Skip to main content

Full text of "USPTO Patents Application 09804625"

See other formats


This Page Is Inserted by IFW Operations 
and is not a part of the Official Record 

BEST AVAILABLE IMAGES 

Defective images within this document are accurate representation of 
The original documents submitted by the applicant. 

Defects in the images may include (but are not limited to): 

• BLACK BORDERS 

• TEXT CUT OFF AT TOP, BOTTOM OR SIDES 

• FADED TEXT 

• — ILLEGIBLE-TEXT 

• SKEWED/SLANTED IMAGES 

• COLORED PHOTOS 

• BLACK OR VERY BLACK AND WHITE DARK PHOTOS 

• GRAY SCALE DOCUMENTS 

IMAGES ARE BEST AVAILABLE COPY. 



As rescanning documents will not correct images, 
please do not report the images to the 
Image Problem Mailbox. 



WORLD INTELLECTUAL PROPERTY ORGANIZATION 
International Bureau 




per 

INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) 



(51) International Patent aassification 4 : 
AOIN 63/02, A61K 35/32, 37/12 



Al 



(11) International Publication Number: 
(43) International Publication Date: 



WO 90/03733 

19 April 1990(19.04.90) 



(21) International Application Number: PCT/US89/04458 

(22) International Filing Date : 6 October 1 989 (06. 1 0.89) 



(30) Priority data: 
256,034 
415,555 



II October 1988 (11.10.88) US 
4 October 1989 (04.10.89) US 



(71) Applicant: INTERNATIONAL GENETIC ENGINEER- 

ING, INC. [US/US]; 1545- 17th Street, Santa Monica, 
CA 90404 (US). 

(72) Inventors: PARSONS, Thomas, F. ; 270 Renoak Way, Ar- 

cadia, CA 91006 (US). SEN, Arup ; 14617 Vanowen 
Street, No. 15, Van Nuys, CA 91405 (US). GRINNA, 
Lynn ; 1044 20th Street, Santa Monica, CA 90403 (US). 
HERSH, Carol ; 26 Baker Hill Road, Great Neck, NY 
11023 (US). THEOFAN, Georgia ; 10905 Ohio Avenue, 
No. 101, Los Angeles, CA 90024 (US). 



(74) Agent: GRUBER, Lewis, S.; Marshall, O'Toole, Gerstein, 
Murray & Bicknell, Two First National Plaza, Suite 
2100, Chicago, IL 60603 (US). 



(81) Designated States: AT (European patent), AU, BE (Euro- 
pean patent), CH (European patent), DE (European pa- 
tent), DK, FR (European patent), GB (European pa- 
tent), IT (European patent), JP, LU (European patent), 
NL (European patent), SE (European patent). 



Published 

With international search report. 



(54) Title: OSTEOGENIC FACTORS 



(57) Abstract 

The present invention provides an osteogenically active protein preparation characterized by a molecular weight of from 
about 31,000 to 34,000 daltons as characterized by non-reducing sodium dodecyl sulfate polyacrylamide gel electrophoresis and 
by the characteristic of eluting from a reverse phase high performance liquid chromatography column equilibrated with buffers 
containing trifluoroacetic acid and acetonkrile by eluting within the concentrations of 35 % to 45 % acetonitrile. The invention 
further provides improved methods for isolating such preparations and genes encoding all or a portion of polypeptide subunits of 
dimers comprising the osteogenic protein preparation. 



FOR THE PURPOSES OF INFORMATION ONLY 



Codes used to identify States party to the PCT on the front pages of pamphlets publishing international 
applications under the PCT. 



AT 


Austria 


ES 


Spain 


MG 


Madagascar 


AU 


Ausualia 


H 


Finland 


ML 


Mali 


BB 


Barbados 


FR 


France 


MR 


Mauritania 


BE 


Belgium 


GA 


Gabon 


MW 


Malawi 


BF 


Burkina Fasso 


GB 


United Kingdom 


NL 


Netherlands 


BG 


Bulgaria 


HU 


Hungary 


NO 


Norway 


Bl 


Benin 


rr 


Italy 


RO 


Romania 


BR 


Brazil 


JP 


Japan 


SD 


Sudan 


CA 


Canada 


KP 


Democratic People's Republic 


SE 


Sweden 


CF 


Central African Republic 




of Korea 


94 


Senegal 


CG 


Congo 


KR 


Republic of Korea 


SU 


Soviet Union 


CH 


Switzerland 


U 


Liechtenstein 


TD 


Chad 


CM 


Cameroon 


LIC 


Sri Lanka 


TG 


Togo 


DE 


Germany, Federal Republic of 


UU 


Luxembourg 


US 


United States of America 


DK 


Den mart 


MC 


Monaco 







OSTEOGENIC FACTORS 



This is a continuation-in-part of application 
Serial No. 256,034 filed October 11, 1988. 

BACKGROUND OF THE INVENTION 
The present invention relates to novel 
preparations of osteogenic factors, methods for their 
isolation and uses thereof (to repair bone defects). 
The preparations so isolated exhibit the ability to 
_promote_or stimulate the formation of bone at the site 

of their application. Bone is a~Mghly^peciaTized — 

connective tissue with unique mechanical properties 
derived from its extensive matrix structure. A network 
of fibrous bundles composed of the protein, collagen, is 
presumed to provide the tension-resistant behavior of 
bone. In addition, other materials including 
proteoglycans, noncollagenous proteins, lipids and 
acidic proteins associated with a mineral phase 
consisting primarily of poorly crystallized 
hydroxyapatite are deposited in the extensive matrix 
architecture of bone. Bone tissue is continuously 
renewed, by a process referred to as remodeling, 
throughout the life of mammals. This physiologic 
process might serve to maintain the properties of a 
young tissue. 

The processes of bone formation and renewal 
are carried out by specialized cells. Osteogenesis 
vis-a-vis morphogenesis and growth of bone is presumably 



WO 90/03733 



PCI7US89/04458 



carried out by the "osteoblasts" (bone-forming cells). 
Remodeling of bone is apparently brought about by an 
interplay between the activities of the bone-resorbing 
cells called "osteoclasts" and the bone-forming 
5 osteoblasts. The boney skeleton is thus not only an 
architectural structure with a mechanical function but 
also is a living tissue capable of growth, modeling, 
remodeling and repair. Since these processes are 
carried out by specialized living cells, chemical 

10 (pharmaceutical/hormonal), physical and physicochemical 
alterations can affect the quality, quantity and shaping* 
of bone tissue. 

A variety of pathological disorders as well as 
physical stress (for example, fracture) necessitate 

15 active formation of bone tissue at rates that are 

significantly higher than that which can be supported by 
the normal milieu of the body. It is thus of value to 

Men^ijfyjt^ysiologically acceptable substances 

( hormones/pharmaceuticals/growth~f actor s)— that— can- 

20 induce the formation of bone at a predetermined site 
where such substances are applied, for example, by 
implantation. Such agents could either provide a 
permissive matrix structure for the deposition of bone- 
forming cells, or stimulate bone-forming cells, or 

25 induce the differentiation of appropriate progenitors of 
bone-forming cells. 

The presence of proteinaceous and 
prostaglandin-like growth stimulators for osteoblasts 
has been examined, see reviews: Raisz, L.G., et al., 

30 The New England Journal of Medicine, Vol. 309, No. 1, 
pp. 29-35 (1983) and Raisz, L.G., et al., The New 
England Journal of Medicine, Vol. 309, No. 2, pp. 83-89 
(1983). 

The observation that a bone graft from the 
35 same individual or a compatible individual leads to the 
formation of new healthy bone at the site of the graft, 



WO 90/03733 



PCT/US89/04458 



led to the hypothesis that bone contains active proteins 
which promote local osteogensis. Urist, et al. 
disclosed evidence that bone matrix-associated 
noncollagenous proteins can be isolated by dissociative 
5 treatment of demineralized bone powder and that this 
mixture of noncollagenous proteins contain the local 
osteoinductive capability which was designated by Urist 
(e.g., Science, Vol. 150, p. 893 (1965)) as bone 
morphogenetic activity. 

10 A variety of osteogenic, cartilage-inducing 

and bone-inducing protein preparations have been 
described in the art. Urist, et al. and others have 
described various partially fractionated protein 
preparations with osteoinductive properties. These 

15 preparations are fractionated from the noncollagenous 
protein mixture extracted using different dissociative 
treatment of demineralized bone powder and subjecting 
the extract to various protein fractionation steps. 
Several ~such~pr epa r at ions -have-been_cha r ac_t_e_r ized_by 

20 different assays to determine their biological 

activities and by protein components identified using 
different standard protein analytical methods. 

Urist, et al., Proceedings of The Society for 
Experimental Biology And Medicine, 162 , pp. 48-53 

25 (1979), disclosed isolation of bone morphogenetic 

protein (BMP) from demineralized rabbit bone matrix. 
The reference discloses that BMP appears to contain a 
multitude of major protein components having molecular 
weights in the range of between 94,000 daltons (94K) to 

30 less than 14,000 daltons (14K) based on reducing SDS 

polyacrylamide gel electrophoretic (SDS-PAGE) analysis. 

Urist, et al. in Proc. Nat'l. Acad. Sci. USA, 
Vol. 76, No. 4, pp. 1828-1832 (April, 1979), disclosed 
another preparation of BMP obtained from demineralized 

35 rabbit bone matrix. Five protein fractions each 
characterized by having a major component with an 



WO 90/03733 



PCI7US89/04458 



apparent molecular weight of 94K f 68K, 43K, 21K and 
14. 3K were identified by subjecting these preparations 
to SDS polyacrylamide gel electrophoresis • All five 
protein preparations were eluted from a gel column with 
5 a-methylmannoside . Four of the five preparations, 

namely those with major components of molecular weights 
ranging from 68K to 14. 3K were eluted with 
ethyleneglycol and two preparations/ namely those with 
major components of molecular weights from 21K and 14. 3K 

10 were precipitated with calcium phosphate. All three 
groups of eluates were found to have comparable BMP 
activity. The reference suggests that the BMP activity 
in the third group (the preparations characterized by 
major components of 21K and 14. 3K proteins) may result 

15 from dissociation of a low molecular weight hydrophobic 
molecule carried by a glycoprotein. The reference 
suggests the alternative possibilities that BMP could be 
a single glycoprotein molecule f that the biologic 
act ivTty" may" "be ~a~ f unction -of— a- pr.o±ein__aggregate or 

20 that BMP activity may not be associated with bone 
glycoprotein at all (pg. 1831). 

Urist, U.S. Patent No. 4,294,753, disclosed 
that the molecular weight of BMP may range between about 
20K and 63K (col. 4, lines 45-61). The reference 

25 disclosed that BMP preparation isolated from rabbit 

dentin matrix protein mixture appears to have a major 
component with a molecular weight of about 23K. Because 
a protein fraction obtained from osteosarcoma cells has 
a molecular weight of 63K, it was suggested that the 

30 matrix free 63K protein may be a BMP precursor. 

Hanamura and Urist, et al., Clin. Ortho. and 
Rel. Res., No. 153, pp. 232-240 ( November -Decembe r , 
1980), disclosed the purification of osteosarcoma 
produced material with bone morphogenetic activity into 

35 three main fractions characterized by having a major 
component of molecular weight of 16K, 12. 5K and 7K, 



WO 90/03733 



PCI7US89/04458 



respectively. Fractions characterized by a major 
component with a higher molecular weight including a 22K 
protein were observed during initial purification steps; 
active fractions purified from such preparations did not 
5 contain the 22K protein. Based on these results, the 
12. 5K and 16K proteins were tentatively identified as 
BMP. 

Conover and Urist, et al., The Chemistry and 
Biology of Mineralized Connective Tissues, Elsevier 

10 North Holland, Inc., Arthur Veis f editor, pp. 597-606 
(1981)/ discloses the isolation of a BMP fraction from 
demineralized rabbit dentin. Preparations containing 
proteins having average molecular weights of 30K, 23K, 
18K, 15K and 12K were identified. While it was 

15 suggested that a 23K protein might represent the active 
BMP fraction, it was acknowledged that the active 
fraction might be the 18K, 15K or 12K proteins which 

th^y_were_unable to separate from the 30K and 23K 

fractions. ~— — 

20 Parley, et al., Biochemistry, Vol. 21, No. 14, 

pp. 3502-3507 (1982), discloses purification of a 
skeletal growth factor from demineralized human bone 
matrix with an apparent molecular weight of 83K. The 
disclosure makes reference to a 1981 reference (Trans. 

25 Annu. Meet .-Orthop. Res. Soc, 6, 136 (1981)) by Urist, 
Conover and others, describing bone morphogenetic 
protein as having a molecular weight of 23K. 

Urist, et al., Clin. Ortho. and Rel. Res., 
No. 162, pp. 219-232, discloses a low molecular weight 

30 bone morphogenetic protein fraction extracted from 

bovine bone matrix and fractionated by ion exchange and 
gel chromatography. The reference discloses that bovine 
BMP may consist of components ranging in molecular 
weight from 12K to 30K with the main components 

35 corresponding to molecular weights of 23K, 18K and 

12K. The reference suggests that the 18K component is 



WO 90/03733 



PCT/US89/04458 



the active protein of the group because of its 
invariable presence in active fractions . 

Urist, et al., Proc. Soc. Exp. Biol, and Med., 
173 , pp. 194-199 (1983), identifies human bone 
5 morphogenetic protein (hBMP) extracted, from 

demineralized human bone matrix as an 18K molecular 
weight protein. The 18K protein was identified as 
putative hBMP as a result of its invariable presence in 
chromatographic fractions having high hBMP activity and 

10 general absence in those fractions lacking such 

activity. 34K, 24K and 14K protein components isolated 
from the demineralized bone were found not to induce 
bone formation. 

Seyedin, et al., U.S. Patent Nos. 4,434,094, 

15 and 4,627,982 describe the work in Orist, U.S. Patent 
No. 4,294,753 and state that in the Urist patent, BMP 
was not fully characterized. The Seyedin patents 

_descr;ibe^ a_ process for partially purifying an osteogenic 

factor and describe the ^actofs""as~ having -a -molecular 

20 weight of less than or equal to 30K. 

Urist, et al., Science, 220 , pp. 680-686 
(1983), again identifies BMP purified from demineralized 
bone matrix as an 18K molecular weight protein. 
Variable quantities of 14K, 24K and 34K proteins were 

25 isolated with the 18K protein but the reference 

discloses that each of the last three protein fractions 
can be removed without loss of BMP activity. The 
reference states that the 18K fraction is responsible 
for BMP activity and suggests that the 34K, 24K and 14K 

30 proteins are individually inactive but are subunits of a 
larger BMP complex with the 18K protein. 

Urist, et al., Proc. Nat'l. Acad. Sci. USA, 
81, pp. 371-375 (1984), confirms that bovine BMP has an 
apparent molecular weight of 18. 5K daltons. The 

35 publication further discloses other bone derived 

proteins with apparent molecular weights of 17. 5K and 



WO 90/03733 



PCT/US89/04458 



17K, proteins with higher molecular weights of 34K, 24K 
and 22K and a protein with a lower molecular weight of 
14K. The publication provided the N-terrainal sequence 
for the 17. 5K protein which had an unblocked amino 
5 terminus. 

Urist f European Patent Application 
No. 212 f 474/ discloses peptide fragments having 
molecular weights between about 4K and 7K comprising at 
least an active portion of the osteoinductive and 

10 immunoreactive domain of the 17. 5K BMP molecule. 

Wang, et al., Patent Cooperation Treaty 
Application No. WO 88/00205 , claiming priority based on 
applications including U.S. Serial No. 880,776 filed 
July 1, 1986, discloses a bovine bone inductive factor 

15 which is isolated from demineralized bone powder by a 
procedure comprising a number of chromatographic and 
dialysis steps. The bone inductive factor so isolated 
was - "found— to-con-tai-n-,- as_ - j.udjged._by _a_nor_- r educ ing 
SDS-PAGE analysis, one or more proteins having a ~~ 

20 molecular weight of approximately 28,000 to 30,000 
daltons. Reducing SDS-PAGE analysis of the active 
protein(s) yielded two major bands having the mobility 
of proteins having molecular weights of 18,000 daltons 
and 20,000 daltons respectively. Wang, et al. discloses 

25 three bovine proteins designated BMP-1, BMP-2 and BMP-3 
where BMP is bone morphogenetic protein and provides 
peptide sequences for the proteins. Wang, et al. also 
discloses the nucleotide sequences and amino acid 
sequences predicted thereby of four human proteins 

30 designated BMP-1, BMP-2 Class I, BMP-2 Class II and 
BMP-3. 

Wozney, et al., Science 242, pp. 1528-1533 
(1988), describes the nucleotide sequences and amino 
acid sequences predicted thereby of three human 
35 complementary DNA clones (designated BMP-1, BMP-2A and 

BMP-3) corresponding to three polypeptides present in an 



extract of bovine bone which is capable of inducing de 
novo bone formation. Recombinant human BMP-1, BMP-2A 
and BMP-3 proteins were said to be independently capable 
of inducing the formation of cartilage in vivo. The 
nucleotide sequence and derived amino acid sequence of a 
fourth complementary DNA clone (designated BMP-2B) is 
also described. The BMP-1, BMP-2A, BMP-2B and BMP-3 
proteins of this publication appear to correspond, 
respectively, to the BMP-1, BMP-2 Class I, BMP-2 
Class II and BMP-3 proteins, respectively, of Wang, et 
al. 

Sen, U.S. Patent No. 4,804,744 issued 
February 14, 1989, discloses a preparation of an 
osteogenic protein which is a member of the P3 family of 
proteins and which has an apparent molecular weight of 
22,000 to 24,000 daltons as revealed by coomassie blue 
staining of reducing SDS-PAGE analysis. 

JLyons, et al., Proc. Nat'l. Acad. Sci. USA 86, 

pp. 4554-4558 ( 1989") y^descrlbes- the-nucleotide-sequence_. 
and derived amino acid sequence of a complementary DNA 
clone (designated Vgr-1) encoding a mouse protein which 
contains homologous regions for the deduced amino acid 
sequences of BMP-2A, BMP-2B and BMP-3. 

Luyten, et al., J. Biol. Chem. 264, 
pp. 13377-13380 (1989), describes the purification and 
partial amino acid sequence analysis of a polypeptide 
present in an extract of bovine bone said to be capable 
of inducing de novo bone formation. This protein, 
designated osteogenin, has an apparent molecular mass of 
22,000 daltons as judged by reducing SDS-PAGE analysis, 
and an apparent molecular mass of 30,000 to 40,000 
daltons as judged by a non-reducing SDS-PAGE analysis. 
The amino acid sequences reported for osteogenin are 
said to show considerable homology to BMP-3 as described 
by Wozney, et al. 



WO 90/03733 



PCT/US89/04458 



Bentz, et al., j # Bone and Mineral Res,/ A 
Supplement l f p. S280 No. 650 (1989) and Bentz, et al., 
J. Cell Biol., 107, 162a No. 918 (1989) describe a 
protein material isolated from demineralized bone matrix 
5 said to promote osteoinduction in the rat. The 
osteoinductive factor (OIF) was identified as a 
glycoprotein and was said to exhibit osteoinductive 
activity only in the presence of TGF-el or TGF-B2. OIF 
had an apparent molecular mass of 22,000 to 28,000 
10 daltons based on SDS gel electrophoresis and was 

identified as a monomeric molecule in light of the fact 
that reduction does not alter its mobility on SDS-PAGE. 

SUMMARY OF THE INVENTION 

15 The present invention is directed to mammalian 

bone matrix-derived proteins which exhibit the ability 
to promote or stimulate local osteogenesis (bone 
formation) at sites of implantation in mammals. 
Specif i'eally— the— invent ion -pr_ovi_des_preparations of 

20 osteogenic proteins and involves extraction and 

purification of such osteogenically active protein 
preparations including extraction of bone matrix 
proteins under dissociative (denaturing) conditions 
followed by further purification using one or more 

25 methods such as specific elution of these proteins from 
gel filtration chromatographic columns, ion-exchange 
chromatographic columns, metal chelate affinity columns, 
hydrophobic adsorption chromatographic columns and 
reverse phase HPLC (high performance liquid 

30 chromatography) columns using an acetonitrile 

gradient. These preparations obtained using such 
purification procedures are clearly characterized by 
their respective chromatographic behaviors using these 
gel filtration, ion-exchange, metal chelate, hydrophobic 

35 adsorption and reverse phase HPLC columns as well as by 
their ability to induce local bone formation in animals 



WO 90/03733 



PCT/US89/04458 



- 10 - 

at a predetermined site where they are applied either 
alone or in admixture with a suitable pharmaceutically 
acceptable carrier. The invention further provides 
methods of inducing bone formation in a mammal 
5 comprising administering to the mammal effective amounts 
of the osteogenic preparation. Also provided are 
pharmaceutically acceptable compositions comprised of 
one or more of the proteins or active polypeptides in 
conjunction with a physiologically acceptable matrix 

10 material. The invention further provides polypeptide 
subunits of the osteogenically active 31,000 to 34,000 
dalton protein molecules, designated P3 OF 31-34 , which 
are found associated with the P3 proteins of bone 
nucleotide sequences encoding certain of the subunits of 

15 P3 OF 31-34 or portions thereof and novel osteogenically 
active heterodimer proteins comprising certain of these 
subunits. 

BRIEF DESCRIPTION' OF~ THE" DRAWINGS 

20 Figure 1 represents the elution profile 

obtained by Sepharose CL-6B column chromatography of the 
proteins obtained in an eight hour extraction of 
demineralized calf bone powder with 4 M GuHCl-0.01 M 
Tris-HCl buffer (pH 7.0). 

25 Figure 2 represents the elution profile 

obtained by Sephacryl S-200 column chromatography, in 
4 M GuHCl-0.01 M Tris-HCl buffer (pH 7.0), of the 
proteins contained in the active fraction obtained from 
Sepharose CL-6B column chromatography. 

30 Figure 3 represents the elution profile of 

proteins present in the active pool from Sephacryl S-200 
column chromatography on a reverse phase Protesil 300 
octyl column using an acetonitrile gradient for the 
elution of proteins. 

35 Figure 4 represents the results of 

electrophoretic analysis of purified bone matrix 



WO 90/03733 



PCI7US89/04458 



- 11 - 

proteins on discontinuous sodium dodecyl sulfate- 
polyacrylamide gels in the presence of a reducing agent 
followed by coomassie blue staining to detect the 
protein material. 
5 Figure 5A represents the elution profile 

obtained by high performance liquid chromatography f on a 
reverse phase C8 column, of fragments of porcine P3 
protein; the fragments were generated by the enzymatic 
digestion of porcine P3 protein using Staphylococcus 

10 aureus V8 protease. 

Figure 5B represents the elution profile 
obtained by high performance liquid chromatography, on a 
reverse phase C8 column, of fragments of bovine P3 
protein; the fragments were generated by the enzymatic 

15 digestion of bovine P3 protein using Staphylococcus 
aureus V8 protease. 

Figure 6A represents the elution profile 

obtained by high performance liquid chromatography, on a 

reverse phas¥^T8^6TumnT ~of -f ragments-of— por.c.irie_ P3 _ 

20 protein; the fragments were generated by the enzymatic 
digestion of reduced, carboxymethylated porcine P3 
protein using Staphylococcus aureus V8 protease. 

Figure 6B represents the elution profile 
obtained by high performance liquid chromatography, on a 

25 reverse phase C18 column, of fragments of human P3 

protein; the fragments were generated by the enzymatic 
digestion of reduced, carboxymethylated human P3 protein 
using Staphylococcus aureus V8 protease. 

Figure 7 represents the results of competitive 

30 radioimmunoassays measuring the ability of radiolabeled 
test antigen to bind to specific antibody molecules in 
the presence of competing unlabelled antigen 
preparations. 

Figure 8 represents the elution profile 

35 obtained by Sephacryl S-200 column chromatography, in 
4 M GuHCl-0.01 M Tris-ECl buffer (pH 7.0), of the 
proteins contained in the active 5K-100K fraction. 



WO 90/03733 



PCT/US89/04458 



- 12 - 

Figure 9 illustrates an alternative method for 
the purification of P3 OF 31*34 (osteogenic factors) 
proteins from calf bone. 

Figure 10A shows the apparent molecular weight 
5 of the osteogenic factors as determined by non-reducing 
SDS polyacrylamide gel electrophoresis followed by 
silver staining. 

Figure 10B shows reducing SDS polyacrylamide 
gel electrophoresis of P3 OF 31-34 proteins followed by 
10 silver staining. 

Figure 11A shows the isolation of the subunits 
of the P3 OF 31-34 proteins (osteogenic factors) by 
reverse phase HPLC. 

Figure 11B shows the apparent molecular 
15 weights of the subunits as detected by silver staining 
of reducing SDS polyacrylamide gel electrophoretic 
analysis . 

Figure 12 represents the alignment of the 
amino terminal "and internal- sequences _of _subjanits^ A, B f 

20 C and D of the P3 OF 31-34 proteins with homologous 

regions from the deduced amino acid sequences of cDNA 
clones encoding hOD and hOE isolated according to the 
invention and the polypeptides designated in the 
literature as BMP-2A, BMP-2B and Vgr-1. 

25 Figure 13A represents the elution profile 

obtained by high performance liquid chromatography, on a 
reverse phase C18 column, of the PS Pool. 

Figure 13B shows non-reducing SDS 
polyacrylamide gel electrophoresis of P3 OF 31-34 

30 proteins eluting in fractions 26 , 27 and 28 from the 
reverse phase HPLC of the PS Pool. 

Figure 14A shows the isolation and 
identification of subunits of the P3 OF 31-34 proteins 
eluting in fraction 26 from the reverse phase HPLC of 

35 the PS Pool. 



WO 90/03733 



PCT/US89/04458 



such as PI, P2 and the like in the order of decreasing 
apparent molecular weight. Equivalent proteins have 
been obtained from bones of different mammals. The 
osteogenically active polypeptides of the invention have 
5 the characteristic that they copurify under certain 

purification procedures with a family of immunologically 
related P3 proteins, having an apparent molecular weight 
of 22 f 000 to 24 f 000 daltons. Similarly, a P3 protein 
isolated from human bone and purified according to the 
10 procedure essentially as described herein is 

immunologically related to the calf P3 protein and has 
an apparent molecular weight of 22,000 to 24,000 daltons 
revealed by coomassie blue staining of reducing SDS-PAGE 
analysis. 

15 The osteogenically active preparation obtained 

using the method of this invention is sometimes referred 
to herein as the P3 protein. The invention further 

concerns the ability to obtain osteogenically active P3 

proteins from bones of "various "mammals- -using— the method 

20 of this invention. The osteogenically active protein 
preparations obtained from different mammalian bones 
using. the method of this invention constitute members of 
a family of proteins, referred to herein as an 
immunologically related family of P3 proteins. The 

25 members of this family show substantial equivalence to 
each other with regard to characteristics such as 
(i) osteogenic activity, (ii) chromatographic 
characteristics in dissociative gel filtration columns, 
(iii) elution from hydrophobic reverse phase HPLC 

30 columns in acetonitrile, (iv) an essential homogeneity 
with regard to a molecular weight of between about 
22,000 and 24,000 daltons revealed by coomassie blue 
staining of reducing SDS-PAGE analysis, (v) 
characteristics of certain major peptide fragments 

35 generated by proteolytic treatment and (vi) reactivity 
in an immunoassay directed toward certain immunogenic 
determinants characteristic in such preparations. 



WO 90/03733 



PCT/US89/04458 



- 15 - 

The invention further relates to the 
identification, in the P3 proteins, of proteins which, 
during gel filtration under non-reducing and 
dissociative conditions, elute as proteins having 
5 apparent molecular weights within the range of about 
25,000 to 38,000 daltons, and more specifically, when 
analyzed by non-reducing SDS-PAGE followed by silver 
staining, migrate as proteins having apparent molecular 
weights within the range of about 31,000 to 34,000 

10 daltons. These proteins are designated P3 OF 31-34 , 

indicating osteogenically active 31,000 to 34,000 dalton 
protein molecules which are found associated with the P3 
proteins of bone and are distinct from bone-derived 
protein molecules of similar molecular weight which lack 

15 osteogenic activity. 

The invention further provides alternative 
protein fractionation methods of isolating these 31,000 
to 34,000 dalton molecular weight protein constituents 
inherent" in" ~the~P3 -proteins- whi ch- ar.e-chara_cteri zed by 

20 the ability to promote osteogenesis. The P3 OF 31-34 
osteogenic protein material yields four distinct peaks 
when analyzed by reverse phase HPLC after reduction. 
When analyzed by reducing SDS-PAGE and silver staining, 
three of the peaks are characterized as protein subunits 

25 migrating with apparent molecular weights within the 

range of 17,500 to 19,000 daltons, and the fourth peak 
is characterized as a protein subunit migrating with an 
apparent molecular weight within the range of 16,000 to 
17,500 daltons. 

30 Applicants have characterized the protein 

subunits of P3 OF 31-34 and designated them as 
subunits A, B, C and D. The subunits have been 
characterized by sequencing of various internal and 
presumptive amino-terminal polypeptide fragments. 

35 Applicants have utilized the polymerase chain reaction 
(PGR) technique to amplify sequences of human cDNA 



WO 90/03733 



PCT/US89/04458 



- 16 - 

homologous to that encoding subunit D and have provided 
amino acid and nucleotide sequences for human subunit D 
(hOD). Applicants have also identified a sequence of 
human cDNA encoding what is characterized as polypeptide 
5 subunit E (hOE) which may be a new osteogenic 

polypeptide or may correspond to the bovine subunit A 
polypeptide. Applicants have also determined that the 
P3 OF 31-34 osteogenic protein material is comprised of 
polypeptide dimers including a heterodimer of subunit D 

10 with subunit B and a heterodimer of subunit A (and/or 
subunit E) with subunit B. The P3 OF 31-34 osteogenic 
material may further comprise heterodimers of subunit A 
(and/or subunit E) with subunit C and heterodimers of 
subunit D with subunit C given the high degree of 

15 homology (80%) between subunits B and C. 

The invention provides polypeptide subunit D 
of P3 OF 31-34 such as isolated from bovine bone and a 
purified and isolated nucleic acid from human DNA 
comp rising- a— nu e 1 eo t i de_ s e qu e nc ^ e_s e [lect ed from the group 

20 consisting of a nucleotide sequence encoding subunit D 
of P3 OF 31*34 , a nucleotide sequence which encodes the 
same sequence of amino acids making up subunit D of P3 
OF 31-34 , a nucleotide sequence which is homologous with 
80% of the nucleotides encoding subunit D of P3 OF 31-34 

25 and a nucleotide sequence which would be homologous with 
80% of the nucleotides encoding subunit D of P3 OF 31-34 
but for the redundancy of the genetic code. The 
invention also provides recombinant expression systems 
for subunit D including vectors including nucleic acid 

30 sequences encoding subunit D of P3 OF 31-34 , a cell 
transformed therewith and a polypeptide expression 
product of such a transformed cell. 

The invention further provides polypeptide 
subunit E of P3 OF 31-34 and a purified isolated nucleic 

35 acid comprising a nucleotide sequence selected from the 
group consisting of a nucleotide sequence encoding 



WO 90/03733 



PCT/US89/04458 



- 17 - 

subunit E of P3 OF 31-34 , a nucleotide sequence which 
encodes the same sequence of amino acids making up 
subunit E of P3 OF 31-34 , a nucleotide sequence which is 
homologous with 80% of the nucleotides encoding subunit 
5 E of P3 OF 31-34 and a nucleotide sequence which would 
be homologous with 80% of the nucleotides encoding 
subunit E of P3 OF 31-34 but for the redundancy of the 
genetic code. The invention also provides recombinant 
expression systems for subunit E including vectors 
10 including nucleic acid sequences encoding subunit E of 
P3 OF 31-34 , a cell transformed therewith and a 
polypeptide expression product of such a transformed 
cell. 

The invention also provides an osteogenic 

15 preparation comprising a dimer comprising subunit D of 

P3 OF 31-34 and, additionally, an osteogenic preparation 
comprising a heterodimer comprising subunits D and B of 

— P-3- OF--3-1— 3-4- -linked -bv-_at_ least one disul fide bond. The 
invention still further provides an osteogenic 

20 preparation comprising a dimer comprising subunit E of 

P3 OF 31-34 and, additionally, an osteogenic preparation 
comprising a heterodimer comprising subunits E and B of 
F3 OF 31-34 linked by at least one disulfide bond. The 
invention further comprises an osteogenic preparation 

25 comprising a dimer comprising subunit A of P3 OF 31-34 
and, additionally, an osteogenic preparation comprising 
a heterodimer comprising subunits A and B of P3 OF 31-34 
linked by at least one disulfide bond. 

The osteogenic protein preparations, namely 

30 the P3 protein, a preparation containing the P3 OF 31-34 
protein or a preparation containing subunits A, B, C, D 
or E or homo- or heterodimers thereof as described 
herein, may be used to form a composition for 
implantation into a mammal by admixture with a 

35 physiologically acceptable matrix material. In 
addition, devices for implantation into mammals 



WO 90/03733 



PCT/US89/04458 



- 18 - 

comprising a structural member encoated with the 
osteogenic factor/matrix composition are provided by the 
invention. 

It may be possible, using procedures well 
5 known in the art, for example, chemical, enzymatic or 
recombinant DNA techniques/ to obtain polypeptides 
derived from the osteogenic proteins described herein 
which exhibit the ability to promote or stimulate 
osteogenesis. For example, any of polypeptide 

10 subunits A, B, C, D and E or nucleic acid encoding such 
polypeptides or analogs not directly provided herein may 
be obtained according to procedures well known to those 
skilled in the art. Such procedures include obtaining 
the complete amino acid sequence of any of the 

15 polypeptide subunits and screening DNA libraries from 

one or more mammalian species with polynucleotide probes 
based thereon, and including identifying cells 

expressing any of the polypeptide subunits present in P3 

OF 31-34 by~us~i~ng~a~rabel~led antibody- .or_ol igonucJLeotlde 

20 according to the present invention, isolating mRNA 

therefrom and preparing cDNA from the isolated mRNA. 
The invention further provides a process for the 
preparation of an osteogenic protein consisting of 
dimers of polypeptide monomers selected from the group 

25 consisting of P3 OF 31-34 subunit A, subunit B, 
subunit C, subunit D and subunit E. The process 
comprises the steps of culturing in suitable culture 
media one or more cell lines transformed with nucleic 
acid sequences encoding one or more polypeptides 

30 selected from the group consisting of P3 OF 31-34 

subunit A, subunit B, subunit C, subunit D and subunit 
E. Dimers are then formed of the polypeptide monomers 
by linking them with at least one disulfide bond and the 
dimers so formed are then isolated. 

35 Proteins or polypeptides that are or can be 

converted to osteogenically active species which are 



WO 90/03733 



PCI7US89/04458 



- 19 - 

immunologically related to the P3 OF 31-34 proteins or 
subunits or fragments thereof are also considered to be 
within the scope of the present invention. Active 
entities, referred to herein as "active polypeptides", 
5 include any portion of the proteins or polypeptides 

which are the subject of the present invention and their 
functional derivatives which can be produced by 
conventional procedures such as chemical synthesis or 
recombinant DNA techniques. Active polypeptides further 

10 include deletions from, or insertions or substitutions 
of residues within the amino acid sequence of the 
osteogenic proteins and subunits. Combinations of 
deletion, insertion and substitution may also be made to 
arrive at the final construct, provided that the final 

15 construct possesses osteogenic activity. Derivatives of 
such active polypeptides can include, for example, 
chemically or enzymatically modified polypeptides; 

_fusicMi proteins; or polypeptides bound to a suitable 

carrier substance such a~s~a~~poryme r — — — 

20 Natural sequence polypeptide subunits present 

in P3 OF 31-34 of one or more mammalian species or 
analogs and variants thereof may be prepared by direct 
chemical synthesis of polypeptide or by expression of 
DNA prepared by site-directed mutagenesis of subunit DNA 

25 or by chemical synthesis of oligonucleotide and assembly 
of the oligonucleotide by any of a number of techniques 
prior to expression in a host cell. [See, e.g., 
Caruthers, U.S. Patent No. 4,500,707; Balland, et al., 
Biochimie, 67, 725-736 (1985); Edge, et al., Nature, 

30 292, 756-762 (1981)]. Messenger RNA encoding P3 OF 
31-34 or analogs thereof may also be expressed in 
vitro . Changes in activity levels are measured by the 
appropriate assay. Modifications of such protein 
properties as redox or thermal stability, 

35 hydrophobicity , susceptibility to proteolytic 

degradation, or the tendency to aggregate with carriers 



WO 90/03733 



PCT/US89/04458 



- 20 - 

or into multimers are assayed by methods well known to 
those of ordinary skill in the art. 

Prokaryotic microorganisms (such as bacteria) 
and eukaryotic microorganisms (such as yeast) may be 
5 employed as host cells according to the present 

invention. cerevisiae , or common baker's yeast, is 

the most commonly used among eukaryotic microorganisms, 
although a number of other strains are commonly 
available. For expression in bacteria and yeast, 

10 cloning and expression vectors are well known to those 
skilled in the art, such as lambda phage and pBR322 in 
E. coli and YRp7 in cerevisiae . 

Cells derived from multicellular eukaryotes 
may also be used as hosts. Cells from vertebrate or 

15 invertebrate eukaryotes may be used, and those skilled 
in the art know of appropriate expression vectors for 
use therein, such as SV40 retroviral and papilloma viral 
- — — — -vector s_^fer_rtmmmalian host cells, NPV vectors for 

invertebrate host cells and Ti ""vectors - f "or "plant— eel-Is-. 

20 The present invention further discloses 

methods of using one or more of the proteins and/or 
active polypeptides and/or immunologically related 
entities as pharmaceutical agents for the stimulation of 
bone growth in mammals. Pharmaceutically acceptable 

25 compositions comprised of one or more of the proteins 
and/or active polypeptides and/or immunologically 
related entities in combination with a pharmaceutically 
acceptable carrier are also disclosed herein. Such 
compositions can optionally contain other bioactive 

30 materials or other ingredients which aid in the 
administration of the composition or add to the 
effectiveness of the composition. 

As used herein, the term "immunologically 
related" is meant to include any polypeptide which shows 

35 binding and/or recognition to antigen-binding sites in 
antibodies raised or manufactured against the protein. 



WO 90/03733 



PCT/US89/04458 



- 21 - 

The term "osteogenesis" means formation of new bone or 
induction of growth of pre-existing bones at specific 
sites in response to local administration (for example, 
implantation of an active preparation in a 
5 pharmaceutical^ acceptable manner). The term 
"osteogenic amount" refers to an amount of the 
osteogenic protein and/or active polypeptide and/or 
immunologically related entity sufficient to provide the 
desired effect. The term "osteogenically active" or 

10 "osteogenic" means that the preparation has the 
capability to promote or induce osteogenesis. 

In addition, two unrelated protein 
preparations designated herein as P2 and P4 have also 
been isolated from bone of several different mammalian 

15 species. A family of P2 proteins, each member isolated 
from a particular mammalian bone source, has been 
characterized. A typical P2 protein isolated from calf 
bone has an apparent molecular weight of 30,000 to 
33 , 000" ~aalf6ns~bu't ~is— in capable- -of -inducing 

20 osteogenesis in the absence of the osteogenic protein 
associated with the P3 protein preparation. 
Immunologically related P2 protein has also been 
isolated according to the procedure essentially as 
described herein from human bone. 

25 In a similar manner, a family of P4 proteins 

has been isolated according to the procedures described 
herein. In the stage of purification accomplished from 
calf bone, the P4 preparation consists of two major 
components which are incapable of inducing osteogenesis 

30 in the absence of the osteogenic protein associated with 
the P3 protein preparation, both having an apparent 
molecular weight of about 16,000 to 18,000 daltons and 
are characterized by amino terminus amino acid sequences 
as described later herein. Immunologically related 

35 members of this P4 protein family which are also 

incapable of inducing osteogenesis in the absence of the 



WO 90/03733 



PCT/US89/04458 



- 22 - 

osteogenic protein have been isolated from human bone 
according to the procedures described herein. 

The application of the osteogenic factors can 
be conveniently accomplished by administering , such as 
5 by implanting, a lyophilized preparation or suspension 
of one or more of the osteogenic proteins and/or one or 
more active polypeptide and/or one or more 
immunologically related entities in sufficient quantity 
to promote osteogenesis at the desired site. 
10 Alternatively , pharmaceutically acceptable compositions 
can be used which are comprised of one or more of the 
osteogenic proteins and/or one or more of the active 
polypeptides and/or one or more of the immunologically 
related entities described herein and a pharmaceutically 
15 acceptable matrix such as collagenous proteins or matrix 
material derived from powdered bone extracted with 
strong denaturing agents, or other pharmaceutically 
acceptable carriers. 

The- f oil owing, .examples _are^ included to further 
illustrate the invention but are not to be construed as 
limitations thereon. 

Example 1 
Isolation Of The Osteogenic Factors 
Bone Processing 

In a typical preparation, long bones (ends of 
long bones) from a mammal (for example, ankles from 
calves, femur heads of vertebral column from human 
bones, the total tibia and fibula from rats) are 
processed and demineralized using well known 
conventional procedures such as those described in 
Urist, M.R., U.S. Patent No. 4,294,753 (1981). These 
and all other references cited herein are incorporated 
herein by reference. 

A convenient method of processing and 
demineralizing bone is as follows: 



25 



30 



WO 90/03733 



PCT/US89/04458 



- 23 - 

The periosteal layer surrounding the bone 
(preferably the bone is obtained from a young mammal and 
kept refrigerated until processing) is removed by 
mechanical means and then the marrow from the central 
5 cavity of the bone is removed by washing with cold 
water. The bone is pulverized into small particles 
[generally 1 to 2 millimeters (mm) in diameter] by 
conventional means , for example, using a Wiley mill. 
The particles are then washed extensively with a 

10 buffered saline solution such as a 0.15 M NaCl-0.1 M 
Tris-HCl buffer (pH 7.0) to remove most of the lipids 
and remaining blood. The particles are further reduced 
in size by shearing, for example, using a polytron 
homogenizer (Brinkman Instruments) so that particles of 

15 approximately 500 microns (y) in diameter or less are 
obtained. The homogenized particles are washed with 
buffered saline such as that noted above and water, then 

^ with ethanol and finally with ether. The washed 

homogenized par~ticres~are "then- vacuum -or-^air-dr_ied„;__thi_s 

20 "bone powder" can be stored at -80°C for prolonged 
periods of time. 

For efficient demineralization and protein 
extraction, the bone powder is sieved to obtain 
particles having a size range of about 75 to 500 y in 

25 diameter. Demineralization (that is, the removal of 

calcium phosphate from the bone matrix) is achieved by 
repeated washes with a hydrochloric acid (HC1) solution, 
for example, by stirring bone powder for one hour with 
about 10 to 15 milliliters (ml) of 0.5 normal (N) HC1 

30 per gram (g) dry weight of bone powder, decanting the 
liquid and then repeated this process three or four 
times. The demineralized bone powder is then washed 
extensively with deionized distilled water until the pH 
approaches neutrality. The water is removed from the 

35 demineralized bone powder by washing with ethanol, then 
ether, and then drying. The demineralized bone powder 



- 24 - 



can be stored at ultralow temperatures (for example , 
-20° to -80°C). Demineralization of the bone powder can 
also be accomplished using other well known procedures, 
for example, using a chelator such as 
ethylenediaminetetraacetic acid. 

To determine if the treated bone powder is 
sufficiently demineralized after HC1 treatment to be 
ready for the extraction of the bone-matrix proteins, 
the water-rinsed powder is tested for mineral content 
[(that is, calcium content), for example, by the method 
of von Kossa, see J. von Kossa, Ziegler's Beitr. 29 f 163 
(1901)]. When the von Kossa stain is negative, the 
treated bone powder is sufficiently demineralized to be 
ready for the extraction of proteins. 

Extraction and Separation of Proteins 
From Demineralized Bone Powder 

Demineralized bone powder, prepared as 

described above7~is "extracted— by— constant— s_t.irxij?jg_^th_ 

an aqueous solution of about 2 to 8 molar (M) guanidium- 

hydrochloride (GuHCl) in a buffer such as Trizma- 

hydrochloride (Tris-HCl) at or near pH 7.0 for a time 

sufficient to extract the desired proteins. Preferably, 

the extraction is performed by stirring the 

demineralized bone powder with 4 M GuHCl-0.01 M Tris*HCl 

buffer (pH 7.0) in the presence of a proteolytic enzyme 

inhibitor such as phenylmethylsulf onyl-f luoride for 8 to 

12 hours (hrs) between about 4° to 20°C. The proteins 

from demineralized bone powder can be extracted by 

contacting the demineralized bone powder with an 

appropriate GuHCl-Tris-HCl buffer for a time sufficient 

to obtain substantial quantities of the desired 

proteins. In a typical extraction of 100 grams of 

demineralized calf bone powder, approximately 1500 

milligrams (mg) of total proteins are extracted in a 

three day extraction period with 4M GuHCl-0.01 M 



Tris-HCl buffer (pH 7.0). In the process of the present 
invention, it has been found that more than 80 percent 
(%) of the total proteins obtained in a three day 
extraction can be extracted in the first 8 to 12 hrs 
with a 4 M GuHCl-0.01 M Tris-HCl buffer (pH 7.0). 
During the first 8 to 12 hrs of extraction, typically 
more than 95% of the total low molecular weight protein 
population that can be obtained in a three day 
extraction is recovered. Most osteogenic activity is 
associated with these low molecular weight proteins. 
About 15 ml of the 4 M GuHCl-0.01 M Tris-HCl buffer 
(pH 7.0) solution is used per gram dry weight of 
demineralized bone powder. After the extraction period 
is complete, the extract is filtered, for example, over 
Whatman paper, and the filtrate concentrated by 
conventional procedures; in typical experiments, an 
Amicon ultrafiltration apparatus (Amicon Corporation, 
Danve r ST-Mas sachus e tts-)- wi-th-a__memhr ane _f il t er_ with 
molecular cut-off size of approximately 5,000 daltons is 
used for the concentration step (that is, the membrane 
retains molecules having a molecular weight greater than 
approximately 5,000 daltons, for example, an appropriate 
Diaflo® ultrafiltration membrane such as YM-5). 

The various buffers, for example, the 4 M 
GuHCl-0.01 M Tris-HCl buffer, the solutions, for 
example, the 0.5 N HC1 solution, described herein are 
aqueous buffers or solutions in which the indicated 
materials are present in water at the indicated 
concentration. The protein components of the 
concentrated protein solution were fractionated using 
various conventional chromatographic techniques 
including high performance liquid chromatography (HPLC) 
as follows: 

The initial protein fractionation was 
conveniently accomplished by chromatography on a 
Sepharose CL-6B (Pharmacia Chemicals, New Jersey) 



WO 90/03733 



PCI7US89/04458 



- 26 - 

column. In a typical experiment, the proteins extracted 
as described herein are concentrated by ultrafiltration 
to a concentration of about 25 to 40 mg/ml. The 
concentration of proteins in various extract 
5 preparations and column fractions were usually estimated 
by conventional means such as spectrophotometric 
measurement of the absorbence of the solutions at 280 
nanometers (nm). An appropriate amount of protein 
concentrate (an amount providing approximately 500 mg of 

10 protein) was applied to a 5 centimeter (cm) x 90 cm 
Sepharose CL-6B column equilibrated with 4 M 
GuHCl-0.01 M Tris-HCl buffer (pH 7.0). The column is 
eluted with the 4 M GuHCl-0.01 N Tris-HCl buffer 
(pH 7.0) at a hydrostatic pressure head of between about 

15 50 to 100 cm and individual fractions of 15 to 20 ml 

volume collected. A typical elution profile under the 
above conditions was obtained by measuring the 
absorbence of individual fractions at 280 nm and is 
shown~"in" Figure It—— . 

20 The bone inducing activity of various 

fractions eluted from the Sepharose CL-6B column was 
measured, using the bone induction assay system 
described herein, and indicated that the pool of 
fractions identified as "C" in Figure 1 contained the 

25 factors responsible for the osteogenic activity. 

Pool C, which consisted of pooled fractions V, VI and 
VII, was concentrated using conventional procedures. In 
a standard extraction, pool C obtained from the elution 
of the total proteins on the Sepharose CL-6B column 

30 represents about 40% of the total proteins obtained in 
an 8 to 12 hr extraction of demineralized calf bone 
powder with 4 M GuHCl-0.01 M Tris-HCl buffer (pH 7.0). 
Further fractionation was then achieved by 
chromatography on a Sephacryl S-200 (Pharmacia 

35 Chemicals, New Jersey) column. In a typical experiment, 
75 to 100 mg of proteins from pool C are applied at a 



concentration of approximately 25 mg/ml to a 
2.2 cm x 115 cm Sephacryl S-200 column and the column 
eluted with 4 M GuHCl-0.01 M Tris-HCl buffer (pH 7.0) 
under a hydrostatic pressure head of between about 50 to 
75 cm and individual fractions of approximately 4 ml in 
volume collected. A typical elution profile which was 
obtained under the above conditions is shown in 
Figure 2. 

Fractions from the Sephacryl S-200 column were 
pooled (see Figure 2) and the resulting pooled materials 
arbitrarily identified as alpha (a), beta (e), gamma I 
(yl), gamma II (yll) and delta (6). 

Analysis of the proteins, using conventional 
discontinuous polyacrylamide gel electrophoresis in the 
presence of sodium dodecyl sulfate visualizing the 
protein bands by staining with coomassie blue [Laemmli, 
U.K., Nature, Vol. 227, pp. 680-685 (1970)], contained 
in the respective alpha through delta pools allowed 
identif i cat ion" of ~several-prote-i-ns-. — It__was_fpu_nd jthat_ 
the alpha pool contained minor protein components of 
molecular weight higher than 50,000 daltons; the beta 
pool contained a major species at 38,000 to 40,000 
daltons, some minor higher molecular weight 
contaminants, and small quantities of lower molecular 
weight protein species migrating between 14,000 and 
30,000 daltons; the gamma I and gamma II pools contained 
four major size class species migrating at 31,000 to 
35,000 daltons, at 22,000 to 25,000 daltons, at 16,000 
to 18,000 daltons, and at 12,000 to 14,000 daltons; the 
delta pool contained mostly proteins in the 12,000 to 
14,000 dalton range. 

Measurement of activity in the bone induction 
assay essentially as described herein indicated that the 
gamma I and gamma II pools contained factors inducing 
bone formation. 



WO 90/03733 



PCT/US89/04458 



- 28 - 

To simplify the discussions concerning the 
final purification of the osteogenic factors, a list of 
the protein species found in the beta, gamma and delta 
pools is presented in Table 1. As indicated previously, 
each of the respective major protein species was 
assigned an identifying code (PI, P2 and the like) as 
indicated in Table 1. 



10 



15 



Table 1 



Major Species 



Assigned 
Name 

PI 
P2 



Estimated 
Molecular 
Weight X 10 

38-40 
30-33 



-3 



Minor Species 



Assigned 
Name 



PA 
PB 



Estimated 
Molecular 
Weight X 10 



28-30 
24 



-3 



20 



25 



30 



35 



P3 

~P4~ 

P5a 
P5b 



22-24 

16-18- 

13-14 
14* 



PC 



PD 



19 



12 



All primary molecular weight assignments of protein 
species are based on mobilities in discontinuous 
polyacrylamide gel electrophoresis with 13% 
acrylamide at pH 8.8 in the resolving gel in the 
presence of sodium dodecyl sulfate and a reducing 
agent. The minor protein species represented less 
than 10 to 15 percent of the total material in the 
respective samples analyzed on gels. *P5b migrates 
at about 10,000 daltons under non-reducing conditions 
which serves to distinguish P5a from P5b. 



Reverse Phase HPLC Purification 
of the Osteogenic Preparation 

A further purification step was carried out by 

reverse phase HPLC of the partially purified protein 

preparations, obtained from Sephacryl S-200 column 

chromatography, using a Beckman Altex HPLC controlled by 



WO 90/03733 



PCT/US89/04458 



a Model 421 microprocessor unit. Two approaches have 
been used. 

A characteristic feature of some of the 
isolated proteins, especially the P3 protein family 
5 described herein and the osteogenically active protein 
preparation copurifying therewith is the lack of 
solubility in the absence of a strong dissociating agent 
such as GuHCl. In addition, when multiple protein 
species were simultaneously present in a pool, the 

10 removal of GuHCl resulted in a coprecipitation of other 
proteins along with the P3 proteins including the P3 OF 
31-34 . A method was, therefore, developed where narrow 
pools consisting of only one or two major proteins were 
obtained from the Sephacryl S-200 column and used as the 

15 starting material for further purification by HPLC. In 
addition, in order to maximize the retention of proteins 
in solution, pools such as the ones described above were 

J dialyzed directly against an aqueous solvent containing 

0.1% t r if luor dace t xcr acrd— (-TFA-)- suppl emen t ed_wi _th_ __ __ 

20 acetonitrile (ACN) at concentrations of between 10% to 
15% by volume. A conventional dialysis membrane tubing 
with molecular weight cut-off size of 3,500 daltons or 
lower is conveniently used in this procedure. Proteins 
soluble in the TFA: ACN solvent could then be 

25 conveniently obtained by removal of the insoluble 

material from each dialyzed pool by centr if ugation. The 
soluble proteins at this point could be chromatographed 
on a reverse phase HPLC column such as the Protesil 300 
octyl column described herein. In a typical experiment, 

30 the TFA : ACN soluble proteins obtained from the peak 
fractions in this manner were applied to a 
0.46 cm x 25.0 cm Protesil 300 octyl column (Whatman) of 
10 micron particle size equilibrated with 
0.1% TFA: 10% ACN. Proteins bound to the column under 

35 these conditions were eluted at a flow rate of 60 ml/hr 
using a linear 10% to 80% ACN gradient developed over 



45 minutes. In a typical experiment, as indicated in 
Figure 3A, P2 and PI proteins were sequentially 
recovered with increasing ACN concentrations (depicted 
by the dashed line) from the gamma I peak. Similarly, 
PI protein can be obtained from the beta peak while P5a 
and P5b are obtained from the delta peak. The P3 
protein and the osteogenically active protein associated 
therewith elute between the gamma I and gamma II regions 
of the Sephacryl S-200 column. The P3 and P3 OF 31-34 
protein preparation is found in both the soluble and the 
insoluble materials obtained by dialysis of appropriate 
functions against TFA:ACN. The lack of solubility of 
the P3 and P3 OF 31-34 proteins, thus yields 
osteogenically active protein in the presence of 
substantially purified P3 protein in the insoluble 
material. The P3 and P3 OF 31-34 proteins retained in 
solution in the TFA : ACN solvent can be further purified 
by reverse phase HPLC essentially as described above. 

~~ TIie~ second-procedure -to_pjiri^ to an 

essentially homogeneous state was designed to take 
advantage of the high degree of insolubility of certain 
proteins in the 35,000 to 14,000 dalton range, 
especially when they are present together at high 
concentrations (for example, approximately 10 mg/ml). 
In this procedure, proteins eluting in the gamma I and 
gamma II pools from the Sephacryl S-200 column 
chromatography (that is, the pools where the bone 
inducing activity is found) were concentrated to 
approximately 10 mg/ml. The material was rapidly 
dialyzed [for example, six changes each of 4 liters 
every 2 to 3 hrs, (using dialysis tubing with a 
molecular cut-off size of 2,000 daltons)] against 
deionized distilled water at 15° to 23°C. Precipitated 
proteins were collected by centrif ugation and washed 
several times with deionized distilled water keeping the 
concentration of protein at higher than 10 mg/ml of 



WO 90/03733 



PCT/US89/04458 



- 31 - 

washing water. The principal constituents of this 
precipitated material were found to be P2, P3 f P4 and 
P5a; small amounts of PI protein was found in variable 
quantities in some cases. The final pellet was 
5 dissolved in 0.1% TFA with 15% ACN and the solubilized 
material was applied to a Protesil 300 octyl column. 
Increasing ACN concentration eluted the P2, P4, P5a and 
P3 proteins as shown in Figure 3B f a typical elution 
profile. 

10 Each of the major protein species described in 

Table 1 was further purified by rechromatographing on 
the Protesil 300 octyl column. Pools of fractions 
obtained as indicated in Figure 3 were concentrated by 
lyophilization and redissolved in 0.1% TFA and about 10 

15 to 20% ACN depending upon the particular lyophilized 
material and reapplied to the Protesil 300 octyl 
column. The proteins were eluted from the column using 

— a_ l.inear_10 %_^to 80% ACN gradient at a flow rate of 

60 ml/hr under condition¥~aiT^r^r^^ 

20 except that the proteins were eluted over a longer 
period^ thus resulting in numerous individual 
fractions. The purity of each of the protein fractions 
- was determined using conventional discontinuous PAGE. 
Those fractions which showed only one major species were 

25 used for further chemical and biological 

characterizations. Typically, these fractions were 
lyophilized and stored as lyophilized powders. 

Figure 4 depicts the results of a typical 
discontinuous gel electrophoretic analysis on sodium 

30 dodecyl sulf ate-polyacrylamide gels. The analysis was 
performed on a discontinuous polyacrylamide gel system 
in the presence of sodium dodecyl sulfate and a reducing 
agent where the resolving gel was 13% in acrylamide and 
0.35% in bis-acrylamide crosslinker at a pH of 8.B. The 

35 gel was run at 50 volts for 30 minutes followed by 7 hrs 
at 100 volts. Protein bands were visualized by staining 



WO 90/03733 



PCT/US89/04458 



- 32 - 

with coomassie brilliant blue R. Columns 1 and 8 depict 
gels with the following standard molecular weight 
markers: 95 f 000 (phosphorylase A), 68,000 (bovine serum 
albumin), 43,000 (ovalbumin), 31,000 (carbonic 
5 anhydrase), 21,000 (soybean trypsin inhibitor), and 
14,000 ( ribonuclease) ; columns 2, 3, 4, 5 and 6 show, 
respectively, the PI, P2, P3 (including the P3 OF 31-34 
protein), P4 and P5 protein (CP1 through CP5) from 
demineralized calf bone powder; and column 7 the 

10 P3/osteogenic protein (HP3) from demineralized human 
bone powder. Portions shaded with oblique lines are 
bands of low concentration. 

The calf and the human protein preparations 
comprising the P3/osteogenic proteins each, when 

15 implanted in rats following the bioassay system 

described herein, induces the formation of bone at the 
implant site in approximately 3 weeks. It appears that 

~ the-os-teogenic-pro.teij^^v^ict^ copurify with the members 

of the P3 protein family isolated from different mammals 

20 will show osteogenic activity in mammals in general. 
Thus, the P3 proteins represent a family of 
immunologically related proteins which copurify with the 
primary osteogenic factors according to the above 
methods . 

25 

Bone Induction Assay System 

To determine the osteogenic activity of test 
protein fractions or proteins a procedure such as the 
following can be used. Bone matrix powder (75 to 500 ym 

30 size) is demineralized as described herein and then 
extracted sequentially three times, each with 15 to 
20 ml of 4 M GuHCl per gram of demineralized bone 
powder. The extracted matrix is extensively washed with 
water, followed by ethanol and ether and then the powder 

35 is dried. This powder, when implanted in a test animal, 
such as a rat, does not induce osteogenesis and is 



WO 90/03733 



PCT/US89/04458 



- 33 - 

called inactive bone matrix (IBM). In order to measure 
the activity of a protein preparation, the IBM powder is 
mixed with an aqueous solution or suspension of the 
protein and the water removed by lyophilization. The 
5 reconstituted matrix is then packed in gelatin capsules 
and implanted subcutaneously near the thigh muscles of 
young (one to two months old) rats. Varying amounts of 
protein preparations are used together with a constant 
amount of IBM in each capsule to determine the efficacy 

10 of the different protein preparations. Osteogenic 

activity in each implant is estimated by two approaches, 
(a) measuring the level of the enzyme alkaline 
phosphatase in the implant tissues at 17 to 20 days 
following implantation and (b) performing a histologic 

15 examination of a 5 to 7 micron thick section of the 

tissue developed at the implant site following staining 
of paraffin-fixed sections of this tissue with toluidine 
blue (stains cartilage matrix and bone matrix), 
hematbxy rin-eosin— ( r esol-ves - f ibrous carii^gijious and 

20 bone tissues) and von Kossa silver stain (for calcified 
matrix of bone tissue). 

The level of alkaline phosphatase is measured 
since active bone formation is characteristically 
preceded by a significant surge of this enzyme and 

25 continued formation of bone is accompanied by a stable 

elevated level of alkaline phosphatase activity compared 
to that found in non-bone fibrous tissue surrounding the 
implants. An approximate quantitation of the levels of 
bone inducing activity in a protein preparation has been 

30 obtained by quantitating the level of alkaline 

phosphatase per unit weight of implant tissue. In 
practice, the implant tissue is homogenized in an 
appropriate buffer such as Tris-saline, dissociated with 
a nonionic detergent and the solubilized enzymes that 

35 are released from the tissue are obtained by removing 

the debris using centrif ugation. The levels of alkaline 



WO 90/03733 



PCT/US89/04458 



- 34 - 

phosphatase are quantitated by measuring the conversion 
of paranitrophenylphosphate to paranitrophenol catalyzed 
by dilutions of the test extract and calculating from a 
standard curve of known enzyme activity. 
5 In bioassay studies, protein pools from the 

Sephacryl S-200 column were reconstituted with IBM and 
implanted subcutaneously in rat thighs. Measurement of 
alkaline phosphatase activity and histological 
evaluation of sections of explants removed 17 to 20 days 

10 after implantation, showed that the PI and the P5a-P5b 
proteins do not have bone inducing activity. The 
bioassay studies indicated the presence of maximum 
osteogenic activity in proteins in pools gamma I and 
gamma II. The three major components of the gamma 

15 fractions, that is, the P2 protein, the P3 and P3 OF 
31-34 protein and the P4 proteins were purified using 
reverse phase HPLC as described above. The purified 
proteins, either singly or in a complete mixture, were 

~reconstituted~ w ^ a bone 

20 induction assay performed. The results are shown in 
Table 2. 



25 



30 



35 



WO 90/03733 



PCI7US89/04458 



10 



15 



- 35 - 

Table 2 

Alkaline 
Phosphatase 
(units/q) 

IBM* Alone <5 

IBM + 750 yg P2 protein <5 

IBM + 750 yg P3 protein 78 
(including the 
P3 OF 31-34 protein) 

IBM + 1000 yg P4 protein <5 



IBM + 250 yg each of 63 
P2, P3 (including the 
P3 OF 31-34 protein) 
and P4 proteins 

* " IBM" means Inactive Bone Matrix. 
"<" means less than. 



Histology 
Fibrous Tissue 
Fibrous Tissue 
New Bone 



Fibrous Tissue 
(a small trace 
of cartilage) 

New Bone 



~~ The~~dat:a~~in Table— 2- -indicate— that_the_P3 

20 protein (including the P3 OF 31-34 protein) alone 

induced the formation of bone. Implants containing the 
P3 and P3 OF 31-34 preparation developed into tissues 
that contained high levels of alkaline phosphatase 
enzyme activity. In contrast, implants prepared by 

25 reconstituting with either the P2 or the P4 preparation 
failed to produce detectable bone. When all three 
preparations were used in combination, significant bone 
formation was observed and high levels of alkaline 
phosphatase enzyme were obtained with one-third the 

30 amount of P3 protein preparation (as compared to the P3 
protein implant alone). It thus appears that at low 
concentrations of P3 protein preparation including P3 OF 
31-34 , the presence of the P2 and/or the P4 protein 
provides enhancement of osteogenesis induced by the P3 

35 protein preparation. 



WO 90/03733 



PCT/US89/044S8 



- 36 - 

In using the active preparations described 
herein, an osteogenic amount of the protein and/or 
active polypeptide and/or immunologically related 
entity, with or without a pharmaceutically acceptable 
5 carrier, is administered at or in the proximity of the 
site in the mammal at which bone induction is desired. 
Administration will depend on the age, condition, sex 
and other characteristics of the subject to be 
treated. Preferred administration is by implantation, 

10 local injection or time controlled delivery using 

microcapsules, or other devices. Dosages will depend on 
the site and configuration of the area to be healed, 
such as, for example, a fracture zone. For example, a 5 
cubic millimeter bone chip can be obtained with about 

15 100 to 200 micrograms (yg) of P3 protein administered or 
implanted locally in the form of an implant in about 
100 mg of IBM. 

Active preparations can include other suitable 
b ioa c t i ve~ma te ria l 1 s ~su ch— a-s-g r ow t h .f ac.to.r_s_,_ jchemqt a c t i c 

20 agents, steroids, antibiotics, anti-inflammatory agents 
and the like. 

Also provided by the present invention are 
alternative methods whereby the osteogenic protein 
present in the preparation purified according to 

25 Example 1 may be treated so as to isolate the P3 OF 
31-34 protein which is of extremely high purity and 
osteogenic potency. 

The process of Example 1 for obtaining the P3 
family of immunologically related protein included a 

30 demineralization step, a guanidine extraction step, a 
size fractionation step in non-reducing denaturing 
solvents, a dialysis step and a reverse phase HPLC 
step. An improvement of the size fractionation step 
involved the use of molecular sizing filters which could 

35 fractionate very large volumes of material and yield a 

molecular weight cut between 5,000 or 10,000 daltons and 



100,000 daltons (5K-100K or 10K-100K). A second 
improvement of the size fraction step relied on the 
pooling of protein fractions eluting within narrower 
molecular weight ranges from a gel filtration 
chromatography column (Sephacryl S-200) run in a non- 
reducing denaturing solvent. Using the S-200 column, 
the osteogenic activity was eluted within the region 
corresponding to a molecular weight range of 
25,000-38,000 daltons, whereas the yl and yll pools used 
to purify the P3 protein had a molecular weight range of 
14,000-40,000 daltons wherein the material 
immunoreactive with the antibodies directed against the 
major immunogenic determinants in the P3 protein 
migrated between the molecular weight range of 
14,000-25,000 daltons (Figure 8). 

With use of these improvements to the process, 
the osteogenic activity eluted from reverse phase HPLC 
col-umns-wi thin _the__s_ame_concent£at ions of acetonitrile 
as those concentrations of acetonitrile required "to 
elute the P3 family of related proteins. Reverse phase 
HPLC of the S-200 active pool (eluting within the 
molecular weight range of 25,000-38,000 daltons) allow 
further resolution of these components of P3 protein 
which could be subf ractionated using additional or 
different fractionation steps. 

Fractionation of the osteogenically active 
pool of 25,000-38,000 dalton proteins using DEAE ion- 
exchange chromatography columns (Pharmacia Chemicals, 
New Jersey) showed that the osteogenic activity does not 
bind to the DEAE column at pH 6.5 and thus could be 
separated from material which bind to DEAE-column. 
Further fractionation of the osteogenically active 
protein preparation has been achieved using 
chromatofocusing columns (Pharmacia Chemicals, New 
Jersey) whereby the activity is recovered at an apparent 
pH of 7.5 or greater. This extended purification work 



- 38 - 



of osteogenically active molecules in P3 proteins has 
also indicated that the osteogenic activity was distinct 
from the TGF-beta and TGF-beta immunoreactive 
material. The osteogenic activity bound binds to a 
Mono-S FPLC (Fast Protein Liquid Chromatography) column 
(Pharmacia Chemicals, New Jersey) equilibrated at pH 6.5 
and can be eluted at a NaCl concentration greater than 
that required to elute the TGF-beta or TGF-beta 
immunoreactive material. It was also found that the 
osteogenic activity in the S active pool eluted from 
Mono-S column again could be characterized by its 
elution from a reverse phase HPLC column within the same 
concentrations of acetonitrile required to elute the P3 
proteins. 

Example 2 

Alternative Method for 
Purification of Bovine Osteogenic Factors 

Th i s ~ex amp le — iiiu s fer a t e s-an_a 1 1 .ernat ive_ me t h od 

providing the complete purification of the 

osteogenically active 31,000-34,000 dalton components of 

the P3 protein from larger quantities of bone powder and 

demonstrates that these protein components which are 

minor constituents of the P3 protein are osteogenically 

active in the essential absence of the major 

22,000-24,000 dalton protein component. According to 

this example, bovine osteogenic factors were isolated 

from demineralized calf bone powder according to the 

procedure disclosed in Figure 9. Approximately 

200 pounds of diaphysial sections of calf bone were 

scraped clean of connective tissue and marrow was 

removed. The demar rowed sections were ground to a 

powder and washed with approximately 2100 liters of cold 

deionized water. The bone powder was allowed to settle 

during the water washes and the suspended connective 

tissue fragments were removed with the supernatant and 

discarded. 



WO 90/03733 



PCT/US89/04458 



- 39 - 

The bone powder was suspended in a total of 
approximately 570 liters of cold 0,5 H HC1 for about 
2 hours and was then allowed to settle. The HC1 was 
removed with the supernatant and discarded. The 
5 remaining HC1 was removed by washing the bone powder 
with approximately 700 liters of cold deionized water, 
followed by approximately 350 liters of cold 0.1 M Tris, 
pH 7, solution. The demineralized bone powder 
(demineralized bone) was allowed to settle and the 

10 supernatant was discarded. 

The demineralized bone powder was suspended in 
approximately 140 liters of cold 4 M guanidine 
hydrochloride containing 0.01 M Tris, pH 7, and 0.001 M 
EDTA for about 20 hours. The extracted bone powder was 

15 removed by filtration and discarded. The supernatant 
(guanidine extract) was saved. 

The guanidine extract was filtered through 

J Amicon spiral cartridges with an average molecular 

we i ghF~cu to f f ~of " TO 0", 000- da-ltons. — The ,1.0 0 ■ _,JQ 00 da 1 to n 

20 filtrate (100K filtrate) was then concentrated through 
Amicon spiral cartridges with molecular weight cutoffs 
of 10,000 daltons. The 10,000 dalton retentate (10K 
retentate) was saved and assayed for pH, conductivity, 
total protein content by BCA colorimetric protein assay 

25 (Pierce Chemicals, Rockford, Illinois), resolution of 

protein constituents in the preparations using reducing 
SDS-PAGE followed by silver staining or coomassie blue 
staining and determination of the osteogenic activity 
using the rat implant assay disclosed below in 

30 Example 3. 

The 10K retentate was exchanged into 6 M urea 
containing 50 mM 2-(N-morpholino)ethanesulf onic acid 
(MES), pH 6.5, by diaf iltration with an Amicon spiral 
cartridge with a molecular weight cutoff of 
35 10,000 daltons. 



WO 90/03733 



PCT/US89/04458 



- 40 - 

The diafiltered extract was adjusted to a pH 
of 6.5 using 5 M NaOH and a conductivity of 10 mS/cm 
using 5 M NaCl and applied to a 0.4 liter S-Sepharose 
column (Pharmacia Chemicals, New Jersey) equilibrated 
5 with 6 M urea containing 50 mM MES , pH 6.5, adjusted to 
conductivity of 10 mS/cm. The column was washed with 
2.4 liters of 6.0 M urea containing 50 mM MES, pH 6.5, 
adjusted to a conductivity of 10 mS/cm to elute the 
unbound proteins. The S-Sepharose active pool (SS Pool) 

10 was eluted with 1.2 liters of 6.0 M urea containing 
50 mM MES, pH 6.5, and 0.5 M NaCl. The S-Sepharose 
active pool was concentrated using membrane filters with 
an average molecular weight cutoff of 10,000 daltons. 
The pH and conductivity of the preparation were 

15 determined, the total protein content was measured by 
BCA protein assay, the protein constituents were 
analyzed using SDS-PAGE followed by silver staining and 
the osteogenic activity was determined using the rat 

implant-assay . _._ 

20 The S-Sepharose active pool ^wa¥~gel~fTlter ed"~ 

with a 3 liter Sephadex G-25 column (Pharmacia 
Chemicals, New Jersey) equilibrated with 6 M urea 
containing 20 mM ethanolamine, pH 9.5. The first 
protein peak containing the active pool (G-25 Pool) was 

25 eluted with 3 liters of 6 M urea containing 20 mM 
ethanolamine, pH 9.5. 

The G-25 Pool was applied to a 0.7 liter 
Q-Sepharose column (Pharmacia Chemicals, New Jersey) 
equilibrated with 6 M urea containing 20 mM 

30 ethanolamine, pH 9.5. The column was washed with 

2.1 liters of 6 M urea containing 20 mM ethanolamine, 
pH 9.5, to elute the unbound proteins. The 
osteogenically active protein pool (QS Pool) was eluted 
from Q-Sepharose column with 1.4 liters of 6 M urea 

35 containing 20 mM ethanolamine, pH 9.5, and 0.2 M NaCl. 
The QS Pool was adjusted to a pH of 6-7 with glacial 



WO 90/03733 



PCT/US89/04458 



- 41 - 

acetic acid and concentrated using membrane filters with 
an approximate molecular weight cutoff of 
10,000 daltons. The QS Pool was assayed for pH and 
conductivity; the total protein content was determined 
5 by BCA protein assay, the protein constituents were 
analyzed by reducing SDS-PAGE followed by silver 
staining and the osteogenic activity was measured using 
the rat implant assay. 

The QS Pool was then applied to a preparative 

10 C-18 HPLC column equilibrated with a buffer containing, 
by volume, 70% Buffer A (Buffer A is 0.05% 
trif luoroacetic acid in water) and 30% Buffer B 
(Buffer B is 0.025% trif luoroacetic acid in 
acetonitrile) . Bound proteins were eluted using a 

15 linear gradient of 30% to 60% acetonitrile in 

120 minutes. As previously characterized for P3 protein 
of example 1, the osteogenic activity (Prep HPLC Pool) 

_ eluted within the concentrations of 35% to 45% 

acetonitrile. The Prep^l^^o^l^a^ry^fim 

20 resuspended in 1 ml of water. The Prep HPLC Pool was 
assayed for pH and conductivity; the total protein 
content was determined by BCA protein assay, the protein 
constituents were analyzed by reducing SDS-PAGE followed 
by silver staining and the osteogenic activity was 

25 measured using the rat implant assay. 

The Prep HPLC Pool was adjusted to a protein 
concentration of 0.5 mg/ml in 6 M urea containing 50 mM 
Tris, pH 7.5-8.0, 20 mM ethanolamine and 0.5 M NaCl and 
was applied to a 5-10 ml Chelating Sepharose 6B column 

30 (Pharmacia Chemicals, New Jersey) charged with Cu 2+ and 
equilibrated with 6 M urea containing 50 mM Tris, 
pH 7.5-8.0, 20 mM ethanolamine and 0.5 M NaCl . The 
column was washed with 5 column volumes of equilibration 
buffer followed by 10 column volumes of 6 M urea 

35 containing 50 mM Tris, pH 7.4-7.8, to elute the unbound 
proteins. Bound proteins were eluted with 10 column 



WO 90/03733 



PCI7US89/04458 



- 42 - 

volumes of 6 M urea containing 50 mM Tris, pH 7 .4-7. 8 , 
and 4 mM imidazole. The osteogenic activity (CC Pool) 
was eluted from the copper chelate column with 10 column 
volumes of 6 M urea containing 50 mM Tris, pH 7. 4-7. 8 , 
5 and 15 mM imidazole. The CC Pool was assayed for total 
protein as estimated by absorbence at 280 nm, and its 
osteogenic activity was measured using the rat implant 
assay. 

The CC Pool was adjusted to 25% ammonium 
10 sulfate and loaded onto a 1-3 ml column of 

Phenyl-Sepharose (Pharmacia Chemicals, New Jersey) 
equilibrated with 6 M urea containing 25% ammonium 
sulfate, 50 mM Tris pH 7.4-7.8. The column was washed 
with 10 column volumes of 6 M urea containing 25% 
15 ammonium sulfate, and 50 mM Tris pH 7.4-7.8, to elute 
the unbound proteins. Bound proteins were eluted with 
10 column volumes of 6 M urea containing 15% ammonium 
sulfate, 50 mM Tris pH 7.4-7.8. The osteogenic activity 
~~(PS ^ool )~~was~ "eluted- f^r-om--the_Ph^y]j-^^phaTose column 

20 with 6 M urea containing 50 mM Tris pH 7.4-7.8, was 

assayed for total protein as estimated by absorbence at 
280 nm, and its osteogenic activity was measured using 
the rat implant assay. 

The PS Pool was applied to a semi-preparative 

25 or analytical C-18 HPLC column equilibrated with a 
buffer containing, by volume, 70% Buffer A and 30% 
Buffer B, as described previously (Buffer A is 0.05% 
trifluoroacetic acid in water and Buffer B is 0.025% 
trif luoroacetic acid in acetonitrile) . Bound proteins 

30 were eluted using a linear gradient of 30% to 60% 

acetonitrile. As was previously characterized, the 
osteogenic activity (HPLC Pool) eluted within the 
concentrations of 35% to 45% acetonitrile. The 
HPLC Pool was assayed for total protein as estimated by 

35 absorbence at 229 nm and its osteogenic activity was 
measured using the rat implant assay. 



WO 90/03733 PCT/US89/04458 



• 43 - 



Characterization of Bovine Osteogenic Factors 
In the following examples, preparations of 
bovine osteogenic factors were characterized according 
5 to various procedures. 



Example 3 
Biological Activity 
The induction of bone matrix was measured 

10 using a rat implant assay as generally described by Sen, 
Walker and Einarson, 1986. In Development and Diseases 
of Cartilage and Bone Matrix , eds. A. Sen and 
T. Thornhill, pp. 201-220. Alan R. Liss, New York and 
Sampath and Reddi, Proc. Natl. Acad. Sci. U.S.A. , 

15 80:6591-6595 (1983). Approximately 70-100 mg of 

inactive bone matrix (bone collagen) was mixed with an 
aqueous solution of osteogenic protein preparation and 

— __the_water_removed by lyophilization. The dried coated 

granules were packed TrT^sl^tilT^pstf^^ 

20 and each capsule was subcutaneously implanted near the 
thigh muscles in each back leg of male Long Evans 
rats. The implanted rats were sacrificed 21 to 28 days 
following implantation and the implant tissue was 
surgically removed and placed in Bouin's Solution. The 

25 specimens were then decalcified and processed for 

toluidine blue stained sections. Histomorphology and 
percent ossification was determined by examination of 
the stained sections. Potency is defined by the amount 
of protein (mg) required for implantation with inactive 

30 bone matrix yielding at least 10% of the area of the 
stained sections occupied by osteoid activity. 



35 



WO 90/03733 



PCT/US89/04458 



- 44 - 
Table 3 

Purification of Osteogenic Factors 

Potency 
in Rat 

Sample Total Protein (mg/implant ) 

Guanidine Extract 130 , 000-170 , 000 mg 

10K Retentate 6/000-15,000 mg 10.0 

S-S Pool 300-900 mg 1.0 

QS Pool 70-250 mg 0.25 

Prep HPLC Active 4-12 mg 0.05 
Pool 

CC Pool 2-5 mg 0.025 

15 PS Pool 0.5-1 mg 0.01 

HPLC Active Pool 0.01-0.05 mg 0.001 

The increase in potency of the various 



10 



20 



25 



30 



35 



osteogenically active proteilT^reparatrons obta-i-ned— — 

using purification steps according to Example 2 is shown 
in Table 3, above, with the HPLC Active Pool having a 
potency of 0.001 mg/implant which is significantly 
higher than the P3 protein produced according to 
Example 1. 

Example 4 

Estimation of Molecular Weight of Osteogenic Activity 
Osteogenically active protein preparations, 
obtained using various purification steps described in 
Example 2, were suspended in SDS sample dilution buffer 
(in the absence of reducing reagents) and applied to a 
10% SDS polyacrylamide gel and electrophoresed. 
Molecular weights were determined relative to either 
prestained molecular weight standards (Bethesda Research 
Labs, Gaithersburg, Maryland) or non-prestained 
molecular weight standards (Bio-Rad, Richmond, 



WO 90/03733 



PCT/US89/04458 



California). After completion, the gel lanes were 
sliced into pieces. Each piece was electroeluted to 
extract the protein. The eluted protein was 
precipitated with acetone, resuspended in guanidine 
5 hydrochloride, dialyzed against water, lyophilized onto • 
inactive bone matrix and implanted into rats to assay 
osteogenic activity according to Example 3. In this gel 
system, the osteogenic activity was eluted from gel 
slices corresponding to the apparent molecular weight 
10 range of 28,000-34,000 daltons. 

Example 5 

Molecular Weight of Purified Osteogenic Factors 
Purified osteogenically active protein 

15 preparation as obtained in the HPLC Active Pool of 

Example 2 were suspended in SDS dilution buffer in the 
absence of reducing reagents (-DTT), electrophoresed on 
12.5% or 15% SDS polyacrylamide gels and the protein 
bands visual" i~zed~by~~s i 1 ver— s ta 1-ni-ng-.— -Mol ec.ula r__ wei _ghts__ 

20 are determined relative to non-prestained molecular 

weight standards (Bio-Rad) . This gel system revealed 
that the HPLC Active Pool contained protein bands which 
migrate within the molecular weight range of 
31,000-34,000 daltons (see Figure 10A) . 

25 

Example 6 

Determination of Molecular Weights of 
Purified Osteogenic Factors Under Reducing 
Conditions and Purification of Reduced Subunits 

Purified osteogenically active proteins in the 

30 

HPLC Active Pool were subjected to an alternative 
analytical method whereby protein subunits held together 
by disulfide bonds can be resolved by reduction of these 
bonds in SDS dilution buffer in the presence of a 
reducing agent (dithiothreitol or B-mercaptoethanol) and 

35 

electrophoreses on 12.5% or 15% SDS polyacrylamide 
gels. Molecular weights were determined relative to 



WO 90/03733 



PCT/US89/04458 



- 46 - 

non-prestained molecular weight standards (Bio-Rad) . In 
this gel system, the HPLC Active Pool revealed proteins 
migrating as two broad bands within the molecular weight 
ranges of 16,000-17,500 and 17,500-19,000 daltons (see 
5 Figure 10B) . 

The HPLC Active Pool was made 6 M in guanidine 
hydrochloride, 50 mM in ethanolamine and 50 raM in 
dithiothreitol to reduce the disulfide bonds. The 
reduced sample was diluted at least 2 fold with either 
10 water or 0.05% trif luoroacetic acid in water and loaded 
onto an analytical C-18 HPLC column equilibrated with a 
buffer comprising, by volume, 70% Buffer A and 30% 
Buffer B, as described previously (Buffer A is 0.05% 
trif luoroacetic acid in water and Buffer B is 0.025% 
15 trif luoroacetic acid in acetonitrile). Bound proteins 
were eluted using a linear gradient of 30% to 60% 
acetonitrile in 60 minutes. Four prominent peaks of 

protein, designated A, B, C and D, were detected by 

monitor ing~UV~ absor bence- a t— 2-2 9-nm ; -thes.e^^uted wi thin 
20 the concentrations of 40% to 47% acetonitrile (see 
Figure 11A) . When analyzed by reducing SDS gel 
electrophoresis followed by silver staining, the reduced 
subunit A migrated within the molecular weight range of 
17,500-19,000 daltons, the reduced subunit B migrated 
25 within the molecular weight range of 16,000-17,500, the 
reduced subunit C migrated within the molecular weight 
range of 17,500-19,000 and the reduced subunit D 
migrated within the molecular weight range of 
17,500-19,000 (see Figure 11B) . 

30 

Example 7 

Amino Acid Sequences of Bovine 
Osteogenically Active Proteins P3 OF 31-34 

The isolated reduced subunits purified from 

35 HPLC Active Pool as disclosed in Example 6, were 

analyzed by a gas phase sequenator (Applied Biosystems, 



WO 90/03733 



PCT/US89/04458 



- 47 - 



Model 470A) , and found to have the following amino- 

terminal sequences: 

Subunit A: SAPGRRRQQARNRSTPAQDV 
Subunit C: SXKHXXQRXRKKNNN 
Subunit D: STGGKQRSQNRSKTPKNQEA 

where the amino acids are represented by the well known 

one-letter and three-letter designations presented in 

Table 4 below. 



10 



Table 4 



15 



20 



25 



30 



riItlJ.no nClu 


Three-Letter 

nOUlcVlal lull 


0ne-Le1 
Symbc 




Al a 
riia 


A 


A T* n i ni np 


Am 


p 


A c t"j ^ rantnp 


Asn 


V4 


ASpaiLlC nClU 


A en 


U 


Cysteine 


Cys 


c 




Gin 


Q 


Glutamic acid 


Glu 


E 


Glycine 


Gly 


G 


Histidine 


His 


H 


Isoleucine 


He 


I 


Leucine 


Leu 


L 


Lysine 


Lys 


K 


Methionine 


Met 


M 


Phenylalanine 


Phe 


F 


Proline 


Pro 


P 


Serine 


Ser 


S 


Threonine 


Thr 


T 


Tryptophan 


Trp 


W 


Tyrosine 


Tyr 


y 


Valine 


Val 


V 


Undetermined 




X 



35 



The isolated subunit B yielded no detectable 



WO 90/03733 



PCT/US89/044S8 



- 48 - 

amino-terminal sequence. When subunit B was digested 
with Staph V8 protease, and rechromatographed by HPLC, 
two detectable internal fragments were isolated having 
the following amino acid sequences: 
5 Subunit B: XWLKNYQDMV 

XEKWLKNYQDM 
where X represents an unassigned amino acid. 

Example 8 

10 Osteogenic Compositions for Implantation 

The osteogenic preparations of the invention 
may be used to prepare osteogenic compositions for 
implantation into mammals. The Prep HPLC Pool of 
Example 2 may be admixed with one or more of a variety 

15 of physiologically acceptable matrices. Such matrices 
may be resorbable, non-resorbable or partially 
resorbable. Resorbable matrices include polylactic acid 
polycaprolactic acid, polyglycolic acid, collagen, 
plaster or~paris"and" a -variety- of— thermoplastic polymer 

20 materials. Non-resorbable materials include 

hydroxyapatite and partially resorbable materials 
include matrices such as tricalcium phosphate. The Prep 
HPLC Active Pool may be adsorbed onto the matrix 
material which can be either in a granular or solid 

25 form. The osteogenic composition may then be dried by 
lyophilization. 

Example 9 

Device Coated With Osteogenic Preparations 
30 In this example, the Prep HPLC Active Pool of 

Example 2 containing the osteogenically active proteins 
was used to form osteogenically active devices useful 
for the healing of bone defects. The devices were 
prepared by absorbing the Prep HPLC Active Pool onto 
35 solid delivery matrices comprising either a porous 
hydroxyapatite disc (Interpore 200, Interpore 



WO 90/03733 



PCT/US89/04458 



- 49 - 

International, Irvine, CA) or a porous polylactic acid 
disc (DRILAC, OSMED Incorporated, Costa Mesa, CA) . The 
discs were 8 to 10 mm in diameter and 3 mm thick and 
were coated with 0.2 to 0.3 mg of the Prep HPLC Active 
5 Pool which was dried onto the matrices by 

lyophilization. The device may then be sterilized by 
gamma-irradiation with as much as 3.3 to 3.5 M rads or 
other suitable means. The devices comprising the 
osteogenic preparation and the matrix were implanted 

10 into trephine defects created in New Zealand Albino 

Female rabbits, weighing 2.5 to 3.0 kg. Specifically, 
test devices either coated with the osteogenic 
preparation or not coated with the osteogenic 
preparation were surgically implanted into the calvaria 

15 using appropriate aseptic surgical techniques. Animals 
were anesthetized with an intramuscular injection of 
Ketamine and Xylazine. Following a midline incision, 

£he_ caj^varium_jwas exposed and two trephine holes (one on 

each side of the midline) 5~mm7 poster i~o~r~-to-the -orbi-ts-, 

20 8-10 mm in diameter and to the depth of the dura were 
cut into the calvarium. Trephine defects were created 
using a Stille cranial drill, exercising great care not 
to injure the dura. A test device was implanted into 
one trephine hole while the trephine hole on the 

25 opposite side was left empty. Following surgical 

implantation, antibiotic prophylaxis with penicillin and 
streptomycin was administered. The animals were 
followed daily by clinical observations. At explant, 
the calvaria was removed en block. The specimens were 

30 fixed in 10% buffered formalin, decalcified and 

processed for hematoxylin and eosin stained sections. 
Histomorphology and qualitative determination of percent 
ossification was determined by examination of the 
stained sections (see Table 5 below). The percent area 

35 of activity is estimated by eye from the fields of view, 
or fraction of fields of view, of newly formed bone 



WO 90/03733 



PCT/US89/04458 



10 



15 



- 50 - 

matrix as compared to the total fields of view not 
occupied by the matrix in the entire full cross section. 

Table 5 

% Ossification in Devices 
Implanted into Rabbit Trephine Defects 

Time of Explant 

Test Device 6 weeks 12 weeks 

Uncoated Hydroxyapatite <10% <25% 

Uncoated Polylactic Acid <10% <10% 

Hydroxyapatite Coated with >90% >90% 

Osteogenic Preparation 

Polylactic Acid Coated with >90% >90% 

Osteogenic Preparation 

Hydroxyapatite Coated with >75% >90% 

Osteogenic Preparation 
and Treated with 
Gamma-Irradiation 



20 Example 10 

Amino Acid Sequences of CNBr Fragments of P3 OF 31-34 
The isolated reduced subunits purified from 
HPLC Active Pool (Example 6) were adsorbed onto 
polyvinylidine difloride (PVDF) transfer membrane 
25 (Millipore, Bedford, MA), exposed to vapors from 

80 mg/ml CNBr in 70% formic acid for 15 to 20 hours and 
sequenced using the gas phase sequenator. The following 
amino acid sequences are represented by the well-known 
one-letter designations presented in Table 4. 
30 Subunit A, following cleavage with CNBr , 

yielded sequences from the simultaneous sequencing of 
several fragments corresponding to the amino terminal 
sequence described in Example 7: 

ANt : SAPGRRRQQARNRSTPAQDV 
35 and an internal fragment: 
Al : NPEYVPK 



WO 90/03733 



PCI7US89/04458 



- 51 - 

Subunit B, following cleavage with CNBr, 
yielded sequences from the simultaneous sequencing of 
two internal fragments: 
Bl : LYLDENEK 
5 B2 : WEGXGXR 

When compared with the sequences of fragments of 
subunit B cleaved with staph V8 protease (Example 7), 
fragments Bl and B2 contain overlapping regions, 
allowing an extended internal sequence in subunit B: 
10 Bl : LYLDENEK 

Staph V8: XEKWLKNYQDM 
Staph V8: XWLKNYQDMV 

B2 : WEGXGXR 
Consensus : LYLDENEKWLKNYQDMWEGXGXR 
15 Subunit D, following cleavage with CNBr , 

yielded sequences from the simultaneous sequencing of 
several fragments corresponding to the amino terminal 
sequence described in Example 7: 

— — DN t-: — STGGKQRS.QNRSA^KNQEA__ 
20 and an internal sequence: 

Dl : XATNHAI VQTLVHP I N 

The isolated reduced subunit C, purified from 
the HPLC Active Pool (Example 6), was adsorbed onto a 
PVDF transfer membrane, subjected to 20 cycles of amino 
25 terminal sequencing using the gas phase sequenator, 

subjected to cleavage by CNBr vapors, and then sequenced 
using the gas phase sequenator. Subunit C, following 
cleavage with CNBr, yielded the following internal 
sequence: 

30 CI: LYLXEYDXWLXNYQ 

The amino terminal and internal sequences of 
subunits A, B, C and D derived from bovine bone can be 
aligned with homologous regions from the deduced amino 
acid sequences of cDNA clones encoding the polypeptides 

35 designated BMP-2A, BMP-2B and Vgr-1 (Figure 12). 

Homologous regions for the deduced sequences of BMP-2A, 



WO 90/03733 



PCT/US89/04458 



- 52 - 

BMP-2B (Wozney, et al., Science, 242, 1528-1534 (1988)) 
and Vgr-1 (Lyons, et al. f Proc. Natl. Acad. Sci. USA, 
86 , 4554-4558 (1989)) are boxed. Homologous residues in 
the sequences for bovine subunits A, B, C and D, as 
5 compared to the deduced sequences for BMP-2A, BMP-2B and 
Vgr-1, are bold-faced ♦ Comparison of the similarities 
and differences of the sequences of subunits B and C and 
the sequences of BMP- 2 A and BMP-2B indicate that bovine 
subunit B shares the same sequence as BMP- 2 A while 
10 bovine subunit C shares the same sequence as BMP-2B . 

Example 11 

Subunit Compositions of Purified 
Osteogenically Active Proteins P3 OF 31-34 

15 Individual fractions, eluting within the HPLC 

active pool (Example 5) and containing the 
osteogenically active proteins P3 OF 31-34 (Figure 13A) , 
were analyzed by SDS polyacrylamide gel electrophoresis 

i-n-fehe-absence_of_x^duc^ng_reagents (Figure 13B) . 

2Q Figure 13A shows the elution profile obtained~by ~filgh~~ 

performance liquid chromatography, on a reverse phase 
C18 column of the PS Pool. Figure 13B shows non- 
reducing SDS polyacrylamide gel electrophoresis of P3 OF 
31-34 proteins eluting in fractions 26, 27 and 28 from 

25 the reverse phase HPLC of the PS Pool. These individual 
fractions were further analyzed (as described in 
Example 6) by reduction of the disulfide bonds with 
50 mM dithiothreitol in 50 inM ethanolamine and 6 M 
guanidine hydrochloride and chromatography on a C18 HPLC 

3Q column (Figure 14). Figure 14A shows the isolation and 
identification of subunits of the P3 OF 31-34 proteins 
eluting in fraction 26 from the reverse phase HPLC of 
the PS Pool, while Figure 14B shows the isolation and 
identification of P3 OF 31-34 proteins eluting in 

35 fraction 28. Subunits A, B, C and D are designated by 

the solid lines in the figures. Fraction 26, the sample 



WO 90/03733 



PCT/US89/04458 



~ 53 - 

comprising the lowermost band of the P3 OF 31-34 region 
(Band I of Figure 13B) , was found to contain 
predominantly subunits B and D with smaller amounts of 
subunits A and C. Fractior. 28, the sample comprising 
5 predominantly the uppermost band of the P3 OF 31-34 

region (Band II of Figure 13B), together with a smaller 
amount of Band I, was found to contain increased amounts 
of subunits A and C, and a decreased amount of 
subunit D, as compared to the relative amount of subunit 
10 B. 

These individual fractions, eluting within the 
HPLC active pool and containing the osteogenically 
active proteins P3 OF 31-34 , were electrophoresed on 
12.5% SDS polyacrylamide gels in the absence of reducing 

15 reagent (-DTT), electrophoretically transferred to 

polyvinylidine difloride (PVDF) transfer membranes in 
the presence of 10% methanol, 10 mM cyclohexylamino-1- 
propanesulfonic acid, pH 10-11, at 0.5 amp for 15 to 

~~ ~3 0~mi nu t e ST~a nd--v-i-sua 1 i z ed-by_s±a i n in.g_ _wi . th _Cooma s s i e 

20 brilliant blue R250. Individual protein bands in the ~ 
region of P3 OF 31-34 , defined here as Band I (lower) 
and Band II (upper), were sliced from the membrane and 
subjected first to N-terminal sequencing, and then to 
internal sequencing following treatment with CNBr as 

25 described in Example 10. These procedures revealed the 
following sequence for Bands I and II: 

Subunit 



Band Sequenced Sequences Identity 

30 Band I Internal XATNXAIVQTL D 

LYLDEXEXWL B 

Band II N-Terminal XXXGRRXQ A 

XXGGXQR D 

Band II Internal LYLDXNXXWLXN B 

35 XPEXVPX A 



WO 90/03733 



PCT/US89/04458 



- 54 - 

where the amino acids are represented by the well-known 
one-letter designations presented in Table 4. 

These results indicated that Band I, the 
lowermost band of the P3 OF 31-34 proteins, contains 
5 predominantly subunits D and B, and that Band II , the 
uppermost band of the P3 OF 31-34 proteins, contains 
predominantly subunits A and B. These compositions, as 
well as the observation that these subunits are purified 
as disulfide-linked dimers in the purified P3 OF 31-34 
10 proteins (Examples 5 and 6), indicate that subunits A 

and B may be disulf ide-linked as a heterodimer, and that 
subunits D and B may be disulf ide-linked as another 
heterodimer . 

15 Example 12 

Polyclonal Antisera Against 
Osteogenically Active Proteins P3 OF 31-34 

Antisera specific for proteins containing 

suEuiTi trs"~A - -or— D -were-genera£ed_ against__the following 

synthetic peptides obtained from Peninsula LaboratorTes^~ 

Belmont , California : 

Antibody 

Antigen Designation 
Subunit A (SAPGRRRQQARNRSTPAQDV) 8 lys 7 AbANt 
Subunit D (STGGKRRSQNRSKTPKNQEA) 8 lys 7 AbDNt 

25 

Antisera were generated in rabbits (3- to 6- 
month-old New Zealand white male) using standard 
procedures of subcutaneous injections, first in complete 
Freunds adjuvant, and later (at 14 and 21 days) in 
incomplete Freunds adjuvant followed by bleeding and 
preparation of antisera. 

The AbANt and AbDNt antisera were cross- 
reactive with the synthetic peptide antigens when used 
in an ELISA or Dot Blot format and the reduced subunits 
35 A and D when used in a Western Blot format. The AbANt 
and AbDNt antisera were also cross-reactive with the 



30 



WO 90/03733 



PCI7US89/04458 



- 55 - 

osteogenically active proteins P3 OF 31-34 when used in 
either an EL ISA, Western or Dot Blot format. These 
antisera are not cross-reactive with any presently 
defined form of subunit B or subunit C as determined by 
5 Western Blot and Dot Blot analysis as against purified 
subunit B and subunit C. 

Example 13 
Presence of P3 OF 31-34 Proteins in P3 

10 The protein contained in P3 was isolated 

substantially as described in Example 1 and Figures 2 
and 3, and was purified utilizing gel filtration on 
Sepharose S-200 and reverse-phase HPLC on a Protesil 300 
octyl column equilibrated in 0.1% TFA and 10% ACN. The 

15 protein was then suspended in a SDS dilution buffer in 
the presence of reducing agents (+DTT) and 
electrophoresed on 12.5 or 15% SDS polyacrylamide gels 

{SDS-PAGEJ^.^ Proteins contained within the gel were 

visualized using CoomasFiV'bFiTriantr blue7 -or- were — — 

20 electrophoretically transferred to nitrocellulose in the 
presence of 10% methanol, 10 mM cyclohexylamino-1- 
propanesulfonic acid (CAPS), pH 10-11, at 0.5 amp for 15 
to 30 minutes. The nitrocellulose filter was treated 
for Western Blot analysis utilizing antibodies generated 

25 against synthetic peptides of the N terminal sequences 
of subunit A (AbANt) and subunit D (AbDNt). 

The nitrocellulose paper containing the 
protein was placed in a solution-designated buffer P 
(composed of 20 mM phosphate, pH 7.4; 0.15 M NaCI; 

30 0.05% Tween-20; 0.25% gelatin; and 0.02% sodium a2ide) 
for a minimum of 1 hour at 22°C with agitation. 

Buffer P was then replaced by buffer Q 
(composed of buffer P plus antibodies AbANt and AbDNt) 
for a minimum of one hour at 22°C (or overnight at 

35 4°C). Buffer Q was replaced by Buffer P, which was 

changed four times over a minimum of one hour. Buffer P 



WO 90/03733 



PCT/US89/04458 



- 56 - 

was replaced by Buffer R (buffer P plus 125 l protein A 
at 2.5 x 10 5 cpm/ml, Amersham) and incubated for 
one hour at 22°C with agitation. Buffer R was replaced 
by Buffer P, which was changed at least four times 
5 during one hour of incubation. 

The moist nitrocellulose filter was placed 
between sheets of plastic wrap, and together with a 
lighting screen and X-ray film (Dupont Cronex, 
Wilmington, DE), enclosed in a light-proof folder, and 
10 placed at -70°C for an appropriate period of time. The 
exposed film was developed using standard techniques and 
equipment, and the resulting autoradiograph shown in 
Figure 15 demonstrates the presence of subunits A and/or 
D within the P3 fraction. 



15 



20 



Example 14 

Glycosylation of Bovine Osteogenically 
Active Protein P3 OP 31-34 



Re due ed~"subun it s- -A-and-D_ we r e_ purified f r om 
HPLC active pool as disclosed in Example 6 and were 
subjected to digestion by Peptide-N 4 (N-acetyl-beta- 
glucosaminyl) arginine amidase (N-glycanase, Genzyme) 
and endo-beta-N-acetyl glucosaminidase H (endo H, 
Genzyme) according to manufacturer's specifications. 
25 The relative molecular weights of the reduced subunits, 
both before and after digestion with the 
endoglycosidases, was evaluated by electrophoresis on a 
15% SDS polyacrylamide gel, followed by Western analysis 
using the antibodies designated as AbANt and AbDNt. 
3Q Figure 16 shows reducing SDS polyacrylamide gel 

electrophoresis of reduced subunits A and D before and 
after treatment with either endo H or N-glycanase. 
Western Blot analysis of isolated reduced subunit A, 
both before and after treatment with glycosidases, is 
35 shown in panel A. Western Blot analysis of isolated 

reduced subunit D, both before and after treatment with 



WO 90/03733 



PCT/US89/04458 



- 57 - 

glycosidases, is shown in panel D. A decrease in the 
relative molecular weights , from approximately 
17,500-19,000 daltons to 14,000-16,000 daltons, of each 
of the digested subunits A and D, indicated that the 
5 subunits A and D contain asparagine-linked carbohydrate 
which was sensitive to digestion either by endo H or 
N-glycanase. 

Example 15 

10 Identification of Sequences of Human cDNA 

Encoding Proteins Homologous to Subunit D of 
Bovine Osteogenically Active Proteins P3 OF 31-34 

A variety of techniques can be used to 

identify sequences of human DNA encoding proteins 

homologous to a particular sequenced protein. Such 

15 methods include the screening of human DNA, human 

genomic libraries and human cDNA libraries. A variety 

of oligonucleotide probes can be used including probes 

exactly complementary to the human DNA sequence, 

mixtures~~of prdb"es~complementar-y-to-all -or_some of the 

20 . --■ — 

possible DNA sequences coding for the particular protein 

sequence, degenerate probes synthesized such that all 

possible sequences complementary to all possible DNA 

sequences coding for the particular protein sequence are 

represented, and degenerate probes synthesized using 

nucleotide analogues such as deoxyinosine 

triphosphate. In this example, the polymerase chain 

reaction (PCR) technique was used to amplify sequences 

of human cDNA encoding proteins homologous to subunit D 

of bovine osteogenically active proteins P3 OF 31-34. 
30 

Preparation of cDNA from U-2 OS Cells 

The human osteogenic sarcoma cell line U-2 OS 
was obtained from the ATCC (American Type Culture 
Collection, Rockville, MD) and maintained in McCoy's 5a 

35 

medium supplemented with 10% fetal calf serum and 1% 
glutamine/penicillin/streptomycin. Unless otherwise 



WO 90/03733 



PCT/US89/04458 



- 58 - 

described, DNA manipulations, definition of terms, and 
compositions of buffers and solutions are described by 
Maniatis, T., et al., Molecular Cloning : A Laboratory 
Manual (1982). Poly (A) + RNA was isolated from U-2 OS 
5 cells using the Fast Track-mRNA isolation kit from 

Invitrogen (San Diego, CA). A first strand cDNA copy of 
the mRNA was generated with oligo (dT) as the primer 
using the AMV Reverse Transcriptase System I from 
Bethesda Research Laboratories (BRL, Gaithersburg , 

10 MD). Each reaction used 1 yg of poly (A) + RNA which was 
reverse transcribed into first strand cDNA that was used 
as template in eight separate polymerase chain reaction 
(PGR) DNA amplification reactions. Following cDNA 
synthesis, RNA was hydrolyzed by treatment with 50 mM 

15 NaOH at 65°C, followed by neutralization in 0.2 N HC1. 

PGR Amplification 

Polymerase chain reaction (PCR), as described 
by ~R.~K7 "Saiki", ~et-~a-l-rr -Science _23.9_:j4_87;-^4^1_J 1988), was 

20 used to amplify DNA from U-2 OS cDNA prepared as 

described above. Oligonucleotide primers for PCR were 
synthesized on an automated DNA synthesizer and were 
derived from the amino terminal and internal amino acid 
sequences of bovine subunit D. The 5' PCR primer , 

25 designated ODM-1, corresponded to sequence from the 

first 11 amino acids from the amino terminus of bovine 
subunit D, namely STGGKQRSQNR. This 32-mer contained 
all possible combinations of nucleotide sequence coding 
for this sequence of amino acids and was greater than 

30 4-million-fold degenerate. The nucleotide sequence of 
ODM-1 was 5 1 - 1 T/A ] [ C/G ] NACNGGNGGNAA [ G/A ] CA [ G/A ] [ C/A ] GN 
[T/A][C/G]NCA[G/A]AA[C/T] [C/AlG-3 1 . Bracketed 
nucleotides are alternatives, and ,! N n means all 
alternatives (A, C, T and G). 

35 The 3 1 PCR primer corresponded to an internal 

sequence of bovine subunit D, namely, NHAIVQTLVHFIN, and 



WO 90/03733 



PCI7US89/04458 



- 59 - 

was synthesized as the inverse and complementary 
sequence. This oligonucleotide primer was designated 
ODB-1 and had the sequence 5 ' -TTTTTTTTGGATCC [ G/A ] TTXAT 
[ G/A ] AA [ G/A ] TGXACXA [ G/A ] XGT [ C/T ) TGXACXATXGC [ G/A ] TG [ G/A ] T 

5 T-3'. Bracketed nucleotides are alternatives, and "X" 
represents the nucleotide analog deoxyinosine- 
triphosphate (dITP), which was used in all positions 
where all four of the nucleotides (A, C, T or G) were 
possible. The sequence is preceded on the 5' end by a 

10 string of eight T's, followed by the sequence GGATCC 
which designates a BamHI recognition site, leaving a 
stretch of 39 nucleotides corresponding to the internal 
amino acid sequence of bovine subunit D. 

Amplification of DNA sequences coding proteins 

15 homologous to bovine subunit D using these two primers 
was accomplished using the Perkin-Elmer Cetus Gene Amp 
DNA Amplification Reagent Kit (obtained either from 
Perkin-Elmer Cetus, Norwalk, CT, or United States 
Bi^chemical-'Corpor ati-on ,- -Cl.ev.eland_f_ _ _QH)_. The PCR 

20 reaction contained 1 yg of each primer ODM-1 and ODB-1, 
1/8 of the synthesized U-2 OS first strand cDNA 
(approximately 25-50 ng), 200 yM of each dNTP, and 2.5U 
Ampli-Taq DNA Polymerase in the kit-supplied reaction 
buffer of 50 xaM KC1, 1.5 mM MgCl 2 r 0.1% (w/v) gelatin. 

25 PCR was performed for 30 cycles consisting of 

1.5 minutes denaturation at 94°C, 2 minutes annealing at 
50°C and 3 minutes elongation at 72°C. After the 
30 cycles, a final 10-minute elongation at 72°C is 
performed. 

30 The PCR products were analyzed by agarose gel 

electrophoresis, which revealed a major band of 
amplified DNA of approximately 300 bp. A Southern Blot 
was performed in which the DNA in the gel was 
transferred to a Nytran nylon membrane (Schleicher and 

35 Schuell, Keene, NH) using an LKB Vacugene Vacuum 

Blotting Unit, and then the DNA was UV-crosslinked to 



WO 90/03733 



PCT/US89/04458 



- 60 - 

the membrane using a Stratalinker (Stratagene, La Jolla, 
CA) . The membrane was probed for amplified sequences 
encoding proteins homologous to bovine subunit D using a 
probe corresponding to the amino acid sequence 
5 KTPKNQEALR. This sequence is found near the amino 
terminus of bovine subunit D, following the sequence 
used to constructed the 5' PCR primer. This probe would 
therefore hybridize to amplified sequences that encode 
proteins homologous to bovine subunit D without 

10 overlapping either of the two primers used in the 

amplif ication. This 29-mer probe was designated ODibb 
and had the sequence AAXACXCCXAA[G/A]AA[C/T]CAXGA[G/A] 
GCX[C/T]TX[C/A]G f where bracketed nucleotides are 
alternative and "X" represents dITP f which was used in 

15 positions where all four nucleotides (A f C, T or G) were 
possible. The Southern Blot was prehybridized at 42°C 
in SxSSPE, 0,5% SDS, 3x Denhardt's, 100 yg/ml salmon 

sperm DNA, then hybridized at 42°C in 6xSSPE, 0.5% SDS 

to the ODibb" proffe~whl*ch— had— bee-n— radioactiyjBly__labelled 

20 using polynucleotide kinase and y[ 32 P]ATP. The blot was 
washed at 42°C in 2xSSC, 0.1% SDS. Autoradiography of 
the blot showed that ODibb hybridized specifically to 
the 300-bp PCR-amplif ied DNA. 

25 Example 16 

Cloning and Sequencing of Human cDNA's Encoding 
Proteins Homologous to Subunit D of 
Bovine Osteogenically Active Proteins P3 OF 31-34 

5' phosphates were added to the blunt-ended 

PCR product of Example 15 using kinase and ATP , and the 

30 DNA was then ligated into the Smal cut (blunt end) site 

of the vector pT7T3 18U (Pharmacia, Piscataway, NJ). 

Following digestion with Smal to linearize any religated 

vector, the recombinant plasmid DNA was used to 

transform E. coli TGI cells. Several transf ormants were 

35 

picked and used to purify plasmid DNA by a mini-lysate 
procedure. The size of the insert contained in these 



WO 90/03733 



PCT/US89/04458 



- 61 - 

plasmids was confirmed to be 300 bp by restriction 
analysis . 

DNAs from seven different transf ormants were 
sequenced by dideoxy sequencing methods (Sequenase, 
5 United States Biochemical Corp) . The sequences of three 
of these clones were identical to each other and, when 
translated to amino acid sequence, it was confirmed that 
they were homologous to the sequence of bovine subunit 
D. The sequence of the PCR-amplif ied DNA, designated 

10 "hOD," is shown in Figure 17, along with the known and 
derived amino acid sequences. Only the DNA sequence 
between the two primers is shown, since the degeneracy 
of the primers did not allow the identification of the 
exact sequence in these regions. The sequence of the 

15 first 34 amplified nucleotides following the ODM-1 
primer codes for amino acid sequence previously 
identified in bovine subunit D. 

~ ~~— ---The-sequences_of_j^^other four recombinant 

clones, while identical to each other~we~re~diTf erent 

20 from the hOD-amplif ied sequence and encoded a different 
sequence of amino acids. This family of clones was 
designated M hOE," and its sequence is shown in 
Figure 18. Figure 19 shows the homology between hOD and 
hOE-amplif ied sequences, indicating 69-70% identity at 

25 both the nucleotide and amino acid level in this 

region. Figure 19A shows the homology between the 
derived amino acid sequences of the PCR-amplif ied hOD 
and hOE sequences wherein the homologous residues are 
bold-faced. In the region following the first cysteine 

30 residue, these two sequences share 39/44 identical amino 
acids, a highly conserved region among the members of 
the TGF-B family. Figure 19B shows the homology between 
the nucleotide sequences of the PCR-amplif ied sequences 
designated hOD and hOE. 



35 



WO 90/03733 



PCT/US89/04458 



- 62 - 
Example 17 

Recombinant Expression of P3 OF 31*34 Subunits 
Complete and partial P3 OF 31-34 subunit 
polypeptide products and analogs may be prepared 
5 utilizing recombinant DNA molecules in bacteria f yeast 
or mammalian expression systems. DNA encoding products 
based on amino acid sequences derived from isolated P3 
OF 31-34 subunits according to the present invention can 
be inserted into an expression vector, for example, a 

10 plasmid, phage or viral expression vector [Vieira, et 
al. r Gene , 19, 259-268 (1982); Young, et al., Proc. 
Natl. Acad. Sci. (USA) , 80, 1194-1198 (1983); Bitter, et 
al., Gene , 32, 263-274 (1984); Cepko, et al., Cell , 37, 
1053-1062 (1984); and Gorman, et al., Mol. Cell. Biol. , 

15 2, 1044-1051 (1982)]. 

In particular, P3 OF 31-34 subunits D and E 
may be produced by expression of DNA characterized by 
ftuicl~eot"ide-seg-uM 17 and 18, 

respectively. Alternatively, DNA characterized~by~~ 

20 nucleotide sequences encoding the same sequence of amino 
acids as set out in Figures 17 and 18 could be inserted 
into an expression vector for the same purpose. Analogs 
of these subunits could also be prepared by means of DNA 
sequences which hybridize (or which would hybridize but 

25 for the redundancy of the genetic code) with at least 
80% of the nucleotide sequence shown in Figures 17 and 
18. 

Another aspect of applicants 1 invention 
involves the preparation of osteogenic materials 

30 comprising dimers of subunit D and heterodimers of 

subunit D and subunit B. Osteogenically active dimers 
can be produced either by expression of nucleic acid 
sequences encoding subunit D and subunit B in the same 
cell allowing disulfide bonds to form during the 

35 biosynthetic process, or by separately expressing each 
subunit in different cells and then combining each 



WO 90/03733 



PCT/US89/04458 



- 63 - 

expressed subunit in such a way as to form a disulfide 
linked dimer. Dimers of subunit A and heterodimers of 
subunit A and subunit B could similarly be prepared. 
Osteogenic preparations comprising recombinant produced 
5 dimers and heterodimers could be prepared which would 
have the same osteogenic activity as the P3 OF 31-34 
osteogenic preparation isolated according to applicants' 
methods. Similarly, heterodimers, in which a 
polypeptide highly homologous to subunit B, such as 

10 subunit C, is substituted for subunit B, could also be 
produced, Pharmaceutically acceptable compositions 
comprised of such recombinant produced polypeptides in 
conjunction with physiologically acceptable matrix 
materials may be prepared and used in the same manner as 

15 with polypeptides isolated from human bone. 

Numerous modifications and variations in the 
practice of the invention are expected to occur to those 
skilled in the art upon consideration of the foregoing 
de~s~cr ipt ions- of -pr ef erre^ ther eof . 

20 Consequently, only such limitations should be placecT - 
upon the invention as appear in the following claims. 



25 



30 



35 



WO 90/03733 



PCI7US89/04458 



- 64 - 

WE CLAIM: 

1. A preparation of an osteogenic protein 
characterized by a molecular weight of from about 25,000 
to about 38,000 daltons as characterized by non-reducing 

5 denaturing gel filtration and further by the 

characteristic of eluting at concentrations of between 
35% and 45% acetonitrile from a reverse phase high 
performance liquid chromatography column equilibrated 
with buffers containing water, acetonitrile and between 
10 0.025% and 0.05% trif luoroacetic acid. 

2. The preparation according to claim 1 
wherein the osteogenic protein is characterized by a 

15 molecular weight of from about 31,000 daltons to about 
34,000 daltons as characterized by non-reducing sodium 
dodecyl sulfate polyacrylamide gel electrophoresis. 



20 3. The preparation according to claims 1 or~2 

further characterized by having in its reduced state at 
least one protein subunit which comigrates on reducing 
sodium dodecyl sulfate polyacrylamide gels with proteins 
within the molecular weight range of 17,500 to 19,000 or 

25 the range of 16,000 to 17,500 daltons. 

4. The preparation according to claim 3 
wherein one of said subunits is characterized by an 
30 amino-terminal sequence selected from the group 
consisting of 

SAPGRRRQQARNRSTPAQDV , 
SXKHXXQRXRKKNNN and 
STGGKQRSQNRSKTPKNQEA 
35 or is characterized by an internal amino acid sequence 
selected from the group consisting of 



WO 90/03733 



PCI7US89/04458 



10 



15 



20 



- 65 - 

XWLKNYQDMV , 
XEKWLKNYQDM, 
NPEYVPK, 
LYLDENEK , 
WEGXGXR, 

XATNHAIVQTLVHFIN and 
LYLXEYDXWLXNYQ 
wherein X represents an undetermined amino acid. 



5. The preparation according to claim 4 
wherein said osteogenic protein comprises a dimer of two 
subunits linked by at least one disulfide bond. 



6. The preparation according to claim 5 
wherein said dimer is a heterodimer of two non-identical 
subunits linked to each other by at least one disulfide 
bond . 



7. The preparation of claim 6 wherein one 
subunit of said heterodimer is characterized by the 
internal sequence of NPEYVPK, and the other subunit is 
25 characterized by the internal sequence of 
LYLXEXXXWLXNYQ . 



8. The preparation of claim 6 wherein one 
30 subunit of said heterodimer is characterized by the 

internal sequence of XATNHAIVQTL , and the other subunit 
is characterized by the internal sequence of 
LYLXEXXXWLXNYQ. 



35 



WO 90/03733 



PCT/US89/04458 



- 66 - 

9. The preparation according to claim 3 
wherein the subunits selected from the group 
characterized by an amino-terminal sequence consisting 
of: 

5 S APG RRRQQ ARNR S TP AQD V and 

STGGKQRSQNRSKTPKNQEA 
contain asparagine-linked carbohydrate, 

10 10. The preparation according to claim 1 

which is isolated from bovine bone. 

11. The preparation according to claim 1 
15 which is isolated from human bone. 

12. The preparation according to claim 1 

which is isolated~f rom "porcine-bone-. — — 

20 

13. A method for isolating a preparation of 
an osteogenic protein from demineralized bone tissue, 
said method comprising: 
25 (a) treating said demineralized bone tissue 

under aqueous conditions with a solubilizing agent for 
said osteogenic protein and thereby extracting the 
osteogenic factor into solution with said solubilizing 
agent; 

30 (b) subjecting said solution to size 

fractionation to recover a concentrated pool of 
proteins of molecular weight between about 10 , 000 and 
about 100 f 000 daltons; 

(c) subjecting said concentrated pool to a 

35 first chromatography step to recover an active 

preparation of proteins from a S-Sepharose column 



WO 90/03733 



PCT/US89/04458 



- 67 - 

equilibrated with 6.0 M urea containing 50 mM MES pH 6,5 
by eluting the active preparation with 6.0 M urea 
containing 50 mM MES pH 6.5 and 0.5 M NaCl; 

(d) subjecting the active preparation of step 
5 (c) to a buffer exchange step; 

(e) subjecting the active preparation of step 

(d) to a second chromatography step to recover an active 
preparation of proteins from a Q-Sepharose column 
equilibrated with 6 M urea containing 20 mM ethanolamine 

10 pH 9.5 by eluting the active preparation with 6.0 M urea 
containing 20 mM ethanolamine pH 9.5 and 0.2 M NaCl; and 

(f) subjecting the active preparation of step 

(e) to a third chromatography step to recover an active 
preparation of proteins from a C-18 high performance 

15 liquid chromatography column equilibrated with buffers 
containing trif luoroacetic acid and acetonitrile by 
eluting the active preparation at concentrations between 
— — — 3.5.%. _ and ^45J acetonitrile . 



20 

14. A method for isolating a preparation of 
on osteogenic protein according to claim 13 further 
comprising the steps: 

(g) subjecting the active fraction of step 

25 (f) to a fourth chromatography step to recover an active 
preparation of proteins from a chelating-Sepharose 
column charged with Cu 2+ and equilibrated with 6 M urea 
containing 50 mM Tris pH 7.5-8.0, 20 mM ethanolamine and 
0.5 M NaCl by eluting the active preparation with 6 M 

30 urea containing 50 mM Tris pH 7.4-7.8 and 15 mM 
imidazole; 

(h) subjecting the active fraction of step 
(g) to a fifth chromatography step to recover an active 
preparation of proteins from a phenyl-Sepharose column 

35 equilibrated with 6 M urea containing 50 mM Tris pH 

7.4-7.8 and 25% ammonium sulfate by eluting the active 



WO 90/03733 



PCT/US89/04458 



10 



- 68 - 

preparation with 6 M urea containing 50 mM Tris pH 
7.4-7.8. 

(i) subjecting the active preparation of step 
(h) to a sixth chromatography step to recover an active 
preparation of proteins from a C-18 high performance 
liquid chromatography column equilibrated with buffers 
containing trif luoroacetic acid and acetonitrile by 
eluting the active preparation at concentrations between 
35% and 45% acetonitrile. 



15. A preparation of an osteogenic protein 
characterized by the capacity of promoting osteogenesis 
in a mammal and prepared according to the method of 
15 claim 13. 



— 16. A preparation of an osteogenic protein 

characterized by a molecular ^^i^hF~df~f"rom~"about--31rO 00 

20 to 34 f 000 daltons as characterized by non-reducing 
sodium dodecyl sulfate polyacrylamide gel 
electrophoresis/ by the capacity of promoting 
osteogenesis in a mammal and prepared according to the 
method of claim 14. 



17. A method for inducing bone formation in a 
mammal comprising administering to said mammal an 
effective amount of the osteogenic preparation of 
30 claims 1/ 4, 7, 8, 15 or 16. 



35 



18. The method of claim 17 wherein said 
osteogenic preparation is administered admixed with a 
physiologically acceptable matrix material. 



WO 90/03733 PCI7US89/04458 

- 69 - 



19, The method of claim 17 wherein said 
osteogenic preparation is administered in the form of a 
device comprising a structural material encoated with 
5 osteogenic preparation admixed with a physiologically 
acceptable matrix material. 



20. A composition for implantation into a 
10 mammal comprising the preparation of osteogenic factor 
according to claims l f 4, 7, 8 r 15 or 16 admixed with a 
physiologically acceptable matrix material. 



15 21. The composition according to claim 20 

wherein said physiologically acceptable matrix material 
is selected from the group consisting of tricalcium 
phosphate, hydroxyapatite, collagen, plaster of par is 
t he r mopla s t-i e -re sins, _po.lyla.c_t i^__ac_i<J, pol y g lycolic acid 

20 and polycaprolactic acid. 



22. A device for implantation into a mammal 
comprising a structural member encoated with the 
25 composition of claim 20. 



23. A purified and isolated nucleic acid 
comprising a nucleotide sequence selected from the group 
30 consisting of: 

the nucleotide sequence as shown in Figure 17; 
a nucleotide sequence which encodes the same 
sequence of amino acids as encoded by the nucleotide 
sequence shown in Figure 17; 
35 a nucleotide sequence which is homologous with 

80% of the nucleotides shown in Figure 17 and which 
encodes a polypeptide having osteogenic activity; and 



WO 90/03733 



PCT/US89/04458 



5 



10 



15 



20 



25 



- 70 - 

a nucleotide sequence which would be 
homologous with 80% of the. nucleotides shown in 
Figure 17 but for the redundancy of the genetic code and 
which encodes a polypeptide having osteogenic activity. 



24. A cell transformed with a nucleic acid as 
recited in claim 23. 



25. A polypeptide comprising a continuous 
sequence of amino acids encoded by a purified and 
isolated nucleic acid as recited in claim 23. 



26. An osteogenic preparation comprising a 
dimer of two polypeptide subunits linked by at least one 
disulfide bond comprising a first polypeptide subunit as 
recited i n ~c 1 aTnf~ 25~~ — — 



27. The osteogenic preparation according to 
claim 26 wherein said dimer is a heterodimer of two non- 
identical subunits. 



28. The osteogenic preparation of claim 27 
wherein one polypeptide subunit is characterized by an 
internal amino acid sequence selected from the group 
30 consisting of: 
LYLDENEK, 
WEGXGXR, 
XWLXNYQ, 
XEKWLKN YQDM , and 
3 5 LYLXEXXXWLXNYQ . 



WO 90/03733 PCT/US89/04458 



- 71 - 



29. A purified and isolated nucleic acid 
comprising a nucleotide sequence selected from the group 
consisting of: 

5 the nucleotide sequence as shown in Figure 18; 

a nucleotide sequence which encodes the same 
sequence of amino acids as encoded by the nucleotide 
sequence shown in Figure 18; 

a nucleotide sequence which is homologous with 
10 80% of the nucleotides shown in Figure 18 and which 

encodes a polypeptide having osteogenic activity; and 

a nucleotide sequence which would be 
homologous with 80% of the nucleotides shown in 
Figure 18 but for the redundancy of the genetic code and 
15 which encodes a polypeptide having osteogenic activity. 



30. A cell transformed with a nucleic acid as 

r e c i t ed— i n -c la im -29 

20 ~~~~ 



31. A polypeptide comprising a continuous 
sequence of amino acids encoded by a purified and 
isolated nucleic acid as recited in claim 29. 

25 

32. An osteogenic preparation comprising a 
dimer of two polypeptide subunits linked by at least one 
disulfide bond comprising a first polypeptide subunit as 

30 recited in claim 31. 



35 



33. The preparation according to claim 32 
wherein said dimer is a heterodimer of two non-identical 
subunits. 



WO 90/03733 PCI7US89/04458 



- 72 - 



34. The osteogenic preparation of claim 33 
wherein one polypeptide subunit is characterized by an 
internal amino acid sequence selected from the group 
5 consisting of: 
LYLDENEK, 
WEGXGXR, 
XWLXNYQ f 
XEKWLKNYQDM and 
1 0 L YLXEXXXWLXN Yp . 



35. A process for the preparation of an 
osteogenic protein consisting of dimers of polypeptide 

15 monomers selected from the group consisting of P3 OF 
31-34 subunit A, subunit B, subunit C, subunit D and 
subunit E, the process comprising the steps of culturing 
in a suitable culture media one or more cell lines 
transfori^d~wrth~nucleic-aGid -sequenc^s_«icodlng one or 

20 more polypeptides selected from the group consisting of 
P3 OF 31-34 subunit A, subunit B, subunit C f subunit D 
and subunit E, forming dimers of said polypeptide 
monomers by linking them with at least one disulfide 
bond, and isolating said dimers. 

25 



30 



35 



WO 90/03733 



PCT/US89/04458 




WO 90/03733 



PCI7US89/04458 



<0 



<£S<5) ^ ^ ^ ^ 



II I I T 



O 



5? 



Mi 




WO 90/03733 



PCT/US89/04458 



VaPROTEAtt-PGaciNK D3 PROTEIN ^^HPLC colum n 




70 M/n. 



Be-fenh'on Hnn* (minutes) ZOAiin. 





70 Min. 



20 M/n. 




WO 90/03733 



PCT/US89/04458 




IO 25 so too esc BOO 
Cornpeiing onhgen (nanograms Jmilliliier) 

7B 



WO 90/03733 



PCI7US89/04458 



JCO -w 



80 L 



\ 

* 20 



(alt? 



Bovine 




fO 25 SO tOO 2SO SOO 

Competing onfigen (nanograms / f mif/ififer) 




lO 25 SO IOO ZSO SOO 

Cornpering antigen (nanograms /milliliter) 



WO 90/03733 



PCI7US89/04458 



Fig. 8 




50 75 100 

Fraction 



WO 90/03733 



Purification of n««« Q g«ntc Fm»t ? r« 



PCT/US89/04458 
Fig. 9 



Qtean, Grind, 4 wash Calf Bona 

0.3 M MO 



Daminarallzad Bona 



4 U Guar*** Hydfo ch toridt 
0.01 M THIS 
0.001 M CDTA 



Guanldlnt Extract 

100K Uf 



100K 



Flltrata 

10KUF 



10K Ratantata 



I 



10KUF 
6M Uroc 

SO mM MES 



Dlaflltarad Extract 

S-SopharoM Column 
6 M UfM 
SO mM MES 

SS Pool 

Sophadoi G-25 Column 
6MUM 

20 mM EttianotamiM 



G*25Pool 



O-Sophavw* Column 
6 M UfM 

20 mM Emonoiammo 



OS Pool 



C-1S HPLC Column 
0.08% TFA . 

38% twough 45% Aeatonttrite 
LyophtlUo 
Roooniutuio 



Prap HPLC Pool 



i 



Dj 2+ Chofcttno 
6 M UfM 
SO mM Trta 
20 mM EVMnonffltfM 
O.SMNtCI 



Column 



CC Pool 



PS Pool 



I 



PHoftyt*$opftsfOM Column 
25%- Ammonium Suite* 
• M Uroft 
SO mM Tmi 



C-18 HPLC Column 
0.08% TFA 

35% tough 48% Ae»ton*rtto 



HPLC Pool 



WO 90/03733 



PCT/US89/044S8 




WO 90/03733 



10/18 

Fig. 



PCT/US89/04458 





WO 90/03733 



BMP-2A 
BMP-2B 
Vgr-1 

A 
B 

C 
D 
WD 
WE 



PCI7US89/04458 



Fig. 12 




K H 
K H 



K - pQ^l KfR] LpH S S 

h s o bJalbJk|k]n K N 

S R R R alafT RNRSTQ3Q0VSRQSQSSOY 

SApg'rRRQQaRNRST P AQDV 

S x - . KHxxQRxRKKNnN 

St ggKqRSQn rsKt pKNQea 

sKtpKNQealRmanvaen 
NKSSShQDsSRmSsvgDY 



BMP-2A 
BMP-2B 
Vgr-1 

A 

B 

C 
0 

wo 

WE 



N G S E L K T 




LYVDFSDVGWNDWI V A 
L Y VOFSO VQWNOWI VA 
L Y Vl SlPrQlD mG wl Q lD W I I A 



ssSdqrqACKKHELYVSFrDLGWQDWI I a 
NtSEqKqACKKHELYVSFrDLGWQDWI I a 



BMP-2A 
BMP-2B 
Vgr-1 



A 

B 

c 

0 
WO 
WE 




AFYCHGECPFPLAOHLNSTNHA I V 
A FY C H gCSJc P F P L A D H LNSTNHA I V 
A Fn I Y ci "p lG E Cl S tF P Ll N A| h["m! n1"a 1 T N H A I V 



X AT NH A I 
PeGYAAyYCeGECaFPLNs yMNAT 
PeGYAAFYCDGECSFPLNAHMNAT 



BMP-2A 
BMP-2B 
Vgr-1 

A 
B 

c 

0 



OTLVNSVN SIX 
OT L V NSV N sis 



P K A 
P K A 



CCVPTELSA 

C C_V_ P T _E_ L S A 



Q T L Vl H L MlNfP E Y V P K P lC cI a Ip T[ "KkrN|A 



N P E Y V P K 



QTLVHF i N 



S M L Y 
S M L Y 



L Y 
L Y 



BMP-2A 
BMP-2B 
Vgr-1 

A 
B 

C 
0 




|L D El N ElKVV L KNYQlO 
[L D e] Y 0|K V V L K N Y QjE 
f\dJd N S NlvfT lL Kf Tl y(r N 



LDENEKVVLKNYQDMVVEGxGxR 
LxEYDxVVLxNYQ 



WO 90/03733 1 2 / 18 PCT/US89/04458 



Fig. 13A 




24 26 28 30 32 

Minutes of Elutlon 



Fig. 13B 



2 6l 2 7l28 




— 14.4 5 



WO 90/03733 



PCT/US89/04458 



Fig. UA 



13/18 



Tube « 26 
♦DTT ► C-18 



0.012— 



CM 



0.008— 



0.004— 




Fig. 14B 

Tube # 28 

+DTT ■» C.18 



0.020— 



0.010— 



i i i I r 

32 34 36 38 40 

Minutes of Elutlon 




i r 

32 34 36 38 40 

Minutes of Elution 



WO 90/03733 PCI7US89/04458 

/<f//r 



Fig. 15 




WO 90/03733 



Fig. 18 



PCT/US89/04458 



ODM-1 



10 



CAATAAATCCAGCTCTCATC 
N K S S S H 



30 



40 



50 



AGGACTCCTCCAGAATGTCCAGTGTTGGAr 
Q D S S R M S S v c 



ATTATAACACAAGTGAGCAAAAACAAGCCT 
D * N T S E Q K O A 



90 



100 



no 



GTAAGAAGCACGAACTCTATGTGAGCTTCC 
C K K H E L Y V S T 



120 130 140 

GGGATCTGGGATGGCAGGACTGGATTATA- 
R D L G W Q D W T t 



no 



130 no 

CACCAGAAGGATACGCTGCATTTTATTGTG 
A P E G Y A A F Y r 



180 i9o 

ATGGAGAATGTTCTTTTCCACTTAACG'" 
DGECSFPLNA 



ZOO 



210 

ATATGAATGCCACCI 
H M N A T 



ODB-1 



WO 90/03733 



PCT/US89/04458 



/r 



Fig. 19A 



bOO »KTi»QiAt*llA»V A «.,,3DQliOACICKB«irVSrROLClfODWIIAPtO 
hOI »K««9iQt>SS*liSSV(»0T«TStQic01CEIlIl,TV8ril0LOIIQDWIIAPIC 



hOO TAATTClOSCxrVLMs rMVA? 
bOS TAAr TCdGKCs FP LMa iMVAT 



Fig. 19B 

hOD CtccAAgaCgccCaagaAcCAOCAagCCctscQoATGcCCAacGTgGcAG 

hQX CAATAAATCCAGCTCTCAtCAGOACTCCTCCAQaAIGtCCACTGTtGgAG 

hOD Ac aAc Ac CAg c AGc GAc CAgAg cCAc GCCTGTAAGAAGCACGAg c Tc TAT 
W« At T At Aa CAc A AGt GAg CAa Aa aCAa GCCTGTAAGAAGCACGAa c ?c TAT 



hOO s*cagcttccgagacctggoctggcaggactggatcat^cT«tga^~ 

hOt GTg AGCTTCCGcGA? CTGGGaTGGCAGGACTGGATtATa GCaCCa GAAGG 

hoo ctacgccgcctactactgtoaogoggactgtgccttccctctgaactcc? 

Ml aTACGCt GCa T t T TAt TGTGAt GGaGAa TGTtCt TTt CCaCTt AACg CCc 

hOD AcATGAACGCCACC 
hOS AtATGAATGCCACC 



INTERNATIONAL SEARCH REPOK 

Internaitonnl Aoohcation No. PCT/US 8 9/ 0 4 4 5 8 

I. CLASSIFICATION OF SUBJECT MATTER 01 sevof.it classificat ion symools apply, mdicate all) * 
According to International Patent Classification (IPC) or to both National Classification and IPC 

INT CI. 4 AGIN 63/02, A61K 35/32, A61K 37/12 

U.S. CI. 424/95, 530/350, 840 

II FIELDS SEARCHED 

Minimum Documentation Searched ' 



Ciassiftcation System 


Classification Symbols 


INT CI. 4 
U.S. CI. 


A01N 63/02, A61K 
424/95, 530/350, 


35/12, A61K,- 35/32, A61K 37/12 
840 

i — ■ 



Documentation Searched other than Minimum Documentation 
lo the Eitent that such Documents are Included in the Fields Searched • 



III. DOCUMENTS CONSIDERED TO BE RELEVANT « 



Category • 


Citation of Document, 11 with indication, where appropriate, ol the relevant passages « 


Relevant to Claim No. 13 


A 


US, A, 4,627,982 (Sevedin et al.) 09 
December 1986. See entire document. 


1 — 1 


A 


US, A, 4,563,350 (Nathan et al.) 07 
January 1986. See entire document. 


1-16 


A 


US, A, 4,455,256 (Urist et al.) 19 
June 1984. See entire document. 


1-16 


A 


Clinical orthopaedics and related research, 
171, 213-244, published December 1982, "The 
JOature ot Bone Morphogenetic Protein (BMP) 
Fractior^De rived - From -Bo vane-Bone^Matrix 






Gelatin," Mizutani et al. See entire 
document. 




A 


Biomedical Research, 2(5), 466-471 published 
1981, "Purification ot a Bone-Inducing 
Substance (osteogenic factor) from a Murine 
osteosarcoma", Takaoka et al., See entire 
document 


1-16 


A 


EPA, 01690:6, (Seyedin et al.), 16 July, 1984 
See entire document 


1-16 



* Special categories of cited documents: 10 
"A H document defining the general state of the art which is not 
considered to be of particular relevance 

"E" earlier document but published on or after the international 
filing date 

M U N document which may throw doubts on priority clatm(s) or 
which is cited to establish the publication date of another 
citation or other special reason (as specified) 

"0 M document referring to an oral disclosure, use. exhibition or 
other means 

"P** document published prior to the international filing date but 
later than the priority date claimed 



"T" Inter document published after the international filing date 
or priority date and not in conflict 'with the apolication but 
cited to understand the principle or theory unaeriymg the 
invention 

"X" document ol particular relevance: the claimed invention 
cannot be considered novel or cannot be considered to 
involve an inventive step 

"Y H document of particular relevance: the claimed invention 
cannot be considered to involve an inventive step when the 
document is combined with one or more other such docu- 
ments, such combination being o&vious to a person skilled 
in the art. 

"67* document member of the same patent family 



IV. CERTIFICATION 



Date of the Actual Completion of the International Search 



01 December 1989 



Date of Mailing ol this International Search Report 



ggJAN wo 

eTOmcer 



International Searching Authority 

ISA/U.S. 



Signature of Authorizes wnicer 

Carlos Azpuru 



form PCT/ISA210 (second sheet) <fi»v.1 1-87) 



International Application No. 



FURTHER INFORMATION CONTINUED FROM THE SECOND SHEET 



PPT /TTS89/04458 



V.Q OBSERVATIONS WHERE CERTAIN CLAIMS WERE FOUND UNSEARCHABLE 1 



This international search report has not been established in respect ol certain claims under Article 17(2) (a) for the following reasons: 
1-0 Claim numbers . because they relate to subject matter »- not required to be searched by this Authority, namely: 



2.fl Claim numbers , because they relate to parts of the international application that do not comply with the prescribed require- 

ments to such an extent that no meaningful international search can be carried out 1 \ specifically: 



3.[~1 Claim numoers 

PCT Rule 6.4(a). 



, because they are dependent claims not drafted in accordance with the second and third sentences of 



VI. g) OBSERVATIONS WHERE UNITY OF INVENTION IS LACKING * 



This International Searching Authority found multiple inventions in this international application as follows: 



Telephone Practice: See attachment 

1. F") As all required additional search fees were timely,paid by the applicant, this international search report covers all searchable claims 

of the international application. * 

2. Q As only some of the required additional search fees were timely paid by the applicant, this international search report covers only 

those claims of the international application for which fees were paid, specifically claims: 

N° required additional search fees were timely paid by the applicant. Consequently, this international search report Is restricted to 
' the invention first mentioned in the claims; it is covered by claim numbers: 

1-16 

4 - As all searchableclaims could be searched without effort justifying an additional fee, the International Searching Authority did not 
* invite payment of any additional tee. 

Remark on Protest 

n The additional search tees were accompanied by applicant's protest. 

n No protest accompanied the payment of additional search fees. 



Form PCT71SA/210 (supo«rnaraal stmt (2) (fttv. 1 1-87)