Skip to main content

Full text of "USPTO Patents Application 09804625"

See other formats


This Page Is Inserted by IFW Operations 
and is not a part of the Official Record 

BEST AVAILABLE IMAGES 



Defective images within this document are accurate representation of 
The original documents submitted by the apphcant. 

Defects in the images may include (but are not limited to): 
BLACK BORDERS 

TEXT CUT OFF AT TOP, BOTTOM OR SIDES 
FADED TEXT 
ILLEOroLE TEXT 
SKEWED/SLANTED IMAGES 
COLORED PHOTOS 

BLACK OR VERY BLACK AND WHITE DARK PHOTOS 
GRAY SCALE DOCUMENTS 



IMAGES ARE BEST AVAILABLE COPY. 



As rescanning documents will not correct images, 
please do not report the images to the 
Image Problem Mailbox. 



per 



WORLD INTELLECTUAL PROPERTY ORGANIZATION 
International Bureau 




INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCTl 



(51) Interaational Patent aassification 5 ; 
C07K 15/00, 15/06, 15/14 
C07K 17/02, C09H 1/02 
A61K 37/12 



Al 



(11) International Publication Number: 
(43) International Publication Date: 



WO 91/05802 

2 May 1991 (02.05.91) 



(21) International Application Number: PCT/US90/05903 

(22) International Filing Date: 15 October 1990 (15.10.90) 



(30) Priority data: 

422,699 
483,913 
569,920 



17 October 1989 (17.10.89) US 
22 February 1990 (22.02.90) US 
20 August 1990 (20.08.90) US 



(71) Applicant: CREATIVE BIOMOLECULES, INC. [US/ 

US]; 35 South Street, Hopkinton, MA 01748 (US). 

(72) Inventors: OPPERMANN, Hermann ; 25 Summer Hill 

Road, Medway, MA 02053 (US). KUBERASAMPATH, 
Thangavel ; 6 Spring Street, Medway, MA 02053 (US). 
RUEGER, David. C. ; 150 Edgemere Road, Apt 4, West 
Roxbury, MA 02132 (US). 02KAYNAK, Engin ; 44 
Purdue Drive, Milford, MA 01757 (US). PANG, Roy, 
H., L. ; 16 Kimberly Drive, Medway, MA 02053 (US). 



(74) Agent: PITCHER, Edmund, R.; Lahive & Cockileld, 60 
State Street, Boston. MA 02109 (US). 



(81) Designated States: AT (European patent), AU, BE (Euro 
pean patent), CA, CH (European patent). DE (Euro- 
pean patent), DK (European patent), ES (European pa- 
tent), FR (European patent), GB (European patent). GR 
(European patent), IT (European patent), JP, LU (Euro- 
pean patent), NL (European patent), SE (European pa- 
tent). 



Published 

With international search report. 



(54) Title: OSTEOGENIC DEVICES 



(57) Abstract 



. • Xt?^^^ ^ ^'^'"^ ^^'^ sequence data, structural features, and various other data characterizing a human osteogenic 
protem, OPl, 2) osteogenic devices comprising a heat treated xenogenic bone collagen matrix containing osteogenic protein 3) 
methods of producing osteogenic proteins using recombinant DNA technology and 4) use of osteogenic devices to mimic the nat- 
ural course of endochondral bone formation in mammals. 



FOR THE PURPOSES OF INFORMATION ONLY 



Codes used to identify States party to the PCT on the front pages of pamphlets publishing international 
applications under the PCT. 



AT 


Austria 


ES 


Spain 


MC 


Monaco 


AU 


Austral U 


PI 


Finland 


MC 


Madagascar 


U 


Barbados 


PR 


France 


ML 


Mali 


BE 


Bclfium 


CA 


Gabon 


MR 


Mauriunia 


BP 


Burkina Fauo 


CB 


United Kjnfdom 


MW 


Malawi 


BC 


Bulfaria 


CR 


Greece 


NL 


Netherbnds 


BJ 


Benin 


HU 


Hunpry 


NO 


f4orway 


BR 


Brszil 


IT 


luly 


RO 


Ronunia 


CA 


Canada 


JP 


Japan 


SO 


Sudan 


CP 


Central African Republic 


KP 


Democratic People*! Republic 


SE 


Sweden 


CC 


Con{o 




of Korea 


SN 


Senegal 


CH 


Swti»;rland 


KR 


Republic of Korea 


SU 


Soviet Union 


CM 


Cameroon 


LI 


Liechlenstein 


TD 




OE 


Germany. Federal Republic of 


LK 


Sri Lanka 


TC 


Togo 


DK 


Denmark 


LU 


laiJu;mbourg 


US 


United Sutes of America 



wo 91/05802 PCT/US90/05903 



-1- 

OSTEOGENIC DEViq EfS 

Reference to Related Appli cations 

This application is a continuation-in-part 
of copending U.S. application Serial No. 422,699 
filed October 17, 1989 entitled -Osteogenic Devices," 
and U.S. application Serial No. 483,913, filed 
February 22, 1990, entitled "Bone Collagen Matrix for 
Implants . " 



Background of the Invention 

This invention relates to osteogenic 
devices, to genes encoding proteins which can induce 
new bone formation in mammals, and to methods for the 
production of these proteins in mammalian cells using 
recombinant DNA techniques. The invention also 
relates to matrix materials useful for allogenic or 
xenogenic implants and which act as a carrier of the 
osteogenic protein to induce new bone formation in 
mammals, and to bone and cartilage repair procedures 
using the osteogenic devices. 

Mammalian bone tissue is known to contain 
one or more proteinaceous materials, presumably- 
active during growth and natural bone healing, which 



wo 91/05802 



-2- 



PCr/US90/05903 



can induce a developmental cascade of cellular events 
resulting in endochondral bone formation. This 
active factor (or factors) has variously been 
referred to in the literature as bone morphogenetic 
or morphogenic protein, bone inductive protein, 
osteogenic protein, osteogenin, or osteoinductive 
protein. 

The developmental cascade of bone 
differentiation consists of recruitment of 
mesenchymal cells, proliferation of progenitor cells, 
calcification of cartilage, vascular invasion, bone 
formation, remodeling, and finally marrow 
differentiation (Reddi (1981) Collagen Rel. Res. 
1:209-226) • 

Though the precise mechanisms underlying 
these phenotypic transformations are unclear, it has 
been shown that the natural endochondral bone 
differentiation activity of bone matrix can be 
dissociatively extracted and reconstituted with 
inactive residual collagenous matrix to restore full 
bone induction activity (Sampath and Reddi (1981) 
Proc, Natl. Acad. Sci. USA 7fi: 7599-7603) . This 
provides an experimental method for assaying protein 
extracts for their ability to induce endochondral 
bone in vivo . Several species of mammals produce 
closely related protein as demonstrated by cross 
species implant experiments (Sampath and Reddi (1983) 
Proc. Natl. Acad. Sci . USA M: 6591-6595) • 

The potential utility of these proteins has 
been recognized widely. It is contemplated that the 
availability of the protein would revolutionize 



wo 91/05802 



PCr/US90/05903 



-3- 



orthopedic medicine/ certain types of plastic 
surgery, and various periodontal and craniofacial 
reconstructive procedures • 

The observed properties of these protein 
fractions have induced an intense research effort in 
several laboratories directed to isolating and 
identifying the pure factor or factors responsible 
for osteogenic activity. The current state of the 
art of purification of osteogenic protein from 
mammalian bone is disclosed by Sampath et al. (1987) 
Proc. Natl> Acad, Sci . USA BQ, Urist et al. (1984) 
Proc. Soc. Exp, Bi ol. Med, 122:194-199 disclose a 
human osteogenic protein fraction which was extracted 
from demineralized cortical bone by means of a 
calcium chloride-urea inorganic-organic solvent 
mixture, and retrieved by differential precipitation 
in guanidine-hydrochloride and preparative gel 
electrophoresis. The authors report that the protein 
fraction has an amino acid composition of an acidic 
polypeptide and a molecular weight in a range of 
17-18 kD. 



Urist et al. (1984) Proc, Natl. Acad. Sci. 
USA 51:371-375 disclose a bovine bone morphogenetic 
protein extract having the properties of an acidic 
polypeptide and a molecular weight of approximately 
18 kD. The authors reported that the protein was 
present in a fraction separated by hydroxyapatite 
chromatography, and that it induced bone formation in 
mouse hindquarter muscle and bone regeneration in 
trephine defects in rat and dog skulls. Their method 
of obtaining the extract from bone results in 
ill-defined and impure preparations. 



wo 91/05802 



-4- 



PCr/US90/05903 



European Patent Application Serial No. 
148,155, published October 7, 1985, purports to 
disclose osteogenic proteins derived from bovine, 
porcine, and human origin. One of the proteins, 
designated by the inventors as a P3 protein having a 
molecular weight of 22-24 kD, is said to have been 
purified to an essentially homogeneous state. This 
material is reported to induce bone formation when 
implanted into animals. 

International Application No. PCT/087/01537, 
published January 14, 1988 (Int. Pub. No. 
WO88/00205) , discloses an impure fraction from bovine 
bone which has bone induction qualities. The named 
applicants also disclose putative ••bone inductive 
factors** produced by recombinant DNA techniques. 
Four DNA sequences were retrieved from human or 
bovine genomic or cONA libraries and expressed in 
recombinant host cells. While the applicants stated 
that the expressed proteins may be bone morphogenic 
proteins, bone induction was not demonstrated, 
suggesting that the recombinant proteins are not 
osteogenic. The same group reported subsequently 
( Science . 242.:1528, Dec. 1988) that three of the 
four factors induce cartilage formation, and 
postulate that bone formation activity "is due to a 
mixture of regulatory molecules" and that "bone 
formation is most likely controlled ... by the 
interaction of these molecules." Again, no bone 
induction was attributed to the products of 
expression of the cDNAs. See also Urist et al., EPO 
212,474 entitled Bone Morphogenic Agents. 



wo 91/05802 



-5- 



PCr/US90/05903 



Wang et al. (1988) Proc. Kf^t , Acad. Rri . nsa 
&!: 9484-9488, disclose the purification of a bovine 
bone morphogenetic protein from guanidine extracts of 
demineralized bone having cartilage and bone 
formation activity as a basic protein corresponding 
to a molecular weight of 30 kD determined from gel 
elution. Purification of the protein yielded 
proteins of 30, 18 and 16 kD which, upon separation, 
were inactive. In view of this result, the authors 
acknowledged that the exact identity of the active 
material had not been determined. 

Wang et al. (1990) Proc. Nai-. Acad. Sr^ . ^Tp a 
£7: 2220-2227 describes the expression and partial 
purification of one of the cDNA sequences described 
in PCT 87/01537. Consistent cartilage and/or bone 
formation with their protein requires a minimum of 
600 ng of 50% pure material. 

International Application No. PCT/89/04458 
published April 19, 1990 (Int. Pub. No. WO90/003733) , 
describes the purification and analysis of a family 
of osteogenic factors called "P3 OF 31-34". The 
protein family contains at least four proteins, which 
are characterized by peptide fragment sequences. The 
impure mixture P3 OF 31-34 is assayed for osteogenic 
activity. The activity of the individual proteins is 
neither assessed nor discussed. 

It has been found that successful 
implantation of the osteogenic factors requires 
association of the proteins with a suitable carrier 
material capable of maintaining the proteins at an in 
viva site of application. The carrier should be 



wo 91/05802 



-6" 



PCT/US90/05903 



biocompatible/ biodegradable and porous enough to 
allow cell infiltration. The insoluble collagen 
particles remaining after guanidine extraction and 
delipidation of pulverized bone generally have been 
found effective in allogenic implants in some 
species. However, studies have shown that while 
osteoinductive proteins are useful cross species, the 
collagenous bone matrix generally used for inducing 
endochondral bone formation is species specific 
(Sampath and Reddi (1983) Proc. Nat. Acad. Sci . USA 
flfi:6591-6594) . Demineralized, delipidated, extracted 
xenogenic bone matrix carriers implanted in vivo 
invariably fail to induce osteogenesis, presumably 
due to inhibitory or immunogenic components in the 
bone matrix. Even the use of allogenic bone matrix 
in osteogenic devices may not be sufficient for 
osteoinductive bone formation in many species. For 
example, allogenic, subcutaneous implants of 
demineralized, delipidated monkey bone matrix is 
reported not to induce bone formation in the monkey. 
(Asperberg et al. (1988) J. Bone Joint Sura. (Br) 
7Ii:iB: 625-627) . 

U.S. 4,563,350, published January 7, 1986, 
discloses the use of trypsinized bovine bone matrix 
as a xenogenic matrix to effect osteogenic activity 
when implanted with extracted, partially purified 
bone-inducing protein preparations. Bone formation 
is said to require the presence of at least 5%, and 
preferably at least 10%, non-f ibrillar collagen. The 
authors claim that removal of telopeptides which are 
responsible in part for the immunogenicity of 
collagen preparations is more suitable for xenogenic 
implants . 



wo 91/05802 



-7- 



PCT/LS90/0S903 



European Patent Application Serial No. 
309,241, published 3/29/89, discloses a device for 
inducing endochondral bone formation comprising an 
osteogenic protein preparation, and a matrix carrier 
comprising 60-98% of either mineral component or bone 
collagen powder and 2-40% atelopeptide 
hypo immunogenic collagen. 

Deatherage et al. (1987) Collagen nel. Rps . 
7:2225-2231, purport to disclose an apparently 
xenogenic implantable device comprising a bovine bone 
matrix extract that has been minimally purified by a 
one-step ion exchange column and reconstituted, 
highly purified human Type-I placental collagen. 

U.S. 3,394,370, published 7/19/83, describes 
a matrix of reconstituted collagen purportedly useful 
in xenogenic implants. The collagen fibers are 
treated enzymatically to remove potentially 
immunogenic telopeptides (also the primary source of 
interfibril crosslinks) and are dissolved to remove 
associated non-collagen components. The matrix is 
formulated by dispersing the reconstituted collagen 
in acetic acid to form a disordered matrix of 
elementary collagen molecules that is then mixed with 
osteogenic factor and lyophilized to form a 
"semi-rigid foam or sponge" that is preferably 
crosslinked. The formulated matrix is not tested in 
vivo . 



U.S. 4,172,128, published 10/23/79, 
describes a method for degrading and regenerating 
bone-like material of reduced immunogenicity, said to 



91/05802 



-8- 



PCr/US90/05903 



be useful cross-species. Demineralized bone 
particles are treated with a swelling agent to 
dissolve any associated mucopolysaccharides 
(glycosarainoglycans) and the collagen fibers 
subsequently dissolved to form a homogenous colloidal 
solution, A gel of reconstituted fibers then can be 
formed using physiologically inert 
mucopolysaccharides and an electrolyte to aid in 
fibril formation. 

It is an object of this invention to provide 
osteogenic devices comprising matrices containing 
dispersed osteogenic protein produced from 
recombinant DNA and capable of bone induction in 
allogenic and xenogenic implants. Another object is 
to provide recombinant osteogenic proteins expressed 
from mammalian cells and capable of inducing 
endochondral bone formation in mammals, including 
humans. Still another object is to provide genes 
encoding osteogenic proteins and methods for their 
production using recombinant DNA techniques. Yet 
another object is to provide a biocompatible. In vivo 
biodegradable matrix capable, in combination with an 
osteoinductive protein, of producing endochondral 
bone formation in mammals, including humans. 

These and. other objects and features of the 
invention will be apparent from the description, 
drawings, and claims which follow. 



wo 91/05802 



-9- 



PCT/US90/05903 



Summary of fhP Inventipn 

This invention provides osteogenic proteins 
and devices which, when implanted in a mammalian 
body, can induce at the locus of the implant the full 
developmental cascade of endochondral bone formation 
including vascularization, mineralization, and bone 
marrow differentiation. The devices comprise a 
carrier material, referred to herein as a matrix, 
having the characteristics disclosed below, and 
containing dispersed osteogenic protein produced 
using recombinant DNA techniques and expressed from 
eukaryotic cells, preferably mammalian cells. 

Preferred embodiments of the recombinant 
protein dispersed in the matrix disclosed herein 
closely mimic the physiological activity of native 
form protein extracted from natural sources and 
reconstituted in allogenic demineralized bone powder 
matrix material. The preferred proteins have a 
specific activity far higher than any biosynthetic 
material heretofore reported, an activity which, 
within the limits of precision of the activity assay, 
appears essentially identical to the substantially 
pure material produced as set forth in copending 
application Serial No. 179,406 filed April 8, 1988 
(PCT US/89 01453). Thus, this application discloses 
how to make and use osteogenic devices which induce 
the full developmental cascade of endochondral bone 
formation essentially as it occurs in natural bone 
healing. 



« 



A key to these developments was the 
elucidation of amino acid sequence and structure data 



91/05802 



-10- 



PCr/US90/05903 



of native osteogenic protein. A protocol was 
developed which results in retrieval of active, 
substantially pure osteogenic protein from mammalian 
bone having a half-maximum bone forming activity of 
about 0.8 to 1.0 ng per mg of implant. The 
availability of the material enabled the inventors to 
elucidate all structural details of the protein 
necessary to achieve bone formation. Knowledge of 
the protein's amino acid sequence and other 
structural features enabled the identification and 
cloning of native genes. 

Consensus DNA sequences based on partial 
sequence data and observed homologies with regulatory 
proteins disclosed in the literature were used as 
probes for extracting genes encoding osteogenic 
protein from genomic and cDNA libraries. One of the 
consensus sequence probes isolated a previously 
unidentified DNA sequence, portions of which, when 
ligated, encoded a protein comprising a region 
capable of inducing endochondral bone formation when 
properly modified, incorporated in a suitable matrix, 
and implanted as disclosed herein. The protein, 
referred to herein as OPl, as well as various 
truncated forms and fusion constructs, has been 
expressed in E. coli and various mammalian cells from 
the full length cDNA sequence and various truncated 
synthetic DKAs, and has been discovered to exhibit 
osteogenic activity as a homodimer or as a 
heterodimer with BMP2, another osteogenic protein 
extracted from human DNA libraries with the consensus 
sequence probes. 



wo 91/05802 



-11- 



PCr/US90/05903 



Characterization of the OPl gene and 
identification of the DNA and amino acid sequence 
necessary for activity has allowed expression of the 
gene in manmalian cells. Mammalian cell expression 
of recombinant proteins, particularly mammalian 
proteins intended for therapeutic use, is generally 
thought to yield proteins having a structure most 
like that of the natural material. This is 
particularly true for secreted proteins which require 
particular post-translational modifications, such as 
glycosylation, which are not carried out in 
procaryotic systems. While expression of the OPl 
gene in F, coli has shown that the unglycosylated 
form of the protein has osteogenic activity, there 
may be other as yet undetermined functions for the 
oligosaccharides, relating to protein stability, 
solubility, or immunogenicity, for example. In 
addition, purification of proteins secreted into 
culture media provide an alternative to extraction of 
induced proteins from procaryotic inclusion bodies. 

Mammalian cell expression of the gene also 
has allowed determination of the N-terminus of the 
mature protein. The amino acid sequence of what is 
believed to be the mature form of OPl is (Seq. ID No 
1): 



wo 91/05802 



-12- 



PCT/US90/05903 



OPl-18 
10 



s 


T 


G 


S K 


Q 


R 


S 


Q N 


R 


S 


K 


T P 








20 
















30 


K 


N 


Q 


E A 


L 


R 


M 


A N 


V 


A 


E 


N S 
















40 










S 


S 


D 


Q R 


Q 


A 


C 


K K 


H 


E 


L 


Y V 








50 
















60 


s 


F 


R 


D L 


G 


W 


Q 


D W 


I 


I 


A 


P E 
















70 










G 


y 


A 


A y 


y 


c 


E 


G E 


C 


A 


F 


P L 








80 
















90 


N 


s 


Y 


M N 


A 


T 


N 


H A 


I 


V 


Q 


T L 
















100 










V 


H 


F 


I N 


P 


E 


T 


V P 


K 


P 


c 


C A 








110 
















120 


P 


T 


Q 


L N 


A 


I 


S 


V L 


Y 


F 


D 


D S 
















130 










s 


N 


V 


I L 


K 


K 


Y 


R N 


M 


V 


V 


R A 


c 


G 


c 


H. 



















Recombinantly-produced OPl also is 
active in several forms truncated at the 
protein's N-terminus. One main species of 
truncated OPl is (Seq. ID No. 2): 

0P1-16S 
8 10 















S 


Q N 


R 


S 


K 


T P 








20 
















30 


K 


N 


Q 


E A 


L 


R 


M 


A N 


V 


A 


E 


N S 
















40 










S 


S 


D 


Q R 


Q 


A 


C 


K K 


H 


E 


L 


y V 








50 
















60 


S 


F 


R 


D L 


G 


W 


Q 


D W 


I 


I 


A 


P E 
















70 










G 


Y 


A 


A Y 


Y 


C 


E 


G E 


C 


A 


F 


P L 








80 
















90 


N 


S 


Y 


M N 


A 


T 


N 


H A 


I 


V 


Q 


T L 
















100 










V 


H 


F 


I N 


P 


E 


T 


V P 


K 


P 


C 


C A 








110 
















120 


P 


T 


Q 


L N 


A 


I 


S 


V L 


Y 


F 


D 


D S 
















130 










S 


N 


V 


I L 


K 


K 


Y 


R N 


M 


V 


V 


R A 


C 


G 


c 


H. 



















wo 91/05802 



-13- 



PCr/US90/05903 



are: 



Four other active shorter OPl sequences 



0P1-16L (Seq. ID No. 3) 





























30 












L 


R 


M 


A 


N 


V 


A 


E 


N S 




















40 










s 


s 


D 


Q 


R 


Q 


A 


C 


K 


K 


H 


E 


L 


y V 










50 


















60 


s 


F 


R 


D 


L 


G 


W 


Q 


D 


W 


I 


I 


A 


P E 




















70 










G 


Y 


A 


A 


Y 


Y 


C 


E 


G 


E 


C 


A 


F 


P L 


N 
IM 








80 


















90 


e 
o 


V 
X 


M 


N 


A 


T 


N 


H 


A 


I 


V 


Q 


T L 


















100 










V 


H 


F 


I 


N 


P 


E 


T 


V 


P 


K 


P 


C 


C A 








110 


















120 


P 


T 


Q 


L 


N 


A 


I 


S 


V 


L 


Y 


F 


D 


D S 


















130 










s 


N 


V 


I 


L 


K 


K 


Y 


R 


N 


M 


V 


V 


R A 


C 


G 


C 


H 


• 




























0P1-16M 


(Seq. 


ID 


No. 


4) 




















23 












30 
















N 


A 


N 


V 


x\ 


Li 


M e 




















40 










S 


S 


D 


Q 


R 


Q 


A 


C 


K 


K 


H 


E 


L 


Y V 










50 


















60 


s 


F 


R 


D 


L 


G 


W 


Q 


D 


W 


I 


I 


A 


P E 




















70 










G 


Y 


A 


A 


Y 


Y 


C 


E 


G 


E 


C 


A 


F 


P L 


N 








80 


















90 


S 


Y 


M 


N 


A 


T 


N 


H 


A 


I 


V 


Q 


T L 


















100 










V 


H 


F 


I 


N 


P 


E 


T 


V 


P 


K 


P 


c 


C A 








110 


















120 


P 


T 


Q 


L 


N 


A 


I 


S 


V 


L 


Y 


F 


D 


D S 


















130 










S 


N 


V 


I 


L 


K 


K 


Y 


R 


N 


M 


V 


V 


R A 


C 


G 


c 


H 


• 





















wo 91/05802 



s 


S 


D 


Q R 


Q 


A 








50 






s 


F 


R 


D L 


G 


W 


G 


Y 


A 


A Y 


Y 


C 








BO 






N 


S 


Y 


M N 


A 


T 


V 


H 


F 


I N 


P 


E 








110 






P 


T 


Q 


L N 


A 


I 


S 


N 


V 


I L 


K 


K 


C 


G 


c 


H ; i 


and 





0P1-16V 



s 


s 


D 


Q R 


Q 


A 








50 






s 


F 


R 


D L 


G 


W 


G 


Y 


A 


A Y 


Y 


c 








80 






N 


S 


Y 


M N 


A 


T 


V 


H 


F 


I N 


P 


E 








110 






P 


T 


Q 


L N 


A 


I 


s 


N 


V 


I L 


K 


K 


c 


G 


c 


H. 







PCr/US90/05903 

-14- 



(Seq. ID. No. 5) 





24 








30 




A N 


V 


A 


E 


N S 




40 










c 


K K 


H 


E 


L 


Y V 












60 


Q 


D W 


I 


I 


A 


P E 




70 










E 


G E 


C 


A 


F 


P L 












90 


N 


H A 


I 


V 


Q 


T L 




100 










T 


V P 


K 


P 


C 


C A 












120 


S 


V L 


Y 


F 


D 


D S 




130 










Y 


R N 


M 


V 


V 


R A 


Seg. ID. 


No. 


6) 
















30 






V 


A 


E 


N S 




40 










C 


K K 


H 


E 


L 


Y V 












60 


Q 


D W 


I 


I 


A 


P E 




70 










E 


G E 


C 


A 


F 


P L 












90 


N 


H A 


I 


V 


Q 


T L 




100 










T 


V P 


K 


P 


c 


C A 












120 




V L 


Y 


F 


D 


D S 




130 










Y 


R N 


M 


V 


V 


R A 



wo 91/05802 



-15" 



PCr/US90/05903 



These 6 species of OPl have been tested for 
osteogenic activity in vivo and all have been shown 
to induce endochondral bone formation in a 
dose-dependent manner when implanted in a mammal in 
association with a suitable matrix. The specific 
activity of these species is close to that of the 
substantially pure, naturally-sourced osteogenic 
protein. Moreover, these proteins mimic the activity 
of the naturally-sourced material more closely than 
other osteogenic protein preparations heretofore 
reported. 

Recombinantly produced OPl is expressed as a 
glycosylated homodimer in mammalian cells. 
Homodimers of OPl-18 have an apparent molecular 
weight of about 36 kD, when oxidized, and about 18 kD 
when reduced, as determined by SDS-PAGE gels. 
0P1-16S, 0P1-16V, 0P1-16M, 0P1-16A and 0P1-16L have 
an apparent molecular weight of about 16kD, when 
reduced, and homodimers of these proteins, as well as 
heterodimers with OPl-18 have an apparent molecular 
weight within the range of about 30-36 kD when 
oxidized, as determined by SDS-PAGE gels. In the 
reduced state, these proteins have no detectable 
osteogenic activity. 

OPl now has been expressed in a number of 
different mammalian cells, all of which glycosylate 
and process the protein after translation. While the 
precise structure of the oligosaccharide side chains 
may vary among the different cell lines, in all cases 
the expressed sequence is osteogenically active in a 
specific and dose dependent manner, 



-16- 



PCr/US90/05903 



The invention is not limited to those 
specific constructs. Thus, the osteogenic proteins 
of this invention may include forms having varying 
glycosylation patterns, varying N-termini, a family 
of related proteins having regions of amino acid 
sequence homology, and active truncated or mutated 
forms of the native amino acid sequence^ produced by 
expression of recombinant DNA in eucaryotic host 
cells. Active sequences useful in an osteogenic 
device of this invention is envisioned to include 
osteogenic proteins having at least a 70% sequence 
homology, preferably at least 80%, with the amino 
acid sequence of 0P1-16V. This includes longer forms 
of the protein, as well as allelic variants and 
muteins . 

ThuS/ in view of this disclosure, skilled 
genetic engineers can isolate genes from cDNA or 
genomic libraries which encode appropriate amino acid 
sequences, or construct DNAs from oligonucleotides, 
and then can express them in various types of 
eucaryotic host cells to produce large quantities of 
active proteins capable of inducing bone formation in 
mammals, including humans. 

The osteogenic proteins are useful in 
clinical applications in conjunction with a suitable 
delivery or support system (matrix). The matrix 
comprises biocompatible, protein-extracted, 
mineral-free, delipidated, insoluble Type-I bone 
collagen particles which may be allogenic or 
xenogenic to the host. The particles preferably are 
treated with a fibril-modifying agent such as hot 
water or other fibril-modifying solvents, to alter 



wo 91/05802 



-17- 



PCr/US90/OS903 



the particle morphology, i.e., to increase the 
intraparticle porosity and the surface area of the 
particles. The particles are packed together to form 
the matriz. The spaces among the particles must be 
of a dimension to permit progenitor cell migration 
and subsequent cell differentiation and 
proliferation. The particle size should be within 
the range of 70 - 850 vm, preferably ISOpin - 420]m. 
The matrix may be fabricated by close packing the 
particles into a shape spanning the bone defect, or 
by otherwise shaping the packed particles as 
desired. The matrix is biocompatible 
(non-inflammatory) and biodegradable in vivo , and 
serves as a "temporary scaffold" and substratum for 
recruitment of migratory progenitor cells, and as a 
base for their subsequent anchoring and 
proliferation. As disclosed herein, the matrix may 
be combined with osteogenic protein to induce 
endochondral bone formation reliably and reproducibly 
in a mammalian body. 

The development of this matrix material 
resulted from the discovery of key features required 
for successful implantation of xenogenic bone matrix 
and osteogenic protein. Studies indicated that 
osteogenic devices comprising substantially pure 
osteogenic protein and allogenic demineralized, 
delipidated protein-extracted bone matrices must have 
interstices dimensioned to permit the influx, 
proliferation and differentiation of migratory 
progenitor cells. It was also observed that 
osteogenic devices comprising xenogenic bone matrices 
induce little or no endochondral bone formation is 
Zivfi. The absence of bone formation by xenogenic 



wo 91/05802 



-18- 



PCr/US90/05903 



matrices generally has been thought to be due to an 
immunogenic or inhibitory response to components 
still present in the matrix (e.g., the collagen 
telopeptides or associated non-collagenous 
glycoproteins • ) 

It has now been discovered that the overall 
specific particle surface area (surface area/unit 
mass), the degree of porosity and micropitting, and 
the size of the micropits and pores of the matrix 
particles is important for successful xenogenic 
implants / and even for allogenic implants of certain 
species . 

Panels A and B of FIGURE 1 are scanning 
electron micrographs showing the particle structure 
of demineralized, guanidine-extracted bone matrix 
from rat and calf, respectively. As can be seen from 
the SEMs, there is a significantly greater inherent 
porosity, or surface area, in rat bone matrix than in 
bovine bone matrix. It has been discovered that 
increasing the porosity and intraparticle surface 
area of bone matrix can promote osteogenic induction 
as evidenced by rat collagenous bone matrix 
implants. This is achieved by treating collagenous 
bone matrix with certain solvents or heat so as to 
alter its morphology. Agents suitable for this 
purpose are disclosed herein and are termed collagen 
fibril-modifying agents. 

Thus, one aspect of this invention includes 
osteogenic devices comprising matrices which have 
been treated to increase the surface area and 
porosity of matrix collagen particles substantially. 



wo 91/05802 



-20- 



PCr/US90/05903 



chromatogram peaks ^ indicates that there is a 
fraction which can inhibit the osteoinductive 
effect. The identity of the substance or substances 
in this inhibiting fraction has not as yet been 
determined. In one aspect of this invention, a 
matrix is provided comprising Type-I bone collagen 
particles of the type described above, further 
characterized in that they are depleted in this 
inhibiting component. 

In view of this disclosure, one skilled in 
the art can create a biocompatible matrix of choice 
having a desired porosity or surface microtexture 
useful in the production of osteogenic devices, and 
useful in other implantable contexts, e.g., as a 
packing to promote bone induction, or as a 
biodegradable sustained release implant. 

The osteogenic proteins and implantable 
osteogenic devices disclosed herein will permit the 
physician to obtain optimal predictable bone 
formation to correct, for example, acquired and 
congenital craniofacial and other skeletal or dental 
anomalies (Glowacki et al. (1981) Lancet 1: 959-963) . 
The devices may be used to induce local endochondral 
bone formation in non-union fractures as demonstrated 
in animal tests, and in other clinical applications 
including periodontal applications where bone 
formation is required. Another potential clinical 
application is in cartilage repair, for example, in 
the treatment of osteoarthritis. 



wo 91/05802 



-21- 



PCr/US90/05903 



Brief Descriptiion of th^ Drawing 

The foregoing and other objects of the 
invention, the various features thereof, as well as 
the invention itself, may be more fully understood 
from the following description, when read together 
with the accompanying drawings, in which: 

FIGURE lA and IB are scanning electron 
micrographs (5000X) of demineralized, delipidated (A) 
rat bone collagen particles, and (B) bovine bone 
collagen particles; 

FIGURE 2-1 and 2-2 represent the full length 
cDNA and encoded amino acid sequence of the prepro 
form of human OPl protein (Seq, ID No. 7); 

FIGURE 3A through 3F are restriction maps of 
various expression vectors designed for the mammalian 
cell expression of OPl; 

FIGURE 4 is a photoreproduction of western 
blots (iramunoblots) comparing OPl expressed from: 
COS cells - (A) pH717, (B) pH731; CHO cells - (C) 
pH754, (D) PH752; and BSC cells - (E> pH717, (F) 
pW24 ; 

FIGURE 5A-C are (1) elution profiles and (2) 
photoreproductions of SDS-PAGE gels expressed from 
BSC cells and purified (in order) on: (A) 
S-Sepharose, (B) phenyl-Sepharose, and (c) C-18 
columns; 



wo 91/05802 



-22" 



PCr/US90/05903 



FIGURE 6 is a photoreproduction of SDS-PAGE 
gels of OPl purified from BSC cells, comparing the 
intact dimer under oxidized conditions (36 kD, lane 
. 1) and the corresponding monomer, after reduction 
with dithiothreitol (IBkD, lane 5), with molecular 
weight standards (lanes 2-4); 

FIGURE 7A through 7D are scanning electron 
micrographs (approx. lOOOX) of deraineralized, " 
delipidated bovine bone matrix heat treated in water 
at (A) a?*' C, (B) 45« C, (C) 55^ C, and (D) 65* C; 

FIGURE 8 is a 214 nm absorbance tracing of 
the extract isolated from hot water-treated bovine 
matrix, identifying the inhibitory effect of 
individual fractions on in vivo bone formation; 

FIGURE 9A and 9B are bar graphs showing the 
inhibitory effect of hot water-treated matrix extract 
on OPl activity, as measured by (A) alkaline 
phosphatase activity and (B) calcium content in day 
12 implants, vs» increasing concentration of extract 
solvent; 

FIGURE lOA-F are photomicrographs (220x) of 
allogenic implants of OPl expressed from COS, BSC and 
CHO cells, and which follow the developmental cascade 
of endochondral bone osteogenesis; 

FIGURE 11 is a photomicrograph showing the 
histology (day 12) of a xenogenic implant of this 
invention using OPl expressed from BSC cells and hot 
water-treated xenogenic bovine matrix; 



wo 91/05802 



-23- 



PCT/US90/05903 



FIGURE 12 describes the dose dependence of 
osteogenic implants for day 12 implants, as 
determined by alkaline phosphatase activity and 
calcium content, for allogenic implants containing 
OPl expressed from COS, BSC and CHO cells; and 

FIGURE 13A and 13B are bar graphs showing 
the dose dependence of OPl expressed in COS and BSC 
cells, as measured by (A) alkaline phosphatase 
activity and (B) calcium content in xenogenic 
implants (day 12), vs increasing concentration of 
protein (dose curve in ng) . 



wo 91/05802 



-24- 



PCr/US90/0S903 



Description 

Purification protocols first were developed 
which enabled isolation of the osteogenic protein 
present in crude protein extracts from mainnialian 
bone. (See PCT US 89/01453, and U.S. Serial No. 
179,406 filed April 8, 1988). The development of the 
procedure, coupled with the availability of fresh 
calf bone, enabled isolation of substantially pure 
bovine osteogenic protein (BOP) . BOP was 
characterized significantly; its ability to induce 
cartilage and ultimately endochondral bone growth in 
cat, rabbit, and rat were demonstrated and studied; 
it was shown to be able to induce the full 
developmental cascade of bone formation previously 
ascribed to unknown protein or proteins in 
heterogeneous bone extracts. This dose dependent and 
highly specific activity was present whether or not 
the protein was glycosylated (see U.S. Serial 
No. 232,630 filed 8/15/88 and Sampath et al., (1990) 
J. Biol. Chem. 265 : pp. 13198-13205) • Sequence data 
obtained from the bovine materials suggested probe 
designs which were used to isolate human genes. The 
OP human counterpart proteins have now been expressed 
and extensively characterized. 

These discoveries enabled preparation of 
DNAs encoding totally novel, non-native protein 
constructs which individually as homodimers and 
combined with other species as heterodimers are 
capable of producing true endochondral bone (see PCT 
89/01469, filed 4/7/89 and US Serial No. 315,342, 
filed 2/23/89). They also permitted expression of 
the natural material, truncated forms, muteins. 



wo 91/05802 



-25- 



PCr/US90/05903 



analogs, fusion proteins, and various other variants 
and constructs, from cDNAs and genomic DNAs retrieved 
from natural sources or from synthetic DNA produced 
using the techniques disclosed herein and using 
automated, commercially available equipment. The 
DNAs may be expressed using well established 
molecular biology and recombinant DNA techniques in 
procaryotic or eucaryotic host cells, and may be 
oxidized and refolded in vitro if necessary, to 
produce biologically active protein. 

One of the DNA sequences isolated from 
genomic and cDNA libraries encoded a previously 
unidentified gene, referred to herein as OPl. The 
protein encoded by the isolated DNA was identified 
originally by amino acid homology with proteins in 
the TGF-B family. Consensus splice signals were 
found where amino acid homologies ended, designating 
exon-intron boundaries. Three exons were combined to 
obtain a functional TGF-B-like domain containing 
seven cysteines. (See, for example, U.S. Serial No. 
315,342 filed 2/23/80, or Ozkaynak, E. et al., (1990) 
mSBQ. a.: pp. 2085-2093). 

The full-length cDNA sequence for OPl, 
including the amino acid sequence it encodes, is 
represented in Figure 2. This full length cDNA 
sequence of OPl, as well as various truncated forms 
of the gene, and fused genes, have been expressed in 
^- gQli and shown to have osteogenic activity when 
implanted in a mammal in association with a matrix. 



The native form protein is expressed 
originally in a "prepro" form which includes a signal 



wo 91/05802 



-26- 



PCr/US90/0S903 



peptide sequence for appropriate secretion of the 
protein. The signal peptide cleavage site is 
underlined in Figure 2. Removal of the signal 
peptide yields the "pro" form of the protein, which 
is processed upon secretion to yield the mature 
sequence. The cleavage site yielding the mature 
sequence is indicated by an arrow in Figure 2. The 
amino acid sequence of what is believed to be the 
mature form is (Seq. ID No. 1): 



OPl-lB 



1 
















10 










s 


T 


G 


s 


K 


Q 


R 


S 


Q N 


R 


S 


K 


T P 










20 
















30 


K 


N 


Q 


E 


A 


L 


R 


M 


A N 


V 


A 


E 


N S 


















40 










S 


S 


D 


Q 


R 


Q 


A 


C 


K K 


H 


E 


L 


Y V 










50 
















60 


S 


F 


R 


D 


L 


G 


W 


Q 


D W 


I 


I 


A 


P E 


















70 










G 


Y 


A 


A 


Y 


Y 


C 


E 


G E 


C 


A 


F 


P L 










80 
















90 


N 


S 


Y 


M 


N 


A 


T 


N 


H A 


I 


V 


Q 


T L 


















100 










V 


H 


F 


I 


N 


P 


E 


T 


V P 


K 


P 


C 


C A 








110 
















120 


P 


T 


Q 


L 


N 


A 


I 


S 


V L 


Y 


F 


D 


D S 


















130 










S 


N 


V 


I 


L 


K 


K 


Y 


R N 


M 


V 


V 


R A 


C 


G 


c 


H. 





















Both the pro form and prepro form, when 
properly dimerized, folded, adsorbed on a matrix, and 
implanted, display osteogenic activity, presumably 
due to proteolytic degradation resulting in cleavage 
and generation of mature form protein or active 
truncated analogs. 



wo 91/05802 



-27- 



PCT/US90/05903 



Active OPl can also be purified in a 
truncated form, missing part of the protein's N 
terminus. One active truncated form of OPl is (Seq. 
ID No. 2): 

0P1-16S 
8 10 















S 


Q N 


R 


S 


K 


T P 


K 






20 
















30 


N 


Q 


E A 


L 


R 


M 


A R 
40 


V 


A 


E 


N S 


S 


S 


D 


Q R 

50 


Q 


A 


C 


K K 


H 


E 


L 


Y V 
60 


S 


F 


R 


D L 


G 


W 


Q 


D W 
70 


I 


I 


A 


P E 


G 


Y 


A 


A Y 
80 


Y 


C 


E 


G E 


C 


A 


F 


P L 
90 


N 


S 


Y 


M N 


A 


T 


N 


H A 

100 


I 


V 


Q 


T L 


V 


H 


F 


I N 
110 


P 


E 


T 


V P 


K 


P 


C 


C A 
120 


P 


T 


Q 


L N 


A 


I 


S 


V L 
130 


Y 


F 


D 


D S 


s 


N 


V 


I L 


K 


K 


Y 


R N 


M 


V 


V 


R A 



C G C H. 



Four other active truncated forms of 

OPl are: 

0P1-16L (Seq. ID. No. 3) 

21 30 
LRMANVAENS 
40 

SSDQRQACKKHELYV 
50 60 
SFRDLGWQDWI lAPE 

70 

GYAAYYCEGECAFPL 
80 90 

NSYMNATNHAIVQTL 

100 

VHFINPETVPKPCCA 
110 / 120 

PTQLNAISVLYFDDS 

130 

SNVILKKYRNMVVRA 
C G C H; 



wo 91/05802 



-28- 



PCr/US90/05903 



nPl-16M (Seq. ID. No. 4) 

23 30 















M 


A N 


V 


A 


E 


N S 
















40 










s 


s 


D 


Q R 


Q 


A 


c 


K K 


H 


E 


L 


y V 








50 
















60 


s 


F 


R 


D L 


G 


W 


Q 


D W 


I 


I 


A 


P E 
















70 










G 


y 


A 


A Y 


y 


C 


E 


G E 


C 


A 


F 


P L 








80 
















90 


N 


s 


Y 


H N 


A 


T 


N 


H A 


I 


V 


Q 


T L 
















100 










V 


H 


F 


I N 


P 


E 


T 


V P 


K 


P 


C 


C A 








110 
















120 


p 


T 


Q 


L N 


A 


I 


S 


V L 


y 


F 


D 


D S 
















130 










s 


N 


V 


I L 


K 


K 


y 


R N 


M 


V 


V 


R A 


c 




r 

w 


H ; 


























-16A 


(Seq. ID. 


No 






















24 








o u 
















A N 


V 




Li 


















40 










e 
t> 


c 
o 


JJ 




Q 


A 


C 


K K 


IT 

n 




T 
1j 


V v 


























e 


r 






G 


W 


Q 


D W 


T 
X 


T 

X 




















70 










G 


y 


A 


A y 


y 


C 


E 


G E 


c 


A 


F 


P L 








80 
















90 


N 


s 


y 


M N 


A 


T 


N 


H A 


I 


V 


Q 


T L 
















100 










V 


H 


F 


I N 


P 


E 


T 


V P 


K 


P 


C 


C A 








110 
















120 


P 


T 


Q 


L N 


A 


I 


S 


V L 


Y 


F 


D 


D S 
















130 










s 


H 


V 


I L 


K 


K 


y 


R N 


M 


V 


V 


R A 



C G C H ; and 



wo 91/05802 



-29- 



PCr/US90/0S903 



1 C\7 
. — -L O V 


(Seg 


; . ID. 


No. 


6) 












26 






30 








V 


A 


E 


N S 






40 










W A 




K K 


H 


E 


L 


Y V 














60 


G W 


Q 


D W 


I 


I 


A 


P E 






70 










Y C 


E 


G E 


C 


A 


F 


P L 














90 


A T 


N 


H A 


I 


V 


Q 


T L 






100 










P E 


T 


V p 


K 


P 


C 


C A 














120 


A I 


S 


V L 


Y 


F 


D 


D S 






130 










K K 


y 


R N 


M 


V 


V 


R A 



S S D Q R 
50 

S F R D L 

G Y A A Y 
BO 

N S Y M N 

V H F I N 
110 

P T Q L N 
S N V I L 
C G C H . 



Given the foregoing amino acid and DNA 
sequence information, various DNAs can be constructed 
which encode at least the minimal active domain of 
OPl, and various analogs thereof, as well as fusion 
proteins, other truncated forms of the mature 
proteins, and similar constructs. These DNAs can be 
produced by those skilled in the art using well known 
DNA manipulation techniques involving genomic and 
cDNA isolation, construction of synthetic DNA from 
synthesized oligonucleotides, and cassette 
mutagenesis techniques. 15-lOOmer oligonucleotides 
may be synthesized on a Biosearch DNA Model 8600 
Synthesizer, and purified by polyacrylamide gel 
electrophoresis (PAGE) in Tris-Borate-EDTA buffer. 
The DNA may then be electroeluted from the gel. 
Overlapping oligomers may be phosphorylated by T4 
polynucleotide kinase and ligated into larger blocks 
which may also be purified by PAGE. 



wo 91/05802 



-30- 



PCr/US90/05903 



The cDNA or synthetic DNA then may be 
integrated into an expression vector and transfected 
into an appropriate host cell for protein 
expression. The host may be a procaryotic or 
eucaryotic cell since the former's inability to 
glycosylate protein will not destroy the protein's 
osteogenic activity. Useful host cells include E. 
coli M Saccharomvces . the insect/baculovirus cell 
system, myeloma cells, and various mammalian cells. 
The protein of this invention preferably is expressed 
in mammalian cells, as disclosed herein. The vector 
additionally may encode various sequences to promote 
correct expression of the recombinant protein, 
including transcription promoter and termination 
sequences, enhancer sequences, preferred ribosome 
binding site sequences, preferred mRNA leader 
sequences, preferred signal sequences for protein 
secretion, and the like. The DNA sequence encoding 
the gene of interest also may be manipulated to 
remove potentially inhibiting sequences or to 
minimize unwanted secondary structure formation. The 
recombinant osteogenic protein also may be expressed 
as a fusion protein. After being translated, the 
protein may be purified from the cells themselves or 
recovered from the culture medium. All biologically 
active protein forms comprise dimeric species joined 
by disulfide bonds or otherwise associated, produced 
by oxidizing and refolding one or more of the various 
recombinant proteins within an appropriate eucaryotic 
cell or in vitro after expression of individual 
subunits. 



As stated earlier, it is generally held that 
recombinant production of mammalian proteins for 



91/05802 



-32^ 



PCr/US90/0S903 



Briefly* among the best characterized 
transcription promoters useful for expressing a 
foreign gene in a particular mammalian cell are the 
SV40 early promoter, the adenovirus promoter (AdMLP) , 
the mouse metallothionein-I promoter (irMT-I), the 
Rous sarcoma virus (RSV) long terminal repeat (LTR), 
the mouse mammary tumor virus long terminal repeat 
(MMTV-LTR) , and the human cytomegalovirus major 
intermediate-early promoter (hCMV) . The DNA 
sequences for all of these promoters are known in the 
art and are available commercially. 

One of the better characterized methods of 
gene amplification in mammalian cell systems is the 
use of the inducible DHFR gene in a dhfr- cell line. 
Generally, the DHFR gene is provided on the vector 
carrying the gene of interest, and induction by 
addition of the cytotoxic drug methotrexate amplifies 
the DHFR gene copy number, as well as that of the 
associated gene of interest. DHFR as an inducible, 
amplifying marker gene in transfected Chinese hamster 
ovary cell lines (CHO cells) is particularly well 
characterized in the art. Other genes useful as 
inducible gene amplifiers include the adenosine 
deaminase (ADA) and glutamine synthetase <GS) genes. 

The choice of cells/cell lines is also 
important and depends on the needs of the 
experimenter. Monkey kidney cells (COS) provide high 
levels of transient gene expression, providing a 
useful means for rapidly testing vector construction 
and the expression of cloned genes. COS cells are 
transfected with a simian virus 40 (SV40) vector 
carrying the gene of interest. The transfected COS 



wo 91/05802 



-33- 



PCT/US90/05903 



cells eventually die, thus preventing the long term 
production of the desired protein product. However, 
transient expression does not require the time 
consuming process (often several weeks) required for 
the development of a stable cell line. 

Among established cell lines, CHO cells may 
be the best characterized to date. They also are 
capable of expressing proteins from a broad range of 
cell types. The general applicability of CHO cells 
and its successful production for a wide variety of 
human proteins in unrelated cell types emphasizes the 
underlying similarity of all mammalian cells. Thus, 
while the glycosylation pattern on a recombinant 
protein produced in a mammalian cell expression 
system may not be identical to the natural protein, 
the differences in oligosaccharide side chains are 
often not essential for biological activity of the 
expressed protein. 

Methods for expressing and purifying 
recombinant OPl from a variety of mammalian cells, " 
the nature of the xenogenic matrix, and other 
material aspects concerning the nature, utility, and 
how to make and how to use the subject matter claimed 
will be further understood from the following, which 
constitutes the best method currently known for 
practicing the invention. 

I- RECOMBINANT PROTEIN EXPRESSION 
IN MAMMALIAN CELLS 

Several different mammalian cell expression 
systems have been used to express recombinant OPl 



wo 91/05802 



-34- 



PCr/US90/0S903 



proteins of this invention. In particular, COS cells 
are used for the rapid assessment of vector 
construction and gene expression, using an SV40 
vector to transfect the DNA sequence into COS cells. 
Stable cell lines are developed using CHO cells 
(Chinese hamster ovary cells) and a 
temperature-sensitive strain of BSC cells (simian 
kidney cells, BSC40-tsA5B, (1988) Biotechnoloov 6 : 
1197-1196) for the long term production of OPl. Two 
different promoters are used to transcribe OPl: the 
CMV promoter, boosted by the enhancer sequence from 
the Rous sarcoma virus LTR, and the mMT promoter 
(mouse metallothionein promoter) . Several selection 
marker genes also are used, namely, neo (neomycin) 
and DHFR. The DHFR gene also may be used as part of 
a gene amplification scheme for CHO cells. Another 
gene amplification scheme relies on the temperature 
sensitivity (ts) of BSC40-tsA58 cells transfected 
with an SV40 vector. Temperature reduction to 33^*0 
stabilizes the ts SV40 T antigen which leads to the 
excision and amplification of the integrated 
transfected vector DNA, thereby also amplifying the 
associated gene of interest. 

Stable cell lines were established for CHO 
cells as well as BSC40-tsA58 cells (hereinafter 
referred to as "BSC cells"). The various cells, cell 
lines and DNA sequences chosen for mammalian cell 
expression of the OPl proteins of this invention are 
well characterized in the art and are readily 
available. Other promoters, selectable markers, gene 
amplification methods and cells also may be used to 
express the OPl proteins of this invention, as well 
as other osteogenic proteins. Particular details of 



wo 91/05802 



-35- 



PCr/US90/05903 



the transf ectiori/ expression, and purification of 
recombinant proteins are well documented in the art 
and are understood by those having ordinary skill in 
the art. Further details on the various technical 
aspects of each of the steps used in recombinant 
production of foreign genes in mammalian cell 
expression systems can be found in a number of texts 
and laboratory manuals in the art, such as, for 
example. Current Protocol s in Molecular Biology . F.M, 
Ausubel et al., ed., John Wiley & Sons, New York 1987. 

1. Exemplary Expression Vectors 

Figure 3 discloses restriction maps of 
various exemplary expression vectors designed for OPl 
expression in mammalian cells. Each of these vector 
contructs employs a full-length cDNA sequence 
originally isolated from a human cDNA library (human 
placenta) and subsequently cloned into a conventional 
pUC vector (pUC-18) using pUC polylinker sequences at 
the insertion sites. The OPl cDNA fragment cloned 
into each of these constructs is either the intact 
Smal-BamHI OPl cDNA fragment depicted in Figure 2 
(Seq. ID No. 7), or modifications of this fragment 
where the flanking non-coding 5' and/or 3' sequences 
have been trimmed back, using standard molecular 
biology methodology. Each vector also employs an 
SV40 origin of replication (ori), useful for 
mediating plasmid replication in primate cells (e.g., 
COS and BSC cells). In addition, the early SV40 
promoter is used to drive transcription of marker 
genes on the vector (e.g., neo and DHFR) . 

The pH717 expression vector (Fig. 3A) 
contains the neomycin (neo) gene as an inducible 



wo 91/05802 



-36- 



PCT/US90/05903 



selection marker. This marker gene is well 
characterized in the art and is available 
commercially. Alternatively/ other selectable 
markers may be used. The particular vector used to 
provide the neo gene DNA fragment for pH717 may be 
obtained from Clontech, Inc./ Palo Alto, CA 
(pMAM-neo-blue) . In pH717/ OPl DNA transcription is 
driven by the CMV promoter, boosted by the RSV-LTR 
and MMTV-LTR (mouse mammary tumor virus) enhancer 
sequences. These sequences are known in the art, and 
are available commercially. For example, vectors 
containing this promoter/enhancer sequence may be 
obtained from Invitrogen Inc., San Diego, CA, (e.g., 
pCDMS) . 

Expression vector pH731 (Fig. SB), utilizes 
the SV40 late promoter to drive OPl transcription. 
As indicated above, the sequence and characteristics 
of this promoter also are well known in the art. 
Alternatively, pH731 may be generated by inserting 
the Smal-BamHI fragment of OPl into pEUK-Cl 
(Clontech, Inc., Palo Alto, CA) . 

The pH754 expression vector (Fig. 3C) 
contains the DHFR sequence as both a selection marker 
and as an inducible gene amplifier. OPl is under CMV 
control. The DNA sequence for DHFR and is well 
characterized in the art, and is available 
commercially. Alternatively, pH754 may be generated 
from pMAM-neo (Clontech, Inc., Palo Alto, CA) by 
replacing the neo gene (BamHI digest) with a BamHI 
fragment containing the DHFR gene (e.g., obtained 
from pSV5-dhfr (ATCC #37148)). OPl DNA then can be 
inserted into the polylinker site downstream of the 
MMTVLTR sequence (mouse mammary tumor virus LTR) , 



wo 91/05802 



-37- 



PCr/US90/05903 



yielding pH752 (Fig. 3D). The CMV promoter sequence 
then may be inserted into pH752 (opened at Clal-Nhel) 
as a Clal-Xbal fragment (e.g., from pMAM-neo blue, 
Clontech, Inc.). 

The pW24 vector (Fig. 3E) , is essentially 
identical in sequence to p754, except that neo is 
used as the marker gene (see pH717) , in place of DHFR. 

Similarly, pH783 (Fig. 3F) contains the 
amplifiable marker DHFR, but here OPl is under mMT 
(mouse metallothionein promoter) control. The mMT 
promoter is well characterized in the art and is 
available commercially. Alternatively, a Clal-Nhel 
fragment containing the mMT promoter sequence 
(available from Allegro Nichols Institute 
Diagnostics, San Juan Capistrano, CA) can be inserted 
into pH752 to generate pH783. 

All vectors tested are stable in the various 
cells used to express OPl, and provide a range of OPl 
expression levels. 

2. Exemplary Mammalian Cells 

Recombinant OPl has been expressed in three 
different cell expression systems: COS cells for 
rapidly screening the functionality of the various 
expression vector constructs, CHO cells for the 
establishment of stable cell lines, and BSC40-tsA58 
cells as an alternative means of producing OPi 
protein. 



91/05802 



•38" 



PCT/US90/05903 



A. COS CELLS 



COS cells (simian kidney cells) are used for 
rapid screening of vector contructs and for 
immediate, small scale production of OPl protein. 
COS cells are well known in the art and are available 
commercially. The particular cell line described 
herein may be obtained through the American Type 
Culture Collection (ATCC #C0S-1, CRL-1650). 

OPl expression levels from different 
vectors, analyzed by northern and western blot 
assays, are compared in Table I below: 



TABLE 1 



ANALYSIS OF OPl EXPRESSION IN COS CELLS 
Vector mRNA OPl Production 

pH717 +++ ++ 

pH731 + + 

pH752 +++ ++++ 

pH754 +++ ++++ 



pH754-transf ected COS cells appear to 
produce the highest yield of OPl to date. However, 
because transfected COS cells do not divide and die 
several days post-transf ection, large amounts of 
plasmid DNA are required for each scaled up 
transformation. 



Large scale preparations of OPl from 
transfected COS cells may be produced using 
conventional roller bottle technology. Briefly, 14 X 



wo 91/05802 



-39- 



PCT/US90/0S903 



10^ cells are used to seed each bottle. After 24 hrs 
of growth, the cells are transfected with 10 >ig of 
vector DNA (e.g., pH717) per 10^ cells, using the 
DEAE-dextran method. Cells are then conditioned in 
serum-free media for 120 hr before harvesting the 
media for protein analysis. Following this protocol, 
OPl yield is approximately 2-6 ng/ml. 



B. CHO Cells 



CHO cells (chine se hamster ovary cells) may 
be used for long term OPl production. CHO cell lines 
are well characterized for the small and large scale 
production of foreign genes and are available 
commercially. The particular cell line described 
herein is CHO-DXBll, (Laurence Chasin, Columbia 
University, NY). Table II, below, shows exemplary 
OPl yields obtained with a variety of expression 
vectors . 



TABLE II 



Selection OPl Production 

CHO C^llg Plasmid Marker no/ml 

pH717 NEO 2-5 

* pH752/pH754 DHFR 100-150 



*Cells are adapted to grow in 
0.1 uM methotrexate 



CHO cells may be transfected by conventional 
calcium phosphate technique. CHO cells preferably 
are transfected with pH754 or pH752 and are 



wo 91/05802 



-40- 



PCr/US90/0S903 



conditioned in media containing serum proteins / as 
this appears to enhance OPl yields. Useful media 
include media containing 0.1-0.5% dialyzed fetal calf 
serum (FCS). 

C. BSC CELLS 

The BSC40-tsA58 cell line ("BSC cells") is a 
temperature-sensitive strain of simian kidney cells 
(1988, BiotechnoloQY 6 ; 1192-1196) which overcomes 
some of the problems associated with COS cells. 
These BSC cells have the advantage of being able to 
amplify gene sequences rapidly on a large scale with 
temperature downshift, without requiring the addition 
of exogenous, potentially toxic drugs. In addition, 
the cells may be recycled. That is, after induction 
and stimulation of OPl expression, the cells may be 
transferred to new growth medium, grown to confluence 
at 39.5®C and induced a second time by downshifting 
the temperature to 33**C. BSC cells may be used to 
establish stable cell lines rapidly for protein 
production. 

Transfected BSC cells may be induced by 
shifting the temperature down to 33**C, in media 
containing 10% FCS, and harvesting the conditioned 
media after 96 hrs of incubation. Comparable amounts 
of OPl RNA and protein are obtained, as compared with 
CHO cells (e.g., 100-150 ng OPl/ml conditioned media 
from BSC clones transfected with pH717) . 

♦ 

3. Evaluation of OPl transfected cells 



wo 91/05802 



-41- 



PCT/US90/05903 



Expression levels of transfected OPl 
sequences can be measured in the different systems by 
analyzing mRNA levels (Northern blots), using total 
cellular RNA and conventional hybridization 
methodology. Generally, about 1 X lO^ cells are 
needed for mRNA analysis. Data between individual 
cell lines can be compared if the total number of 
cells and the total amount of mRNA is normalized, 
using rRNA as an internal standard. Ribosomal RNA is 
visualized in the agarose gel by ethydium bromide 
stain prior to transfer of the RNA to nitrocellulose 
sheets for hybridization. Ribosomal RNA also 
provides an indicator of the integrity of the RNA 
preparation. 

OPl protein levels also may be measured by 
Western blots (immunoblots) using rabbit antisera 
against human OPl. Figure 4 is an immunoblot showing 
OPl production in: COS cells - (A) pH717, (B) 
PH731; CHO cells - (C> pH754, (D) pH752; and BSC 
cells - <E) PH717 and (F> pW24 . 

Southern blots may be used to assess the 
state of integrated OPl sequences and the extent of 
their copy number amplification. The copy number of 
excised plasmids in temperature-shifted BSC cells 
also can be determined using Southern blot analysis. 



II. PROTEIN PURIFICATION 



The purification scheme developed to purify 
the recombinant osteogenic proteins of this invention 
is rapid and highly effective. The protocol involves 



wo 91/05802 



"42- 



PCT/US90/05903 



three chromatographic steps (S-Sepharose, 
phenyl^Sepharose and C-18 HPLC) / and produces OPl of 
about 90% purity. 

For a typical 2 L preparation of transfected 
BSC cells conditioned in 0.5% FCS, the total protein 
is 700 mg. The amount of OPl in the media, estimated 
by western blot, is about 80 OPl media is 

diluted to 6M urea, 0.05M NaCl, 13ntM HEPES, pH 7.0 
and loaded onto an S-Sepharose column, which has 
attached sulfite groups and acts as a strong cation 
exchanger. OPl binds to the column in low salt, and 
serum proteins are removed. The column is 
subsequently developed with two step salt elutions. 
The first elution (O.IM NaCl) removes contaminants 
and approximately 10% of the bound OPl. The 
remaining 90% of OPl then is eluted in 6M urea, 0.3M 
NaCl, 20mM HEPES, pH 7.0. 

Ammonium sulfate is added to the 0.3M NaCl 
fraction to obtain final solution conditions of 6M 
urea, IM (NH4)2S04, 0.3M NaCl, 20mM HEPES, pH 7.0. 
The sample then is loaded onto a phenyl-Sepharose 
column (hydrophobic interaction chromatography) . 
OPl binds phenyl-Sepharose in the presence of high 
concentrations of a weak chaotropic salt (e.g., IM 
(NH4)2S04). Once OPl is bound, the column is 
developed with two step elutions using decreasing 
concentrations of ammonium sulfate. The first 
elution (containing 0.6M (NH4)2S04) primarily removes 
contaminants. The bound OPl then is eluted with a 6M 
urea, 0.3M NaCl, 20MM HEPES, pH 7.0 buffer containing 
no ammonium sulfate. 



wo 91/05802 



43- 



PCT/US90/05903 



The OPl eluted from the phenyl-Sepharose 
column is dialyzed against water, followed by 30% 
acetonitrile (0.1% TFA), and then applied to a C-18 
reverse phase HPLC column. Figures 5A, .B, and C are 
(1) chromatograms and (2) coomassie-stained SDS-PAGE 
gels of fractions after reduction with dithiothreitol 
(DTT) eluting from the (A) S-Sepharose, (B) 
phenyl-Sepharose, and (C) C-18 columns. Gel 
separation of oxidized and reduced OPl samples show 
that the reduced subunit has an apparent molecular 
weight of about 18 kD, and the dimer has an apparent 
molecular weight of about 36 kD, as illustrated in 
Figure 6. The subunit size appears to be identical 
to that purified from COS cells, as well as that of 
the naturally-sourced bOP. The current protocol 
yields about 30 ug of OPl for 2 L of conditioned 
media, a recovery of about 25%, as estimated by gel 
scanning . 

An alternative chromatography protocol is to 
perform the S-Sepharose chromatography in the absence 
of 6 M urea. The bound proteins then are eluted with 
salt step elutions (e.g., 100-400 mM NaCl>. Most of 
the OPl is eluted with about 300 mM NaCl. Additional 
OPl then can be eluted with 300 mM MaCl in the 
presence of 6M urea. The 6M urea elution also may be 
used in place of the non-urea elution to achieve 
maximum recovery in one step. 

OPl also will bind hydroxyapatite 
efficiently, but only in the absence of 6 M urea and 
at low phosphate concentrations (less than 5 mM 
phosphate) . Bound OPl can be removed from the column 
with a step elution of 1 mM to 0.5M phosphate (in 0.5 



wo 91/05802 



44- 



PCr/US90/059G3 



M NaCl, 50 inM Tris, pH 7.0). OPl elutes at about 250 
mM phosphate. Additionally, urea (6M) may be added 
during the elution step. 

Other related chromatography methods also 
may be useful in purifying OPl from eukaryotic cell 
culture systems. For example, heparin-Sepharose may 
be used in combination with the S-Sepharose column. 
Alternatively, Cu^^-immobilized metal-ion affinity 
chromatography (IMAC) will bind OPl in a phosphate 
buffer (pH7.0) containing 6M urea. 

III. MATRIX PREPARATION 

Practice of the invention requires the 
availability of bone, preferably mammalian bone, 
e.g., bovine. The bone is cleaned, demarrowed, 
delipidated, demineralized, reduced to particles of 
an appropriate size, extracted to remove soluble 
proteins, sterilized, and otherwise treated as 
disclosed herein to produce an implantable material 
useful in a variety of clinical settings. 

Matrices of various shapes fabricated from 
the material of the invention may be implanted 
surgically for various purposes. Chief among these 
is to serve as a matrix for bone formation in various 
orthopedic, periodontal, and reconstructive 
procedures, as a sustained release carrier, or as a 
collagenous coating for implants. The matrix may be 
shaped as desired in anticipation of surgery or 
shaped by the physician or technician during 
surgery. Thus, the material may be used for topical, 
subcutaneous, intraperitoneal, or intramuscular 



wo 91/05802 



-45- 



PCr/US90/05903 



implants; it may be shaped to span a nonunion 
fracture or to fill a bone defect. In bone formation 
or conduction procedures, the material is slowly 
absorbed by the body and is replaced by bone in the 
shape of or very nearly the shape of the implant. 

Various growth factors, hormones, enzymes, 
therapeutic compositions, antibiotics, and other body 
treating agents also may be sorbed onto the carrier 
material and will be released over time when 
implanted as the matrix material is slowly absorbed. 
Thus, various known growth factors such as EGF, PDGF, 
IGF, FGF, TGF alpha, and TGF beta may be released in 
vivfi. The material can be used to release 
chemotherapeutic agents, insulin, enzymes, or enzyme 
inhibitors . 

Details of how to make and how to use the 
materials of the invention are disclosed below. 



1- Preparation of Dpmi.neraligpfl Bni^a 

Demineralized bovine bone matrix is prepared 
by previously published procedures (Sampath and Reddi 
(1983) Proc. Natl. Acad. Sci . USA M: 6591-6595) . 
Bovine diaphyseal bones (age 1-10 days) are obtained 
from a local slaughterhouse and used fresh. The 
bones are stripped of muscle and fat, cleaned of 
periosteum, demarrowed by pressure with cold water, 
dipped in cold absolute ethanol, and stored at 
-20»C. They are then dried and fragmented by 
crushing and pulverized in a large mill. Care is 



wo 91/05802 



-46- 



PCT/US90/05903 



taken to prevent heating by using liquid nitrogen. 
The pulverized bone is milled to a particle size in 
the range of 70-850 ]m, preferably 150 pin-420 |im, and 
is defatted by two washes of approximately two hours 
duration with three volumes of chloroform and 
methanol (3:1). The particulate bone is then washed 
with one volume of absolute ethanol and dried over 
one volume of anhydrous ether yielding defatted bone 
powder. The defatted bone powder is then 
demineralized by four successive treatments with 10 
volumes of 0.5 N HCl at 4**C for 40 rain. Finally, 
neutralizing washes are done on the demineralized 
bone powder with a large volume of water. 

2. Guanidine Extraction 

Demineralized bone matrix thus prepared is 
extracted with 5 volumes of 4 M guanidine-HCl, 50mM 
Tris-HCl, pH 7.0 for 16 hr. at 4**C. The suspension 
is filtered. The insoluble material is collected and 
used to fabricate the matrix. The material is mostly 
collagenous in nature. It is devoid of osteogenic or 
condrogenic activity. 

3. Mgtrix Tr?9tmgnt5 

The major component of all bone matrices is 
Type-I collagen. In addition to collagen, 
demineralized bone extracted as disclosed above 
includes non-collagenous proteins which may account 
for 5% of its mass. In a xenogenic matrix, these 
noncollagenous components may present themselves as 
potent antigens, and may constitute immunogenic 
and/or inhibitory components. These components also 



wo 91/05802 



-47- 



PCT/IJS90/0S903 



may inhibit osteogenesis in allogenic implants by 
interfering with the developmental cascade of bone 
differentiation. It has been discovered that 
treatment of the matrix particles with a collagen 
fibril-modifying agent extracts potentially unwanted 
components from the matrix, and alters the surface 
structure of the matrix material. 

The currently most preferred fibril 
modifying agent is a heated aqueous medium, most 
preferably water. Various amounts of delipidated, 
demineralized guanidine-extracted bone collagen is 
heated in water (1 g/30 ml) under constant stirring 
in a glass flask, water jacked, and maintained at a 
given temperature for 1 hour. In some instances the 
water may be replaced with O.IM acetic acid to help 
"swell" the collagen before heating. The temperature 
employed is held constant at room temperature, and 
about 37»C, 45''C, 55", 65", 75«. After the heat 
treatment, the matrix is filtered and lyophilized and 
used for implant. 

The effects of hot water treatment on 
morphology of the matrix material is apparent from a 
comparison of the photomicrographs in Figure 6 with 
those of Figure 1. Figure 6 illustrates the 
morphology of the successfully altered collagen 
surface treated at (a) 37-C, (b) 45»C, (c) 55»C and 
(d) 65»C. The photomicrographs of Figure 1 describe 
the morphology of untreated rat and bovine bone 
matrix (A and B, respectively). As is evident from 
the micrographs, the hot water treatment increases 
the degree of micropitting on the particle surface 
at least about 10-fold, as well as also substantially 



wo 91/05802 



-48- 



PCr/US90/05903 



increasing particle's porosity (compare Figure IB and 
5C, 5D) . This alteration of the matrix particle's 
morphology substantially increases the particle 
surface area. Careful measurement of the pore and 
micropit sizes reveals that hot aqueous medium 
treatment of the matrix particles yields particle 
pore and micropit diameters within the range of l^irn 
to 100pm. 

Characterization of the extract produced by 
the hot water treatment reveals that the treatment 
also may be removing component(s) whose association 
with the matrix may interfere with new bone formation 
in vivo . Figure 8 is a 214 nra absorbance tracing 
of the extract isolated from hot water treated bovine 
matrix/ and indicates the effect of each peak (or 
fraction) on in vivo bone formation. 

The extract from a large scale preparative 
run (100 g bovine matrix, hot water-treated) was 
collected, acidified with 0.1% TFA, and run on a C-18 
HPLC column, using a Millipore Delta Prep Cartridge, 
Fractions were collected at 50 mL intervals at a flow 
rate of 25 ml/min. and pooled appropriately to 
isolate the individual peaks in the tracing. Each of 
these fractions then was implanted with recombinant 
OPl and an appropriate rat matrix carrier (see 
infra), and its effect on bone formation activity 
measured. Fraction 12 alone appears to inhibit bone 
formation in allogenic implants. The inhibitory 
activity appears to be dose dependent. It is 
possible that the removal of the inhibitory 
component (s) present in this peak may be necessary to 
support osteogenic activity in xenogenic implants. 



wo 91/05802 



-49- 



PCT/US90/05903 



Figure 9 describes the influence of complete 
solvent extract from hot water-treated matrix on 
osteogenic activity as measured in 12-day implants, 
and determined by alkaline phosphatase activity and 
calcium content. Rat carrier matrix and OPl 
implanted without any extract is used as a positive 
control. The solvent extract obtained from 100 grams 
of hot water-treated bovine matrix was evaporated and 
taken up in 6 M of 50% acetonitrile/0 . 1% TFA. 
100-300 ]il aliqucts then were combined with known 
amounts of recombinant OPl, and 25 mg of rat matrix 
carrier, and assayed (see infra). The results 
clearly show the extract inhibits new bone formation 
in a dose dependent manner. 

After contact with the fibril-modifying 
agent, the treated matrix is washed to remove any 
extracted components, following a form of the 
procedure set forth below: 

1. Suspend in TBS (Tris-buf f ered saline) 
ig/200 ml and stir at 4»C for 2 hrs; or in 6 M urea, 
50 mM Tris-HCl, 500 mM NACl, pH 7.0 (UTBS) or water 
and stir at room temperature (RT) for 30 minutes 
(sufficient time to neutralize the pH) ; 

2. Centrifuge and repeat wash step; and 

3. Centrifuge; discard supernatant; water 
wash residue; and then lyophilize. 

Other useful fibril-modifying agents include 
acids such as trif luoroacetic acid and hydrogen 



wo 91/05802 



-50- 



PCr/US90/05903 



fluoride, and organic solvents such as 
dichloromethane, acetonitrile, isopropanol, and 
chloroform, as well as combinations of these agents. 
Matrix treatments using these other fibril-modifying 
agents, as well as a detailed physical analysis of 
the effect these fibril-modifying agents have on 
demineralized, guanidine-extracted bone collagen 
particles is disclosed in copending U.S. Patent 
Application No. 422,613, filed 10/17/89, the 
disclosure of which is hereby incorporated by 
reference. 

The collagen matrix materials preferably 
take the form of a fine powder, insoluble in water, 
comprising nonadherent particles. It may be used 
simply by packing into the volume where new bone 
growth or sustained release is desired, held in place 
by surrounding tissue. Alternatively, the powder may 
be encapsulated in, e.g., a gelatin or polylactic 
acid coating, which is adsorbed readily by the body. 
The powder may be shaped to a volume of given 
dimensions and held in that shape by interadhering 
the particles using, for example, soluble, species 
biocompatible collagen. The material may also be 
produced in sheet, rod, bead, or other macroscopic 
shapes • 



IV. FABRICATION OF OSTEOGENIC DEVICE 



The recombinant protein as set forth above, 
and other constructs, can be combined and dispersed 
in a suitable matrix preparation using any of the 
methods described below: 



wo 91/05802 



-51- 



PCr/US90/05903 



1. Ethanol Precipitation 

Matrix is added to osteogenic protein 
dissolved in guanidine-HCl . Samples are vortexed and 
incubated at a low temperature. Samples are then 
further vortexed. Cold absolute ethanol is added to 
the mixture which is then stirred and incubated. 
After centrifugation (microfuge, high speed) the 
supernatant is discarded. The matrix is washed with 
cold concentrated ethanol in water and then 
lyophilized. 

2. Acetonitrile Trif luoroacetic 
Acid Lyophilization 

In this procedure, osteogenic protein in an 
acetonitrile trif luroacetic acid (ACN/TFA) solution 
was added to the carrier material. Samples were 
vigorously vortexed many times and then lyophilized. 
Osteogenic protein was added in varying 
concentrations, and at several levels of purity. 
This method is currently preferred. 

3. Urea Lyophilization 

For those osteogenic proteins that are 
prepared in urea buffer, the protein is mixed with 
the matrix material, vortexed many times, and then 
lyophilized. The lyophilized material may be used 
"as is" for implants. 



wo 91/05802 



-52- 



PCr/US90/05903 



4. Buffered Saline Lyophilization 

OP preparations in physiological saline may 
also be vortexed with the matrix and lyophilized to 
produce osteogenically active material. 

These procedures also can be used to adsorb 
other active therapeutic drugs, hormones, and various 
bioactive species for sustained release purposes. 

V. BIOASSAY 

The functioning of the various matrices can 
be evaluated with an in vivo rat bioassay. Studies 
in rats show the osteogenic effect in an appropriate 
matrix to be dependent on the dose of osteogenic 
protein dispersed in the matrix. No activity is 
observed if the matrix is implanted alone. 
Demineralized, guanidine extracted xenogenic bone 
matrix materials of the type described in the 
literature are ineffective as a carrier, fail to 
induce bone, and produce an inflammatory and 
immunological response when implanted unless treated 
as disclosed above. Many of the allogenic matrix 
materials also are ineffective as carriers. The 
following sets forth various procedures for preparing 
osteogenic devices from control and matrix materials 
prepared as set forth above, and for evaluating their 
osteogenic utility. 

Imp^gntgt^pn 

The bioassay for bone induction as described 
by Sampath and Reddi (Proc. Natl. Acad. Sci. USA 
(1983) flfi: 6591-6595), herein incorporated by 
reference, may be used to monitor endochondral bone 



wo 9J/05802 



-53- 



PCT/US90/0S903 



differentiation activity. This assay consists of 
implanting the bovine test samples xenogenically in 
subcutaneous sites in recipient rats under ether 
anesthesia. Male Long-Evans rats, aged 28-32 days, 
were used. A vertical incision (1 cm) is made under 
sterile conditions in the skin over the thoraic 
region, and a pocket is prepared by blunt 
dissection. Approximately 25 mg of the test sample 
is implanted deep into the pocket and the incision is 
closed with a metallic skin clip. The day of 
implantation is designated as day of the experiment. 
Implants were removed on day 12. The heterotropic 
site allows for the study of bone induction without 
the possible ambiguities resulting from the use of 
orthotropic sites. 



Cellular EvPntp 



Successful implants exhibit a controlled 
progression through the stages of matrix induced 
endochondral bone development including: (l) 
transient infiltration by polymorphonuclear 
leukocytes on day one; (2) mesenchymal cell migration 
and proliferation on days two and three; (3) 
chondrocyte appearance on days five and six; (4) 
cartilage matrix formation on day seven; (5) 
cartilage calcification on day eight; (6) vascular 
invasion, appearance of osteoblasts, and formation of 
new bone on days nine and ten; (7) appearance of 
osteoblastic and bone remodeling and dissolution of 
the implanted matrix on days twelve to eighteen; and 
(8) hematopoietic bone marrow differentiation in the 
ossicle on day twenty-one. The results show that the 
shape of the new bone conforms to the shape of the 
implanted matrix. 



wo 91/05802 



-54- 



PCT/US90/05903 



Histological Evaluation 

Histological sectioning and staining is 
preferred to determine the extent of osteogenesis in 
the implants. Implants are fixed in Bouins Solution, 
embedded in paraffin, and cut into 6-8 ym sections • 
Staining with toluidine blue or hemotoxylin/eosin 
demonstrates clearly the ultimate development of 
endochondral bone. Twelve day implants are usually 
sufficient to determine whether the implants contain 
newly induced bone. 

Biological Markers 

Alkaline phosphatase activity may be used as 
a marker for osteogenesis. The enzyme activity may 
be determined spectrophotometrically 
after homogenization of the implant. The activity 
peaks at 9-10 days in vivo and thereafter slowly 
declines. Implants showing no bone development by 
histology have little or no alkaline phosphatase 
activity under these assay conditions. The assay is 
useful for quantitation and obtaining an estimate of 
bone formation quickly after the implants are removed 
from the rat. Alternatively, the amount of bone 
formation can be determined by measuring the calcium 
content of the implant. 

OPl from different cell sources and purified 
to different extents (1-5% pure to 30-90% pure) were 
tested for osteogenic activity in vivo as set forth 



wo 91/05802 



-55- 



PCr/US90/05903 



above using matrices of approximately 25 mg. Table 
III below shows the histology score for OPl expressed 
in all three cell types. 

TABLE III 



Mammalian OPl Protein Histology 

— Ceils — jgylpynit Concentration s Score 

(ng) (%) 

BSC40-tsA58 ISkDa* 32.5 50 

65.0 40 

130.0 80 

260.0 100 

16 kDa+ 12.5 20 

25.0 50 

50.0 80 

100.0 100 

200.0 100 

CHO 16-20 kDaS 50.0 90 

100.0 90 

200.0 100 

COS 18 kDaS 25.0 10 

50.0 30 

100.0 90 

200.0 90 



10-30%: moderate bone formation 
30-80%: extensive bone formation 
above 80%: showed sign of hemopoietic bone 
marrow recruitment. 



* 70-90% pure 

+ 30-40% pure 

^ less than 5% pure 

t estimated by immunoblots or gel scanning 

The histology scores detailed in Table III 
show that OPl is active regardless of cell source 



wo 91/05802 



-56- 



PCr/US90/05903 



and that the activity mimics that of native bovine 
OP. The bone-inducing activity is highly 
reproducible and dose dependent. Further evidence of 
the bone-forming activity of recombinant OPl is 
provided in the photomicrographs of Figures 10 and 11. 

Figure lOA-F are photomicrographs recording 
the histology of allogenic implants using recombinant 
OPl expressed from COS, BSC, and COS cells. The 
micrographs (magnified 220X) , provide graphic 
evidence of the full developmental cascade induced by 
the osteogenic proteins of this invention, confirming 
that recombinantly produced OPl alone is sufficient 
to induce endochondral bone formation, when implanted 
in association with a matrix. As evidenced in Figure 
lOA, allogenic implants that do not contain OPl show 
no new bone formation at 12 days' post implant. Only 
the implanted bone matrix (m> and surrounding 
mesenchyme are seen. Conversely, implants containing 
OPl already show evidence of extensive chodrogenesis 
by 7 days post implant (Fig. lOB, 500 ng BSC-produced 
protein, 30% pure). Here, newly formed cartilage 
cells, chrondroblasts (Cb) and chondrocytes (Cy) are 
in close contact with the matrix (m) . By 9 days post 
implant endochondral bone differentiation, cartilage 
calcification, hypertrophy of chondrocytes, vascular 
invasion, and the onset of new bone formation are all 
evident (Fig. IOC, 220 ng COS-produced protein, 
approx. 5% pure). Invading capillaries (c) and the 
appearance of basophilic osteoblasts (indicated by 
arrows) near the vascular endothelium are 
particularly evident. By 12 days post implant 
extensive bone formation and remodeling has occurred 
(Fig. lOD (220X), and lOE (400X), CHO-produced 



wo 91/05802 



-57- 



PCT/US90/05903 



protein, approx. 60% pure). The newly formed bone 
laid down by osteoblasts is being remodeled by 
multinucleated osteoclasts (Oc) , and the implanted 
matrix is being resorbed and replaced by remodeled 
bone. Bone marrow recruitment in the newly formed 
ossicles is also evident. Finally, hematopoietic 
bone marrow differentiation within the ossicles can 
be seen by 22 days' post implant (Fig. lOF, 500 ng 
BSC-produced protein, 30% pure) . By this time most 
of the implanted matrix (m) has been resorbed and is 
occupied by newly-formed bone containing ossicles 
filled with bone marrow elements including 
erythrocytic and granulocytic series and 
megakaryocytes. Similar histological observations 
have been made for implants incorporating greater 
than 90% pure OPl preparations. 

Figure 11 is a photomicrograph showing the 
histology at 12 days post implant for a xenogenic 
implant using hot water-treated bovine matrix and OPl 
(BSC-produced). The recruitment of hematopoietic 
bone marrow elements is evident in the 
photomicrograph, showing that the bone forming 
activity of xenogenic implants with OPl parallels 
that of allogenic implants (compare Figure 11 with 
Figures lOD and lOE) . 

The cellular events exhibited by the OPl 
matrix implants and evidenced in Figures 10 and 11 
truly mimics the endochondral bone differentiation 
that occurs during the foetal development. Although 
endochondral bone differentiation has been the 
predominant route, there is also evidence for 
intra-membraneous bone formation at the outer surface 
of the implant. 



wo 91/05802 



-58- 



PCT/US90/05903 



Figures 12 and 13 describe the dose 
dependence of osteogenic activity for 12-day 
implants, as determined by specific activity of 
alkaline phosphatase and calcium content of allogenic 
implants (Figure 12) and xenogenic implants of this 
invention (Figure 13) • In all cases, OPl protein 
concentration (quantitated by immuno blot staining or 
by gel scanning), is represented in nanograms. In 
each case, bone inducing activity is specific to OPl 
in a dose dependent manner in all cells. 

The invention may be embodied in other 
specific forms without departing from the spirit or 
essential characteristics thereof. The present 
embodiments are therefore to be considered in all 
respects as illustrative and not restrictive, the 
scope of the invention being indicated by the 
appended claims rather than by the foregoing 
description, and all changes which come within the 
meaning and range of equivalency of the claims are 
therefore intended to be embraced therein. 



-59- 



PCT/US90/05903 



SEQUENCE LISTING 
GENERAL INFORMATION: 

(i> APPLICANT: Oppermann, Hermann 

Kuberasampath, Thangavel 
Rueger, David C. 
Ozkaynak, Engin 
Pang, Roy H.L. 

(ii> TITLE OF INVENTION: Osteogenic Devic 

(iii) NXJMBER OF SEQUENCE: 7 

(iv) CORRESPONDENCE ADDRESS: 

(A) ADDRESSEE: Lahive & Cockfieia 

(B) STREET: 60 State Street 

(C) CITY: Boston 

<D) STATE: Massachusetts 

(E) COUNTRY: U.S.A. 

(F) ZIP: 02109 

(v) COMPUTER READABLE FORM: 

(A) MEDIUM TYPE: Diskette, 3.5 inch, 

720kb storage 

(B) COMPUTER: IBM XT 

(C) OPERATING SYSTEM: DOS 3.30 

(D) SOFTWARE: Word Perfect 5.0 

(vi) CURRENT APPLICATION DATA: 
(B) FILING DATE: 20-Aug-90 

(vii) PRIOR APPLICATION DATA: 

(A) APPLICATION NUMBER: US 422,699 

(B) FILING DATE: 17-Oct-89 

(C) APPLICATION NUMBER: US 483,913 

(D) FILING DATE: 22-Feb-89 



wo 91/05802 



-60- 



PCT/US90/05903 



(2) INFORMATION FOR SEQ ID N0:1: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 139 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:1: 

Ser Thr Gly Ser Lys Gin Arg Ser Gin 
1 5 

Asn Arg Ser Lys Thr Pro Lys Asn Gin 

10 15 

Glu Ala Leu Arg Met Ala Asn Val Ala 

20 25 

Glu Asn Ser Ser Ser Asp Gin Arg Gin 

30 35 

Ala Cys Lys Lys His Glu Leu Tyr Val 

40 45 

Ser Phe Arg Asp Leu Gly Trp Gin Asp 

50 

Trp lie lie Ala Pro Glu Gly Tyr Ala 

55 60 

Ala Tyr Tyr Cys Glu Gly Glu Cys Ala 

65 70 

Phe Pro Leu Asn Ser Tyr Met Asn Ala 

75 80 

Thr Asn His Ala He Val Gin Thr Leu 

85 90 

Val His Phe He Asn Pro Glu Thr Val 

95 

Pro Lys Pro Cys Cys Ala Pro Thr Gin 

100 105 

Leu Asn Ala He Ser Val Leu Tyr Phe 

110 115 



wo 91/05802 



-61- 



PCr/US90/05903 



Asp Asp Ser Ser Asn Val He Leu Lys 

Lys Tyr Arg Asn Met Val Val Arg Ala 
130 

Cys Gly Cys His. 



(2) INFORMATION FOR SEQ ID NO: 2: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 132 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2: 

Ser Gin 
1 

Asn Arg Ser Lys Thr Pro Lys Asn Gin 
5 10 

Glu Ala Leu Arg Met Ala Asn Val Ala 



15 



20 



Glu Asn Ser Ser Ser Asp Gin Arg Gin 

25 

Ala Cys Lys Lys His Glu Leu Tyr Val 



30 



35 



Ser Phe Arg Asp Leu Gly Trp Gin Asp 



40 



45 



Trp He lie Ala Pro Glu Gly Tyr Ali 



50 



55 



Ala Tyr Tyr Cys Glu Gly Glu Cys Ali 



60 



65 



Phe Pro Leu Asn Ser Tyr Met Asn Ala 

70 



wo 91/05802 



-62- 



PCr/US90/05903 



Thr Asn His Ala lie Val Gin Thr Leu 
75 80 

Val His Phe lie Asn Pro Glu Thr Val 
85 90 

Pro Lys Pro Cys Cys Ala Pro Thr Gin 
95 100 

Leu Asn Ala lie Ser Val Leu Tyr Phe 
105 110 

Asp Asp Ser Ser Asn Val lie Leu Lys 

115 

Lys Tyr Arg Asn Met Val Val Arg Ala 

120 125 

Cys Gly Cys His. 
130 



(2) INFORMATION FOR SEQ ID NO: 3: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 119 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3: 

Leu Arg Met Ala Asn Val Ala Glu Asn 
1 5 

Ser Ser Ser Asp Gin Arg Gin Ala Cys 
10 15 

Lys Lys His Glu Leu Tyr Val Ser Phe 
20 25 

Arg Asp Leu Gly Trp Gin Asp Trp lie 
30 35 

lie Ala Pro Glu Gly Tyr Ala Ala Tyr 

40 45 



! 

WO 91/05802 



-63- 



PCr/US90/0S903 



Tyr Cys Glu Gly Glu Cys Ala Phe Pro 

50 

Leu Asn Ser Tyr Met Asn Ala Thr Asn 

55 60 

His Ala He Val Gin Thr Leu Val His 
65 70 

Phe He Asn Pro Glu Thr Val Pro Lys 
75 80 

Pro Cys Cys Ala Pro Thr Gin Leu Asn 

85 90 

Ala He Ser Val Leu Tyr Phe Asp Asp 

95 

Ser Ser Asn Val He Leu Lys Lys Tyr 

100 105 

Arg Asn Met Val Val Arg Ala Cys Gly 
110 115 

Cys His . 



(2) INFORMATION FOR SEQ ID NO: 4: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 117 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

<ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:4 







Met 
1 


Ala 


Asn 


Val 


Ala 
5 


Glu 


Asn 


Ser 


Ser 


Ser 
10 


Asp 


Gin 


Arg 


Gin 


Ala 

15, 


Cys 


Lys 


Lys 


His 


Glu 
20 


Leu 


Tyr 


Val 


Ser 


Phe 
25 


Arg 


Asp 


Leu 


Gly 


Trp 


Gin 


Asp 


Trp 


He 



91/05802 



-64- 



PCr/US90/05903 



lie Ala Pro Glu 
35 

Tyr Cys Glu Gly 
45 

Leu Asn Ser Tyr 
55 

His Ala He Val 

65 

Phe He Asn Pro 

Pro Cys Cys Ala 
80 

Ala He Ser Val 
90 

Ser Ser Asn Val 
100 

Arg Asn Met Val 
110 

Cys His . 



Gly Tyr Ala Ala Tyr 
40 

Glu Cys Ala Phe Pro 
50 

Met Asn Ala Thr Asn 

60 

Gin Thr Leu Val His 

70 

Glu Thr Val Pro Lys 
75 

Pro Thr Gin Leu Asn 
85 

Leu Tyr Phe Asp Asp 
95 

He Leu Lys Lys Tyr 
105 

Val Arg Ala Cys Gly 

115 



(2) INFORMATION FOR SEQ ID NO: 5: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 116 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(zi) SEQUENCE DESCRIPTION: SEQ ID NO: 5: 

Ala Asn Val Ala Glu Asn 
1 5 

Ser Ser Ser Asp Gin Arg Gin Ala Cys 

10 15 

Lys Lys His Glu Leu Tyr Val Ser Phe 

20 



wo 91/05802 

PCT/US90/05903 

-65- 

Arg Asp Leu Gly Trp Gin Asp Trp He 



25 



70 



30 



He Ala Pro Glu Gly Tyr Ala Ala Tyr 



35 



40 



Tyr Cys Glu Gly Glu Cys Ala Phe Pro 



45 



50 



Leu Asn Ser Tyr Met Asn Ala Thr Asn 

55 60 
His Ala He Val Gin Thr Leu Val His 



65 



Phe He Asn Pro Glu Thr Val Pro Lys 



75 



Pro Cys Cys Ala Pro Thr Gin Leu Asn 
80 85 

Ala He Ser Val Leu Tyr Phe Asp Asp 
90 95 

Ser Ser Asn Val He Leu Lys Lys Tyr 
100 105 

Arg Asn Met Val Val Arg Ala Cys Gly 

110 

Cys His . 
115 



(2) INFORMATION FOR SEQ ID NO: 6: 

<i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 114 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 



wo 91/05802 



-66- 



PCr/US90/05903 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6: 

Val Ala Glu Asn Ser Ser Ser Asp Gin 
1 5 

Arg Gin Ala Cys Lys Lys His Glu Leu 
10 15 

Tyr Val Ser Phe Arg Asp Leu Gly Trp 
20 25 

Gin Asp Trp He He Ala Pro Glu Gly 
30 35 

Tyr Ala Ala Tyr Tyr Cys Glu Gly Glu 

40 45 

Cys Ala Phe Pro Leu Asn Ser Tyr Met 

50 

Asn Ala Thr Asn His Ala He Val Gin 

55 60 

Thr Leu Val His Phe He Asn Pro Glu 
65 70 

Thr Val Pro Lys Pro Cys Cys Ala Pro 
75 80 

Thr Gin Leu Asn Ala He Ser Val Leu 

85 90 

Tyr Phe Asp Asp Ser Ser Asn Val He 

95 

Leu Lys Lys Tyr Arg Asn Met Val Val 

100 105 

Arg Ala Cys Gly Cys His . 
110 



(2) INFORMATION FOR SEQ ID NO: 7: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 1822 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 



wo 91/05802 



-67- 



PCT/US90/05903 



(ii) MOLECULE TYPE: cDNA to mRNA 

(iii) HYPOTHETICAL: no 

(iv) ANTI-SENSE: no 

(vi) ORIGINAL SOURCE: 

(A) ORGANISM: Bovinae 
(F) TISSUE TYPE: bone 

(vii) IMMEDIATE SOURCE: 

(A) LIBRARY: human placenta 
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7: 

GGTGCGGGCC CGGAGCCCGG AGCCCGGGTA GCGCGTAGAG 40 

CCGGCGCG ATG CAC GTG CGC TCA CTG CGA GCT GCG 75 
Met His Val Arg Ser Leu Arg Ala Ala 
1 5 

GCG CCG CAC AGC TTC GTG GCG CTC TGG GCA CCC 108 
Ala Pro His Ser Phe Val Ala Leu Trp Ala Pro 
10 15 20 

CTG TTC CTG CTG CGC TCC GCC CTG GCC GAC TTC 141 
Leu Phe Leu Leu Arg Ser Ala Leu Ala Asp Phe 

25 30 
AGC CTG GAC AAC GAG GTG CAC TCG AGC TTC ATC 174 
Ser Leu Asp Asn Glu Val His Ser Ser Phe He 
35 40 

CAC CGG CGC CTC CGC AGC CAG GAG CGG CGG GAG 207 
His Arg Arg Leu Arg Ser Gin Glu Arg Arg Glu 
45 50 

ATG CAG CGC GAG ATC CTC TCC ATT TTG GGC TTG 24 0 
Met Gin Arg Glu He Leu Ser He Leu Gly Leu 
55 60 

CCC CAC CGC CCG CGC CCG CAC CTC CAG GGC AAG 273 
Pro His Arg Pro Arg Pro His Leu Gin Gly Lys 
65 70 75 



wo 91/05802 



-68- 



PCr/US90/05903 



CAC AAC TCG GCA 
His Asn Ser Ala 

TAG AAC GCC ATG 

Tyr Asn Ala Met 
90 

GCC GGG GGG GAG 

Pro Gly Gly Gin 
100 

GCC GTC TTG AGT 

Ala Val Phe Ser 
110 

AGG CTG CAA GAT 
Ser Leu Gin Asp 
120 

GAG ATG GTC ATG 
Asp Met Val Met 

CAT GAG AAG GAA 

His Asp Lys Glu 
145 

GAT GGA GAG TTG 

His Arg Glu Phe 
155 

GCA GAA GGG GAA 

Pro Glu Gly Glu 
165 

GGG ATC TAG AAG 
Arg lie Tyr Lys 
175 

GAG AAT GAG AGG 
Asp Asn Glu Thr 

GTG CTG GAG GAG 



GCC ATG TTG ATG 
Pro Met Phe Met 
80 

GGG GTG GAG GAG 
Ala Val Glu Glu 

GGG TTG TCG TAG 

Gly Phe Ser Tyr 
105 

AGG GAG GGG CCC 

Thr Gin Gly Pro 
115 

AGG CAT TTG GTC 
Ser His Phe Leu 
125 

AGG TTG GTG AAC 
Ser Phe Val Asn 
135 

TTG TTC CAC CCA 
Phe Phe His Pro 

GGG TTT GAT GTT 

Arg Phe Asp Leu 
160 

GCT GTG AGG GGA 

Ala Val Thr Ala 
170 

GAG TAG ATG GGG 

Asp Tyr lie Arg 
180 

TTG GGG ATG AGG 

Phe Arg lie Ser 
190 

GAG TTG GGG AGG 



GTG GAG CTG 306 
Leu Asp Leu 
85 

GGG GGG GGG 339 

Gly Gly Gly 
95 

GCC TAG AAG 372 
Pro Tyr Lys 

GCT GTG GCC 405 
Pro Leu Ala 

AGG GAG GGG 438 

Thr Asp Ala 
130 

GTC GTG GAA 471 

Leu Val Glu 
140 

GGG TAG CAC 504 

Arg Tyr His 
150 

TCG AAG ATG 537 
Ser Lys lie 

GCC GAA TTG 570 
Ala Glu Phe 

GAA GGG TTG 603 

Glu Arg Phe 
185 

GTT TAT CAG 63 6 

Val Tyr Gin 
195 

GAA TGG GAT 669 



wo 91/05802 



-69- 



PCr/US90/05903 



Val Leu Gin Glu 
200 

CTC TTC CTG CTC 
Leu Phe Leu Leu 
210 

TCG GAG GAG GGC 

Ser Glu Glu Gly 
220 

GCC ACC AGC AAC 

Ala Thr Ser Asn 
230 

CAC AAC CTG GGC 
His Asn Leu Gly 

CTG GAT GGG CAG 
Leu Asp Gly Gin 
255 

GGC CTG ATT GGG 
Gly Leu He Gly 
265 

CAG CCC TTC ATG 
Gin Pro Phe Met 
275 

GAG GTC CAC TTC 

Glu Val His Phe 
285 

AGC AAA CAG CGC 
Ser Lys Gin Arg 

CCC AAG AAC CAG 
Pro Lys Asn Gin 
310 

GTG GCA GAG AAC 



His Leu Gly Arg 

GAC AGC CGT ACC 
Asp Ser Arg Thr 
215 

TGG CTG GTG TTT 

Trp Leu Val Phe 
225 

CAC TGG GTG GTC 

His Trp Val Val 
235 

CTG CAG CTC TCG 

Leu Gin Leu Ser 
245 

AGC ATC AAC CCC 
Ser He Asn Pro 

CGG CAC GGG CCC 
Arg His Gly Pro 
270 

GTG GCT TTC TTC 
Val Ala Phe Phe 
280 

CGC AGC ATC CGG 
Arg Ser He Arg 
290 

AGC CAG AAC CGC 

Ser Gin Asn Arg 
300 

GAA GCC CTG CGG 
Glu Ala Leu Arg 

AGC AGC AGC GAC 



Glu Ser Asp 
205 

CTC TGG GCC 702 
Leu Trp Ala 

GAC ATC ACA 735 
Asp He Thr 

AAT CCG CGG 768 
Asn Pro Arg 
240 

GTG GAG ACG 801 
Val Glu Thr 
250 

AAG TTG GCG 834 

Lys Leu Ala 
260 

CAG AAC AAG 867 
Gin Asn Lys 

AAG GCC ACG 900 
Lys Ala Thr 

TCC ACG GGG 933 
Ser Thr Gly 
295 

TCC AAG ACG 966 
Ser Lys Thr 
305 

ATG GCC AAC 999 

Met Ala Asn 
315 

CAG AGG CAG 1032 



wo 91/05802 



-70- 



PCr/US90/0S903 



Val Ala Glu Asn Ser Ser Ser Asp Gin Arg Gin 
320 325 

GCC TGT AAG AAG CAC GAG CTG TAT GTC AGC TTC 1065 

Ala Cys Lys Lys His Glu Leu Tyr Val Ser Phe 
330 335 

CGA GAC CTG GGC TGG CAG GAG TGG ATC ATC GCG 1098 

Arg Asp Leu Gly Trp Gin Asp Trp lie lie Ala 
340 345 350 

OCT GAA GGC TAC GCC GCC TAC TAC TGT GAG GGG 1131 
Pro Glu Gly Tyr Ala Ala Tyr Tyr Cys Glu Gly 

355 360 

GAG TGT GCC TTC CCT CTG AAC TCC TAC ATG AAC 1164 

Glu Cys Ala Phe Pro Leu Asn Ser Tyr Met Asn 
365 370 

GCC ACC AAC CAC GCC ATC GTG CAG ACG CTG GTC 1197 
Ala Thr Asn His Ala lie Val Gin Thr Leu Val 
375 380 

CAC TTC ATC AAC CCG GAA ACG GTG CCC AAG CCC 1230 
His Phe lie Asn Pro Glu Thr Val Pro Lys Pro 
385 390 

TGC TGT GCG CCC ACG CAG CTC AAT GCC ATC TCC 1263 

Cys Cys Ala Pro Thr Gin Leu Asn Ala lie Ser 
395 400 405 

GTC CTC TAC TTC GAT GAC AGC TCC AAC GTC ATC 1296 

Val Leu Tyr Phe Asp Asp Ser Ser Asn Val lie 

410 415 

CTG AAG AAA TAC AGA AAC ATG GTG GTC CGG GCC 1329 

Leu Lys Lys Tyr Arg Asn Met Val Val Arg Ala 
420 425 

TGT GGC TGC CAC TAGCTCCTCC GAGAATTCAG 1361 

Cys Gly Cys His 
430 

ACCCTTTGGG GCCAAGTTTT TCTGGATCCT CCATTGCTCG 1401 



wo 91/05802 

PCr/US90/05903 

-71- 

CCTTGGCCAG GAACCAGCAG ACCAACTGCC TTTTGTGAGA 1441 
CCTTCCCCTC CCTATCCCCA ACTTTAAAGG TGTGAGAGTA 14 81 
TTAGGAAACA TGAGCAGCAT ATGGCTTTTG ATCAGTTTTT 1521 
CAGTGGCAGC ATCCAATGAA CAAGATCCTA CAAGCTGTGC 1561 
AGGCAAAACC TAGCAGGAAA AAAAAACAAC GCATAAAGAA 1601 
AAATGGCCGG GCCAGGTCAT TGGCTGGGAA GTCTCAGCCA 1641 
TGCACGGACT CGTTTCCAGA GGTAATTATG AGCGCCTACC 1681 
AGCCAGGCCA CCCAGCCGTG GGAGGAAGGG GGCGTGGCAA 1721 
GGGGTGGGCA CATTGGTGTC TGTGCGAAAG GAAAATTGAC 1761 
CCGGAAGTTC CTGTAATAAA TGTCACAATA AAACGAATGA 1801 
ATGAAAAAAA AAAAAAAAAA A ^^^2 



wo 91/05802 



-72- 



PCr/US90/05903 



What is claimed is: 

1. An osteogenic device for implantation in a 

mammal, the device comprising: 

a biocompatible, in vivo biodegradable 
matrix of mineral-free, delipidated Type I insoluble 
bone collagen particles, depleted in noncollagenous 
protein; and 

a protein produced by the expression of 
recombinant DNA in a mammalian host cell, the protein 
comprising two oxidized subunits, the amino acid 
sequence of each subunit being sufficiently 
duplicative of the amino sequence (Seq. ID No. 6): 

0P1-16V 

30 

V A E N S 

40 



s 


s 


D 


Q R 
50 


Q 


A 


C 


K K 


H 


E 


L 


Y V 
60 


s 


F 


R 


D L 


G 


W 


Q 


D W 
70 


I 


I 


A 


P E 


G 


Y 


A 


A Y 
80 


Y 


C 


E 


G E 


C 


A 


F 


P L 
90 


N 


S 


y 


M N 


A 


T 


N 


H A 
100 


I 


V 


Q 


T L 


V 


H 


F 


I N 
110 


P 


E 


T 


V P 


K 


P 


c 


C A 
120 


P 


T 


Q 


L N 


A 


I 


S 


V L 
130 


Y 


F 


D 


D S 


S 


N 


V 


I L 


K 


K 


Y 


R N 


M 


V 


V 


R A 



C G C H, 



such that the dimeric species comprising 
said subunits has a conformation that is capable of 
inducing endochondral bone formation in a mammal when 
disposed within said matrix and implanted in said 
mammal • 



wo 91/05802 



-73- 



PCT/US90/05903 



2* An osteogenic protein expressed from 

recombinant DNA in a mammalian host cell and capable 
of inducing endochondral bone formation in a mammal 
when disposed within a matrix implanted in said 
mammal; 

a protein produced by the expression of 
recombinant DNA in a mammalian host cell, the protein 
comprising two oxidized subunits, the amino acid 
sequence of each subunit being sufficiently 
duplicative of the amino sequence (Seq. ID No. 6): 

0P1-16V 

30 



















V 


A 


E 


N S 
















40 










s 


s 


D 


Q R 
50 


Q 


A 


C 


K K 


H 


E 


L 


Y V 
60 


s 


F 


R 


D L 


G 


W 


Q 


D W 
70 


I 


I 


A 


P E 


G 


Y 


A . 


A Y 


Y 


C 


E 


G E 


C 


A 


F 


P L 


N 






80 
















90 


S 


Y 


M N 


A 


T 


N 


H A 
100 


I 


V 


Q 


T L 


V 


H 


F 


I N 
110 


P 


E 


T 


V p 


K 


P 


C 


C A 
120 


P 


T 


Q 


L N 


A 


I 


S 


V L 
130 


Y 


F 


D 


D S 


S 


N 


V 


I L 


K 


K 


Y 


R N 


M 


V 


V 


R A 



C G C H, 



such that the dimeric species comprising 
said subunits has a conformation that is capable of 
inducing endochondral bone formation in a mammal when 
disposed within said matrix and implanted in said 
mamma 1 . 



wo 91/05802 



-74- 



PCr/US90/05903 



3. The invention of claim 1 or 2 wherein the 

amino acid sequence of each said subunit has at least 
70% homology with the amino acid sequence (Seq. ID 
N0.6) : 

OP1-16V 

30 

V A E N S 

40 



s 


s 


D 


Q R 


Q 


A 


C 


K K 


H 


E 


L 


Y V 








50 
















60 


s 


F 


R 


D L 


G 


W 


Q 


D W 


I 


I 


A 


P E 
















70 










G 


y 


A 


A Y 


Y 


C 


E 


G E 


C 


A 


F 


P L 








80 
















90 


N 


s 


Y 


M N 


A 


T 


N 


H A 


I 


V 


Q 


T L 
















100 










V 


H 


F 


I N 


P 


E 


T 


V P 


K 


P 


C 


C A 








110 
















120 


P 


T 


Q 


L N 


A 


I 


S 


V L 


Y 


F 


D 


D S 














130 










S 


N 


V 


I L 


K 


K 


Y 


R N 


M 


V 


V 


R A 


c 


G 


c 


H. 



















4. The invention of claim 1 or 2 wherein 

the amino acid sequence of each said subunit has 
at least 80% homology with the amino acid 
sequence (Seq. ID No. 6): 



0P1-16V 



30 

V A E N S 

40 

SSDQRQACKKHELYV 
50 60 
SFRDLGWQDWI lAPE 

70 

GYAAYYCEGECAFPL 



wo 91/05802 



-75- 



PCr/US90/05903 



80 90 

NSYMNATNHAIVQTL 

100 

VHFINPETVPKPCCA 

120 

PTQLNAISVLYFDDS 

130 

SNVILKKYRNMVVRA 
C G C H. 



^- The invention of claim 1 or 2 wherein the 

amino acid sequence of each said subunit comprises 
(Seq. ID No. 6) : 

0P1-16V 



30 

V A E N S 

40 

SSDQRQACKKHELYV 

60 
P E 



50 

SFRDLGWQDWI lA 

70 

GYAAYYCEGECA 



80 



FPL 
90 



NSYMNATNHAIVQTL 

100 

VHFINPETVPKPC 
110 

PTQLNAISVLYF 



C A 
120 
D D S 



130 

SNVILKKYRNMVVRA 
C G C H. 



6. The invention of claim 1 or 2 wherein the 

amino acid sequence of said subunit comprises (Seq, 
ID No.l) : 



wo 91/05802 PCr/US90/05903 

-76- 

OPl-18 

1 10 



s 


T 


G 


S K 


Q 


R 


S 


Q N 


R 


S 


K 


T P 

<3 u 


K 


N 


Q 


E A 


L 


R 


M 


A N 


V 


A 


E 


N S 


S 


S 


D 


Q R 

C A 
0\J 


Q 


A 


C 


K K 


H 


E 


L 


Y V 

AH 
D V 




r 


K 


T\ T 


n 
o 




o 

V 


70 


T 
X 


T 
X 


A 

n 


P F 

XT £* 


G 


Y 


A 


A Y 
80 


Y 


C 


E 


G E 


c 


A 


F 


P L 
90 


N 


S 


Y 


M N 


A 


T 


N 


H A 
100 


I 


V 


Q 


T L 


V 


H 


F 


I N 
110 


P 


E 


T 


V P 


K 


P 


C 


C A 
120 


P 


T 


Q 


L N 


A 


I 


S 


V L 
130 


Y 


F 


D 


D S 


S 


N 


V 


I L 


K 


K 


Y 


R N 


M 


V 


V 


R A 



C G C H. 



7. The invention of claim 1 or 2 wherein 

the amino acid sequence o£ each said subunit 
comprises (Seg. ID No. 2): 

8 10 















S 


Q N 


R 


S 


K 


T P 








20 
















30 


K 


N 


Q 


E A 


L 


R 


M 


A N 
40 


V 


A 


E 


N S 


S 


S 


D 


Q R 
50 


Q 


A 


C 


K K 


H 


E 


L 


Y V 
60 


S 


F 


R 


D L 


G 


W 


Q 


D W 
70 


I 


I 


A 


P E 


G 


Y 


A 


A Y 
80 


Y 


C 


E 


G E 


C 


A 


F 


P L 
90 


N 


S 


Y 


M N 


A 


T 


N 


H A 
100 


I 


V 


Q 


T L 


V 


H 


F 


I N 
110 


P 


E 


T 


V P 


K 


P 


c 


C A 
120 


P 


T 


Q 


L N 


A 


I 


S 


V L 
130 


Y 


F 


D 


D S 


S 


N 


V 


I L 


K 


K 


Y 


R N 


M 


V 


V 


R A 



C G C H. 



-77- 



PCr/US90/05903 



8. The invention of claim 1 or 2 wherein 

the amino acid sequence of each said subunit 
comprises (Seq. ID No. 3): 

0P1-16L 

21 30 











L 


R 


H 


A N 
40 


V 


A 


E 


N S 


s 


S 


D 


Q R 
50 


Q 


A 


C 


K K 


H 


E 


L 


y V 

60 


s 


F 


R 


D L 


G 


W 


Q 


D W 
70 


I 


I 


A 


F E 


G 


y 


A 


A y 
80 


y 


C 


E 


G E 


C 


A 


F 


P L 
90 


N 


s 


y 


M N 


A 


T 


N 


H A 
100 


I 


V 


Q 


T L 


V 


H 


F 


I N 
110 


P 


E 


T 


V P 


K 


P 


C 


C A 
120 


P 


T 


Q 


L N 


A 


I 


S 


V L 
130 


y 


F 


D 


D S 


S 


N 


V 


I L 


K 


K 


y 


R N 




V 


V 


R A 



C G C H. 



9. The invention of claim 1 or 2 wherein 

the amino acid sequence of each of said subunit 
comprises (Seq. ID No. 4): 



0P1-16M 

















23 












30 
















M 


A N 
40 


V 


A 


E 


N 


s 


s 


S 


D 


Q 


R 
50 


Q 


A 


C 


K K 


H 


E 


L 


y 


V 
60 


s 


F 


R 


D 


L 


G 


W 


Q 


D W 
70 


I 


I 


A 


p 


E 


G 


y 


A 


A 


y 

80 


y 


C 


E 


G E 


C 


A 


F 


p 


L 
90 


N 


s 


y 


M 


N 


A 


T 


N 


H A 
100 


I 


V 


Q 


T 


L 


V 


H 


F 


I 


N 


P 


E 


T 


V P 


K 


P 


C 


c 


A 



wo 91/05802 



- 78 - 



PCr/US90/05903 



110 120 
PTQLNAISVLYFDDS 

130 

SNVILKKYRNMVVRA 
C G C H. 



10. The invention of claim 1 or 2 wherein 

the amino acid sequence of each of said subunit 
comprises (Seq. ID No. 5): 



24 30 

















A N 


V 


A 


E 


N S 
















40 










s 


S 


D 


Q R 


Q 


A 


C 


K K 


H 


E 


L 


Y V 








50 
















60 


s 


F 


R 


D L 


G 


W 


Q 


D W 


I 


I 


A 


P E 
















70 










G 


Y 


A 


A Y 


Y 


C 


E 


G E 


C 


A 


F 


P L 








80 
















90 


N 


S 


Y 


N N 


A 


T 


N 


.H A 


I 


V 


Q 


T L 
















100 










V 


H 


F 


I N 


P 


E 


T 


V P 


K 


P 


C 


C A 








110 
















120 


P 


T 


Q 


L N 


A 


I 


S 


V L 


Y 


F 


D 


D S 
















130 










S 


N 


V 


I L 


K 


K 


Y 


R N 


M 


V 


V 


R A 


C 


G 


c 


H. 



















11. The invention of claim 1 or 2 wherein 
said protein has an apparent molecular weight of 
about 30 kD when oxidized, as determined by 
comparison to molecular weight standards in 
SDS-polyacrylamide gel electrophoresis. 

12. The invention of claim 1 or 2 wherein * 
said protein has an apparent molecular weight of 

about 36 kD when oxidized, as determined by » 
comparison to molecular weight standards in 
SDS-polyacrylamide gel electrophoresis. 



- 79 . 



PCT/US90/05903 



13. The invention of claim 1 or 2 wherein 
said protein is unglycosylated. 

14. The invention of claim 1 or 2 wherein 
said mammalian host cell is a Chinese hamster 
ovary cell. 

15. The invention of claim 1 or 2 wherein 
said mammalian host cell is a simian kidney cell. 

16. A biocompatible, in vivo biodegradable 
matrix for implantation in a mammal comprising 
demineralized, delipidated. Type I insoluble 
bone collagen particles, depleted in 
noncollagenous protein, and treated with a hot 
aqueous medium having a temperature above about 
37*C in an amount and for a time sufficient to 
alter the morphology of said particles. 

17. The invention of claim 1 or 16 wherein 
said matrix is treated with a hot aqueous medium 
having a temperature within the range of 37**C to 
65*C. 

18. The invention of claim 1 or 16 wherein 
said matrix is treated with a hot aqueous medium 
having a temperature within the range of 45®C to 
60*»C. 

19. The invention of claim 1 or 16 wherein 
said matrix is treated to increase the number of 
pores and micropits on said collagen particles 
at least 3-fold. 



wo 91/05802 



-80- 



PCr/US90/05903 



20. The invention of claim 1 or 16 wherein 
said matrix is treated to increase the number of 
pores and micropits on said collagen particles 
at least 10-fold. 

21. The invention of claim 1 or 16 wherein 

said bone collagen particles comprise pores or ' 
micropits having a mean diameter within the 
range of l]m to lOOym. 

22. The invention of claim 1 or 16 wherein 
said collagen particles have a mean diameter 
within the range of 70 mm to 420 mm. 

23. Osteogenic protein expressed from 
recombinant DNA in a mammalian host cell, said 
protein comprising two oxidized subunits 
constituting a dimeric species, the amino acid 
sequence of said subunits having sufficient 
homology with the amino acid sequence encoded by 
the gene of Figure 2 (Seq. ID No. 7) such that 
said dimeric species is capable of inducing bone 
or cartilage formation when implanted in a 
mammal in association with a matrix. 

24. A biocompatible, in vivo biodegradable 
matrix for implantation in a mammal comprising 
demineralized, delipidated, Type-I insoluble 
bone collagen particles, depleted in a material 
comprising fraction 12 identified in Figure 8. 



PCT/US90/05903 




FIG. 1A 




FIG. IB 

SUBSTITUTE SHEET 



PCT/US90/05903 



2/20 

10 20 30 40 50 60 

GGTGCGGGCCCGGAGCCCGGAGCCCfiSiaTAGCGCGTAGAGCCGGCGCGATGCACGTGCGC 

Smal M H V R 

70 80 90 100 110 120 

TCACTGCGAGCTGCGGCGCCGCACAGCTTCGTGGCGCTCTGGGCACCCCTGTTCCTGCTG 
SLRAAAPHSFVALWAPLFLL 
130 140 150 160 170 180 

CGCTCCGCCCTGGCCGACTTCAGCCTGGACAACGAGGTGCACTCGAGCTTCATCCACCGG 
R SALAD FSLDNEVHSSFIHR 

190 200 210 220 230 240 

CGCCTCCGCAGCCAGGAGCGGCGGGAGATGCAGCGCGAGATCCTCTCCATTTTGGGCTTG 
RLRSQERREMQREILSILGL 
250 260 270 280 290 300 

CCCCACCGCCCGCGCCCGCACCTCCAGGGCAAGCACAACTCGGCACCCATGTTCATGCTG 
PHRPRPHLQGKHNSAPMFML 
310 320 330 340 350 360 

GACCTGTACAACGCCATGGCGGTGGAGGAGGGCGGCGGGCCCGGCGGCCAGGGCTTCTCC 
DLYNAMAVEEGGGPGGQGFS 
370 380 390 400 410 420 

TACCCCTACAAGGCCGTCTTCAGTACCCAGGGCCCCCCTCTGGCCAGCCTGCAAGATAGC 
YPYKAVFSTQGPPLASLQDS 
430 440 450 460 470 480 

CATTTCCTCACCGACGCCGACATGGTCATGAGCTTCGTCAACCTCGTGGAACATGACAAG 
HFLTDADMVMSFVNLVEHDK 
490 500 510 520 530 540 

GAATTCTTCCACCCACGCTACCACCATCGAGAGTTCCGGTTTGATCTTTCCAAGATCCCA 
EFFHPRYHHREPRFDLSKI P 
550 560 570 580 590 600 

GAAGGGGAAGCTGTCACGGCAGCCGAATTCCGGATCTACAAGGACTACATCCGGGAACGC 
EGEAVTAAEFRIYKDYIRER 
610 620 630 640 650 660 

TTCGACAATGAGACGTTCCGGATCAGCGTTTATCAGGTGCTCCAGGAGCACTTGGGCAGG 
FDNETFRISVYQVLQEHLGR 
670 680 690 700 710 720 

GAATCGGATCTCTTCCTGCTCGACAGCCGTACCCTCTGGGCCTCGGAGGAGGGCTGGCTG 
ESDLFLLDSRTLWASEEGWL 
730 740 750 760 770 780 

GTGTTTGACATCACAGCCACCAGCAACCACTGGGTGGTCAATCCGCGGCACAACCTGGGC 
VFDITATSNHWVVNPRHNLG 
790 800 810 820 830 840 

CTGCAGCTCTCGGTGGAGACGCTGGATGGGCAGAGCATCAACCCCAAGTTGGCGGGGCTG 
LQLSVETLDGQSINPKLAGL 
850 860 870 880 890 900 

ATTGGGCGGCACGGGCCCCAGAACAAGCAGCCCTTCATGGTGGCTTTCTTCAAGGCCACG 
IGRHGPQNKQPFMVAFFKAT 
910 920 930 940 950 960 

GAGGTCCACTTCCGCAGCATCCGGTCCACGGGGAGCAAACAGCGCAGCCAGAACCGCTCC 
EVHFRSIRSTGSKQRSQNRS 

' > 

« ^''^ 990 1000 1010 1020 

AAGACGCCCAAGAACCAGGAAGCCCTGCGGATGGCCAACGTGGCAGAGAACAGCAGCAGC 
KTPKNQEALRMANVAENSSS 
1030 1040 1050 1060 1070 1080 



riG. 2-1 

SUBSTITUTE SHEET 



wo 91/05802 



PCT/US90/05903 



3/20 

GACCAGAGGCAGGCCTGTAAGAAGCACGAGCTGTATGTCAGCTTCCGAGACCTGGGCTGG 

° ,5n«° ACKKHELYVSFRDLGW 
1090 1100 1110 1120 1130 1140 

CAGGACTGGATCATCGCGCCTGAAGGCTACGCCGCCTACTACTGTGAGGGGGAGTGTGCC 
° lAPEGYAAYYCEGECA 
1150 1160 1170 1180 1190 1200 

TTCCCTCTGAACTCCTACATGAACGCCACCAACCACGCCATCGTGCAGACGCTGGTCCAC 
,o,/^^^"^^NHA IVQTLVH 
1210 1220 1230 1240 1250 ISfiO 

TTCATCAACCCGGAAACGGTGCCCAAGCCCTGCTGTGCGCCCACGCAGCTCAATGCCATC 
1270 ^ PK PCCAPTQLNAI 

1270 1280 1290 1300 1310 T^9n 

TCCGTCCTCTACTTCGATGACAGCTCCAACGTCATCCTGAAGAAATACAGAAA^^^ 

l5;-in SSNVILKKYRNMV 
1330 1340 1350 1360 1370 1380 

GTCCGGGCCTGTGGCTGCCACTAGCTCCTCCGAGAATTCAGACCCTTTGGGGCCAAGTTT 
VRACGCH.* 

1390 1400 1410 1420 1430 1440 

TTCTSiS^TCCATTGCTCGCCTTGGCCAGGAACCAGCAGACCAACTGCCTTTTGTGAG 
BdtnHl 

1450 1460 1470 1480 1490 1500 

ACCTTCCCCTCCCTATCCCCAACTTTAAAGGTGTGAGAGTATTAGGAAACATGAGCAGCA 
1510 1520 1530 1540 1550 iSfio 

TATGGCTTTTGATCAGTTTTTCAGTGGCAGCATCCAATGAACAAGATCCTACAAGCTOT^ 
1570 1580 1590 1600 1610 1620 

CAGGCAAAACCTAGCAGGAAAAAAAAACAACGCATAAAGAAAAATGGCCGGGCCAGGTCA 
1630 1640 1650 1660 1670 IfiftO 

TTGGCTGGGAAGTCTCAGCCATGCACGGACTCGTTTCCAGAGGTAATTATGAGCGCCTAC 
iJJS^o ^"720 1730 1740 



CAGCCAGGCCACCCAGCCGTGGGAGGAAGGGGGCGTGGCAAGGGGTGGGCACATTGGTGT 
1750 1760 1770 1780 17Qn lann 

CTGTGCGAAAGGAAAATTGACCCGGAAGTTCCTGTAATAAATGTCACAATAAAACGAATG 



1810 1820 
AATGAAAAAAAAAAAAAAAAAA 



FIG, 2-2 



ir 



SUBSTITUTE SHEET 



wo 91/05802 



PCr/US90/05903 



4/20 

Hind 3 i POLY LINKER 




FIG. 3B 

SUBSTITUTE SHEET 



PCr/US90/05903 



5/20 

HindS 




Nhel 

MMTV LTR \Smal 




Sail 
Xhol 

SNO splice i poly A 
BamHI 



SV40 splice i poly A 



EcoRI 



SUBSTITUTE SHEET 



wo 91/05802 



PCT/US90/0S903 



Xbal 



6/20 



OP-I 



MMTV LTR 



RSV S LTR ^ 
Ndel 



SV40 splice & polyA 

BamHI 
Smeiori 
■HindS 




EcoRI 



SV40splicei poly A 



BamHI 



FIG. 3E 



Clal 
MMTVLTk 
HiodS 
EcoRI 

RSV S LTR 
Hdel 




Soli 
Xhol 



SV40 splice i poly A 



BamHI 
SV40eSori 



SV40 splice £ poly A 



EcoRI 



BamHI 



FIG. 3F 

SUBSTITIITF .WFFT 



wo 91/05802 



PCr/US90/05903 



7/20 




A B CD E F 

COS CHO BSC 



FIG. 4 

y 



mmm sheet 



wo 91/05802 



PCr/US90/05903 



8/20 



E 
c 

O 
CD 
CVJ 

M 
JQ 
< 



UB E2 


V i / \ 1 / 









FIG. 5A-1 



E 
c 

O 
CD 

V) 



E2 






E, 




UB 






-A 







FIG. 5B-I 




30 39414345 50 
FRACTION NUMBER 



60 



T 
70 



IE SHEET FIG. 5C-I 



wo 91/05802 



PCT/US90/05903 



9/20 




FIG. 5A-2 



0^ 





FIG. 5B-2 



(KDa) 

-94 
-67 

-43 
-30 
-20 
-14 




1 1 i I 
39 41 43 45 

FRACTION NUMBER 

FIG. 5C-2 



SJlBSTlTiHE SHEET 



wo 91/05802 



PCr/US90/05903 




SiiBSTIM SHEET 



wo 91/05802 



PCT/US90/05903 




SUBSTITUTE SHEET 



PCT/US90/05903 



12/20 




FIG. 7C 




FIG. 7D SUBSTITUTE SHEET 



PCr/US90/05903 



WO 91/05802 



13/20 



g 
s 

K 
O 
u. 

UJ 
Z 

o 

CD 



UJ 
CD 

<t 
111 



+ + ++ " 




luu -blE sqv 



SUBSTITUTE SHEET 



wo 91/05802 



PCr/US90/0S903 



14/20 



ALKALINE PHOSPHATASE (u/mq protein) 




RAT +100 +200 +300 
0P(5/xg)/S0LVENT(^l) 



FIG. 9A 



CALCIUIVI CONTENT (^g/mg tissue) 




rol + OP 

IXWN^ rat + OP + solvent 





RAT +100 +200 +300 

OP (5/xg)/S0LVENT(/xl) 

FIG. 9B 



SUBSTITUTE SHEET 



PCT/US90/OS903 



15/20 




FIG. 10B 

SUBSTITUTE SHEET 



wo 91/05802 



PCT/US90/05903 




FIG. 10D 

SUBSTITUTE SHEET 



wo 91/05802 



PCr/US90/05903 




FIG. 10E 




FIG. 10F 

SeBSTITyiE SHEET 



wo 91/05802 

PCr/US90/05903 



18/20 



i 




FIG. 1 1 



wo 91/05802 



19/20 



PCr/US90/05903 




<!;UBSTITUTE SHEET 



wo 91/05802 



PCr/US90/0S903 



20/20 

ALKALINE PHOSPHATASE (u/mq protein) 




I40ng 

FIG, I3A 



12 
10 
8 



Wm POOL A 
POOL B 


7 


1 1 POOL C 


% 






\ 






^ 
















J J 



35ng 



70ng 
OPI 



I40ng 

FIG. I3B 



SUBSTITUTE SHEET 



INTERNATIONAL SEARCH REPORT 

Inlernatlenal A pplicalion No. PCT/US90/05903 

I. CLASSIFICATIOM OF SUBJECT MATTER (i( sever,, classif.cat.on symbols ,o,.,. ind.c... .!» . 

Accordmg to Inletnaticnal Patent Classif.cation (IPC) or to both National Classincation and IPC 

IPC (5); C07K 15/00,15/06,15/14,17/02; C09H 1/02; A61K 37/12 
U.S. CL. 530/350,356,840; 514 /2,21; 424/423,424,426; 128/EIG g 

FIELDS SEARCHED ~ . 



Classification System 



U.S. 



Minimum Documentation Searched f 

Classification Symbols 



530/350, 356, 840; 514/2, 21; 424/423, 424, 426 
128/DIG 8 



Documentation Searched other than Minimum Oocumentaiion 
to the Extent tha! such Documents are Included in the Fields Searched e 



111. DOCUMENTS CONSIDERED TO BE RELEVANT « 



I Category * 



Citation of Document. " with indication, where appropriate, ol the relevant passages »2 



Relevant to Claim No. '3 



us. A, 4,394,370 (JEFFERIES) 19 JULY 1983 
See column 3, lines 10-25 for the demineral- 
ized bone powder and Example 1 for prepara- 
tion of the matrix. 

EP, A, 0 148 155 (SEN) 10 JULY 1985 

See page 18 for production of mineralized 

bone povder. 

EP, A, 0182 483 (NATHAN) 28 MAY 1986 

See page 9, line 31 to page 10, line 23 for 

production of demineralized bone powder. 

WO, A, W088/00205 (WANG) 14 JANUARY 1988 
See page 11, lines 2-19 for production of a 
matrix and page 12, line 12 to page 13, line 
27 for production of matrix material. 

Proc. Natl. Acad. Sci . , USA, Vol. 80, 
November 1983, (SAMPATH), "Homology of bone- 
inductive proteins from human, monkey, 
bovine and rat extracellular matrix" pages 
6591-6595. See "Materials and Methods" for 
production of the matrix. 



1-22 & 24 



1-22 & 24 



1-22 & 24 



1-24 



1-22 & 24 



• Special categories of cited documents: « 

"A" document defining the general state of the art which is not 
considered to be of particular relevance 

fiHflgdat'e published on or after the international 

"L" document which may throw doubts on priority claim(s) or 
which IS cited to establish the publication date of anothef 
citation or other special reason (as specified) 

-O** document referring to an oral disclosure, use. exhibition or 
otner means 

iL^f published prior to the international filing date but 
later than the priority date claimed 



T later document published after the international filing date 
or priority date and not in conflict with the application but 
invention" Principle or theory underlying the 

"X" document of particular relevance; the claimed invention 
cannot be considered novel or cannot be considered to 
involve an inventive step 

"Y" document of particular relevance; the claimed invention 
cannot be considered to involve an inventive step when the 
document is combined with one or more other such docu- 
ments, such combination being obvious to a person skilled 
in the art. 

"A" document member of the same patent family 



ly. CERTIFICATION 



Date of the Actual Completion of the International Search 

13 DECEMBER 1990 

International Searching Authority 

ISA/DS 

Fomi PCT/ISA^lO (second thaeq (Hw.l 1-87) 



Date j»f Mailing of this International Search Report 

■0 5 l - £B mi 



Signature oiL 



Officer ' 



lan 



Nutter 



International Application No. PCT/US90/05903 



III. DOCUMENTS CONSIDERED TO BE RELEVANT (CONTINUED FROM THE SECOND SHEET) 


Category • 


1 


,ilion 


of Document. with indication, where appropriate, of the relevant passages 


Relevant to Claim No 


V 


Proc. Natl. Acad. Sci., Vol. 78, No. 12, USA, 
December 1981 (SAMPATH), "Dissociative 
extraction and reconstitution of extracellulai 
matrix components involved in local bone 
differentiation". Pages 7599-7503. See page 
7599 "Preparation of Demineralized Bone", See 
entire section. 


1 


-22 




24 


A 


US, 


A, 


4, 172,128 


(THIELE) 23 OCTOBER 1979 


1 


-24 






A 


US, 


A, 


4,294,753 


(URIST) 13 OCTOBER 1981 


1 


-24 






A 


US, 


A, 


4,434,094 


(SEYEDIN) 28 FEBRUARY 1984 


1 


-24 






TV 

A 


US, 


A, 


4,563,350 


(NATHAN) 07 JANUARY 1986 


1 


-24 






A 


US, 


A, 


4,563,489 


(URIST) 07 JANUARY 1986 


1 


-24 






A 


US, 


A, 


4,657,548 


(NICHOLS) 14 APRIL 1987 


1 


-24 






A 


US, 


A, 


4,703,108 


(SILVER) 27 OCTOBER 1987 


1 


-24 






A 


US, 


A, 


4,725,671 


(CHU) 16 FEBRUARY 1988 


1 


-24 






TV 

A 


US, 


A, 


4,789,663 


(WALLACE) 06 DECEMBER 1988 


1 


-24 






A 


US, 


A, 


4,812,120 


(FLANAGAN) 14 MARCH 1989 


1 


-24 






TV 

A 


US, 


A, 


4,824,939 


(SIMPSON) 25 APRIL 1989 


1 


-24 






TV 

A 


US, 


A, 


4,837,285 


(BERG) 06 JUNE 1989 


1 


-24 






A f r 


us. 


A, 


4,894,441 


(MENICAGLI) 16 JANUARY 1990 


1 


-24 






A 


wo. 


A, 


W086/00526 


(CAPLAN) 30 JANUARY 1986 


1 


-24 






A / i:' 


wo. 


A, 


WO89/096O5 


(BENTZ) 19 OCTOBER 1989 




23 






A/ F 


wo, 


A, 


W089/10409 


(WANG) 02 NOVEMBER 1989 


1 


-24 






A 


EP, 


A, 


0 128 041 


(BAYLINK) 12 DECEMBER 1984 




23 






TV 

A 


EP, 


A, 


0 169 001 


(SABELMAN) 22 JANUARY 1986 


1 


-22 


& 


24 


TV 

A 


EP, 


A, 


0 169 016 


(SEYEDIN) 22 JANUARY 1986 




23 






A 


EP, 


A, 


0 212 474 


(URIST) 04 MARCH 1987 


1 


-24 






A 


EP, 


A, 


0 230 647 


(FUJIOKA) 05 AUGUST 1987 


1 


-24 






A 


EP, 


A, 


0 309 241 


(CHU) 29 MARCH 1989 


1 


-24 






A 


Collagen Research, Vol. 1/1981 A.H. Reddi 
"Cell Biology and Biochemistry of Endochondral 
Bone Development" pages 209-226. 


1 


-24 







Form PCT/ISA;210 (extra thea) (Rev.1 1^ 



InternatJonal Application No. 



PCT/US90/05903 



III. DOCUMENTS CONSIDERED TO BE RELEVANT (CONTINUED FROM THE SECOND SHEET) 



Category * | Citation of Document, le with indication, where appropriate, of the relevant passages \ Relevant to Claim No »« 



I 



The Lancet, May 2, 1981, Julie Glovacki 
"Application of the Biological Principle of 
Induced Osteogenesis for Craniofacial 
Defects" pages 959-963- 



1*24 



Journal of Biomedical Materials Research, 
j Vol. 19, 1985, A.H. Reddi " Implant-stimulate^ 
i interface reactions during collageous bone 
1 matrix-induced bone formation" pages 233- 
! 239. 

Clinical Orthopaedics and Related Research 
Number 187, July/August 1984, Marshall R. 
Urist '^-tricalcium Phosphate Delivery 
System for Bone Morphogenetic Protein" pages 
277-280. 

! Biotechnology and Bioengineering . Vol. XXVI, 
• 1984 Janie M. strand "A Modified Matrix 
j Perf usion-Micro-carrier Bead Cell Culture 
! System. I Adaption of the Matrix Perfusion 
j System for Growth of Human Foreskin 
i Fibroblasts" pages 503-507. 

Clinical Orthopaedics and Related Research , 
Number 232, July 1988 Stephan D. Cook 
"Hydroxyapatite-Coated Titanium for 
Orthopaedic Implant Applications" pages 225- 
243. 

Journal of Arthroplasty, Vol 2, No. 2, June 

1987 Myron Spector "Historical Review of 
! Porous Coated Implants" pages 163-177. 

I Int. J. Orla Maxillofac. Surg. Vol. 17, 

1988 J.R. Deatherage "A review of matrix- 
induced osteogenesis with special reference 
to its potential use in craniofacial surgeryl* 
pages 395-399. 

J- Bone JointSurg. Vol. 70-B, 1988 Per 
Aspenberg "Failure of Bone Induction by 
Bone Matrix in Adult Monkeys" pages 625-627 



1-24 



1-24 



1-24 



1-24 



1-24 



1-24 



1-24 



Form PCT/tS A/210 (extra sheet) (June 1980} 



I 
I