rate. The effect 
of perchlorate exposure (ingestion exposure to perchlorate) decreased the normal 
metabolic rate, and led to the faster pace of the increase of metabolic rate when suddenly 
moving to cold stress (Figure 4). 


16 of 24 










Time (hours) Time (hours) 

Figure 4. Computer simulation for the transient temperature and vasomotor responses of 
a subject when exposed to a 16 H C decrease in ambient temperature (28°C to 12°C) at 150 
hrs {pf= 0.60). 

Fish Model. 

Exposure Scenario. A “worst-case” scenario was developed, in which individual catfish were 
exposed to the maximum effluent perchlorate concentration from the groundwater treatment plant 
of 975 ppb. Most tissue compartments took approximately 100-200 hours to equilibrate, with the 
thyroid compartment taking 300 hours (Figures 5, 6 ). If we assume that 975 ppb is the highest 
level any fish is exposed to then all measured field tissue concentrations should be less than or 
equal to those simulated. Currently there are no measured field concentrations in channel catfish 
to compare these results to for verification. Largemouth Bass collected in Caddo Lake had trace 
levels or less in muscle and liver tissues, but no data was collected on other tissue compartments 
(Smith et al. 2001). For representative purposes the model was run a second time using the 
juvenile ingestion term (Figures 7, 8 ). 

The thyroid concentration data were then used in the hormone secretion model to determine the 
level of hormone inhibition. Perchlorate inhibition was initiated after 1000 hours to allow the 
hormone compartments to reach steady-state prior to insult (Figure 9). T 3 hormone levels 
decreased 17.3-20.8% and T 4 levels decreased 54% (Table 1). No field data have been collected 
on thyroid hormone levels in any fish species for model verification. 


17 of 24 













skin 


Gl tract 


liver 



.Q 

CL 

Q. 

d 

c 

o 

O 


kidney 


muscle 


gills 



Time (hours) Time (hours) Time (hours) 

Figure 5. Simulated tissue concentrations based on a 975 ppb dose of perchlorate. 


Thyroid 



Figure 6. Simulated thyroid tissue concentrations based on a 975 ppb dose 
of perchlorate. 


18 of 24 
























skin 


Gl tract 


liver 



1000 

500 

0 

-500 


0 


kidney 



400 

200 

0 

-200 


2000 

1000 

0 


--TTT'IOOO 

100 200 0 


muscle 


5000 


0 100 200 
Time (hours) 


-5000. 


100 200 
gills 


0 100 200 
Time (hours) 


Figure 7. Simulated tissue concentrations based on a 975 ppb dose of 
perchlorate with juvenile ingestion term. 


Thyroid 



Figure 8. Simulated thyroid tissue concentrations based on a 975 ppb dose 
of perchlorate with juvenile ingestion term. 


19 of 24 


























Plasma T3 



E 

CL 

a. 

6 

c 

o 



Rapid T4 


Slow T4 



Time (hours) Time (hours) Time (hours) 

Figure 9. Simulated hormone inhibition based on a 975 ppb dose of 
perchlorate starting at hour 1000. 


Table 1. Thyroid hormone inhibition based on a 975 ppb dose of perchlorate 
starting at hour 1000. __ 



Steady State ng/ml 

Simulated ng/ml 
(% decrease) 

Plasma T3 

11.5 

9.4761 (17.6%) 

Fast Pool T3 

0.5347 

0.4401 (17.7%) 

Slow Pool T3 

3.1605 

2.5054 (20.7%) 

Plasma T4 

3.0908 

1.421 (54%) 

Fast Pool T4 

0.1373 

0.0631 (54%) 

Slow Pool T4 

0.63 

0.2897 (54%) 


Plant Model. 

There are few data available on the partitioning of perchlorate in plant parts. We used 
data from a study of perchlorate in plants near the Naval Weapons Industrial Reserve 
Plant near Waco, Texas. Perchlorate concentrations in mulberry leaves and fruits 
measured during October were 1310± 1720 ppb and 467±661ppb respectively (Figure 
10). The plant model was calibrated to these data using a water concentration of 47±28 
ppb from the same study. The predicted perchlorate concentration was adjusted to fit the 


20 of 24 







































observed data by reducing uptake from the soil water and reducing the flow into leaves 
and fruits. 





Figure 10. Observed and predicted perchlorate concentrations in mulberry plant parts. 


10.0 DISCUSSION 
Small Mammal Model. 

The modified Crosbie, et al. (1961) model comprehensively simulated the effects of cold 
stress and perchlorate on the regulation of metabolic rate and body temperature well. 
Cold stress simulation predicted that ambient temperature is the main factor to affect the 
regulation of metabolic rate and the body temperature. We can understand that the 
regulation of body temperature when exposed to cold stress resulted from the change of 
metabolic rate. In the nude man model (Crosbie, et al. 1961), the vaporization increased 
as the ambient temperature increased above 28°C, and the metabolic rate increased as the 
ambient temperature decreased below 28°C. In a cold environment, the increase of 
metabolic rate is the main physiological mechanism of the regulation of body 
temperature. Environmental chemicals, such as perchlorate, disturb the function of the 
thyroid gland that involves body metabolism, and then decreases the body metabolic rate. 
When suddenly meeting the cold stress, the body has to increase its metabolic burden to 
keep the normal body temperature. 


21 of24 















Although Crosbie, et al.’s model could simulate the regulation of metabolic rate and 
thermoregulation, the effect of perchlorate should receive further study to identify the 
mechanisms involved in disturbing thyroid hormone production 

Fish Model. The lack of measured field concentrations for catfish tissue concentrations 
and fish thyroid hormone levels makes it impossible to determine if the current models 
are accurately simulating perchlorate uptake and effects. It is important to note that the 
use of the maximum effluent concentration is a true “worst-case” scenario and the actual 
exposure levels are significantly less. This is evidenced by only trace levels in 
largemouth bass found in Caddo Lake and a high of 206 ppb in a composite sample of 
seven mosquitofish taken from the Harrison Bayou Ponded Area, where the GWTP 
effluent is discharged. 

Limited data sets for initial model calibration resulted in a simplification of the thyroid 
compartment. A singular thyroid compartment may be an oversimplification of the 
kinetic behavior of perchlorate. Chow and Woodbury (1970) determined that a three- 
compartment model (stroma, follicle, and lumen) was necessary to properly model the 
behavior of perchlorate in rat thyroids. It is unknown if fish would follow a similar 
kinetic behavior since they lack the centralized thyroid gland of mammals. The 
simplification of the thyroid compartment, in conjunction with the use of 100 ppm dosing 
data for calibration, instead of a range of concentrations, may have incorrectly estimate 
uptake at low doses. 

The rapid, and substantial, decrease in hormone levels should be viewed cautiously. We 
do not know if channel catfish respond in the same way to perchlorate exposure as the 
mosquitofish used for the inhibition term. Additionally we cannot fully characterize the 
system without the data necessary to determine a T 3 inhibition term, hence the reason T 3 
levels decreased substantially less than T 4 . At present the simulated results are only a 
“best guess” and should not be viewed as a definitive answer. It is also important to note 
that fish are very adept at altering thyroid hormone levels based on various environmental 
and dietary conditions. As a result of this ability, fish tend to rapidly reestablish normal 
hormone levels once the inhibitory condition is removed. In addition, various studies 
have shown that different species rapidly eliminate perchlorate and recover from 
exposure, once they are removed from a contaminated system. 

Plant Model. 

The vascular plant model was developed under the assumption that water is the driving 
force behind the uptake and distribution of perchlorate in plants. Because the model 
predicts tissue concentrations that are in line with laboratory and field values, it is 
reasonable to assume that water movement in plants is an important driving force in the 
uptake and distribution of perchlorate. 

The model also indicates that perchlorate is capable of bioaccumulation in the leaves and 
fruits of exposed plants. If this result is true, there is significant potential for trophic 
transfer of perchlorate if wildlife and humans consume exposed plants. Although 


22 of 24 





parameter estimates were based on calibration with lab and field data, direct parameter 
estimation may improve the accuracy of the model predictions. 


11.0 STUDY RECORDS AND ARCHIVE 

Study Records will be maintained at The Institute of Environmental and Human 
Health (TIEHH) Archive for a minimum of one after study completion date. 

12.0 REFERENCES 

Bianchi, R., G. Iervasi, A. Pilo, F. Vitek, M. Ferdeghini, F. Cazzuola, and G. 
Giraudi. 1987. Role of serum carrier proteins in the peripheral metabolism and 
tissue distribution of thyroid hormones in familial dysalbuminemic 
hyperthyroxinemia and congenital elevation of thyroxine-binding globulin. J. 
Clin. Invest. 80: 522-534. 

Bradford, C. 2002. Perchlorate uptake and effects on thyroid function in fish. 
Master’s Thesis, Texas Tech University, Lubbock, Texas. 

Chow S.Y., D.M. Woodbury. 1970. Kinetics of distribution of radioactive 
perchlorate in rat and guinea-pig thyroid glands. J. Endocrinol., 47:207-218. 

Crosbie, R. J., J. D. Hardy, and E. Fessenden. Electrical Analog Simulation of 
Temperature Regulation in Man. 1961. In “TEMPERATURE: Its Measurement 
and Control in Science and Industry”. Reinhold Publishing Corporation, New 
York, Vol. 3, p. 627. 

DiStefano, J. J., III. 1986. Modeling approaches and models of the distribution 
and disposal of thyroid hormones. In “Thyroid Hormone Metabolism” 
(Hennemann, G., Ed.). Dekker, New York/Basel. 

Dixon, K. R., R. J. Luxmoore, and C. L. Begovich. 1978. CERES - a model of 
forest stand biomass dynamics for predicting trace contaminant, nutrient, and 
water effects. I. Model description. Ecol. Modelling 5:17-38. 

Erickson, R.J. and J.M. McKim, 1990. A model for exchange of organic 
chemicals at fish gills: Flow and diffusion limitations. Aquatic. Toxicol. 18: 175- 
198. 

Gaylord, T.G., D.S. MacKenzie and D.M. Gatlin III. 2001. Growth performance, 
body composition and plasma thyroid hormone status of channel catfish (Ictalurus 
punctatus) in response to short-term feed deprivation and refeeding. Fish Physiol. 
Biochem. 24: 73-79. 

Hershman, J., K. Nadamanee, M. Sugawara, A.E. Pekary, R. Ross, B. Singh, and 
J.J. DiStefano, III. 1986. Thyroxine and triiodothyronine kinetics in cardiac 
patients taking amiodarone. Acta Endocrinol. Ill: 193-199. 


23 of 24 





Machle, W., and T. F. Hatch. 1947. Heat: man’s exchange and physiological 
responses,” Physiol. Rev. 27, 200. 

Nichols, J.W., J.M., Anderson, M.E., Gargas, M.L., Clewell, H.J., III and R.J. 
Erickson. 1990. A physiologically based toxicokinetics model for the uptake and 
disposition of waterborne organic chemicals in fish. Toxicol. Appl. Pharmacol. 
106:433-447, 1990. 

Nichols, J.W., J.M. McKim, M.E. Anderson, G.J. Lien, A.D. Hoffman and S.L. 
Bertelson. 1991. Physiologically based toxicokinetics modeling of three 
waterborne chloroethanes in rainbow trout (Oncorhyncus mykiss). Toxicol. Appl. 
Pharmacol. 110:374-389. 

Nichols, J.W., J.M. McKim, G.J. Lien, A.D. Hoffman, S.L. Bertelsen and C.A. 
Gallinat. 1993. Physiologically-based toxicokinetic modeling of three 
waterborne chloroethanes in channel catfish, Ictalurus punctatus, Aquatic 
Toxicol. 27:83-112. 

Pilo, A., G. Iervasi, F. Vitek, M. Fereghini, F. Cazzuola and R. Bianchi. 1990. 
Thyroidal and peripheral production of 3,5,3’-triiodothyronine in humans by 
multicompartmental analysis. Am. J. Physiol. 258: E715-E726. 

Ricklefs, R. E. 1993. The Economy of Nature, third edition, pp.189. W.H. 
Freeman, New York. 

Sefkow, A. J., J. J. DiStefano III, B. A. Himick, S. B. Brown and J. G. Eales. 

1996. Kinetic analysis of thyroid hormone secretion and interconversion in the 5- 
day fasted rainbow trout, Oncorhyncus mykiss. Gen. Comp. Endocrinol. 101: 123- 
138. 

Smith P.N., C.W. Theodarakis, T.A. Anderson, and R.J. Kendall. 2001. 
Preliminary assessment of perchlorate in ecological receptors at Longhorn Army 
Ammunition Plant (LHAAP), Kamack, Texas. Ecotoxicology 10: 305-313. 

Wissler, E. H. 1961. The Mathematical Analysis of Heat Transfer and 
Temperature Relations in the Human Body,” University of Texas Report (March 
15). 

Wyndham, C. J. and A. R. Atkins, 1960. Approach to the solution of human bio- 
thermal problem with the aid of an analog computer,” Paper No. 27, 3 rd Internal 
Conference on Medical Electronics (July, 1960). 


24 of 24 









Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
FROG-03-01 Phase V 


*9 MAR 2004 

PRELIMINARY ASSESSMENT OF RADIOLABELED IODIDE UPTAKE BY 
BULLFROG TADPOLE THYROID GLAND: A METHOD DEVELOPMENT AND 

FEASABILITY STUDY 

STUDY NUMBER: FROG-03-01 

SPONSOR: Strategic Environmental and Research Development 

Program 

SERDP Program Office 

901 North Stuart Street, Suite 303 

Arlington, VA 22203 

CONTRACT ADMINISTRATOR: The Institute of Environmental and Human Health 

Texas Tech University/TTU Health Sciences Center 
Box 41163 

Lubbock, TX 79409-1163 

TESTING FACILITY: The Institute of Environmental and Human Health 

Texas Tech University 
Box 41163 

Lubbock, TX 79409-1163 

TEST SITE: Texas Tech University 

Human Sciences Building 
Box 42002 

Lubbock, TX 79409-2002 
RESEARCH INITIATION: July 1,2003 

RESEARCH COMPLETION: December 31, 2003 


Page 1 of 15 



Final Report TIEHH Project No. T9700 

U.S. Air Force Coop. Agreement CU 1235 FROG-03-01 Phase V 


Table of Contents 

List of Tables and Figures...3 

Good Laboratory Practice Statement.4 

I. 0 Descriptive Study Title.5 

2.0 Study Number.5 

3.0 Sponsor.5 

4.0 Testing Facility Name and Address. 5 

5.0 Proposed Experiment Start and Termination Dates. 5 

6.0 Key Personnel.... 5 

7.0 Study Summary. 5 

8.0 Test Materials.6 

9.0 Justification of Test System.7 

10.0 Test animals.7 

II. 0 Experimental Design.7 

12.0 Methods......9 

13.0 Results......9 

14.0 Discussion. 14 

15.0 Study Records and Archive.14 

16.0 References. 14 

17.0 Appendices.14 


Page 2 of 15 






















Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
FROG-03-01 Phase V 


List of Tables and Figures 

Figure 1. Microdissected thyroid glands from prometamorphic bullfrog tadpoles.8 

Table 1. Mean specific iodide transport in thyroid/branchial cartilage).11 

Figure 2. Results of the first washout experiment on isolated thyroid pairs. 12 

Figure 3. Results of the second washout experiment on isolated thyroid pairs.13 


Page 3 of 15 







Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
FROG-03-01 Phase V 


GOOD LABORATORIES PRACTICES STATEMENT 

This study was conducted in accordance with established Quality Assurance 
Program guidelines and in the spirit of Good Laboratory Practice Standards whenever possible 
(40 CFR Part 160, August 17, 1989). 


Submitted By: 






Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
FROG-03-01 Phase V 


1.0 DESCRIPTIVE STUDY TITLE: Preliminary Assessment of Radiolabeled Iodide 
Uptake By Bullfrog Tadpole Thyroid Gland: A Method Development And Feasability 
Study. 

2.0 STUDY NUMBER: FROG-03-01 
3.0 SPONSOR: 

Strategic Environmental and Research Development Program 

SERDP Program Office 

901 North Stuart Street, Suite 303 

Arlington, VA 22203 


4.0 TESTING FACILITY NAME & ADDRESS: 

The Institute of Environmental and Human Health 
Texas Tech University 

Texas Tech University Health Sciences Center 
Box 41163 

Lubbock, TX 79409-1163 

5.0 PROPOSED EXPERIMENTAL START & TERMINATION DATES: 

Start Date: 7/1/03 
Termination Date: 12/31/03 

6.0 KEY PERSONNEL: 

James A. Carr, Co-Principal Investigator/ DBS Testing Facility Management/Study 
Director 

Mike Wages, Research Associate 
Mathilde Odeyer, undergraduate research student 
James Sullivan, undergraduate research student 
Jeff Thatcher, undergraduate research student 
Nathan Collie, unpaid consultant 

Todd Anderson, Analytical Chemist/ Asst. Director for Science 
Ryan Bounds, Quality Assurance Manager 

Ronald Kendall, Principal Investigator/ TIEHH Testing Facility Management 
7.0 STUDY SUMMARY: 

We studied iodide uptake using thyroid cartilage and isolated thyroid glands from 
bullfrog tadpoles in vitro. In the first set of experiments we attempted to measure rapid 
uptake of I25 I using 3 HPEG as a tissue extracellular space marker as a means of 
determining the first order rate kinetics for iodide transport by the sodium-dependent 
iodide symporter (NIS). There was no apparent time-dependent transport of 125 I into the 
thyroid/cartilage composite, and no affect of perchlorate on calculated 125 I transport (100 


Page 5 of 15 



Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
FROG-03-01 Phase V 


pM perchlorate). Moreover, cartilage alone exhibited greater apparent iodide transport 
than thyroid/cartilage complexes together. These results suggested that the 
thyroid/cartilage composite may be a) non-specifically binding considerable 125 I, and b) 
that 3 HPEG was not a suitable extracellular space marker. 

To avoid the confounding effects of nonspecific binding to cartilage, and the 
confounding results obtained using 3 HPEG as an extracellular space marker, we carried 
out a second set of experiments to investigate the feasibility of using isolated tadpole 
thyroid glands for determining iodide transport. The results clearly demonstrate that 4 x 
15s washes are sufficient to remove most of the background counts and that l25 I uptake 
by thyroid was much greater than background counts in each experiment. Thus, this 
protocol appears to be promising for working out the first order rate kinetics of the NIS 
and the effects of perchlorate on transport rate. 

8.0 TEST MATERIALS: 

Test Chemical name: sodium perchlorate 
CAS number: 7601-89-0 
Characterization: X% pure, 

Source: Sigma-Aldrich Chemical Company 

Test Chemical name: sodium iodide 
CAS number: 7681-82-5 
Characterization: X% pure, 

Source: Sigma-Aldrich Chemical Company 

Test Chemical name: Na 125 I 
Characterization: 99.5% pure, 106mCi/mL 
Specific activity: 17.4 Ci/mg 
Source: Perkin-Elmer Life Sciences Products 

Test Chemical name: [l,2- 3 H]-polyethylene glycol 
Characterization: 99.5% pure, 0.5-2 mCi/g 
Source: Perkin-Elmer Life Sciences Products 

Reference Chemical name: Amphibian Ringer’s solution, preincubation solution 
CAS number: Not Applicable 

Characterization: Deionized water containing the following reagents per 20 L: 101.3 mM 
NaCl (119.48 g); 3 mM KC1 (4.47 g); 3 mM NaHP0 4 (8.52 g); 1 mM MgS0 4 (2.4 g); 2 
mM NaHC0 3 (33.6 g); 2 mM CaCl 2 (4.4 g), 5 mM glucose (18 g). 

Reference Chemical name: Amphibian Ringer’s solution, incubation solution 
CAS number: Not Applicable 

Characterization: Deionized water containing the following reagents per 20 L (except for 
Nal): 101.3 mM NaCl (119.48 g); 3 mM KC1 (4.47 g); 3 mM NaHP0 4 (8.52 g); 1 mM 
MgS0 4 (2.4 g); 2 mM NaHCOs (33.6 g); 2 mM CaCl 2 (4.4 g), 5 mM glucose (18 g), 5 pM 
Nal (0.00015 g/0.2 L). On the day of testing Na 125 I was added to a final concentration of 
0.1-1 pCi/mL (approximately 2E5-2E6 cpm/mL, or 30-300 nM 125 I). 


Page 6 of 15 





Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
FROG-03-01 Phase V 


9.0 JUSTIFICATION OF TEST SYSTEM 

Ionic perchlorate alters calcium balance in fishes and amphibians (Luttgau et al., 
1983; Thevenod et ah, 1992; Jong et ah, 1997) as well as other vertebrates. Perchlorate is 
known to prevent intake of iodide from water or food and thus it is goitrogenic (thyroid 
gland inhibitor) in many animals including fishes and amphibians (Miranda et ah, 1996; 
Manzon and Youson, 1997). Because of the important role played by hormones in 
development and reproduction, endocrine disruption is likely to lead to serious 
impairments in growth, reproductive fitness, and consequently, amphibian and wildlife 
stability as well as human health. Although the effects of AP on thyroid function of 
larval frogs has already been exa mi ned (Goleman et ah, 2002a, b) the direct effects of 
perchlorate on iodide uptake by tadpole thyroid tissue remains unexplored. Bullfrogs are 
native to the US and thus represent a useful surrogate for extrapolating to other native 
ranids. Furthermore they are sufficiently large to permit dissection of the thyroid gland 
(Figure 1) for analysis of in vivo and in vitro exposures. In this study we investigated the 
feasibility of using an in vitro thyroid preparation to examine perchlorate-dependent 
i nh ibition of thyroidal iodide uptake. This information will be useful in determining the 
affinity of the anuran sodium/iodide symporter to perchlorate, data which presently do 
not exist but are critical for appropriate modeling of perchlorate effects on frogs. 

Virtually nothing is known about the molecular structure or transport kinetics of this 
transporter in other vertebrates, particularly amphibians. It is important to note that our 
goal was to accurately characterize first order rate kinetics of the NIS, and not simply 
examine bulk iodide uptake as has been done in other studies. As such, much of the work 
completed to date falls under the category of method development, with the long term 
goal being the collection of reliable data on the transport kinetics that can be used to 
predict and model perchlorate disruption of thyroid function in these organisms. 

10.0 TEST ANIMALS: 

Species: Rana catesbeiana, American Bullfrog 

Strain: wild type 

Age: prometamorphic larvae 

Number: approximately 100 

Source: Charles Sullivan Inc. 

11.0 EXPERIMENTAL DESIGN INCLUDING BIAS CONTROL: 

In the first set of experiments we examined the time-dependent transport of 125 I using 3 H- 
PEG as an extracellular space marker. The goal of these preliminary experiments was to 
identify an incubation time at which the extracellular space is fully occupied but transport 
of 125 I is till linear and is not yet showing signs of saturation. A total of six experiments 
were carried in the summer and early fall of2003. Thyroid glands and associated 
cartilage from three tadpoles per experiment (Fig. 1) were incubated separately in the 
presence of Na I25 I for varying times to determine time-dependent iodide transport. At the 
incubation time providing maximal transport, thyroid/cartilage complexes were incubated 
with Na I in the presence or absence of sodium perchlorate (100 pM). 


Page 7 of 15 





Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
FROG-03-01 Phase V 


The results from the first studies suggested that co-incubation of thyroid glands and 
cartilage together would not be feasible. Therefore, we examined the feasibility of 
examining l25 I uptake in isolated tadpole thyroid glands. Rather than use 3 H-PEG as an 
extracellular space marker for determining nonspecific binding, we designed a set of 
experiments to examine timed rinses of the tissue with ice-cold preincubation buffer. 
Thyroid gland pairs (dissected free from associated cartilage) from three tadpoles per 
experiment (Fig. 1) were incubated separately in the presence of Na l2S I for 30 min and 
washed for varying times with ice-cold preincubation buffer. 



Figure 1. Microdissected thyroid glands from prometamorphic bullfrog tadpoles. Fig. 1A . 
Thyroid glands attached to branchial cartilage. The thyroid glands exist as distinct bilaterally 
symmetric pair of glands attached to the cartilage by connective tissue. Fig. IB . Enlargement of 
a single thyroid gland showing the follicular structure and highly vascularized nature of the 
gland. Photo taken by Dr. Carr at Elms College, Chickopee MA, February 2003. 


Page 8 of 15 




Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
FROG-03-01 Phase V 


12.0 METHODS: 

12.1 Test System acquisition, quarantine, acclimation. Prometamorphic tadpoles 
(Taylor-Kollros stage XV-XIX) were obtained from Carolina Biological Supplies. 
Refer to TIEHH AQ-1-14 for details on routine R. catesbeiana tadpole husbandry. 
They were maintained in a large fiberglass enclosure (760 L, 108"L x 24"W x 
22"D, stocking density = 50) in filtered and dechlorinated tap water at 22 ± 2 °C 
on a 12L: 12D light regimen for at least 7 d prior to initiation of exposure. The 
tank was labeled as indicated in SOPs TIEHH AQ-1-24/ DBS ET-1-03, which 
includes genus and species name, common name, project name, number, and start 
date, and the name of the person primarily responsible for animal care 

12.2 Test Material Application 
Rates/concentrations: lOOppb 
Frequency: once for 2 min 

Route/Method of Application: Perchlorate was added to the incubation medium 
bathing the thyroid tissue. 

12.3 Animal Sacrifice and Sample Collections. Animals were quickly euthanized in 
MS-222 (Ig/L, TIEHH AQ-1-03/ DBS AF-3-03). In the first set of experiments 
using the radiolabeled extracellular space marker 3 HPEG, thyroid glands attached 
to the branchial cartilage were removed. In a second set of experiments, isolated 
thyroid gland pairs were removed. Tissues were placed in 1 mL of ice-cold 
oxygenated preincubation buffer. After all tissues were collected, they were 
transferred to individual wells of a sterile 24-well culture plate containing 1 mL of 
prewarmed, oxygenated preincubation buffer at 21° C. Tissues were pre¬ 
incubated for 5 min before transfer to individual wells containing 1 mL of 
incubation buffer and Na 125 I (and 3 HPEG in some experiments). Tissues were 
then incubated for varying periods of time at 21° C and constant gassing with 95% 
0 2 / 5% C0 2 in a Dubnoff shaker. At the end of the incubation, tissues were 
blotted. In experiments in which 3 HPEG was used, tissues was transferred to 
scintillation vials containing Soluene. Tissues were solubilized at 60° C for 16 h 
followed by liquid scintillation spectroscopy. In cases where 3 HPEG was not 
used, tissues were transferred directly to 12 x 75 mm polypropylene culture tubes 
and counts determined on a gamma counter. 

12.4 Endpoint Analysis 

Counts per minute was the measured endpoint. 

13.0 RESULTS: 

hi February 2003, Dr. Carr visited the laboratory of Sr. Dr. Mary Wright at Elm’s 
College in Chickopee MA to leam the method for dissecting thyroid glands from bullfrog 
tadpoles. The methodology was modified during this visit and it was clear after 
examining several developmental stages that the thyroid glands were most easy to 
remove and were largest in prometmamorphic tadpoles between the stages of XV and 
XXII. After stage XXII the thyroid glands move laterally and lose quite a lot of their 


Page 9 of 15 




Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
FROG-03-01 Phase V 


vascularization, making them very difficult to visualize in fresh preparations. The large 
size of thyroid glands between stages XV and XXII corresponds to the intense degree of 
thyroid hormone secretion that is taking place during this period as tadpoles lose their 
tails and the forelimbs emerge. 

Results of the initial transport studies are reported in Table 1. In these 
experiments, 3 HPEG was used as a tissue extracellular space marker, and counts present 
in the extracellular apace were subtracted from total counts to obtain specific I 
transport in finol/min. There was no apparent time-dependent transport of 125 I into the 
thyroid/cartilage composite, and no affect of perchlorate (100 pM perchlorate) on 
calculated 125 I transport. Moreover, cartilage alone exhibited greater apparent iodide 
transport than thyroid/cartilage complexes together. These results suggested that the 
thyroid/cartilage composite may be a) non-specifically binding considerable 125 I, and b) 
that 3 HPEG was not a suitable extracellular space marker. 

In the first set of experiments, the size of the branchial cartilage relative to the 
size of the thyroids was considerable (Fig. 1). To avoid the confounding effects of 
nonspecific binding to cartilage, and the confounding results obtained using 3 HPEG as an 
extracellular space marker, we carried out a second set of experiments to investigate the 
feasibility of using isolated tadpole thyroid glands for determining iodide transport. To 
our knowledge this has never been done before, and we wanted to confirm that we could 
detect measurable transport. In order to confirm that we were maximally reducing 
background counts and could still detect measurable 125 I uptake by thyroids, we 
incubated isolated thyroid gland pairs with 125 I for 30 min and then examined the washout 
kinetics using cold preincubation buffer. The results of two washout experiments are 
shown in Figures 2 and three. In these experiments each wash lasted 60 s (Experiment 1) 
or 15 s (experiment 2). The results clearly demonstrate that 4 x 15 s washes are sufficient 
to remove most of the background counts and that 125 I uptake by thyroid was much 
greater than background counts in each experiment. Thus, this protocol appears to be 
promising for working out the first order rate kinetics of the NIS and the effects of 
perchlorate on transport rate. We had planned to conduct experiments along these lines 
in late November but were unable to get prometamorphic tadpoles at the right 
developmental stage. We are waiting for these animals to develop to later 
prometamorphic stages to continue testing this protocol. 


Page 10 of 15 






Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
FROG-03-01 Phase V 


Table 1. Mean (± SEM) specific iodide transport in thyroid/branchial cartilage 
composites from bullfrog tadpoles._ 


Treatment 


Specific iodide transport (fmol/min)* 

5 pM Nal 

2 min 

7.59 ±2.55 


8 min 

2.16 ±0.61 


16 min 

1.50 ±0.20 


30 min 

1.24 ±0.11 

5 pM Nal +100 pM perchlorate 

2 min 

2.55 ± 1.02 

5 pM Nal +100 pM perchlorate 
(Cartilage alone) 

2 min 

12.2 ±2.85 


* Determined by subtracting 3 HPEG counts from total counts. 


Page 11 of 15 










Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
FROG-03-01 Phase V 



Wash Number 


Figure 2. Results of the first washout experiment on isolated thyroid pairs from prometamorphic 
bullfrog tadpoles. Total counts per minute (CPM) in the incubation medium are shown on the y- 
axis. Wash times were 60 s each. Paired thyroid glands from three tadpoles were incubated 
individually with l25 I for 30 min at 21° c with constant 95%02/5%CC>2 gassing. The l25 I (mean 
CPM per thyroid pair) taken up by the paired thyroids is shown by the red line. 


Page 12 of 15 























Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
FROG-03-01 Phase V 



Wash Number 


Figure 3. Results of the second washout experiment on isolated thyroid pairs from 
prometamorphic bullfrog tadpoles. Total counts per minute (CPM) in the incubation medium 
are shown on the y-axis. Wash times were 15 s each. Paired thyroid glands from three tadpoles 
were incubated individually with 125 1 for 30 min at 21° c with constant 95%02/5%CC>2 gassing. 
The 125 1 (mean CPM per thyroid pair) taken up by the paired thyroids is shown by the red line. 


Page 13 of 15 
























Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
FROG-03-01 Phase V 


10. DISCUSSION: 

Our data indicate that thyroid glands must be isolated prior to incubation in order 
to minimize the confounding effects of nonspecific background binding of 125 I to 
cartilage. The data on iodide uptake in isolated, paired thyroids is highly reproducible. 
The confounding effect of nonspecific 125 I uptake was so great in the first series of 
experiments that we observed no effect of perchlorate on 125 I uptake. Perchlorate is well 
known to have great affinity for the NIS. 

Our data also indicate that not all developmental stages are suitable for thyroid 
studies in vitro. The thyroid glands are extremely difficult to locate in adult frogs and in 
early stage tadpoles because the degree of vascularization is quite a bit less than during 
late prometamorphosis, when the thyroid is at its greatest level of activity. This creates 
somewhat of a problem in obtaining suitable numbers of tadpoles at the right 
developmental stages, because two commercial suppliers do not adequately stage their 
material that they provide and another commercial source (Charles Sullivan Inc.) collects 
specimens directly from local ponds and generally cannot supply animals between the 
months of October and April. For example, of 50 animals ordered in late 2003, only 2-3 
were of the correct developmental stage. Although these animals continue to grow, it 
may be several weeks before they reach prometamorphosis. Bullfrog tadpoles may take 
2-3 years total to complete metamorphosis. 

11. STUDY RECORDS AND ARCHIVE: 

Study Records will be maintained at The Institute of Environmental and Human Health 
(TIEHH) Archive for a minimum of one year after study completion date. 

12. REFERENCES: 

GoIeman,W.L., Urquidi, L.J., Anderson, T.A., Kendall, R.J., Smith E.E., and Carr, J.A. 
(2002a). Environmentally relevant concentrations of ammonium perchlorate 
inhibit development and metamorphosis in Xenopus laevis. Environ. Toxicol. 
Chem. 21: 424-430. 

Goleman, W.L., Carr, J.A., and Anderson, T.A. (2002b). Environmentally relevant 

concentrations of ammonium perchlorate inhibit thyroid function and alter sex 
ratios in developing Xenopus laevis. Environ. Toxicol. Chem. 21:590-597. 
Luttgau, H.C., Gottschalk, G., Kovacs, L., Fuxreiter, M. (1983). How perchlorate 

improves excitation-contraction coupling in skeletal muscle fibers Biophys. J. 
43:247-249. 

Jong, D.S., Stroffekova, K., Heiny, J.A. (1997). A surface potential change in the 
membranes of frog skeletal muscle is associated with excitation-contraction 
coupling. J. Physiol.499:787-808. 

Manzon, R.G. and Youson, J.H. (1997). The effects of exogenous thyroxine (T 4 ) on 

triiodothyronine (T 3 ), in the presence or absence of potassium perchlorate, on the 
incidence of metamorphosis and on serum T 4 and T 3 concentrations in larval sea 
lampreys (Petromyzon marinus L). Gen. Comp. Endocrinol. 106: 211-220. 


Page 14 of 15 







Final Report 

U.S. Air Force Coop. Agreement CU 1235 


TIEHH Project No. T9700 
FROG-03-01 Phase V 


Miranda, L.A., Pisano, A. and Casco, V. (1996). Ultrastructural study of thyroid glands 
of Bufo renarum larvae kept in potassium perchlorate solution. Biocell 20: 
147-153. 

Thevenod, F. and Jones, S.W. (1992). Cadmium block of calcium current in frog 
sympathetic neurons. Biophys. J. 63:162-168. 


Page 15 of 15