Skip to main content

Full text of "USPTO Patents Application 09804625"

See other formats


u^/uy/^uoi 11 .al FAX 



sraby certify thaVthbi paper or fee fa being 
waited with the United Stataa Postal Service 
(press Mail Post Office to Addressee'* service 
dar 37 C.F.R.1. 10 on the date indicated above 

1 is addressed to the Commissioner of Patents QI 5160C 

A Trademarks, Washington, O.C 20231. 



" NOVEL BMP PRODUCTS 

This application is a continuation-in-part of U.S. Serial 
Nos. 493,272 filed March 14, 1990 (which is a CIP of 406,217 
filed September 12, 1989); 378,537 filed July ll, 1989; and 
655,579 filed February 14, 1991 which is a divisional of U.S. 
Serial No. 179,100 filed April 8, 1988 (now U.S. Patent 
5,013,649) which is a continuation-in-part of U.S. Serial Nos. 
028,285 filed March 20, 1987 now abandoned; 943,332 filed 
December 17, 1986 now abandoned; and 880,776 filed July l, 1986 
now abandoned. 

The present invention relates to 1 a novel family of 
purified proteins designated BMP-2 and BMP-4 proteins and 
processes for obtaining and producing them. These proteins 
may be used to induce bone and/or cartilage formation and in 
wound healing and tissue repair. 

BMP-2 and BMP-4 proteins have previously been referred to 
collectively as BMP-2 proteins (BMP-2 previously referred to 
as BMP- 2 A or BMP-2 Class I and BMP-4 as BMP-2B or BMP-2 Class 
II). 

Human BMP-2 proteins are characterized by an amino acid 
sequence comprising amino acid #299 (His, Pro, Le U ...) - # 396 
(Arg) of Figure 2 (SEQ ID NO: 4). Human BMP-2 proteins are 
further characterized as dimers of BMP-2 subunits. Mature BMP- 
2 is characterized by comprising amino acid #283 (Gin, Ala, 
Lys...) - #396 (Arg) of Figure 2. Mature BMP-2 is further 
characterized as a disulfide linked dimer wherein each subunit 
comprises amino acids #283-#396 of Figure 2 (SEQ ID NO: 4). 

Human BMP-2 may be produced by culturing a cell 
transformed with a DNA sequence comprising the nucleotide 
coding sequence from nucleotide #356 to #1543 as shown in 
Figure 2 (SEQ ID NO: 3) and recovering and purifying from the 
culture medium a protein comprising amino acid #299 to #396 as 
shown in Figure 2 (SEQ ID NO: 4) , substantially free from other 



03/09/2001 11:52 FAX 



@1003 



2 

proteinaceous materials with which it is co-produced. Human 
BMP-2 is characterized by the ability to induce bone formation. 
Human BMP-2 is further characterized by the ability to induce 
cartilage formation. Human BMP-2 may be further characterized 
5 by the ability to demonstrate cartilage and/or bone formation 
activity in the rat bone formation assay described below. In 
preferred embodiments, the proteins of the invention 
demonstrate activity in this assay at a concentration of 10 
- 500 pg/gram of bone. BMP-2 proteins may be characterized by 
10 the ability of 1 /jg of the protein to score at least +2 in the 
rat bone formation assay of Example III using the* modified 
r scoring method described in Example VII. 

J? The bovine BMP-2 protein is a member of the family of BMP- 

Ur 2 proteins of the invention. Bovine BMP-2 proteins comprise 
15 rf the amino acid sequence represented by amino acid #32 to amino 
m acid #129 of Figure 1 (SEQ ID NO: 2) . These proteins are 
capable of inducing- the formation of cartilage and/or bone, 
f Bovine BMP-2 may be further characterized by the ability to 
|:i demonstrate cartilage and/or bone formation activity in the rat 
20 bone formation assay described below. In preferred 
J embodiments, the proteins of the invention demonstrate activity 
f;3 in this assay at a concentration of 10 ^g - 500 /xg/gram of 
^ bone. These proteins may be characterized by the ability of 
1 m9 of the protein to score at least +2 in the rat bone 
25 formation assay described in Example III using the modified 
scoring method as described in Example VII. 

Human BMP-4 proteins are characterized by an amino acid 
sequence comprising amino acids #311{His, Ser, Leu ...) - #408 
(Arg) as shown in Figure 3 (SEQ ID NO: 6) . Mature BMP-4 
30 comprises amino acids #293 (Ser, Pro, Lys...) - #408 (Arg) of 
Figure 3. BMP-4 proteins are further characterized as dimers 
of BMP-4 subunits. Mature BMP-4 is further characterized as 
a disulfide linked dimer wherein each subunit comprises amino 
acids #293-#408 of Figure 3 (SEQ ID NO: 6). 
35 BMP-4 may be produced by culturing a cell transformed with 



03/09/2001 11:53 FAX 

• 



3 

a DNA sequence comprising the nucleotide coding sequence from 
nucleotide #403 to nucleotide #1626 substantially as shown in 
Figure 3 (SEQ ID NO: 5) and recovering and purifying from the 
culture medium a protein containing the amino acid sequence 
5 from amino acid #311 to #408 as shown in Figure 3 (SEQ ID NO: 
6) substantially free from other proteinaceous materials with 
which it is co-produced, BMP-4 proteins are capable of 
inducing the formation of bone. BMP-4 proteins are capable of 
inducing formation of cartilage, BMP-4 proteins are further 
10 characterized by the ability to demonstrate cartilage and/or 
bone formation activity in the rat bone formation assay 
described below. In preferred embodiments, the proteins of the 
invention demonstrate activity in this assay at a concentration 
^ of 10 /ig - 500 ^g/gram of bone. These proteins may be 
15 characterized by the ability of 1 ^g of the protein to score 
Tf at least +2 in the rat bone formation assay of Example III 
using the modified scoring method described in Example VII, 

Another aspect of the invention provides pharmaceutical 
p compositions containing a therapeutically effective amount of 
2 0 :f a BMP-2 or BMP-4 protein in a pharmaceutically acceptable 
.jh vehicle or carrier. These compositions of the invention may 
D be utilized in the formation of cartilage. These compositions 
may further be utilized in the formation of bone. They may 
also be used for wound healing and tissue repair. In further 

2 5 embodiments the compositions of the invention may be utilized 

for neuronal survival. 

Further compositions of the invention may comprise a 
therapeutically effective amount of BMP-2 and BMP-4 in a 
pharmaceutically acceptable vehicle. Compositions of the 

3 0 invention may further include, in addition to a BMP-2 or BMP- 

4 protein, at least one other therapeutically useful agent such 
as the BMP proteins BMP-1, BMP-3 , BMP-5, BttF-6, BMP-7 , and BMP- 
8 disclosed respectively in co-owned U.S. patent applications 
Ser. No. 655,578, Ser. No. 179,197, Ser. No. 370,547, Ser. No. 
35 370,544 Ser. No. 370,549, and Ser. No. 525,357. The 



g]004 




4 

compositions of the invention may comprise, in addition to a 
BMP- 2 or BMP-4 protein, otljer therapeutically useful agents 
including growth factors such as epidermal growth factor (EGF) , 
fibroblast growth factor (FGF) , and transforming growth factor 
(TGF-a and TGF-£) . The compositions may also include an 
appropriate matrix for instance, for supporting the composition 
and providing a surface for bone and/or cartilage growth. The 
matrix may provide slow release of the BMP protein and/or the 
appropriate environment for presentation of the BMP protein. 

The BMP-2 and BMP-4 compositions may be employed in 
methods for treating a number of bone and/or cartilage defects, 
periodontal disease and various types of wounds. These 
methods, according to the invention, entail administering to 
a patient needing such bone and/or cartilage formation wound 
healing or tissue repair, an effective amount of a BMP-2 or 
BMP-4 protein. These methods may also entail the 

administration of a protein of. the invention in conjunction 
with at least one of the novel BMP proteins disclosed in the 
co-owned applications described above. In addition, these 
methods may also include the administration of a BMP-2 or BMP- 
4 protein with other growth factor^. 

Still a further aspect of the invention are DNA sequences 
encoding a BMP-2 or BMP-4 protein. Such sequences include the 
sequence of nucleotides in a 5* to 3 1 direction illustrated in 
Figures 1 through 3 (SEQ ID NO: 1,3, and 5) or DNA sequences 
which hybridize under stringent conditions with the DNA 
sequences of Figures 1-3 and encode a protein having the 
ability to induce the formation of cartilage and/or bone. 
Finally, allelic or other variations of the sequences of 
Figures 1 through 3, whether such nucleotide changes result in 
changes in the peptide sequence or not, are also included in 
the present invention. 

A further aspect of the invention entails a vector 
comprising a DNA sequence as described above in operative 
association with an expression control sequence therefor. Such 



vector may be employed in a novel process for producing a BMP- 
2 or BMP-4 protein of the, invention in which a cell line 
transformed with a DNA sequence encoding a BMP-2 or BMP-4 
protein in operative association with an expression control 
sequence therefor, is cultured in a suitable culture medium and 
a BMP-2 or BMP-4 protein is recovered and purified therefrom. 
This claimed process may employ a number of known cells both 
prokaryotic and eukaryotic as host cells for expression of the 
polypeptide. 

Other aspects and advantages of the present invention will 
be apparent upon consideration of the following detailed 
description and preferred embodiments thereof. 

Brief Description of the Drawing 

FIG. 1 comprises partial DNA and derived amino acid sequence 
of bovine BMP-2 from bacteriophage lambda bP-21, ATCC #40310 
further described below. 

FIG. 2 sets forth the DNA and derived amino acid sequence of 
human BMP-2 from lambda U20S-39, ATCC #40345 further described 
below. 

FIG. 3 sets forth the DNA and derived amino acid sequence of 
human BMP-4 from lambda U20S-3, ATCC #40342 further described 
below. 

Detailed Descri ption of the Invention 

BMP-2 proteins are characterized by an amino acid sequence 
comprising amino acid #299-#396 of Figure 2 (SEQ ID NO: 4). 
BMP-2 proteins are further characterized as dimers of BMP-2 
subunits. Mature BMP-2 comprises amino acids #283-#396 of 
Figure 2. Mature BMP-2 is further characterized as a disulfide 
linked homodimer wherein each subunit comprises amino acids 
#283-#396 of Figure 2 (SEQ ID NO: 4) . 

The purified human BMP-2 proteins of the present invention 



!&Q07 



6 

are produced by culturing a host cell transformed wth a DNA 
sequence comprising the DNA coding sequence of Figure 2 (SEQ 
ID NO: 3) from nucleotide #356 to nucleotide #1543 and 
recovering and purifying from the culture medium a protein 
5 which contains the 97 amino acid sequence or a substantially 
homologous sequence as represented by amino acid #299 to #396 
of Figure 2 (SEQ ID NO: 4) . The BMP-2 proteins recovered from 
the culture medium are purified by isolating them from other 
proteinaceous materials with which they are co-produced and 
10 from other contaminants present. 

BMP-4 proteins are characterized by an amino acid sequence 
comprising amino acids #311-#408 as shown in Figure 3 (SEQ ID 
^ NO: 6) „ BMP-4 proteins are further characterized as dimers of 
I : BMP-4 subunits* Mature BMP-4 comprises amino acids #293-#408 
15 of Figure 3. Mature BMP-4 is further characterized as a 
)T disulfide linked homodimer each subunit comprising amino acids 
#293-#408 of Figure 3 (SEQ ID NO: 6) . 

The purified BMP-4 proteins are produced by culturing a 
P host cell transformed with a DNA sequence comprising the DNA 
20 coding sequence of Figure 3 (SEQ ID NO: 5) from nucleotide #403 
/f ; to nucleotide #1626 and recovering and purifying from the 
£ culture medium a protein comprising the amino acid sequence 
^ from amino acid #311 to #408 of Figure 3 (SEQ ID NO: 6} . The 
BMP-4 proteins recovered from the culture medium are purified 
25 by isolating them from other proteinaceous materials with which 
they are co-produced and from other contaminants present. 

BMP-2 and BMP-4 proteins are characterized by the ability 
to induce the formation of bone. They are further 
characterized by the ability to induce the formation of 
3 0 cartilage. BMP-2 and BMP-4 proteins may be further 

characterized by the ability to demonstrate cartilage and/or 
bone formation activity in the rat bone formation assay 
described below. In preferred embodiments, the proteins of the 
invention demonstrate activity in this rat bone formation assay 
3 5 at a concentration of 10 pg - 500 jug/gram of bone. These 



10 



proteins may be characterized by the ability of 1 of the 
protein to score at least +2 in the rat bone formation assay 
using the modified scoring method described in Example VII. 

The BMP-2 and BMP-4 proteins provided herein also include 
factors encoded by the sequences similar to those of Figures 
1 -3 (SEQ ID NO: 1,3,5), but into which modifications are 
naturally provided (e.g. allelic variations in the nucleotide 
sequence which may result in amino acid changes in the 
polypeptide) or deliberately engineered. For example, 
synthetic polypeptides may wholly or partially duplicate 
continuous sequences of the amino acid residues of Figures 1 - 
q 3. These sequences, by virtue of sharing primary, secondary, 
IJi or tertiary structural and conformational characteristics with 
r- bone growth factor polypeptides of Figures 1-3 may possess 
l|. bone growth factor biological properties in common therewith. 
J ; Thus, they may be employed as biologically active substitutes 
for naturally-occurring BMP-2 and BMP-4 polypeptides in 
^ therapeutic processes. 

Ij Other specific mutations of the sequences of BMP-2 and 

2ffi BMP-4 proteins described herein involve modifications of at 
least one of the glycosylation 'sites. The absence of 
iA glycosylation or only partial glycosylation results from amino 
acid substitution or deletion at asparagine- linked 
glycosylation recognition sites present in the sequences of 
BMP-2 and BMP-4 proteins shown in Figures 1-3. The 
asparagine-1 inked glycosylation recognition sites comprise 
tripeptide sequences which are specifically recognized by 
appropriate cellular glycosylation enzymes. These tripeptide 
sequences are either asparagine-X-threonine or asparagine-X- 
serine, where X is usually any amino acid. A variety of amino 
acid substitutions or deletions at one or both of the first or 
third amino acid positions of a glycosylation recognition site 
(and/or amino acid deletion at the second position) results in 
non-glycosylation at the modified tripeptide sequence. 
35 The present invention also encompasses the novel DNA 



25 



30 



8 

sequences, free of association with DNA sequences encoding 
other proteinaceous materials, and coding on expression for 
BMP-2 and BMP-4 proteins. These DNA sequences include those 
depicted in Figures 1 - 3 in a 5 1 to 3 1 direction and those 
sequences which hybridize under stringent hybridization 
conditions [see, T. Maniatis et al, Molecular Cloning (A 
Laboratory Manual) , Cold Spring Harbor Laboratory (1982) , pages 
387 to 389] to the DNA sequences of Figures 1-3 and encode 
a protein having cartilage and/or bone inducing activity. 

Similarly, DNA sequences which code for BMP-2 and BMP-4 
polypeptides coded for by the sequences of Figures 1-3, but 
which differ in codon sequence due to the degeneracies of the 
genetic code or allelic variations (naturally-occurring base 
changes in the species population which may or may not result 
in an amino acid change) also encode the novel factors 
described herein. Variations in the DNA sequences of Figures 
1-3 which are caused by point mutations or by induced modifi- 
cations (including insertion, deletion, and substitution) to 
enhance the activity, half -life or production of the 
polypeptides encoded thereby are also encompassed in the 
invention • 

Another aspect of the present invention provides a novel 
method for producing BMP-2 and BMP-4 proteins. The method of 
the present invention involves culturing a suitable cell line, 
which has been transformed with a DNA sequence coding on 
expression for a BMP-2 or BMP-4 protein, under the control of 
known regulatory sequences. The transformed host cells are 
cultured and the BMP-2 or BMP-4 proteins recovered and purified 
from the culture medium. The purified proteins are 

substantially free from other proteins with which they are co- 
produced as well as from other contaminants. Suitable cells 
or cell lines may be mammalian cells, such as Chinese hamster 
ovary cells (CHO) ♦ The selection of suitable mammalian host 
cells and methods for transformation, culture, amplification, 
screening and product production and purification are known in 



9 

the art. See, e.g., Gething and Sambrook, Nature, 293 :620- 
625 (1981), or alternatively, Kaufman et al, Mol. Cell. Biol. . 
5(7) :1750-1759 (1985) or Howley et al, U.S. Patent 4,419,446. 
Another suitable mammalian cell line, which is described in the 
accompanying examples, is the monkey C0S-1 cell line. The 
mammalian cell CV-1 may also be suitable. 

Bacterial cells may also be suitable hosts. For example, 
the various strains of E. coli (e.g., HB101, MC1061) are 
well-known as host cells in the field of biotechnology. 
Various strains of B. subtilis , Pseudomonas , other bacilli and 
the like may also be employed in this method. 

Many strains of yeast cells known to those skilled in the 
art may also be available as host cells for expression of the 
polypeptides of the present invention. Additionally, where 
desired, insect cells may be utilized as host cells in the 
method of the present invention. See, e.g. Miller et al, 

Genetic Engineering . 8:277-298 (Plenum Press 1986) and 

references cited therein. 

Another aspect of the present invention provides vectors 
for use in expression of these novel BMP-2 and BMP-4 
polypeptides. Preferably the vectdrs contain the full novel 
DNA sequences described above which encode the novel factors 
of the invention. Additionally the vectors also contain 
appropriate expression control sequences permitting expression 
of the BMP-2 and BMP-4 protein sequences. Alternatively, 
vectors incorporating modified sequences as described above are 
also embodiments of the present invention and useful in the 
production of the BMP-2 and BMP-4 proteins. The vectors may 
be employed in the method of transforming cell lines and 
contain selected regulatory sequences in operative association 
with the DNA coding sequences of the invention which are 
capable of directing the replication and expression thereof in 
selected host cells. Useful regulatory sequences for such 
vectors are known to one of skill in the art and may be 
selected depending upon the selected host cells. Such 



# # 



10 

selection is routine and does not form part of the present 
invention. , 

A protein of the present invention, which induces 
cartilage and/ or bone growth in circumstances where bone is not 
normally formed, has application in the healing of bone 
fractures and cartilage defects in humans and other animals. 
Such a preparation employing a BMP-2 or BMP-4 protein may have 
prophylactic use in closed as well as open fracture reduction 
and also in the improved fixation of artificial joints. De 
novo bone formation induced by an osteogenic agent contributes 
to the repair of congenital, trauma induced, or oncologic 
resection induced craniofacial defects, and also is useful in 
cosmetic plastic surgery. A BMP-2 or BMP-4 protein may be used 
in the treatment of periodontal disease, and in other tooth 
repair processes. Such agents may provide an environment to 
attract bone-f orming cells, stimulate growth of bone- forming 
cells or induce differentiation of progenitors of bone-forming 
cells. BMP-2 and BMP-4 polypeptides of the invention may also 
be useful in the treatment of osteoporosis. A variety of 
osteogenic, cartilage- inducing and bone inducing factors have 
been described. See, e.g. European patent applications 148,155 
and 169,016 for discussions thereof. 

The proteins of the invention may also be used in wound 
healing and related tissue repair. The types of wounds 
include, but are not limited to burns, incisions and ulcers. 
(See, e.g. PCT Publication WO84/01106 for discussion of wound 
healing and related tissue repair) . 

The proteins of the invention may increase neuronal 
survival and therefore be useful in transplantation and 
treatment of conditions exhibiting a decrease in neuronal 
survival , 

A further aspect of the invention is a therapeutic method 
and composition for repairing fractures and other conditions 
related to cartilage and/or bone defects or periodontal dis- 
eases, in addition, the invention comprises therapeutic 



11 

methods and compositions for wound healing and tissue repair. 
Such compositions comprise a, therapeutically effective amount 
of a BMP-2 or BMP-4 protein of the invention in admixture with 
a pharmaceutically acceptable vehicle, carrier or matrix. 

It is expected that the proteins of the invention may act 
in concert with or perhaps synergistically with other related 
proteins and growth factors. Further therapeutic methods and 
compositions of the invention therefore comprise a therapeutic 
amount of a BMP-2 or BMP-4 protein of the invention with a 
therapeutic amount of at least one of the other BMP proteins 
disclosed in co-owned and concurrently filed U.S. applications 
described above. Such combinations may comprise separate 
molecules of the BMP proteins or heteromolecules comprised of 
different BMP moieties. For example, a BMP-2 or BMP-4 subunit 
may be linked to a BMP-1, BMP-3, BMP-5, BMP-6, BMP-7 or BMP- 
8 subunit. Such linkage may comprise disulfide bonds, A 
method and composition of the invention may comprise a 
disulfide linked dimer comprising a BMP-2 or BMP-4 protein 
subunit and another "BMP" protein subunit described above. One 
may comprise a heterodimer of BMP-2 and BMP-4 moieties. 
Another embodiment may comprise a heterodimer of BMP-2 and BMP- 
7 subunits. 

In further compositions, BMP-2 and BMP-4 proteins may be 
combined with other agents beneficial to the treatment of the 
bone and/or cartilage defect, wound, or tissue in question. 
These agents include various growth factors such as epidermal 
growth factor (EGF) , platelet derived growth factor (PDGF) , 
transforming growth factors (TGF-a and TGF-b) , and insulin- 
like growth factor (IGF). The preparation and formulation of 
such physiologically acceptable protein compositions, having 
due regard to pH, isotonicity, stability and the like, is 
within the skill of the art. The therapeutic compositions are 
also presently valuable for veterinary applications due to the 
lack of species specificity in BMP proteins. Particularly 
domestic animals and thoroughbred horses in addition to humans 



12 

are desired patients for such treatment with BMP-2 and BMP-4 
of the present invention. , 

BMP-2 may be used individually in a pharmaceutical 
composition. BMP-2 may also be used in combination with BMP- 
4 and/or one or more of the other BMP proteins disclosed in 
co-owned and co-pending US applications as discussed above. 
BMP-4 may be used individually in pharmaceutical composition. 
In addition, it may be used in combination with other BMP 
proteins as described above. 

The therapeutic method includes administering the 
composition topically, systematically, or locally as an implant 
or device, when administered, the therapeutic composition for 
use in this invention is, of course, in a pyrogen-free, 
physiologically acceptable form. Further, the composition may 
desirably be encapsulated or injected in a viscous form for 
delivery to the site of bone, cartilage or tissue damage. 
Topical administration may be suitable for wound healing and 
tissue repair. Therapeutically useful agents other than the 
BMP-2 and BMP-4 proteins which may also optionally be included 
in the composition as described above, may alternatively or 
additionally, be administered simultaneously or sequentially 
with the BMP composition in the methods of the invention. 
Preferably for bone and/or cartilage formation, the composition 
would include a matrix capable of delivering BMP-2, BMP-4 or 
other BMP proteins to the site of bone and/or cartilage damage, 
providing a structure for the developing bone and cartilage and 
optimally capable of being resorbed into the body. Such 
matrices may be formed of materials presently in use for other 
implanted medical applications. 

The choice of matrix material is based on 
biocompatibility, biodegradability, mechanical properties, 
cosmetic appearance and interface properties. The particular 
application of the BMP-2 and BMP-4 compositions will define the 
appropriate formulation. Potential matrices for the 

compositions may be biodegradable and chemically defined 



13 

calcium sulfate, tricalciumphosphate, hydroxyapatite, 
polylactic acid, polyglycolic acid and polyanhydrides. Other 
potential materials are biodegradable and biologically well 
defined, such as bone or dermal collagen. Further matrices are 
5 comprised of pure proteins or extracellular matrix components. 
Other potential matrices are nonbiodegradable and chemically 
defined, such as sintered hydroxyapatite, bioglass, aluminates, 
or other ceramics. Matrices may be comprised of combinations 
of any of the above mentioned types of material, such as 

10 polylactic acid and hydroxyapatite or collagen and 
tricalciumphosphate. The bioceramics may be altered in 

T :; composition, such as in calcium-aluminate-phosphate and 
processing to alter pore size, particle size, particle shape, 
and biodegradability. 

|5 The dosage regimen will be determined by the attending 

physician considering various factors which modify the action 

y: of the BMP-2 and BMP-4 proteins, e.g. amount of i?one weight 
desired to be formed, the site of bone damage, the condition 

Q. s of the damaged bone, the size of a wound, type of damaged 

ko tissue, the patient's age, sex, and diet, the severity of any 

f~ infection, time of administration ahd other clinical factors. 

^ The dosage may vary with the type of matrix used in the 
reconstitution and the types of BMP proteins in the 
composition. The addition of other known growth factors, such 

25 as IGF I (insulin like growth factor I), to the final 
composition, may also effect the dosage. Progress can be 
monitored by periodic assessment of bone growth and/or repair, 
for example, x-rays, histomorphometric determinations and 
tetracycline labeling. 

30 The following examples illustrate practice of the present 

invention in recovering and characterizing bovine BMP-2 protein 
and employing it to recover the human proteins BMP-2 and BMP- 
4, and in expressing the proteins via recombinant techniques. 



35 



14 



EXAMPLE I 

Isolation of Bovine Bone Inductive Factor 

Ground bovine bone powder (20-120 mesh, Helitrex) is 
prepared according to the procedures of M. R. Urist et al., 
Proc. Natl Acad. Sci USA . 70:3511 (1973) with elimination of 
some extraction steps as identified below. Ten kgs of the 
ground powder is demineralized in successive changes of 0.6N 
HC1 at 4*C over a 48 hour period with vigorous stirring. The 
resulting suspension is extracted for 16 hours at 4'C with 50 
liters of 2M CaCl 2 and lOmM ethylenediamine-tetraacetic acid 
[EDTA] , and followed by extraction for 4 hours in 50 liters of 
0.5M EDTA. The residue is washed three times with distilled 
water before its resuspension in 20 liters of 4M guanidine 
hydrochloride [GuCl], 20mM Tris (pH7.4), ImM N-ethylmaleimide, 
ImM iodoacetamide, ImM phenylmethylsulfonyl fluorine as 
described in Clin. Orthop. Rel. Res. . 171: 213 (1982). After 
16 to 20 hours the supernatant is removed and replaced with 
another 10 liters of GuCl buffer. The residue is extracted 
for another 24 hours. 

The crude GuCl extracts are combined, concentrated 
approximately 20 times on a Pellicon apparatus with a 10,000 
molecular weight cut-off membrane, and then dialyzed in 50mM 
Tris, 0.1M NaCl, 6M urea (pH7.2), the starting buffer for the 
first column. After extensive dialysis the protein is loaded 
on a 4 liter DEAE cellulose column and the unbound fractions 
are collected. 

The unbound fractions are concentrated and dialyzed 
against 50mM NaAc, 50mM NaCl (pH 4.6) in 6M urea. The unbound 
fractions are applied to a carboxymethyl cellulose column. 
Protein not bound to the column is removed by extensive washing 
with starting^ buffer, and the material containing protein 
having bone and/or cartilage formation activity as measured by 
the Rosen-modified Sampath - Reddi assay (described in Example 
III below) desorbed from the column by 50mM NaAc, 0.25mM NaCl, 
6M urea (pH 4.6). The protein from this step elution is con- 



15 



10 



centrated 20- to 40- fold, then diluted 5 times with 80mM 
KPO«, 6M urea (pH 6.0). The ,pH of the solution is adjusted to 
6.0 with 500mM K 2 HP0 A . The sample is applied to an 
hydroxylapatite column (LKB) equilibrated in 80mM KP0 4 , 6M urea 
(pH 6.0) and all unbound protein is removed by washing the 
column with the same buffer. Protein having bone and/or 
cartilage formation activity is eluted with lOOmM KPO< (pH7.4) 
and 6M urea. 

The protein is concentrated approximately 10 times, and 
solid NaCl added to a final concentration of 0.15M. This 
material is applied to a heparin - Sepharose column 
D equilibrated in 50mM KP0 4 , 150mM NaCl, 6M urea (pH 7.4) . After 
g extensive washing of the column with starting buffer, a protein 
with bone and/or cartilage inductive activity is eluted by 50mM 
|j> KP0 4 , 700mM NaCl, 6M urea (pH 7.4). This fraction is con- 
; 1; centrated to a minimum volume, and 0.4ml aliquots are applied 
U] to superose 6 and Superose 12 columns connected in series, 
: :] equilibrated with 4M GuCl, 20mM Tris (pH 7.2) and the columns 
developed at a flow rate of 0.25ml/min. The protein demon- 
strating bone and/or cartilage inductive activity has a 
relative migration on SDS-PAGE corresponding to approximately 
3 0,000 dalton protein. 

The above fractions from the superose columns are pooled, 
dialyzed against 50mM NaAc, 6M urea (pH 4.6), and applied to 
a Pharmacia MonoS HR column. The column is developed with a 
gradient to 1.0M NaCl, 50mM NaAc, 6M urea (pH 4.6). Active 
bone and/or cartilage formation fractions are pooled and 
brought to pH 3.0 with 10% trif luoroacetic acid (TFA) . The 
material is applied to a 0.46 x 25cm Vydac C4 column in 0.1% 
TFA and the column developed with a gradient to 90% 
acetonitrile, 0.1% TFA (31.5% acetonitrile, 0.1% TFA to 49.5% 
acetonitrile, 0.1% TFA in 60 minutes at 1ml per minute). 
Active material is eluted at approximately 40-44% ace- 
tonitrile. Aliquots of the appropriate active fractions are 
iodinated by one of the following methods: P. J. McConahey et 



25 



30 



35 



16 

al, Int. Arch. Allerov . 29:185-189 (1966); A. E. Bolton et al, 
Biochem J . . 133:529 (1973); and D. F. Bowen-Pope, 
J. Biol. Chem. . 237:5161 (1982). The iodinated proteins 
present in these fractions are analyzed by SDS gel 
electrophoresis and urea Triton X 100 isoelectric focusing. 
At this stage, the protein having bone and/or cartilage forming 
activity is estimated to be approximately 10-50% pure. 

EXAMPLE II 

Characterization of Bovine Bone Inductive Factor 
A. Molecular Weight 

Approximately 20ug protein from Example I is lyophilized 
and redissolved in IX SOS sample buffer. After 15 minutes of 
heating at 37 'C, the sample is applied to a 15% SDS 
polyacrylamide gel and then electrophoresed with cooling. The 
molecular weight is determined relative to prestained molecular 
weight standards (Bethesda Research Labs) . Immediately after 
completion, the gel lane containing bone and/or cartilage 
forming material is sliced into 0.3cm pieces. Each piece is 
mashed and 1.4ml of 0.1% SDS is added. The samples are shaken 
gently overnight at room temperature to elute the protein. 
Each gel slice is desalted to prevent interference in the 
biological assay. The supernatant from each sample is 
acidified to pH 3.0 with 10% TFA, filtered through a 0.45 
micron membrane and loaded on a 0.46cm x 5cm C4 Vydac column 
developed with a gradient of 0.1% TFA to 0.1% TFA, 90% CH 3 CN. 
The appropriate bone and/or cartilage inductive protein - 
containing fractions are pooled and reconstituted with 20mg 
rat matrix and assayed. In this gel system, the majority of 
bone and/or cartilage inductive fractions have the mobility of 
a protein having a molecular weight of approximately 28,000 - 
3 0,000 daltons. 



B. Isoelectric Focusing 

The isoelectric point of bone inductive factor activity 



17 

is determined in a denaturing isoelectric focusing system. The 
Triton X100 urea gel system # (Hoeffer Scientific) is modified 
as follows: 1) 40% of the ampholytes used are Servalyte 3/10; 
60% are Servalyte 7-9; and 2) the catholyte used is 40mM NaOH. 
Approximately 20ug of protein from Example I is lyophilized, 
dissolved in sample buffer and applied to the 
isoelectrofocusing gel. The gel is run at 20 watts, 10 C for 
approximately 3 hours. At completion the lane containing bone 
and/or cartilage inductive factor is sliced into 0.5 cm 
slices. Each piece is mashed in 1.0ml 6M urea, 5mM Tris (pH 
7.8) and the samples agitated at room temperature. The samples 
are acidified, filtered, desalted and assayed as described 
above. The major portion of activity as determined by the 
Rosen-modified Sampath - Reddi assay migrates in a manner 
consistent with a pi of about 8.8 - 9.2. 

C. Subunit Characterization 

The subunit composition of the isolated bovine bone 
protein is also determined. Pure bone inductive factor is 
isolated from a preparative 15% SDS gel as described above. 
A portion of the sample is then reduced with 5mM DTT in sample 
buffer and re-electrophoresed on a 15% SDS gel. The 
approximately 28-30kd protein yields two major bands at 
approximately 18-20kd and approximately 16-18kd, as well as a 
minor band at approximately 28-30kd. The broadness of the two 
bands indicates heterogeneity caused most probably by 
glycosylation, other post translational modification, 
proteolytic degradation or carbamylation. 

EXAMPLE III 

Rosen Modified Sampath-Reddi Assay 

A modified version of the rat bone formation assay 
described in Sampath and Reddi, Proc, Natl. Acad. Sci. U.S. A, , 
80:6591-6595 (1983) is used to evaluate bone and/or cartilage 
activity of the bovine protein obtained in Example I and the 



18 

BMP-2 proteins of the invention. This modified assay is 
herein called the Rosen-modified Sampath-Reddi assay. The 
ethanol precipitation step of the Sampath-Reddi procedure is 
replaced by dialyzing (if the composition is a solution) or 
5 diafiltering (if the composition is a suspension) the fraction 
to be assayed against water. The solution or suspension is 
then redissolved in 0.1 % TFA, and the resulting solution added 
to 2 0mg of rat matrix. A mock rat matrix sample not treated 
with the protein serves as a control. This material is frozen 

10 and lyophilized and the resulting powder enclosed in #5 gelatin 
capsules. The capsules are implanted subcutaneously in the 
abdominal thoracic area of 21 - 49 day old male Long Evans 
rats. The implants are removed after 7-14 days. Half of 

J! each implant is used for alkaline phosphatase analysis [See, 

|f5 A. H. Reddi et al., Proc. Natl Acad Sci. . 69:1601 (1972)]. 

The other half of each implant is fixed and processed for 
histological analysis. 1/im glycolmethacrylate sections are 
stained with Von Kossa and acid fuschin to score the amount of 

^ induced bone and cartilage formation present in each implant. 

§0 The terms -hi through +5 represent the area of each 
histological section of an implant dccupied by new bone and/or 
cartilage cells and matrix. A score of +5 indicates that 
greater than 50% of the implant is new bone and/or cartilage 
produced as a direct result of protein in the implant, A score 

25 of +4, +3, +2 and +1 would indicate that greater than 40%, 
30%, 20% and 10% respectively of the implant contains new 
cartilage and/or bone. 

The rat matrix samples containing at least 200 ng of 
bovine protein obtained in Example I result in bone and/or 

30 cartilage formation that filled more than 20% of the implant 
areas sectioned for histology. This protein therefore scores 
at least +2 in the Rosen-modified Sampath-Reddi assay. The 
dose response of the matrix samples indicates that the amount 
of bone and/or cartilage formed increases with the amount of 

35 protein in the sample. The control sample did not result in 



19 



any bone and/or cartilage formation. The purity of the protein 
assayed is approximately 10^15% pure. 

The bone and/or cartilage formed is physically confined 
to the space occupied by the matrix. Samples are also analyzed 
by SDS gel electrophoresis and isoelectric focusing as 
described above, followed by autoradiography. Analysis reveals 
a correlation of activity with protein bands at 28 - 30kd and 
a pi of approximately 8.8-9.2. To estimate the purity of the 
protein in a particular fraction an extinction coefficient of 
1 OD/mg-cm is used as an estimate for protein and the protein 
is run on SDS PAGE followed by silver staining or 
radioiodination and autoradiography. 

EXAMPLE IV 
Bovine BMP- 2 

The protein composition of Example IIA of molecular 
weight 28 - 30kd is reduced as described in Example IIC and 
digested with trypsin. Eight tryptic fragments are isolated 
by standard procedures having the following amino acid 



sequences : 


























Fragment 1 


: A 


A 


F 


L 


G 


D 


I 


A 


L 


D 


E 


E 0 L G 


Fragment 2: 


: A 


F 


Q 


V 


Q 


Q 


A 


A 


D 


L 






Fragment 3: 


: N 


Y 


Q 


D 


M 


V 


V 


E 


G 








Fragment 4: 


: S 


T 


P 


A 


Q 


D 


V 


S 


R 








Fragment 5: 


: N 


Q 


E 


A 


L 


R 














Fragment 6: 


• L 


S 


E 


P 


D 


P 


S 


H 


T 


L 


E 


E 


Fragment 7; 


F 


D 


A 


Y 


Y 
















Fragment 8: 


L 


K 


P 


S 


N 


■? 

* 


A 


T 


I 


Q 


S 


I V E 



Two probes consisting of pools of oligonucleotides (or 
unique oligonucleotides) are designed according to the method 
of R. Lathe, J. Mol. Biol., 183(1): 1-12 (1985) on the basis of 
the amino acid sequence of Fragment 3 and synthesized on an 
automated DNA synthesizer as described above. 
Probe #1: ACNACCAT [A/G] T C [T/C] T G [A/G] A T 



Probe #2: C A [A/G] G A [T/C] ATGGTNGTNGA 

Because the genetic cqde is degenerate (more than one 
codon can code for the same amino acid) , the number of oligo- 
nucleotides in a probe pool is reduced based on the frequency 
of codon usage in eukaryotes, the relative stability of G:T 
base pairs, and the relative infrequency of the dinucleotide 
CpG in eukaryotic coding sequences [See J. J. Toole et al, 
Nature, 312:342-347 (1984)]. Bracketed nucleotides are 
alternatives. "N" means either A, T, C or G. These probes are 
radioactively labeled and employed to screen a bovine genomic 
library. The library is constructed as follows: Bovine liver 
DNA is partially digested with the restriction endonuclease 
enzyme Sau 3A and sedimented through a sucrose gradient. Size 
fractionated DNA in the range of 15-3 Okb is then ligated to 
the vector lambda J' . Bam HI arms [Mullins et al., Nature . 
308:856-858 (1984)]. The library is plated at 8000 
recombinants per plate. Duplicate nitrocellulose replicas of 
the plaques are made and amplified according to a modification 
of the procedure of Woo et al, Proc. Natl. Acad. Sci. USA . 
75:3688-91 (1978). Probe #1 is hybridized to the set of filters 
in 3M tetramethylammonium chloride (TMAC) , 0.1M sodium 
phosphate pH6.5, ImM EDTA, 5X Denhardts, 0.6% SDS, lOOug/ml 
salmon sperm DNA at 48 degrees C, and washed in 3M TMAC, 50mM 
Tris pH 8.0 at 50 degrees C. These conditions minimize the 
detection of mismatches to the 17 mer probe pool [see, Wood et 
a1 ' Proc. Natl. Acad. Sci. U.S.A. r 82:1585-1588 (1985)]. 

400,000 recombinants are screened by this procedure. One 
duplicate positive is plaque purified and the DNA is isolated 
from a plate lysate of the recombinant bacteriophage designated 
lambda bP-21. Bacteriophage bP-21 was deposited with the 
American Type Culture Collection, 12301 Parklawn Drive, 
Rockville, Maryland USA (hereinafter the "ATCC") under 
accession number ATCC 40310 on March 6, 1987. This deposit as 
well as the other deposits contained herein meets the 
requirements of the Budapest Treaty on the International 



21 



Recognition of the Deposit of Microorganisms for the Purposes 
of Patent Procedure and Regulations thereunder. The bP-21 clone 
encodes at least a portion of a bovine BMP-2 protein designated 
bovine BMP-2 or bBMP-2. 

The oligonucleotide hybridizing region of this BMP-2 clone 
is localized to an approximately 1.2 kb Sac I restriction 
fragment which is subcloned into M13 and sequenced by standard 
techniques. The partial DNA sequence and derived amino acid 
sequence of this Sac I fragment and the contiguous Hind III - 
Sac I restriction fragment of bP-21 are shown below in Figure 
1 (SEQ ID NO: 1). The BMP-2 peptide sequence from this clone 
is 129 amino acids in length and is encoded by the DNA sequence 
from nucleotide #1 through nucleotide #387 (SEQ ID N0:1) . The 
amino acid sequence corresponding to the tryptic fragment 
isolated from the bovine bone 28 to 30kd material is underlined 
in Figure 1. The underlined portion of the sequence 
corresponds to tryptic Fragment 3 above from which the 
oligonucleotide probes for BMP-2 are designed. The predicted 
amino acid sequence indicates that tryptic Fragment 3 is 
preceded by a basic residue (K) as expected considering the 
specificity of trypsin. The arginine residue encoded by the 
CGT triplet is presumed to be the carboxy-terminus of the 
protein based on the presence of a stop codon (TAG) adjacent 
to it. 



22 

EXAMPLE V 

Human BMP-2 and BMP-4 

The Hindlll-SacI bovine genomic BMP-2 fragment described 
in Example IV is subcloned into an M13 vector. A 32 P-labeled 
single- stranded DNA probe is made from a template preparation 
of this subclone. This probe is used to screen polyadenylated 
RNAs from various cell and tissue sources. Polyadenylated RNAs 
from various cell and tissue sources are electrophoresed on 
formaldehyde-agarose gels and transferred to nitrocellulose by 
the method of Toole et al., supra . The probe is then 
hybridized to the nitrocellulose blot in 50% formamide, 5 x 
SSC, 0.1% SDS, 40 mM sodium phosphate pH 6.5, 100 ug/ml 
denatured salmon sperm DNA, and 5 mM vanadyl ribonucleosides 
at 42° c overnight and washed at 65° c in 0.2 X SSC, 0.1% SDS. 
A hybridizing band corresponding to an mRNA species of 
approximately 3.8 kb is detected in the lane containing RNA 
from the human osteosarcoma cell line u-2 OS. cDNA is 
synthesized from U-2 OS polyadenylated RNA and cloned into 
lambda GT10 by established techniques (Toole et al, supra) . 
20,000 recombinants from this library are plated on each of 50 
plates. Duplicate nitrocellolose * replicas are made of the 
plates. 

The Hindlll-SacI fragment is labeled with 32 P by nick 
translation and used to screen the nitrocellulose filter 
replicas of the above-described u-2 OS cDNA library by 
hybridization in standard hybridization buffer at 65° overnight 
followed by washing in 1 X SSC, 0.1% SDS at 65°. Twelve 
duplicate positive clones are picked and replated for 
secondaries. Duplicate nitrocellulose replicas are made of 
the secondary plates and both sets hybridized to the bovine 
genomic probe as the primary screening was performed. One set 
of filters is then washed in 1 X SSC, 0.1% SDS; the other in 
0.1 X SSC, 0.1% SDS at 65°. 

Two classes of hBMP-2 cDNA clones are evident based on 
strong (4 recombinants) or weak (7 recombinants) hybridization 



signals under the more stringent washing conditions (0.1 X SSC, 
0.1% SDS). All 11 recombinant bacteriophage are plaque 
purified, small scale DNA preparations made from plate lysates 
of each, and the inserts subcloned into pSP65 and into M13 for 
sequence analysis. Sequence analysis of the strongly 
hybridizing clones designated hBMP-2 (previously designated 
BMP- 2 A and BMP-2 Class I) indicates that they have extensive 
sequence homology with the sequence given in Figure 1 (SEQ ID 
NO: 1) . These clones are therefore cDNA encoding the human 
equivalent of the protein encoded by the bBMP-2 gene whose 
partial sequence is given in Figure 1. Sequence analysis of 
the weakly hybridiz ing recombinants designated hBMP-4 
(previously designated BMP-2 B and BMP-2 Class II) indicates 
that they are also quite homologous with the sequence given in 
Figure 1 (SEQ ID NO: 1) at the 3 • end of their coding regions, 
but less so in the more 5 1 regions. Thus they encode a human 
protein of similar, though not identical, structure to that 
above . 

Full length human BMP-2 cDNA clones are obtained in the 
following manner. The 1.5 kb insert of one of the BMP-4 
subclones (II-10-1) is isolated and radioactively labeled by 
nick-translation. One set of the nitrocellulose replicas of 
the U-2 OS cDNA library screened above (50 filters, 
corresponding to 1,000,000 recombinant bacteriophage) are 
rehybridized with this probe under stringent conditions 
(hybridization at 65° in standard hybridization buffer; washing 
at 65° in 0.2 X SSC, 0.1% SDS). All recombinants which 
hybridize to the bovine genomic probe which do not hybridize 
to the BMP-4 probe are picked and plaque purified (10 
recombinants) . Plate stocks are made and small scale 
bacteriophage DNA preparations made. After subcloning into 
M13, sequence analysis indicates that 4 of these represent 
clones which overlap the original BMP-2 clone. One of these, 
lambda U20S-39, contains an approximately 1.5 kb insert* and was 
deposited with the ATCC on June 16, 1987 under accession 



24 

number 40345. The DNA sequence (SEQ ID NO: 3) (compiled from 
lambda U20S-39 and several o£her hBMP-2 cDNA recombinants) and 
derived amino acid sequence (SEQ ID NO: 4) are shown below in 
Figure 2. Lambda U20S-39 is expected to contain all of the 
nucleotide sequence necessary to encode the entire human 
counterpart of the protein BMP-2 encoded by the bovine gene 
segment whose partial sequence is presented in Figure 1. The 
BMP-2 protein encoded by the DNA sequence of Figure 2 is 
contemplated to contain the 97 amino acid sequence from amino 
acid #299 to #396 or a sequence substantially homologous 
thereto. This human cDNA hBMP-2 contains an open reading frame 
of 1188 bp, encoding a protein of 396 amino acids. The protein 
is preceded by a 5' untranslated region of 342 bp with stop 
codons in all frames. The 13 bp region preceding this 5' 
untranslated region represents a linker used in the cDNA 
cloning procedure. This protein of 396 amino acids has a 
molecular weight of 45kd based on this amino acid sequence. 
It is contemplated that this sequence represents the primary 
translation product. It is further contemplated that BMP-2 may 
correspond to the approximately 18 - 20kd subunit of Example 
IIC. The sequence corresponding- to the sequence tryptic 
Fragment 3 of Example IV is underlined in Figure 2. The "pre" 
portion of the human BMP-2 protein is contemplated to comprise 
amino acid #1 to amino acid #23 as shown in Figure 2. The 
"pro" portion is contemplated to comprise amino acid #24 to 
amino acid #282 of Figure 2 (SEQ ID NO: 4) . The mature portion 
is contemplated to comprise amino acid #283 (Gin, Ala, Lys...) 
to #396 (Arg) of Figure 2. 

BMP-2 proteins of the invention comprise at least the 
amino acid sequence from amino acid #299 to #396, although 
further included in the invention are protein species with a 
carboxy terminus which is characterized by an amino acid 
upstream from amino acid #396. 

Full-length BMP-4 human cDNA clones are obtained in the 
following manner. The 200 bp EcoRI-SacI fragment from the 5' 



25 

end of the BMP-4 recombinant Il-io-l is isolated from its 
plasmid subclone, labeled by, nick-translation, and hybridized 
to a set of duplicate nitrocellulose replicas of the U-2 OS 
cDNA library (25 filters/set; representing 500,000 
recombinants) . Hybridization and washing are performed under 
stringent conditions as described above. 16 duplicate 
positives are picked and replated for secondaries. 
Nitrocellulose filter replicas of the secondary plates are made 
and hybridized to an oligonucleotide which was synthesized to 
correspond to the sequence of II-10-1 and is of the following 
sequence : 

CGGGCGCTCAGGATACTCAAGACCAGTGCTG 

Hybridization is in standard hybridization buffer AT 50° C with 
washing at 50° in 1 X SSC, 0.1% SDS. 14 recombinant 
bacteriophage which hybridize to this oligonucleotide are 
plaque purified. Plate stocks are made and small scale 
bacteriophage DNA preparations made. After sucloning 3 of 
these into M13 , sequence analysis indicates that they represent 
clones which overlap the original BMP-4 clone. One of these, 
lambda U20S-3, was deposited with the ATCC under accession 
number 40342 on June 16, 1987. U20S-3 contains an insert of 
approximately 1.8 kb. The DNA sequence (SEQ ID NO: 5) and 
derived amino acid sequence (SEQ ID NO: 6) of U20S-3 are shown 
below in Figure 3. This clone is expected to contain all of 
the nucleotide sequence necessary to encode the entire human 
BMP-4 protein. The BMP-4 protein encoded by Figure 3 is 
contemplated to contain the 97 amino acid sequence from amino 
acid #311 to #408 or a sequence substantially homologous 
thereto. This cDNA contains an open reading frame of 1224 bp, 
encoding a protein of 408 amino acids, preceded by a 5« 
untranslated region of 394 bp with stop codons in all frames, 
and contains a 3' untranslated region of 308 bp following the 
in- frame stop codon. The 8 bp region preceding the 5' 
untranslated region represents a linker used in the cDNA 
cloning procedure. This protein of 408 amino acids has 



molecular weight of 47kd and is contemplated to represent the 
primary translation product % Mature BMP-4 is contemplated to 
comprise amino acid #293 (Ser, Pro, Lys...) - #408 (Arg) of 
Figure 3. A sequence similar though not idential to tryptic 
Fragment 3 of Example IV is underlined in Figure 3 (SEQ ID NO: 
6) . The under lined sequence Asn-Tyr-Gln-Glu-Met-Val-Val-Glu- 
Gly differs from the tryptic fragment Asn-Tyr-Gln- Asp-Met -Val- 
Val-Glu-Gly by one amino acid in position four. 

The sequences of BMP-2 and BMP-4, as shown in Figures 2 
and 3, have significant homology to the beta (B) and beta (A) 
subunits of the inhibins. The inhibins are a family of 
hormones which are presently being investigated for use in 
contraception. See, A* J. Mason et al, Nature, 318:659-663 

(1985) . To a lesser extent they are also homologous to 
Mullerian inhibiting substance (MIS) , a testicular glycoprotein 
that causes regression of the Mullerian duct during development 
of the male embryo, and transforming growth factor-beta (TGF- 
p) which can inhibit or stimulate growth of cells or cause them 
to differentiate. Furthermore, the sequences of Figures 2 and 
3 indicate that BMP-2 and BMP-4 have significant homology to 
the Drosophila decapentaplegic (DPP*-C) locus transcript. See, 
J. Massague, Cell , 49:437-438 (1987); R. W. Padgett et al, 
Nature, 325:81-84 (1987); R. L. Cate et al, Cell 45: 685-698 

(1986) . It is considered possible therefore that a BMP-2 
protein is the human homolog of the protein made from this 
transcript from this developmental mutant locus. BMP-2 and 
BMP-4 share sequence similarity with Vgl. Vgl mRNA has been 
localized to the vegetal hemisphere of Xenopus oocytes. During 
early development, it is distributed throughout the endoderm, 
but the mRNA is not detectable after blastula formation has 
occurred. The Vgl protein may be the signal used by the 
endoderm cells to commit ectodermal cells to become the 
embryonic mesoderm. 

The procedures described above may be employed to isolate 
other related BMP-2 and BMP-4 proteins of interest by utilizing 



27 

the bovine BMP-2 and BMP-4 proteins as a probe source. Such 
other BMP-2 and BMP-4 proteins may find similar utility in, 
inter alia, fracture repair, wound healing and tissue repair. 

EXAMPLE VI 

Expression of BMP-2 and BMP-4 

In order to produce bovine, human or other mammalian BMP- 
2 and BMP-4 proteins, the DNA encoding the desired protein is 
transferred into an appropriate expression vector and 
introduced into mammalian cells or other preferred eukaryotic 
or prokaryotic hosts by conventional genetic engineering 
techniques. The presently preferred expression system for 

biologically active recombinant human BMP-2 and BMP-4 is stably 

transformed mammalian cells. 

One skilled in the art can construct mammalian expression 
vectors by employing the sequence of Figures 1-3 (SEQ ID NO: 
1,3, and 5), or other DNA sequences containing the coding 
sequences of Figures 1-3 , or other modified sequences and known 
vectors, such as pCD [Okayama et al., Mol. Cell Biol. , 2:161- 
170 (1982)] and pJL3, pJL4 [Gough et al., EMBO J. , 4:645-653 
(1985)]. The BMP-2 and BMP-4 cDNA sequences can be modified 
by removing the non-coding nucleotides on the 5* and 3 1 ends 
of the coding region. The deleted non-coding nucleotides may 
or may not be replaced by other sequences known to be 
beneficial for expression. The transformation of these vectors 
into appropriate host cells can result in expression of BMP- 
2 or BMP-4 proteins. 

One skilled in the art could manipulate the sequences of 
Figures 1-3 (SEQ ID NO: 1,3, and 5) by eliminating or replacing 
the mammalian regulatory sequences flanking the coding sequence 
with bacterial sequences to create bacterial vectors for 
intracellular or extracellular expression by bacterial cells. 
For example, the coding sequences could be further manipulated 
(e.g. ligated to other known linkers or modified by deleting 



28 



non-coding sequences there-f rom or altering nucleotides therein 
by other known techniques) . The modified BMP-2 or BMP-4 coding 
sequence could then be inserted into a known bacterial vector 
using procedures such as described in T. Taniguchi et al., 
Proc. Natl Acad. Sci. USA, 77:5230-5233 (1980). This exemplary 
bacterial vector could then be transformed into bacterial host 
cells and BMP-2 protein or BMP-4 expressed thereby. For a 
strategy for producing extracellular expression of BMP-2 or 
BMP-4 proteins in bacterial cells., see, e.g. European patent 
application EPA 177,343. 

Similar manipulations can be performed for the 
construction of an insect vector [See, e.g. procedures 
described in published European patent application 155,476] for 
expression in insect cells. A yeast vector could also be 
constructed employing yeast regulatory sequences for 
intracellular or extracellular expression of the factors of 
the present invention by yeast cells. [See, e.g., procedures 
described in published PCT application WO86/00639 and European 
patent application EPA 123,289]. 

A method for producing high levels of a BMP-2 or BMP-4 
protein of the invention in mammalian cells involves the 
construction of cells containing multiple copies of the 
heterologous BMP-2 or BMP-4 gene. The heterologous gene is 
linked to an amplifiable marker, e.g. the dihydrofolate 
reductase (DHFR) gene for which cells containing increased gene 
copies can be selected for propagation in increasing 
concentrations of methotrexate (MTX) according to the 
procedures of Kaufman and Sharp, J. Mol. Biol . r 159:601-629 
(1982). This approach can be employed with a number of 
different cell types. 

For example, a plasmid containing a DNA sequence for a 
BMP-2 or BMP-4 of the invention in operative association with 
other plasmid sequences enabling expression thereof and the 
DHFR expression plasmid P AdA26SV(A)3 [Kaufman and Sharp, Mol. 
Cell. Biol. , 2:1304 (1982)] can be co-introduced into DHFR- 



29 

deficient CHO cells, DUKX-BII, by calcium phosphate 
coprecipitation and trans fec^t ion, electroperation, protoplast 
fusion or lipofection. DHFR expressing transformants are 
selected for growth in alpha media with dialyzed fetal calf 
serum, and subsequently selected for amplification by growth 
in increasing concentrations of MTX (e.g. sequential steps in 
0.02, 0.2, 1.0 and 5uM MTX) as described in Kaufman et al., Mol 
Cell Biol. , 5:1750 (1983). 

Transformants are cloned, and biologically active BMP-2 
or BMP-4 expression is monitored by the Rosen-modified Sampath 
- Reddi rat bone formation assay described above in Example 
III. BMP-2 and BMP-4 expression should increase with 
increasing levels of MTX resistance. Similar procedures can 
be followed to produce other related BMP-2 and BMP-4 proteins. 

A. COS Cell Expression 

As one specific example of producing a BMP-2 protein of 
the invention, the insert of II-3 (a X GT10 derivative 
containing the full length BMP-2 cDNA) is released from the 
vector arms by digestion with EcoRI and subcloned into pSP65 
(Promega Biotec, Madison, Wisconsirt) [Melton et al, Nucl. Acids 
Res. 12:7035-7056 (1984)] in both orientations yielding pBMP- 
2 #39-3 or pBMP-2 #39-4. The insert is subcloned into the 
EcoRI site of the mammalian expression vector, pMT2 CXM, 
described below, though derivitives thereof may also be 
suitable. Plasmid DNA from this subclone is transfected into 
COS cells by the DEAE-dextran procedure [Sompayrac and Danna 
PNAS 78:7575-7578 (1981); Luthman and Magnusson, Nucl. Ac ids 
Res . 11: 1295-1308 (1983)] and the cells are cultured. Serum- 
free 24 hr. conditioned medium is collected from the cells 
starting 40 - 70 hr. post-trans feet ion. Recovery and 
purification of the COS expressed BMP-2 proteins is described 
below in Example VII. 

The mammalian expression vector pMT2 CXM is a derivative 
of p91023 (b) (Wong et al., Science 228 :810-815, 1985) 



30 

differing from the latter in that it contains the ampicillin 
resistance gene in place of , the tetracycline resistance gene 
and further contains a Xhol site for insertion of cDNA clones. 
The functional elements of pMT2 CXM have been described 
(Kaufman, R.J., 1985, Proc. Natl. Acad. Sci. USA 82:689-693) 
and include the adenovirus VA genes, the SV40 origin of 
replication including the 72 bp enhancer, the adenovirus major 
late promoter including a 5' splice site and the majority of 
the adenovirus tripartite leader sequence present on adenovirus 
late mRNAs, a 3' splice acceptor site, a DHFR insert, the SV40 
early polyadenylation site (SV40) , and pBR322 sequences needed 
for propagation in EL. coli . 

Plasmid pMT2 CXM is obtained by EcoRI digestion of pMT2- 
VWF, which has been deposited with the American Type Culture 
Collection (ATCC) , Rockville, MD (USA) under accession number 
ATCC 67122. EcoRI digestion excises the cDNA insert present 
in pMT2-VWF, yielding pMT2 in linear form which can be ligated 
and used to transform E. coli HB 101 or DH-5 to ampicillin 
resistance. Plasmid pMT2 DNA can be prepared by conventional 
methods. pMT2 CXM is then constructed using loopout/in 
mutagenesis [Morinaga, et al., Biotechnology 84 ♦ 636 (1984). 
This removes bases 1075 to 1145 relative to the Hind III site 
near the SV40 origin of replication and enhancer sequences of 
pMT2. In addition it inserts the following sequence: 

5« PO_ c ATGGGCAGCTCGAG-3 • 
at nucleotide 1145. This sequence contains the recognition 
site for the restriction endonuclease Xho I. A derivative of 
PMT2CXM, termed pMT23, contains recognition sites for the 
restriction endonucleases PstI, Eco RI, Sail and Xhol. Plasmid 
PMT2 CXM and pMT23 DNA may be prepared by conventional methods. 

B. CHO Cell Expression 

(!) BMP-2 Expression in CHO Cells 
In order to achieve high levels of human BMP-2 protein 
expression, the DNA sequence of Figure 2 (SEQ ID NO: 3) encoding 



31 

BMP-2 is inserted into a eucaryotic expression vector, stably 
introduced into CHO cells and amplified to high copy number by 
methotrexate selection of DHFR [R.J. Kaufman, et al., EMBO J. 
6:189 (1987)]. The transformed cells are cultured and the 
expressed BMP-2 proteins are recovered and purified from the 
culture media. 

A BMP-2 protein of the invention is expressed in CHO cells 
by releasing the insert of pBMP-2 #39-3 described above, from 
the vector by digestion with EcoRI . The insert is subcloned 
into the EcoRI cloning site of the mammalian expression vector, 
pMT2 CXM described above, though derivitives thereof* may also 
be suitable. 

A derivative of the BMP-2 cDNA sequence set forth in 

Figure 2 (SEQ ID NO: 3) in which the 5* untranslated region is 

deleted is made by removal of the sequences contained between 

the Sail site at the 5 1 adapter (from the original cDNA 

cloning) , and the Sail site 7 base pairs upstream of the 

initiator ATG, by digestion with Sail and religation. This 

step is conveniently performed in either SP65 derivatives 

containing the full length BMP-2 cDNA, but can also be 

performed in pMT2 derivatives. The 3* untranslated region is 

removed using heteroduplex mutagenesis using the mutagenic 

oligonucleotide 

5 1 GAGGGTTGTGGGTGTCGCTAGTGAGTCGACTACAGCAAAATT 

Terminator Sail 

The sequence contains the terminal 3 ' coding region of the BMP- 

2 cDNA, followed immediately by a recognition site for Sail. 

The BMP-2 cDNA with deletions of the 5' and 3 f 

untranslated regions are excised from pSP65 with Sail, and 

subcloned into the Sail site of pMT23 described above. Plasmid 

DNA from the subclones is transfected into CHO cells by 

electroporation [Neuman et al, EMBO J, , 1:841-845 (1982)]. Two 

days later, cells are switched to selective medium containing 

10% dialyzed fetal bovine serum and lacking nucleosides. 

Colonies expressing DHFR are counted 10-14 days later. 



32 

Individual colonies or pools of colonies are expanded and 
analyzed for expression of BMP-2 RNA and protein using standard 
procedures and are subsequently selected for amplification by 
growth in increasing concentrations of MTX. Stepwise selection 
of the preferred pool, termed 2aD, is carried out up to a 
concentration of 2 MTX, Individual cells from the pool are 
then cloned and assayed for BMP-2 expression. Procedures for 
such assay include Northern Blot analysis to detect the 
presence of mRNA, protein analysis including SDS-PAGE and 
analysis for cartilage and/or bone formation activity using the 
ectopic rat bone formation assay described above. The 
presently preferred clonally-derived cell line is identified 
as 2AD2I. This cell line secretes BMP-2 proteins into the 
media containing 2/iM MTX. 

The CHO cell line 2AD2I is grown in Dulbecco^ modified 
Eagle's medium (DMEM) /Ham's nutrient mixture F-12, 1:1 
(vol/vol) , supplemented with 10% fetal bovine serum. When the 
cells are 80 - 100 % confluent, the medium is replaced with 
serum- free DMEM/F-12. Medium is harvested every 24 hours for 
4 days. For protein production and purification the cells are 
cultured serum- free. 

Currently, this cell line 2AD2I is being subjected to 
stepwise selection in increasing concentrations of MTX (IOjiM, 
100/iM, 1000/iM) which may potentially yield cells which produce 
even higher levels of BMP-2 protein expression. 

cDNA genes inserted into the EcoRI and/or Xho I sites are 
expressed as a bicistronic mRNA with DHFR in the second 
position. In this configuration, translation of the upstream 
(BMP-2) open reading frame is more efficient than the 
downstream (DHFR) cDNA gene [Kaufman et al, EMBO J . 6:187-193 
(1987). The amount of DHFR protein expressed is nevertheless 
sufficient for selection of stable CHO cell lines. 

Characterization of the BMP-2 polypeptides through pulse 
labeling with [35S] methionine or cysteine and polyacrylamide 
gel electrophoresis indicates that multiple molecular size 



33 

forms of BMP- 2 proteins, further described below, are being 
expressed and secreted from #the stable CHO lines. 
(2) BMP-4 Expression in CHO Cells 

In order to achieve high levels of human BMP-4 protein 
expression, the DNA sequence of Figure 3 (SEQ ID NO: 5) 
encoding BMP-4 is inserted into a eucaryotic expression vector, 
stably introduced into CHO cells and amplified to high copy 
number by methotrexate selection of DHFR [R.J. Kaufman, et al., 
EMBO J. 6:189 (1987)]. The transformed cells are cultured and 
the expressed BMP-4 proteins are recovered and purified from 
the culture media. 

As described above, numerous expression vectors known in 
the art may be utilized in the expression of BMP proteins of 
the invention. The vector utilized in the following example 
is pEMC2£l derived from pMT21 though other vectors may be 
suitable in practice of the invention. 

pMT21 is derived from pMT 2 which is derived from pMT2- 
VWF, deposited with the American Type Culture Collection 
(ATCC) , Rockville, MD (USA) under accession number ATCC 67122 
under the provisions of the Budapest Treaty. EcoRI digestion 
excises the cDNA insert present in pMT-VWF, yielding pMT2 in 
linear form which can be ligated and used to transform E^ Coli 
HB 101 or DH-5 to ampicillin resistance. Plasmid pMT2 DNA can 
be prepared by conventional methods. 

pMT21 was derived from pMT2 through the following two 

modifications. First, 76 bp of the 5* untranslated region of 

the DHFR cDNA including a stretch of 19 G residues from G/C 

tailing for cDNA cloning was deleted. In this process, a Xhol 

site was inserted to obtain the following sequence immediately 

upstream from DHFR: 5' - CTGCAG GCGAGCCT GAATTCCTCGAG CCATCATG-3 1 

PstI ECO RI Xhol 

Second, a unique Clal site was introduced by digestion with 
EcoRV and Xbal, treatment with Klenow fragment of DNA 
polymerase I, and ligation to a Clal linker (CATCGATG) . This 



34 

deletes a 250 bp segment from the adenovirus virus associated 
RNA (VAI) region but does ,not interfere with VAI RNA gene 
expression or function. pMT21 was digested with EcoRI and 
Xhol, and used to derive the vector pEMC2Bl. 

A portion of the EMCV leader was obtained from pMT2-ECATl 
[S.K. Jung, et al, J, Virol 63:1651-1660 (1989)] by digest with 
Eco RI and PstI, resulting in a 2752 bp fragment. This 
fragment was digested with TaqI yielding an Eco RI-TaqI 
fragment of 508 bp which was purified by electrophoresis on low 
melting agarose gel. A 68 bp adapter and its complementary 
strand were synthesized with a 5» TaqI protruding end and a 3 1 
Xhol protruding end which has the following sequence: 

5 1 -CGAGGTTAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTT 
TaqI 

GAAAAACACG ATTGC- 3 1 
Xhol 

This sequence matches the EMC virus leader sequence from 
nucleotide 763 to 827. It also changes the ATG at position 10 
within the EMC virus leader to an ATT and is followed by a Xhol 
site. A three way ligation of the pMT21 Eco Rl-Xhol fragment , 
the EMC virus EcoRI -TaqI fragment, and the 68 bp 
oligonucleotide adapter Taql-Xhol adapter resulted in the 
vector pEMC2Bl* 

This vector contains the SV40 origin of replication and 
enhancer, the adenovirus major late promoter, a cDNA copy of 
the majority of the adenovirus tripartite leader sequence, a 
small hybrid intervening sequence, an SV40 polyadenylation 
signal and the dadenovirus VA I gene, DHFR and B-lactamase 
markers and an EMC sequence, in appropriate relationships to 
direct the high level expression of the desired cDNA in 
mammalian cells, 

A derivative of the BMP-4 cDNA sequence set forth in 
Figure 3 in which the 3* untranslated region is removed is made 
via heteroduplex mutagenesis with the mutagenic 



35 

oligonucleotide: 

5 « GGATGTGGGTGCCGCTGACTCTAGAGTCGAC GGAATTC 3 • . 

Terminator EcoRI 
This deletes all of the sequences 3' to the translation 
terminator codon of the BMP-4 cDNA, juxtaposing this terminator 
codon and the vector polyl inker sequences. This step is 
performed in an SP65 vector though may be conveniently 
performed in MT2 derivatives containing the BMP-4 cDNA. The 
5' untranslated region is removed using the restriction 
endonuclease BsmI, which cleaves within the eighth codon of 
BMP-4 cDNA. Reconstruction of the first eight codons is 
accomplished by ligation to oliognucleotides: 

EcoRI Initiator BsmI 
5' AATTCA C CATGA TTCCTGGTAAC CGAATGCT 3' and 

3 ' GTGGTACTAAGGACCATTGGCTTAC 5 • 

These oligonucleotides form a duplex which has a BsmI 
complementary cohesive end capable of ligation to the BsmI 
restricted BMP-4 cDNA, and it has an EcoRI complementary 
cohesive end capable of ligation to*the EcoRI restricted vector 
MT2. Thus the cDNA for BMP-4 with the 5' and 3 ' untranslated 
regions deleted, and retaining the entire encoding sequence is 
contained within an EcoRI restriction fragment of approximately 
1.2kb. 

The BMP-4 containing plasmid designated pXMBMP-4DUT is 
digested with EcoRI in order to release the BMP-4 cDNA 
containing insert from the vector. This insert is subcloned 
into the EcoRI site of the mammalian expression vector pEMC2jSl 
described above. Plasmid DNA from the subclones is transfected 
into CHO cells by electroporation [Neuman et al, EMBO J. . 
1:841-845 (1982)]. Two days later, cells are switched to 
selective medium containing 10% dialyzed fetal bovine serum 
and lacking nucleosides. Colonies expressing DHFR are counted 
10-14 days later. Individual colonies or pools of colonies are 



36 



expanded and analyzed for expression of BMP-4 RNA and protein 
using standard procedures ajid are subsequently selected for 
amplification by growth in increasing concentrations of MTX. 
Stepwise selection of the preferred pool, termed 4aED, is 
carried out up to a concentration of 2 pH MTX. Individual 
cells from the pool are then cloned and assayed for BMP-4 
expression. Procedures for such assay include Northern Blot 
analysis to detect the presence of mRNA, protein analysis 
including SDS-PAGE and analysis for cartilage and/or bone 
formation activity using the ectopic rat bone formation assay 
described above. 

4AED is grown in Dulbecco's modified Eagle's medium 
(DMEM) /Ham's nutrient mixture F-12, 1:1 (vol/vol) , supplemented 
with 10% fetal bovine serum. When the cells are 80 - 100 % 
confluent, the medium is replaced with serum- free DMEM/F-12. 
Medium is harvested every 24 hours for 4 days. For protein 
production and purification the cells are cultured serum- free. 

cDNA genes inserted into the EcoRI and/or Xho I sites are 
expressed as a bicistronic mRNA with DHFR in the second 
position. In this configuration, translation of the upstream 
(BMP-4) open reading frame is 'more efficient than the 
downstream (DHFR) cDNA gene [Kaufman et al, EMBO J . 6:187-193 
(1987) . The amount of DHFR protein expressed is nevertheless 
sufficient for selection of stable CHO cell lines. 

Characterization of the BMP-4 polypeptides through pulse 
labeling with [35S] methionine or cysteine and polyacrylamide 
gel electrophoresis indicates that multiple molecular size 
forms of BMP-4 proteins, further described below, are being 
expressed and secreted from the stable CHO lines. 

EXAMPLE VII 

Characterization and Biologic al Activity of Expressed bmp-2 
and BMP- a 

To measure the biological activity of the expressed BMP- 
2 and BMP-4 proteins obtained in Example VI above, the proteins 



37 

are recovered from the cell culture and purified by isolating 
the BMP-2 and BMP-4 proteins from other proteinaceous materials 
with which they are co-produced as well as from other 
contaminants. The purified protein is assayed in accordance 
with the rat bone formation assay described in Example III 
using a modified scoring method described below. 

A. COS Expressed Protein 

The COS expressed material of Example VI may be partially 
purified on a Heparin Sepharose column. 4 ml of the collected 
post trans feet ion conditioned medium supernatant from one 100 
mm culture dish is concentrated approximately 10 fold by 
ultrafiltration on a YM 10 membrane and then dialyzed against 
20mM Tris, 0.15 M NaCl, pH 7.4 (starting buffer). This 
material is thsn applied to a 1.1 ml Heparin Sepharose column 
in starting buffer. Unbound proteins are removed by an 8 ml 
wash of starting buffer, and bound proteins, including BMP-2 
polypeptides, are desorbed by a 3-4 ml wash of 20 mM Tris, 2.0 
M NaCl, pH 7.4. 

The proteins bound by the Heparin column are concentrated 
approximately 10-fold on a Centricbn 10 and the salt reduced 
by diaf iltration with 0.1% trif luoroacetic acid. The 
appropriate amount of this solution is mixed with 20 mg of rat 
matrix and then assayed for in vivo bone and/or cartilage 
formation activity by the Rosen-modified Sampath - Reddi assay. 
A mock transfection supernatant fractionation is used as a 
control . 

The implants containing rat matrix to which specific 
amounts of human BMP-2 or BMP-4 have been added are removed 
from rats after seven days and processed for histological 
evaluation . Representative sections from each implant are 
stained for the presence of new bone mineral with von Kossa and 
acid fuschin, and for the presence of cartilage-specific matrix 
formation using toluidine blue. The types of cells present 
within the section, as well as the extent to which these cells 



38 

display phenotype are evaluated and scored as described in 
Example III. P 

Addition of the expressed human BMP-2 or BMP-4 to the 
matrix material results in formation of cartilage-like nodules 
at 7 days post implantation. The chondroblast-type cells are 
recognizable by shape and expression of metachromatic matrix. 
The amount of activity observed for human BMP-2 or BMP-4 
indicates that it may be dependent upon the amount of human 
BMP-2 or BMP-4 protein added to the matrix sample. 

Similar levels of activity are seen in the Heparin 
Sepharose fractionated COS cell extracts. Partial purification 
is accomplished in a similar manner as described above except 
that 6 M urea is included in all the buffers. 
B. CHO Expressed Protein 

(1) BMP-2 

To measure the biological activity of the BMP-2 proteins 
expressed in accordance with Example VIB above, .5 liters of 
conditioned media is directly adsorbed to 1 ml Heparin 
Sepharose (Pharmacia) column. The resin is washed with 0.15 
M NaCl, 6.0 M urea, 20 mM Tris, pH 7.4 and then developed with 
a linear gradient to 1.0 M NaCl, 6.0 M urea, 50 mM Tris, pH 
7.4. Fractions are assayed by the rat ectopic cartilage and 
bone formation assay described in Example III. The highest 
specific activity fractions are pooled and concentrated by 
ultrafiltration on a YM-10 (Amicon) membrane. Conditioned 
medium from CHO cells not transfected with the BMP-2 gene is 
prepared similarly, except that a step gradient to 1 M NaCl is 
used. Protein concentration is determined by amino acid 
analysis. 

Further purification is achieved by preparative 
NaDodS<VPAGE [Laemmli, Nature 227 : 680-685 (1970)]. 
Approximately 300 nq of protein is applied to a 1.5-mm-thick 
12.5% gel: recovery is estimated by adding L-[ 35 S]methionine- 
labeled BMP-2 purified over heparin-Sepharose as described 
above. Protein is visualized by copper staining of an adjacent 



39 

lane [Lee, et al., Anal. Biochem. 166:308-312 (1987)]. 

Appropriate bands are excise^ and extracted in 0.1% NaDodS0 4 /20 

mM Tris, pH 8.0. The supernatant is acidified with 10% CF 3 COOH 

to pH 3 and the proteins are desalted on 5.0 x 0.46 cm Vydac 
5 C« column (The Separations Group, Hesperia, CA) developed with 

a gradient of 0.1% CF 3 C00H to 90% acetonitrile/0 . 1% CF 3 COOH. 
The pooled material is analyzed by SDS-PAGE using a 12% 

acrylamide [U.K. Laemmli, Nature 227 : 680 (1970)] stained with 

silver [R.R. Oakley, et al. Anal. Biochem* 105 ; 361 (1980)] and 
10 by immunoblot [H. Towbin, et al. Proc. Natl. Acad. Sci. USA 

76:4350 (1979)] of 13.5% gel. SDS-PAGE reveals that multiple 
\l molecular size forms of BMP-2 proteins are being expressed and 

secreted from the stable CHO lines. Under non-reduced 
~j conditions, the major protein species is represented by a broad 

ji5 band at 30,000 daltons. Lower molecular weight species are 

seen as well as higher species, most notably 82,000 daltons 

and 113,000 daltons. 

The 30,000 dalton band reacts with a rabbit antiserum 

directed against an IL. coli produced fragment of BMP-2 amino 
%0 acids #130-#396 as shown in Figure 2 (SEQ ID NO: 4), with which 

'"•hri 

q it was incubated followed by 125 I^Protein A. Under reduced 

^ conditions the 30,000 dalton material shifts to the 16,000- 

20,000 range with several species within this range observed. 
Each band is recognized by a turkey-derived anti-peptide 

25 antibody directed against amino acids #350-#365 as shown in 
Figure 2 with which it is incubated followed by 125 I-rabbit 
anti-turkey IgG, as well as the anti-BMP-2 antibody described 
above. The peptide antibody is generated by coupling to bovine 
serum albumin with glut ar aldehyde [J. P. Briand, et al. 

30 Immunol. Meth. 78:59 (1985)] in the presence of 100 ug/ml 
albumin. The broadness of the 30,000 dalton band and the 
mutiplicity of its subunits are contemplated to arise from 
differences in carbohydrate in the potential N-gylcosylation 
site or from N-terminal heterogeneity. 

35 A major N-terminal amino acid sequence beginning at amino 



acid #283 (Gin, Ala,Lys. . . ) as shown in Figure 2 is obtained 
from the 30,000 dalton b^nd isolated under non-reducing 
conditions. The calculated subunit molecular weight of a 
protein of amino acids 283-396 is approximately 13,000 daltons. 
Preliminary experiments indicate that over 90% of the 
biological activity in the total protein pool is eluted from 
a non-reduced SDS-PAGE at a relative mass of 30,000 daltons. 
It is contemplated therefore that a dimer of amino acids #283- 
396 of BMP-2, (referred to as a mature BMP-2) accounts for the 
majority of the biological activity in the mixture of expressed 
BMP-2 proteins. It is further contemplated that processing of 
BMP-2 to the mature forms involves dimerization of the 
proprotein (amino acids #24 Leu, Val, Pro ... to #396) and 
removal of the N-terminal region in a manner analogous to the 
processing of the related protein TGF-0 [L.E. Gentry, et al. 
Molec. & Cell Biol. 8:4162 (1988); R. Dernyck, et al. Nature 
316:701 (1985)]. 

Immunoblot analysis using antibodies directed against a 
portion of the mature region (amino acids #350-365) and an 
antibody directed against the pro region (amino acids #103- 
116) of the 82,000 and 113,000 higher molecular weight species 
of BMP-2 under both non-reduced and reduced conditions suggests 
-that these species may represent intermediate forms in the 
processing of the BMP-2 dimer. A 66,000 dalton species is 
present under reduced conditions. The 113,000 dalton species 
is contemplated to comprise proprotein dimers of 113,000 
daltons (2 subunits of 66,000 daltons) and the 82,000 dalton 
species is contemplated to comprise a proprotein subunit linked 
to a mature BMP-2 subunit (66,000 daltons plus 18,000 daltons) . 
Based on these analyses, approximately 50% of the total protein 
is active mature BMP-2. 

The pool of protein containing recombinant human BMP-2 is 
assayed in accordance with the rat cartilage and bone formation 
assay described in Example III using a modified scoring method 
as follows, three non-adjacent sections are evaluated from each 



41 

implant and averaged* "+/-" indicates tentative identification 
of cartilage or bone; indicates >10% of each section being 

new cartilage or bone; "+2", >25%; "+3«, >50%; "+4", -75%; 
"4-5", >80%. A indicates that the implant is not recovered. 
The scores of the individual implants (in triplicate) are 
tabulated to indicate assay variability, BMP-2 protein is 
implanted subcutaneous ly in rats for times ranging frdm 5-21 
days and the resulting implants evaluated histologically for 
the presence of newly formed cartilage and bone. Additionally, 
the level of alkaline phosphatase, synthesized by both 
cartilage and bone cells is measured. 

Addition of partially purified CHO expressed human BMP- 
2 to the matrix material induces both new cartilage and new 
bone formation. Implantation of amounts of 0.46 - 115.3 /*g of 
protein tested for times ranging from 5-21 days results in the 
induction of new cartilage and bone formation. Induction of 
cartilage formation is evident by day 7 and induction of bone 
formation is evident by day 14 for the lowest dose. The time 
at which bone formation occurs is related to the amount of BMP- 
2 implanted. At high doses bone can be observed at five days. 

The development of cartilage and bone with time of a 12.0 
microgram dosage of protein containing BMP-2 is summarized 
below. Amounts of new cartilage and bone are evaluated semi- 
quantitatively and scored on a scale of 0 to 5. Individual 
implants are listed to illustrate assay variability. At 5 
days, many immature and some hypertrophic cartilage cells are 
present in the BMP-containing implant, but no mineralizing 
cartilage is detected. After 7 days chondrogenesis progresses 
so that most of the cartilage cells are hypertrophic and 
surrounded by mineralized matrix. Osteoblasts appear to be 
actively secreting osteoid, which is not yet mineralized. Day 
7 implants have the greatest alkaline phosphatase content 
reflecting production by both chondrocytes and osteoblasts. 
Vascular elements, including giant cells and bone marrow 
precursors, are seen and are most abundant in areas where 



42 

calcified cartilage is undergoing remodeling. 

The decline of alkalinf phosphatase activity on day 10 
signals the end of chondrogenesis in the implants. At 14 days 
the removal of calcified cartilage is nearly complete and bone 
is widespread. Osteoblasts and osteoclasts are abundant and 
appear to be actively engaged in the organization of newly 
formed trabecular bone. The levels of alkaline phosphatase 
reflect osteoblast activity at this stage in the maturation 
process. The vascularity of the implants has increased 
markedly, and hematopoietic cell maturation is tentatively 
observed. 

At 21 days, implants show increased maturity over the 
previous time point. The bone is highly organized with mature 
marrow spaces, and bone-forming cells embedded in mineralized 
bone matrix are apparent. At 21 days, all remnants of matrix 
carrier have been removed in contrast to the control implants 
with no BMP, where matrix remains intact. 

NaDodS0 4 /PAGE is used to purify each of the three BMP-2 
species to homogeneity. The overall recovery of BMP-2 protein 
after electrophoresis, desalting, and concentration is 
approximately 30% and 87% of the HMP-2 is the 30,000 dalton 
form. All three forms of BMP-2 show in vivo activity when 
assayed for cartilage and bone induction. The 30,000 and 
82,000 dalton species were equivalent in this assay while the 
113,000 dalton species showed significantly less activity. 

(2) BMP-4 

To measure the biological activity of BMP-4 expressed in 
accordance with Example VIB above BMP-4 is collected from the 
conditioned medium by batch adsorbing BMP-4 to heparin 
sepharose CL-6B using 3ml swelled heparin sepharose per liter 
conditined media (CM) and stirring overnight at 4 fl C. The 
heparin sepharose is collected by filtering the CM through a 
fitted glass filter and washed with cold (4°C) 50mM Tris pH 
7.4, A Pharmacia column is packed with the heparin sepharose 



43 

using 50mM Tris buffer and washed with buffer to the baseline. 
Elution is carried out with, the following gradient of sodium 
chloride: 

Buffer A: 50mM Tris pH 7.4 

Buffer B: 50mM Tris pH 7.4, 1M NaCl 

BMP-4 containing fractions are located using Western blots 
probed with antipeptide antibody W10 (an anti-peptide 
polyclonal antibody recognizing the carboxy terminus of BMP- 
2) . The BMP-4 containing fractions are pooled, the NaCl 
concentration is adjusted to 0.8M, and the pool is loaded onto 
a Butyl Toyopearl hydrophobic interaction column. Gradient 
elution from the hydrophobic interaction column is carried out 
using a sodium chloride and ethanol gradient: 

Buffer A: 50mM Tris pH 7,4, 0.8M NaCl 

Buffer B: 50mM Tris pH 7,4, 10% Ethanol 
BMP-4 elutes at approximately 0.37M NaCl, 5.4% ethanol. The 
BMP-4 containing fractions are pooled and concentrated. Yields 
are approximately 33A*g/liter CM of >95% pure material. 

SDS-PAGE and silver stain analysis reveals that BMP-4 
typically migrates as a single band at approximately 35kD (non- 
reduced) and reduces to a single b&nd at approximately 22kD. 
BMP-4 is, therefore, a dimer of approximate molecular weight 
35kD which reduces to a monomer of approximate molecular weight 
20kD. Monomers of 18 and 22kD have been detected. Monomer can 
also be seen reducing from a high molecular weight region 
(>67kD) where it is assumed to be associated with an 
unprocessed BMP-4 molecule. The 2D pattern indicates that 
heterodimers are formed between the various molecular weight 
monomeric species. 

BMP-4 is sensitive to N-glycanase, Endoglycosidase H, and 
Endoglycosidase F digestion, indicating the presence of N 
linked high mannose sugars. In a western format, ConA and WGA 
bind BMP-4, again indicating the presence of N-linked high 
mannose glycans. Lentil Lectin, which indicates the presence 
of a-D mannosyl or a-D glycosyl linkages, also binds BMP-4. 



03/09/2001 12:23 FAX 



@ 045 




44 



N-terminal sequence analysis reveals a single amino 
terminus at serine #293. Indicating a cleavage site at amino 
acid 293. This amino terminus is analogous to the Gin, Ala, 
Lys... of BMP-2. Mature BMP-4 is, therefore, a dimer of amino 
acids #293 - #408 as shown in Figure 3 (SEQ ID NO:4). 

Presently, experiments indicate a minimum dose of 156ng 
reproducibly induces cartilage formation with BMP-4 in the rat 
ectopic assay which is comparable to BMP-2. Bone that is 
formed by BMP-4 is highly calcified, organized, and 
histologically similar to that formed by BMP-2, as described 
above. The time course' of the appearance and the subsequent 
remodelling into bone is similar for BMP-4 and BMP-2 • 

The foregoing descriptions detail presently preferred 
embodiments of the present invention. Numerous modifications 
and variations in practice thereof are expected to occur to 
those skilled in the art upon consideration of these descrip- 
tions. Those modifications and variations are believed to be 
encompassed within the claims appended hereto. 



10 u