Skip to main content

Full text of "USPTO Patents Application 09804625"

See other formats


This Page Is Inserted by IFW Operations 
and is not a part of the Official Record 

BEST AVAILABLE IMAGES 



Defective images within this document are accurate representation of 
The original documents submitted by the apphcant. 

Defects in the images may include (but are not limited to): 
BLACK BORDERS 



TEXT CUT OFF AT TOP, BOTTOM OR SIDES 
FADED TEXT 
ILLECroLE TEXT 
SKEWED/SLANTED IMAGES 
COLORED PHOTOS 

BLACK OR VERY BLACK AND WHITE DARK PHOTOS 
GRAY SCALE DOCUMENTS 



IMAGES ARE BEST AVAILABLE COPY. 



As rescanning documents will not correct images, 
please do not report the images to the 
Image Problem Mailbox. 



WORLD INTELLECTUAL PROPERTY ORGANIZATION 
Inicmational Bureau 




per 

INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT C OOPERATION TREATY (PCT) 

WO 91/18047 



(51) Interaational Patent aassification 5 
O08J7/18, C08K7/02 



Al 



(11) International Publication Number: 
(43) International Publication Date: 28 November 1991 (28.1 1 .91) 



(21) International Application Number: PCT/US9 1/03540 

(22) iDtemational Filing Date: 20 May 1991 (20.05.91) 



(30) Priority data: 

528,300 



24 May 1990 (24.05.90) 



US 



(71) Applicant: GENENTECH, INC. [US/US]; 460 Point San 

Bruno Boulevard, South San Francisco, CA 94080 (US). 

(72) Inventors: HAMMONDS, R., Glenn ; 7036 Norfolk Road, 

Berkeley, CA 94705 (US). MASON, Anthony, J. ; 1446 
Floribunda, #204, Burlingame, CA 94010 (US). 

(74) Agents: HASAK, Janet, E. et al.; Genentech, Inc., Legal 
Department, 460 Point San Bruno Boulevard. South San 
Francisco, CA 94080 (US). 



(81) Designated States: AT (European patent), BE (European 
patent), CA, CH (European patent), DE (European pa- 
tent). DK (European patent), ES (European patent), FR 
(European patent), GB (European patent), GR (Euro- 
pean patent), IT (European patent), JP, LU (European 
patent), NL (European patent), SE (European patent). 



Published 

With international search report. 

Before the expiration of the time limit for amending the 
claims and to be republished in the event of the receipt of 
amendments. 



(54) Title: MAMMALIAN EXPRESSION OF THE BMP-2 FAMILY 



(57) Abstract 

A DNA construct is provided comprising DNA encoding a mature BMP-2 upstream of which is DNA encoding a precur- 
sor portion of a mammalian protein other than the BMP-2. Also provided are mammalian expression vectors and hosts contam- 
ing such a DNA construct and methods for improved expression using such construct. 



FOR THE PURPOSES OF INFORMATION ONLY 



Codes used to identify States party to the PCX on the front pages of pamphlets publishing international 
applications under the PCT. 



AT 


Austria 


ES 


Spain 


MG 


Madagascar 


AU 


Australia 


FI 


Finland 


ML 


Mali 


BB 


Barbados 


FR 


France 


MN 


Mongolia 


BE 


Bclgiuin 


GA 


Gabon 


MR 


Mauritania 


BP 


Burkina Faso 


GB 


United Kingdom 


MW 


Malawi 


BG 


Bulgaria 


GN 


Guinea 


NL 


Netherlands 


BJ 


Benin 


GR 


Greece 


NO 


Norw>-ay 


BR 


Brazil 


HU 


Hungary 


PL 


Poland 


CA 


Canada 


IT 


Italy 


RO 


Romania 


CF 


Cenual African Republic 


JP 


Japan 


SD 


Sudan 


CG 


Congo 


KP 


Democratic People's Republic 


SB 


Sweden 


CH 


Switzerland 




of Korea 


SN 


Senegal 


CI 


Cote d'lvoirc 


KR 


Republic or Korea 


SU 


Soviet Union 


CM 


Cameroon 


LI 


Liechtenstein 


TO 


Chad 


cs 


Czechoslovakia 


LK 


Sri Lanka 


TG 


Togo 


DE 


Germany 


LU 


Luxembourg 


US 


United Slates of America 


DK 


Denmark 


MC 


Monaco 







wo 91/18047 



PCr/US91/03540 



-1- 

MAMMALIAN EXPRESSION OF THE BMP-2 FAMILY 
Field of the Invention 

This invention relates to an improved method for expressing DNA encoding the bone 
morphogenetic protein-2 family in mammalian cells. 
5 Description of Related Art 

The disorders associated with bone loss present major public health problems for 
Western societies. Osteoporosis alone may affect 20 million Americans in the early years of 
the next century. Hence, there is wide interest in identifying factors or potential therapeutic 
agents that inhibit bone loss and stimulate the formation of healthy new bone. 

10 Bone is an extremely complex, but highly organized, connective tissue that is 

continuously remodeled during the life of an adult by cellular events that initially break it 
down (osteoclastic resorption) and then rebuild it (osteoblastic formation). This remodeling 
process occurs in discrete packets throughout the skeleton, i.e., in both cortical bone and 
trabecular bone. It has recently been reported that mouse bone marrow cells can be 

j| 5 stimulated to generate osteoclasts in the presence of parathyroid hormone-related protein or 

vitamin D, See Akatsu et air ^EfTdocrinoloov T-^l 25 :-^2 0,-27 (1 989)jjrakat^^ al., 
Endocrinology . 123 : 2600-2602 (1988) and Takahashi et al., Endocrinology, 123: 1504^ 
1510 (1988). 

The currently available therapeutic agents known to stimulate bone formation are 
20 fluoride, estrogen, metabolites, and vitamin D. Fluoride clearly increases trabecular bone 
mass, but questions remain about the quality of the new bone formed, the side effects 
observed in some patients, whether there are beneficial effects on vertebral fracture rates, 
and whether increased fragility of cortical bone with subsequent propensity to hip fracture 
follows. 

25 Another approach is using agents that promote resorption (parathyroid hormone) and 

then interrupt resorption (calcitonin). One proposed, but not validated, such sequential 
therapeutic regimen is coherence therapy, where bone metabolic units are activated by oral 
phosphate administration and then resorption is inhibited by either diphosphonates or 
calcitonin, 

30 Within the past few years several factors that stimulate osteoblasts have been 

identified in bone, including transforming growth factor-yff (TGF-^j, fibroblast growth factor, 
platelet-derived growth factor, insulin-like growth factor-l, and pi macroglobulin. 

Other proteins stored in the bone matrix may also be important for bone formation. 
When demineralized bone was injected into the muscle or subcutaneous tissue of rats, a 

35 cascade of events, including chondrogenesis, ensued. Urist, Science . 150 : 893 (1965). 
Since the 1 960s several investigators have attempted to identify and characterize this activity 
and have provided an assay for purification of such activity. Reddi and Huggins, Prcc. Natl. 



wo 91/18047 



PCr/US91/03540 



-2- 

Acad. Sci. USA . 69: 1 601 -1 605 (1 972); Sampath and Reddi, Proc. Natl. Acad. Sci. USA . 78: 
7599-7603 11981). 

This assay served as the basis for purifying several novel proteins fronn bone in 
sufficient quantity and purity to provide amino acid sequence information, including 
5 osteogenin, a protein of 22 Kd [Sampath et al., Pmr. Natl. Acad. Sci. IIRA . 84- "7109 (1 987); 
Luyten et a!., J. Biol. Chem. . 264 : 13377-13380 11989)] and a glycoprotein called 
osteoinductive factor [Bentz et al., J. Cell. Biol.. 107 : 162a (1989)]. See also Wang et aL, 
Proc. Natl. Acad. Sci. , 85 : 9484-9488 11988). Based on amino acid sequence data, clones 
encoding several proteins related by sequence similarity to IGF-p were isolated from bovine 

10 and human sources. Wozney et al., Science, 242 : 1528-1534 (1988); PCT WO 88/00205 
published January 1 4, 1 988; U.S. 4,877,864 issued October 31 , 1 989. These lauer proteins 
included BMP-2A {also known as BMP-2), BMP-2B (also known as BMP-4), and BMP-3. The 
sequence of tryptic peptides from osteogenin match the sequence repoaed for BMP-3. 

The TGP-/S supergene family includes five distinct forms of TGF-^ [Sporn and Roberts, 

15 in -Peptide Growth Factors and Their Receptors , Sporn and Roberts, eds. (Springer-Verlag: 

Berlin, 1990) pp. 419-472], as well as the differentiatiorrfactors vgWWeeks-and^Melto^ 
Cell/ 51: 861-867 (1987)] and DPP-C polypeptide [Padgen et al., Nature , 325 : 81-84 
(1987)], the hormones activin and inhibin [Mason et al., Nature , 318 : 659-663 (1985); 
Mason et al., Growth Factors . 1: 77-88 (1 987)], the Mullerian-inhibiting substance, MIS [Gate 

20 et al.. Cell, 45: 685-698 (1 986)], the BMPs, and the developmentally regulated protein Vgr-1 
[Lyons et al., Proc. Natl. Acad. Sci. USA . 86: 4554-4558 (1989)]. The subset BMP-2A and 
BMP-2B is approximately 75% homologous in sequence to DPP-C and may represent the 
mammalian equivalent of that protein. 

The proteins of the TGF-^ supergene family are disulfide-linked homo- or heterodimers 

25 encoded by larger precursor polypeptide chains containing a hydrophobic signal sequence, 
a long and relatively poorly conserved N-terminal pro region of several hundred amino acids, 
a cleavage site (usually polybasic), and a shorter and more highly conserved C-terminal 
region. This C-terminal region corresponds to the processed mature protein and contains 
approximately 100 amino acids with a characteristic cysteine motif, i.e., the conservation of 

30 seven of the nine cysteine residues of IGF-fi among all known family members. Although the 
position of the cleavage site between the mature and pro regions varies among the family 
members, the C-terminus of ail of the proteins is in the identical position, ending in the 
sequence Cys-X-Cys-X, but differing in every case from the TGF-^ consensus C-terminus of 
Cys-Lys-Cys-Ser. Sporn and Roberts, 1 990, supra. 

35 The pro region of TGF-;ff associates non-covalentty with the mature TGF-^ dimer 

[Wakefield et al., J. Biol. Chem.. 263 : 7646-7654 (1988); Wakefield et al., Growth Factors , 
1: 203-218 (1989)], and the pro regions are found to be necessary for proper folding and 
secretion of the active mature dimers of both and activin [Gray and Mason, Science . 



wo 91/18047 



PCr/US91/03540 



-3- 

247 : 1328-1330 (1990)]. The association between the mature and pro regions of TGF-^ 
masks the biological activity of the mature dimer, resulting in formation of an inactive latisnt 
form. Latency is not a constant of the TGF-^ supergene family, since the presence of the pro 
region has no effect on activin or inhibin biological activity. 
5 A unifying feature of the biology of the proteins from the TGF-^ supergene family is 

their ability to regulate developmental processes. Regarding bone formation in vivo, of all the 
proteins in the IGf-P supergene family, the BMPs and TGF-^ play the most major role. 

Recombinant TGF-)ff1 has been cloned [Derynck et aL, Nature . 316 :701-705 11985)] 
and expressed in Chinese hamster ovary cells [Gentry et ai., Mol. Cell. Biol. . 7: 3418-3427 
10 {1987}]. Additionally, recombinant human TGF-)ff2 [deMartin et al., EMBO J. . 6: 3673 

(1987) ], as well as human and porcine TGF-;ff3 [Derynck et al., EMBO J. ,7: 3737-3743 

(1988) ; ten Dijke et al., Proc. Natl. Acad. Set. USA , 85 : 4715 (1988)], have been cloned. 
Expression levels of the mature TGF-^1 protein in COS cells are increased by substituting a 
serine residue for cysteine residues located in the pro region of the TGF-;S1 precursor. 

~T5 Bnjnneret-al77 -JT-Biol.-Chem . ,, 264 : 13660-13664 (1989)]. 

BMP-2A and BMP-3 have been recombinantly produced in monkey COS-l^cells-and 
Chinese hamster ovary cells by Wozney et aL, supra. However, the level of expression of 
BMP-2A and -2B cDNA is relatively low when the DNA is not amplified.. Higher levels of 
BMP-2A protein expression in CHO cells have been obtained by amplification to a high copy 
20 number using methotrexate selection of dihydrofolate reductase. Wang et al., Proc. Natl. 
Acad. Sci. USA . 82: 2220-2224 (1 990). 

Confirmation of the osteogenic activity of BMPs and commercial production thereof 
depend on the ability to produce useful amounts of active material by recombinant means of 
expression and development of methods to purify them in an active form. The ability to 
25 successfully reconstitute endochondral bone formation remains the standard by which to 
judge the osteogenic character of candidate factors. The biological activities of BMP-2A, 
BMP-3, and an unrelated molecule, BMP-1 , were originally assessed in an implant model using 
material expressed in COS cells, resulting in only cartilage formation. Wozney et al., supra. 
More recently, the partially purified BMP-2A expressed in CHO cells was shown to require a 
30 dose of at least 600 ng/implant to induce cartilage and bone formation. Wang et al., 1990, 
supra. The osteogenic activities of BMP-2B and BMP-3 have not been established. 

It is an object of the present invention to provide purified BMP-2B in sufficient 
quantities to test for its osteogenic activity, and to produce it on a commercial scale. 

It is another object to improve the expression levels of BMP-2 DNA in mammalian cells 
35 without amplifying the DNA. 

It is still another object to achieve higher production of BMP-2 protein than was 
previously attained at a level of amplification equivalent to that previously employed. 



wo 91/18047 



PCT/US91/03540 



.4- 

These and other objects will be apparent to those of ordinary skill in the art of 
molecular biology. 

Summary of the Invention 
Accordingly, this invention provides a DNA construct comprising DNA encoding a 
5 mature BMP-2 upstream of which is DNA encoding a precursor portion of a mammalian 
protein other than that of BMP-2. Preferably, the precursor portion has at least 25% amino 
acid sequence identity to the native precursor portion of the BMP-2 in the region spanning 
the N-terminus of the BMP-2 precursor to the first cysteine residue in the mature BMP-2. 
In another aspect, this invention provides an expression vector comprising the above- 
10 described DNA construct and hosts transformed with such a vector. 

In a method for expressing DNA encoding a BMP-2 in mammalian cells, this invention 
also furnishes the improvement which comprises employing as the host the host transformed 
with the vector described above. 

Additionally, this invention provides a method for producing BMP-2 by culturing 
15 mammalian hostxelis transfected with the expression vector described above, the cells being 
capable of expressing the DNA construct of the vector, and~recovering-mature-BMP::2jfrom^ 
the cells. Preferably, the recovery is from the host cell media (in which case the expression 
vector contains a signal sequence, whether native to the precursor or BMP-2 or heterologous 
to the precursor or BMP-2, that directs secretion of the mature BMP-2 to the medium). 
20 The result of this method is dramatically improved expression levels of BMP-2 DNA in 

mammalian cells over that attainable using the BMP-2 precursor portion that is native to the 
BMP-2 to be produced. 

Brief Description of the Drawings 
Figure 1 depicts the amino acid sequences of BMP-2A and BMP-2B and indicates the 
25 regions of sequence identity. The junction between the precursor portions and mature 
portions is shown by a vertical line with two arms. 

Figure 2 depicts the complete amino acid sequence of the chimera of the precursor 
portion of BMP-2A and the mature region of BMP-2B. 

Figure 3A depicts expression plasmid pRK5.bmp2/4-1 .1 , and Figure 3B depicts the 
30 junction region of the BMP-2A/2B hybrid insert. A portion of an alignment of BMP-2A and 
BMP-2B is shown with identical residues boxed. The coding sequence resulting from fusion 
of BMP-2A and BMP-2B is shaded showing the crossover point. The underlined sequence 
with an arrow indicates sequence confirmed by Edman degradation of purified recombinant 
BMP-2B. 

35 Figure 4 depicts a fluorogram of an SDS-PAGE reducing gel of supernatants from 

human embryonic kidney cell line transfections with DNA encoding either the native BMP-2A 
molecule (lane 1), the chimeric BMP-2A/2B molecule (lane 2), the native BMP-2B molecule 
(lane 3), control pRK5 plasmid (lane 4), or no plasmid (lane 5). Rgure 5 depicts graphs 



wo 91/18047 PCr/US91/03540 

-5- 

of calcium content (Fig. 5A) and alkaline phosphatase content (Fig. 5B) of implants in rats 
(harvested at 12 days) of demineralized bone powder (DBP) or guanidine-HCI-extracted DBP 
reconstituted with the indicated amounts of mature recombinant BMP-2B orTGF-^. The solid 
and cross-hatched bars presented for two doses are duplicate runs. 
5 Description of the Preferred Embodiments 

Definitions 

As used herein, the term "BMP-2" refers to the family of bone morphogenetic proteins 
of the type 2, derived from any species. Reference to BMP-2 herein is understood to be a 
reference to any one of the currently identified forms, including BMP-2A and BMP-2B 

10 (formerly called BMP-4) described by Wozney et a!., supra, and WO 88/00205, supra, the 
sequences of which are shown in Figure 1, as well as to BMP-2 species identified in the 
future. The term "BMP-2" also includes polypeptides derived from the sequence of any 
known BMP-2 whose mature sequence is at least about 75% homologous with the sequence 
of a mature BMP-2, including DPP-C. Members of the BMP-2 family appear to be encoded 

^1-5 as^aJaigeLP''ecursor that shares a region of high homology near the fJ-terminus. 

As used herein, "precursor portion"~refers^to~the-polypeptide-sequence derived from 
a prepro-mammalian protein representing either the pro-domain or prepro-domain without the 
mature protein. Candidate mammalian proteins having such precursor portions are those 
encoded as larger precursors that typically contain a signal sequence at their N-terminus 

20 followed by a dibasic amino acid cleavage site and a pro-region, followed by another dibasic 
amino acid cleavage site and the mature region of the protein. Thus, the precursor portion 
is that which is N-terminal to the mature N-terminus of the mammalian protein and may 
include the signal sequence for secretion of that protein. Preferably, the mammalian protein 
from which the precursor portion is derived is a member of the TGF-yff supergene family, as 

25 described above. Examples of suitable precursor portions are those wherein the signal 
sequence is followed by a sequence that represents a polypeptide region that after cleavage 
reassociates with the mature protein covalently or non-covalently, as in the case of insulin, 
relaxin, inhibin, activin, and TGF-y?. 

The expression "at least 25% amino acid sequence identity to the native precursor 

30 portion of the BMP-2 from the N-terminus of the BMP-2 precursor to the first cysteine residue 
in the mature region of the BMP-2" refers to a precursor ponion that shares this minimum 
sequence identity to the relevant portion of the BMP-2 DNA being expressed. This sequence 
identity can be readily calculated for BMP-2A and BMP-2B from the entire amino acid 
sequences shown in Figure 1. As examples, the precursor ponion of BMP-2A shares 55% 

35 amino acid sequence identity to the native precursor portion of BMP-2B from the N-ierminus 
of the BMP-2B precursor to the first cysteine residue in the mature region of the BMP-2B 
molecule, and vice-versa. The precursor of the protein vgr [Lyons et al., Proc. Natl. Acad. 
Sci. USA , 86 : 4554-4558 (1 989)], which is related to the product of an amphibian gene vgl 



wo 91/18047 



PCT/US91/03540 



-6- 

expressed in frog oocytes, shares 25% homology with the relevant poalon of BMP-2B. The 
protein decapenta-plegic gene complex from Drosophila . DPP-C IPadgen et al.. Nature . 325 : 
81-84 (1987)], shares 27% and 28% amino acid sequence identity with the relevant poaions 
of BMP-2A and BMP-2B, respectively. Most preferred herein is the use of the BMP-2A 
5 prepro-domain as the precursor portion for secreting mature BMP-2B. 
Modes for Carrvino Out the Invention 

The vectors and methods disclosed herein are suitable for use for expression in a wide 
range of mammalian host cell lines. 

In general, prokaryotes such as, e.g., 5. coli strains are preferred for cloning, 

10 amplifying, or storing the vectors of interest. Vector DNA is easily obtainable from certain 
prokaryotes. £. coli KM strain MM 294 (ATCC No. 31,446) is particularly useful for this 
purpose, as are £. co//B and E. co// X1776 (ATCC No. 31,537). In general, plasmid 
vectors containing replicon and control sequences that are derived from species compatible 
with the host cell are used in connection with these prokaryotic hosts. The vector ordinarily 

15 carries a replication site, as well as marking sequences that are capable of providing 
phenotypic selection in transformed celIS7-^For-example,-^£.-CO//jsj^^ transformed using 
pBR322, a plasmid derived from an E. coli species (see, e.g.. Bolivar et al., Gene. 2: 95 
(1977)]. pBR322 contains genes for ampiciilin and tetracycline resistance and thus provides 
easy means for identifying transformed cells. The pBR322 plasmid, or other microbial plasmid 

20 or phage, must also contain, or be modified to contain, promoters that can be used by the 
microbial organism for expression of the selectable marker genes. 

Cultures of cells derived from mammalian organisms are useful as expression hosts 
using tissue culture methods [ Tissue Culture . Academic Press, Kruse and Patterson, editors 
(1 973)]. Examples of such useful host cell lines include monkey kidney CVi line transformed 

25 by SV40 sequences (COS-7, ATCC CRL 1651); human embryonic kidney line [293, Graham 
et al., J. Gen. Virol. , 36: 59 (1977)]; baby hamster kidney cells (BHK, ATCC CCL 10); 
Chinese hamster ovary cells [CHO, Urlaub and Chasin, Proc. Natl. Acad. Sci. USA . 77 : 4216 
(1980)]; mouse Sertoli cells [TM4, Mather, Biol. Reprod. . 23: 243-251 (1980)]; monkey 
kidney cells (CVI, ATCC CCL 70); African green monkey kidney cells (VERO-76, ATCC CRL- 

30 1587); human cervical carcinoma cells (HELA, ATCC CCL 2); canine kidney cells (MDCK, 
ATCC CCL 34); buffalo rat liver cells (BRL 3A, ATCC CRL 1442); human lung cells {W138, 
ATCC CCL 75); human liver cells (Hep G2, HB 8065); mouse mammary tumor cells (MMT 
060562, ATCC CCL51); rat hepatoma cells [HTC, Ml. 54, Baumann et aL, J. Cell. Biol. , 85: 
1 -8 (1 980)1; and TRl cells [Mather et al., Annals N.Y. Acad. Sci. . 383: 44-68 (1 982)]. The 

35 most preferred mammalian hosts herein are CHO and 293 cell lines. 

Expression vectors for such cells ordinarily will contain control regions, which are 
specific sequences at the 5' and 3' ends of eukaryotic genes that may be involved in the 
control of either transcription, RNA processing, or translation. At the 3' end of most 



wo 91/18047 



PCr/US91/03540 



-7- 

eukaryotic genes is an AATAAA sequence that signals processing of the mRNA for 
polyadenylation addition. 

Thus, the vector will typically include a promoter located in front of the gene to be 
expressed, polyadenylation sites, and transcriptional terminator sequences, all described in 
5 further detail herein. The vector may optionally also include an origin of replication. Further, 
the vector may contain, after the promoter, a transcription initiation site located in front of 
an optional splice unit, which is in turn located before the encoding gene. 

Examples of suitable mammalian expression vectors are found in EP 307,247; 
260,148; 309,237; and 307,248. 

10 For use in mammalian cells, the control functions on the expression vectors are often 

provided by viral material. For example, commonly used promoters are derived from the 
genomes of polyoma, Adenovirus2, retroviruses, cytomegalovirus, and Simian Virus 40 
(SV40), Other promoters are those from heterologous sources, e.g., the beta actin promoter. 
The early and late promoters of SV40 virus' are particularly useful because both are obtained 

Ts^ easilv^ffom the virus as a-f ragment that also contains the SV40 viral origin of replication [Piers 
et al.. Nature , 273 : 113 (1978)]. Smaller or larger SV40 fragments-may-also-be_use^,_ 
provided there is included the approximately 250-bp sequence extending from the Hindlll site 
toward the Bgjl site located in the viral origin of replication. The immediate early promoter 
of the human cytomegalovirus is conveniently obtained as a Hindlll restriction fragment. 

20 Greenaway et al.. Gene . 18 : 355-360 (1 982), Further, it is also possible, and often desirable, 
to utilize promoter or control sequences normally associated with the desired gene sequence, 
provided such control sequences are compatible with the host cell systems. 

Transcription of a DNA encoding a desired heterologous polypeptide by higher 
eukaryotes is increased by inserting an enhancer sequence into the vector. The enhancer is 

25 a cis-acting element of DNA, usually about from 10 to 300 bp, that acts on a promoter to 
enhance its transcription-initiation activity. Enhancers are relatively orientation and position 
independent, having been found 5' [Laimins et al., Proc. Natl. Acad. Sci. USA , 78: 993 
II 981 )1 and 3' [Lusky et ah, Mol. Cell Bio. , 3: 1 1 08 (1 983)1 to the transcription unit, within 
an intron [Banerji et al., Cell , 33: 729 (1983)] as well as within the coding sequence itself 

30 (Osborne et al., Mol. Cell Bio. , 4: 1293 (1984)]. Preferably, however, the enhancer element 
is located upstream of the promoter sequence for this invention. Many enhancer sequences 
are now known from mammalian genes (globin, elastase, albumin, a-fetoprotein, and insulin). 
Typically, however, one will use an enhancer from a eukaryotic cell virus. Examples include 
the SV40 enhancer on the late side of the replication origin (bp 100-270), the 

35 cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the 
replication origin, and adenovirus enhancers. One preferred enhancer is the SV40 enhancer 
region. 



wo 91/18047 



PCT/US91/03540 



-8- 

Expression vectors used in mammalian host cells will also contain polyadenylation sites. 
Examples of polyadenylation regions are those derived from viruses such as, e.g.. the SV40 
(early and late) or HBV. 

An origin of replication may be provided either by construction of the vector to include 
5 an exogenous origin, such as may be derived from SV40 or other viral {e.g.. Polyoma, Adeno, 
VSV, BPV) source, or may be provided by the host cell. If the vector is integrated into the 
host cell chromosome, the latter is often sufficient. 

The expression vectors may suitably contain a selection gene, also termed a selectable 
marker. A selection gene encodes a protein necessary for the survival or growth of a host 

10 cell transformed with the vector. Examples of suitable selectable markers for mammalian 
cells include dihydrofolate reductase (DHFR), thymidine kinase (TK), or neomycin. When such 
selectable markers are successfully transferred into a mammalian host cell, the transformed 
mammalian host cell can survive if placed under selective pressure. 

There are two widely used distinct categories of selective regimes. The first category 

X5___js^ased^on^h^^ of a ceil and the use of a mutant cell line that lacks the ability to 

grow independent of a supplementedlfiecJiumrTwo examples-are-CHO^DHFRlcells and mouse 
LTK* cells. Threse cells lack the ability to grow without the addition of such nutrients as 
thymidine or hypoxanthine. Because these cells lack certain genes necessary for a complete 
nucleotide synthesis pathway, they cannot survive unless the missing nucleotides are 

20 provided in a supplemented medium. An alternative to supplementing the medium is to 
introduce an intact DHFR or TK gene into ceils lacking the respective genes, thus altering their 
growth requirements. Individual cells that were not transformed with the DHFR or TK gene 
will not be capable of survival in non-supplemented medium. Therefore, direct selection of 
those cells requires cell growth in the absence of supplemental nutrients. 

25 The second category is dominant selection, which refers to a selection scheme that 

does not require the use of a mutant cell line. This method typically employs a drug to arrest 
growth of a host cell. Those cells that have a novel gene would express a protein conveying 
drug resistance and would survive the selection. Examples of drugs used in dominant 
selection include neomycin [Southern and Berg, J. Molec. AddI. Genet. . 1: 327 (1982)], 

30 mycophenolic acid [Mulligan and Berg, Science . 209 : 1422 (1 980)1, or hygromycin [Sugden 
et al., Mol. Cell. Biol., 5: 41 0-41 3 ( 1 985)). The three examples given above employ bacterial 
genes under eukaryotic control to convey resistance to the appropriate drug, i.e., neomycin 
IG418 or geneticin), xgpt (mycophenolic acid), or hygromycin, respectively. 

Extremely good amounts of polypeptide are produced by transiently transfected cell 

35 cultures using the method of this invention. It Is also expected that stable transformants 
would result in higher production levels of the BMP-2 than transformants with the native 
proBMP-2 sequence. Furthermore, the process herein is expected to enhance production 
levels further when the cells are cotransfected with a separate vector encoding a secondary 



wo 91/18047 



PCr/US91/03540 



-9- 

coding sequence. One secondary coding sequence comprises dihydrofolate reductase (DHFR) 
that is affected by an externally controlled parameter, such as methotrexate (MIX), thus 
permitting control of expression by control of the MTX concentration. 
Typical MethodoloQV Employable 
5 Construction of suitable vectors containing the desired coding and control sequences 

employs standard recombinant techniques. Isolated plasmids or DNA fragments are cleaved, 
tailored, and re-ligated to form the desired pliasmid. 

If flush ends are required, the cleaved DNA preparation may be treated for 30 minutes 
at37®C with DNA Polymerase ! (Klenow fragment) orT4 DNA polymerase, phenol-chloroform 
10 extracted, and ethanol precipitated. 3' protruding ends are removed by the 3' to 5' 
exonucleolytic activity of either enzyme, and the 5' protruding ends are made flush by the 
5' to 3' polymerase activity incorporating complementary nucleotide until the end of the 
fragment is reached. 

Size separation of the cleaved fragments may be performed using 6 percent 

-15^ polyacrylamide gel described by Goeddel et al.. Nucleic Acids Res. , 8: 4057 (1980). 

For analysis to confirm correct sequences in plasmids constructed, the ligation mixtures 
are typically used to transform £. co//K1 2 strain 294 (ATCC 31 ,446) or other suitable £. coli 
strains, and successful transformants selected by ampicillin or tetracycline resistance where 
appropriate. Plasmids from the transformants are prepared and analyzed by restriction 

20 mapping and/or DNA sequencing by the method of Messing et a!.. Nucleic Acids Res. . 3: 309 
(1 981 ) or by the method of Maxam et al., Meth. Enzvm . 65: 499 (1 980), 

If amplification of the sequences is desired, DHFR-protein-coding DNA sequences are 
introduced into the mammalian cell host and stable transfectants are selected in the medium. 
The host cell cultures are grown in the presence of approximately 200-500 nM 

25 concentrations of methotrexate, a competitive inhibitor of DHFR activity. The effective range 
of concentration is highly dependent, of course, upon the nature of the DHFR gene and the 
characteristics of the host. Clearly, generally defined upper and lower limits cannot be 
ascertained. Suitable concentrations of other folic acid analogs or other compounds that 
inhibit DHFR could also be used. MTX itself is, however, convenient, readily available, and 

30 effective. 

In order to simplify the examples and claims, certain frequently occurring methods will 
be referenced by shorthand phrases. 

"Transfection" refers to the taking up of an expression vector by a host cell whether 
or not any coding sequences are in fact expressed. Numerous methods of transfection are 
35 known to the ordinarily skilled artisan, for example, CaP04 and electroporation. Successful 
transfection is generally recognized when any indication of the operation of this vector occurs 
within the host cell. 



wo 91/18047 



PCr/US91/03540 



-10- 



10 



15 



20 



25 



30 



"Transformation" means introducing DNA into an organism so that the DMA is 
replicable, either as an extrachromosomal element or by chromosomal integrant. Depending 
on the host cell used, transformation is done using standard techniques appropriate to such 
cells. The calcium treatment employing calcium chloride, as described by Cohen, S.IM. Proc. 
Natl. Acad. Sci. (USA), 69: 2110 (1972); Mandel et al., J. Mol. Biol. 53:154 (1970); and 
more recently Liljestrom et al.. Gene , 40: 241-246 (1985), is generally used for prokaryotes 
or other cells that contain substantial cell-wall barriers. For mammalian cells without such 
cell wails, the calcium phosphate precipitation method of Graham and van der Eb, Viroloov , 
52: 456-457 (1978) is preferred. General aspects of mammalian cell host system 
transformations have been described by Axel in U.S. Pat. No. 4,399,21 6 issued August 1 6, 
1983. Transformations Into yeast are typically carried out according to the method of Van 
Solingen, et al., J. Bact. . 130 : 946 (1 977) and Hsiao, et al., Prbc. Natl. Acad. Sci. (USA) 76: 
3829 (1979). However, other methods for introducing DNA into cells such as by nuclear 
injection or by protoplast fusion may also be used. 

"Operably linked" refers to juxtaposition such that the normal function of the 
components can belperformed; — Thus,-a-^coding sequence "operably linked" to control 



sequences refers to a configuration wherein the coding sequence can be expressed undeTther 
control of these sequences and wherein the DNA sequences being linked are contiguous and, 
in the case of a secretory leader, contiguous and in reading phase. For example, DNA for a 
presequence or secretory leader is operably linked to DNA for a polypeptide if it is expressed 
as a preprotein that participates in the secretion of the polypeptide; a promoter or enhancer 
is operably linked to a coding sequence if it effects the transcription of the sequence; or a 
ribosome binding site is operably linked to a coding sequence if it is positioned so as to 
facilitate translation. Linking is accomplished by ligation at convenient restriction sites. If 
such sites do not exist, then synthetic oligonucleotide adaptors or linkers are used in 
accordance with conventional practice. 

"Control sequences" refers to DNA sequences necessary for the expression of an 
operably linked coding sequence in a particular host organism. The control sequences that 
are suitable for prokaryotes, for example, include a promoter, optionally an operator 
sequence, a ribosome binding site, and possibly, other as yet poorly understood sequences. 
Eukaryotic cells are known to utilize promoters, polyadenylation signals, and enhancers. 

"Expression system" refers to DNA sequences containing a desired coding sequence 
and control sequences in operable linkage, so that hosts transformed with these sequences 
are capable of producing the encoded proteins. To effect transformation, the expression 
system may be included on a vector; however, the relevant DNA may then also be integrated 
into the host chromosome. 

As used herein, "cell," "cell line," and "cell culture" are used interchangeably and all 
such designations include progeny. Thus, "transformants" or "transformed cells" includes 




wo 91/18047 



PCr/US91/03540 



-li- 
the initial transformant and cultures derived therefrom without regard for the number of 
transfers. It is also understood that all progeny may not be precisely identical in DNA 
content, due to deliberate or inadveaent mutations. Mutant progeny that have the same 
functionality as screened for in the originally transformed cell are included. Where distinct 
5 designations are intended, it will be clear from the context. 

"Plasmids" are designated by a lower case p preceded and/or followed by capital letters 
and/or numbers. The starting plasmids herein are commercially available, are publicly 
available on an unrestricted basis, or can be constructed from such available plasmids in 
accord with published procedures. In addition, other equivalent plasmids are known in the 

10 art and will be apparent to the ordinary artisan. 

"Digestion" of DNA refers to catalytic cleavage of the DNA with an enzyme that acts 
only at specific nucleotide sequences in the DNA. Such enzymes are called restriction 
enzymes, and the sequence for which each is specific is called a restriction site. The various 
restriction enzymes used herein are commercially available and their reaction conditions, 
^ofactofs~and~other--requirements as established by the enzyme suppliers are used. 
Restriction enzymes commonly are designated by abbreviations composed~of"a^capitaHetter- 
followed by other letters representing the microorganism from which each restriction enzyme 
originally was obtained and then a number designating the particular enzyme. In general, 
about 1 //g of plasmid or DNA fragment is used with about 1-2 units of enzyme in about 20 

20 /yl of buffer solution. Appropriate buffers and substrate amounts for particular restriction 
enzymes are specified by the manufacturer, incubation of about 1 hour at 37°C is ordinarily 
used, but may vary in accordance with the supplier's instructions. After incubation, protein 
is removed by extraction with phenol and chloroform, and the digested nucleic acid is 
recovered from the aqueous fraction by precipitation with ethanol. When appropriate, 

25 digestion with a restriction enzyme is- followed by bacterial alkaline phosphatase-mediated 
hydrolysis of the terminal 5' phosphates to prevent the two ends of a DNA fragment from 
"circularizing, " or forming a closed loop that would impede insertion of another DNA fragment 
at the restriction site. Unless otherwise stated, digestion of plasmids is not followed by 5' 
terminal dephosphorylation. Procedures and reagents for dephosphorylation are conventional 

30 (Maniatis et al.. Molecular Cloning : A Laboratory Manual (New York: Cold Spring Harbor 
Laboratory, 1982) pp. 133-134). 

"Recovery" or "isolation" of a given fragment of DNA from a restriction digest means 
separation of the digest on polyacrylamide or agarose gel by electrophoresis, identification 
of the fragment of interest by comparison of its mobility versus that of marker DNA 

35 fragments of known molecular weight, removal of the gel section containing the desired 
fragment, and separation of the gel from DNA. This procedure is known generally. For 
example, see R. Lawn et al.. Nucleic Acids Res. 9: 6103-61 14 (1981), and D. Goeddel et al., 
Nucleic Acids Res. 8: 4057 (1980). 



wo 91/18047 



PCT/US91/03540 



-12- 



"Ligation" refers to the process of forming phosphodiester bonds between two double- 
stranded nucleic acid fragments [T. Maniatis et a!., 1982, supra, p. 146). Unless otherwise 
provided, ligation may be accomplished using known buffers and conditions with 10 units of 
T4 DNA ligase ("ligase") per 0.5 /vg of approximately equimolar amounts of the DNA 
5 fragments to be ligated. 

"Preparation" of DNA from transformants means isolating plasmid DNA from microbial 
culture. Unless otherwise provided, the alkaline/SDS method of Maniatis et al., 1 982, supra, 
p. 90, may be used. 



1 0 that are chemically synthesized by known methods [such as phosphotriester, phosphite, or 
phosphoramidite chemistry, using solid-phase techniques such as described in EP Pat. Pub. 
No. 266,032 published May 4, 1988, or via deoxynucleoside H-phosphonate intermediates 
as described by Froehler et al., Nucl. Acids Res. . .14: 5399-5407 (1986)]. They are then 
purified on polyacrylamide gels. 
-1-5^^--___J[hefollowing example is intended to illustrate specific embodiments now known for 



practicing the invention, but the inventiorTisT^ot to'be considered-limited^thereto. 

EXAMPLE 1 

cDNAs for BMP-2A and BMP-2B were cloned from a human placental cDNA library 
constructed in lambda gtIO [Ullrich et al., Nature , 313 : 756-761 (1985)] using 
20 oligonucleotide probes based on the human nucleotide sequence (Wozney et al., supra] using 
standard cloning techniques [Sambrook et ai.. Molecular Cloninc: A Laboratory Manual . 
Second Ed. (Cold Spring Harbor Laboratory, New York, 1989)]. The probes employed were 
as follows (where the initiator ATG is underlined and the direction from left to right is 5' to 
3'): 

25 BMP-2A Probes 

CGACCATGGTGGCCGGGACCCGCTGTCTTCTAGCGTTGCTGCTTCCCCAGGTCCTCCTGG 
GCGGCGCG (for 5' end) 

AATGAAAAGGTTGTATTAAAGAACTATCAGGACATGGTTGTGGAGGGTTGTGGGTGTCGC 
(for 3' end) 
30 BMP-2B Probes 

AIGATTCCTGGTAACCGAATGCTGATGGTCGTTTTATTATGCCAAGTCCTGCTAGGAGGC 
GCGAGCCATGCTAGTTTG (for 5' end) 

CAGGAGATGGTAGTAGAGGGATGTGGGTGCCGCTGAGATCAGGCAGTCCTTGAGGATAG 
ACAG (for 3' end) 

35 No clones for BMP-3 were found in the human placental cDNA library using a similar 

approach to that above. Several cell lines were screened for expression of BMP-3 RNA by 
polymerase chain reaction amplification of the RNA [Mullis et al., Cold Spring Harbor Svmo. 
Quant. Biol. . 51 : 263-273 (1986)1 using oligonucleotide primers based on the human 



"Oligonucleotides" are short-length, single- or double- stranded polydeoxynucleotides 




wo 91/18047 



PCT/US91/03540 



-13- 

nucleotide sequence [Wozney et ai., supra]. One positive cell line, the NCI-H69 hunnan snnall- 
cell lung carcinoma [Gazdar et al.. Cancer Res. . 40: 3502-3507 (1980)] was identified. A 
cDNA library was prepared from the mRNA and screened with oligonucleotide probes using 
standard techniques (Sambrook et al., supra). The probe sequences were as follows (where 
5 the direction from left to right is 5' to 3'): 

AGTGTCCCGCAGCGACGCCGGGAGCCGACGCGCCGCGCGGGTACCTAGCC (for 5' end) 
TACCCTAACATGACAGTAGAGTCTTGCGCTTGCAGATAACCTGGCAAAGA (for 3' end) 

Positive lambda gtl 0 clones were identified for BMP-2A, BMP-2B, and BMP-3 proteins, 
and these clones were sequenced. The sequenced clones encoding the BMP-2A and BMP-2B 

10 full-length proteins were digested with Sajl. The expression vector pRK5 [EP 307,247 
published 3/1 5/89) was also digested with Sail and the gel-isolated large fragment was 
ligated with the cDNA Sal' digests encoding each BMP to create the expression plasmids 
pRK5.bmp2a and pRk5.bmp2b, for BMP-2A and BMP-2B, respectively. 

The sequenced clone encoding the BMP-3 full-length protein was digested with EcoRi. 

IT pRK5^war^also~digested-with-EcoRI and the gel-isolated large fragment was ligated with the 

cDNA EcoRI digest encoding BMP-3 to create the expression plasmid pRK5Tbmp3: 

A human embryonic kidney cell line (293) [Graham et al., supra] was grown to 
confluence on 60-mm plates in F12:DMEM (1:1) medium (Gibco) containing 10% fetal calf 
^serumif CS)-and-transfectedj^'jth_qne of the three BMP expression plasmids by the calcium 

20 phosphate method [Gorman, DNA Cloning , Vol. 11 (edy~GTover;"D:)7T43-1 904IRL, Oxford, 
1985)1. More specifically, 5-10 //g of one of the three BMP plasmid DNAs was mixed with 
1 //g of DNA encoding the VA RNA gene (Thimmappaya et a!., CeH, 31: 543 (1982)) and 
dissolved in 250 jj\ of 0.25 M CaC!^. Added to this (dropwise while vortexing) was 250 //I 
of 50 mM HEPES (pH 7.35), 280 mM NaCI, 1 .5 mM NaPO^, and the precipitate was allowed 

25 to form for 5-10 min. at 25^C. The suspended precipitate was then added to the cells and 
allowed to settle for 4-5 hours in the incubator. The medium was then aspirated off, the cell 
layer was washed with 5 ml of F12:DMEM (1:1), and 0.5 ml of 20% glycerol in phosphate- 
buffered saline (PBS) was added for 30 sec. A total of 5 ml of F12:DMEM (1:1) containing 
1 0% fetal bovine serum was added, aspirated off, and replenished. 24 to 48 hours later, the 

30 10% fetal bovine serum medium was replaced with serum-free F12:DMEM (1:1) minus 
cysteine and methionine. The cells were incubated for 2 hours at 37°C in 5% CO2 in the 
presence of 200 //Ci/ml ^^S-cysteine and 200 ^Ci/ml ^^S-methionine. Then the cell layers 
were washed with PBS and F12:DMEM (1:1) containing cysteine and methionine was added 
and the cells* were allowed to incubate for 5-7 hours. Conditioned medium was then 

35 collected, concentrated 5-fold by lyophilization, and loaded on a 15% SDS gel, which was 
soaked with Enhance® (New England Nuclear) gel scintillation fluid, dried, and exposed to film 
at -80°C for 12 hours. Metabolic labeling of the conditioned medium revealed detectable 



wo 91/18047 



PCT/US91/03540 



-14. 

levels of expression that were low as compared with transfections of similar vectors 
containing activin or TGf-p cDNAs. 

Conditioned medium from the cells transfected with BMP-2A, BMP-2B, or BMP-3 was 
partially purified by heparin-Sepharose chromatography as follows. A 5-ml heparin-Sepharose 
5 CL6B (Pharmacia) column was initially equilibrated with 4 M urea, 20 mM TrisCI at pH 7. 
Then the conditioned medium in 4 M urea, 20 mM TrisCI, pH 7, was loaded on the column. 
After loading, the fractions were eluted stepwise with 0, 0.1, 0.5 and 2.0 M NaCI in 4 M 
urea, 20 mM TrisCI, pH 7. The bone-forming activity of the fractions of each step was 
assessed in vivo by the method of Sampath and Reddi, supra. Both BMP-2A and BMP-2B 
1 0 possessed easily demonstrable activity, but BMP-3 activity was more difficult to demonstrate. 
Not all transfections gave biologically active material. These data suggest that expression 
levels of BMP-3 are substantially lower than those of BMP-2A and BMP-2B using native 
precursors. 

Next, the role of the precursor region on formation and secretion of mature BMP-2B 

15 was examined. An expression plasmid containing DNA encoding the N-terminal prodomain 
of BMP-2A splicedTo~the~C=terminahmature-grov\^h_facto'' domain of BMP-2B (the sequence 
of which is shown in Figure 2) was assembled. This hybrid BMP-2A/2B construct codes for 
a protein of 400 amino acids, consisting of residues 1-268 from BMP-2A and residues 277- 
409 of BMP-2B. The hybrid was assembled from the BMP-2A plasmid {pRK5.bmp2a) by 

20 rennd\^ng~the~region from- -the -BalU site- -to_, the Hindl[[ site and replacing it with the 
corresponding Bail to Hindlll fragment from the BMP-2B plasmid (pRK5.bmp2b). ~ 

The resulting expression plasmid (designated pRK5.bmp2/4-1 ,1 ) is shown in Figure 3A. 
Nucleotide sequencing revealed two differences in the BMP-2A sequence compared to that 
reported by Wozney et a!., supra: a substitution of A for G at base 261 relative to the ATG 

25 start codon, which is silent, and an A for T substitution at base 570 that results in an Arg 
instead of a Thr at residue 1 90. (The sequences in Figures 1 and 2 do not reflect the newly 
found difference at position 1 90.) The 2A/2B insert sequence is shown in Figure 3B. E, coli 
MM294 cells transformed with this plasmid (£. co/i MM294/pRK5.bmp2/4-1 .1) were 
deposited with the American Type Culture Collection on May 23, 1990 under ATCC 

30 Accession No. 68,330. 

pRK5.bmp2/4-1 . 1 , as well as pRK5.bmp2a and pRK5 .bmp2b for comparative purposes, 
were used to transfect 293 cells using the same procedure as described above, and the 
transfected cells were metabolically labeled using the same procedure as described above, 
except that they were labeled for four hours with 250 |/Ci/mI each of the ^^S-labeled 

35 methionine and cysteine. They were then applied to a 10% SDS-PAGE gel (reduced) using 
the procedure described above. Figure 4 is the fluorogram exposed for 12 hours at -80°C 
of this gel (reduced) of conditioned media (5 //1/lane) from the 293 cells transfected with 



wo 91/18047 



PCT/US91/03540 



-15- 

plasmids containing either BMP.2A (lane 1), BMP.2A/2B (lane 21, BMP-2B (lane 3), control 
pRK5 plasnnid (lane 4), or no plasmid (lane 5). 

For the hybrid, strong bands were found at 36 kD and 23 kD corresponding to the pro 
and mature forms, respectively. The full-length BMP-2A construct expressed mostly the 36- 
5 kD band of the pro form with a small amount of the iB-kD mature form, while for the full- 
length BMP-2B construct, only a small amount of the 23-kD mature band was found. Thus, 
greatly enhanced expression of the DNA encoding the BMP-2B mature dimer was observed 
over expression with the native prodomains. 

Biologically active recombinant BMP-2B homodimers were purified from 3-10 liters of 
10 conditioned medium from 293 cultures (in 150-mm dishes) transiently transfected with 
pRK5.bmp2/4-l.l and DNA encoding the VA RNA gene (Thimmappaya et aL, supra) as 
described above but using 28 A>g pRK5.bmp2/4-l .1 and 8 pg VA gene per dish. One hour 
after glycerol shock, the media was replaced with serum-free medium [F12:DMEM (1:1) 
supplemented with 5 )7g/ml human transferrin, 10 pg/ml insulin, and optionally 10 ng/ml 

15 epidermaLgrowth factor, Mather, Biol. Reorod. . 23: 243 (1980)] (20 ml of media in each 

plate). The cells were incubated for24-^hoursT'the-medi.a_j^vasjTar^^ fresh 
medium was added; the cells were incubated again for 24 hours, the medium was harvested 
and fresh medium was added; and this cycle was repeated once again for a total of three 
— — — -harvests_aj^ 24, 48, and 72 hours. 

20 Under the conditioris~oTharvestingrthe-BMP-2B„accum^^^^ in^e medium to about 

200 ng/ml, while background protein levels remain relatively low, as. estimated by"the~ 
intensity of silver-stained SDS-PAGE gels of the conditioned medium. The protein was 
purified as follows: A 30-ml heparin-Sepharose CL6B column (Pharmacia) was initially 
equilibrated with 4 M urea, 20 mM TrisCI at pH 7. Then the conditioned medium in 4 M urea, 
25 20 mM TrisCI, pH 7, was loaded on the column. The fractions were eluted with a 500-mI 
gradient of 0 to 0.5 M NaCI in 4 M urea, 20 mM TrisCI, pH 7. One major protein band 
appeared on the SDS-PAGE gel of the pooled fractions, with an estimated 70-80% purity. 

The pooled fractions were concentrated with an Amicon Centricon* 10 concentrator 
about 10-foId, then diluted about 10-fold with 4 M urea, 20 mM Tris, pH 7. The diluted 
30 material was loaded onto a 1-ml Pharmacia Mono-Q HR 5/5 column and was eluted with a 
0 to 0.3 M NaCI gradient (30 ml) in 4 M urea, 20 mM Tris, pH 7. The peak fractions were 
pooled, and determined to be about 95% pure by SDS-PAGE. The pooled fractions were 
diaiyzed against 0.1 M acetic acid, lyophilized, and redissolved in 1 ml of 0.1 M acetic acid. 
In cases where the purity of the Mono-Q column eluate was judged unsatisfactory, an 
35 additional HPLC purification step was employed. This step involved loading the pooled 
fractions from the Mono-Q column directly on a Vydac C4 RP-HPLC column (100 x 2.1 mm). 
The HPLC column was eluted with a 30-m! gradient of 0 to 40% N-propanol, 0.1 to 0.06% 
trifluoroacetic acid. The pooled material from this third step was approximately 95% pure, 



wo 91/18047 



PCr/US91/03540 



-16- 

as judged by SDS gel electrophoresis. This material was lyophilized and redissolved as 
described above. Final yield of purified mature BMP-2B was determined by quantitative amino 
acid analysis; the preparation with the three steps yielded 10 //g/liter of conditioned medium, 
or approximately 5% overall based on SDS gel analysis. 
5 N-terminal amino acid sequencing of the purified mature BMP-2B showed a single 

amino terminal sequence beginning at residue 285 of BMP-2A/2B (residue 294 of BMP-2B). 
Sequence data was collected for 18 cycles, and matched exactly that shown underlined in 
Fig. 3B. No minor sequence was observed. The prominent 36-Kd band observed in the SDS 
gel of the transfected supernatants was identified as the pro region by amino terminal 
10 sequencing after transfer to PVDV membranes. Cleavage of the signal sequence between 
residues 23 and 24 (...LLGGAAGiLVPELGRRKFAAA) was as predicted by the weight matrix 
method of von Heijne, Nucl. Acid Res. . 144 : 683-690 (1986). No cleavage at the nearby 
RRK sequence was observed. 

Recombinant BMP-2B is a disuifide-linked dimer, as shown by a decrease in apparent 
15 molecular weight on SDS gel electrophoresis from 33 Kd in the absence of reductants to 23 
Kd in tfie~pr^ence-of-reduGtants. JM^Pi2BJias^^ sites for N-glycosylation. 

The HPLC-purified recombinant BMP-2B was tested in the bone formatiorTassay^of 
Reddi and Sampath, supra, along with TGF-;? and a control. In this assay the implants placed 
into rats were 25 mg demineralized bone powder (DBP) or 25 mg guanidine-HCI-extracted 
20 DBp-reconstituted with-0,-0,5,^2,0,_or e.C^g^^ purified recombinant BMP-2B or 1 ^g 
recombinant mature human TGF->ff1 (U.S. Pat. No. 4,886,747^sued E5eceiTiber~1 2,-1 989)-.— 
The implants were harvested at 12 days, and the calcium content (Fig. 5A) was measured 
by atomic absorption spectrophotometry and the alkaline phosphatase content (Fig. 5B) was 
measured by hydrolysis of p-nitrophenyi phosphate. Duplicate experiments of the 0.5 and 
25 2.0 doses of BMP-2B indicated by solid and cross-hatched bars in Fig. 5 were performed. 

A significant increase in calcium content (even over DBP, which contains some BMP) 
was seen with the 2 //g dose of BMP-2B, while the 0.5 pg dose was sufficient to increase 
alkaline phosphatase. After a 1 2-day harvest, implants of guanidine-HCI-extracted DBP alone 
or reconstituted with 1 //g of purified recombinant BMP-2B were fixed and mounted without 
30 decalcification. Three-micron sections were cut and stained with haematoxylin and eosin. 
Microscopic examination of these stained sections showed abundant bone formation in 
implants reconstituted with BMP-2B as indicated by the presence of calcium deposits. 
Implants reconstituted with vehicle alone did not form bone. 

A construct of the BMP-2A prodomain with the BMP-3 mature region prepared as 
35 described above (by replacing the small Bali to Hindill fragment of pRK5.bmp2a with the 
corresponding Ball-Hindlll fragment from pRK5.bmp3) was transfected into 293 cells as 
described above, in this case, the expression level was no better than the expression levels 
of the native prosequences for BMP-2A and BMP-3. This experiment shows that the BMP-2A 



wo 91/18047 



PCr/US91/03540 



-17- 

prodomain does not improve expression levels of every member of the entire BMP family, but 
rather is effective in enhancing expression of DNA encoding the BMP-2 family. 

The ability of the heterologous precursor region to improve secretion of the biologically 
active dimer may reflect a preference of the BMP-2A precursor region for the BMP-2B mature 
5 growth factor sequence. It certainly indicates the importance of the precursor region in 
proper expression and folding of the biologically active mature dimer form in the BMP-2 
family. 

Deposit of Materials 

The following culture has been deposited with the American Type Culture Collection, 

10 12301 Parklawn Drive, Rockville, MD, USA (ATCC): 

Strain ATCC Deo. No. Deposit Date 

MM294/pRK5.bmp2/4-1.1 68,330 May 23, 1990 

This deposit was made under the provisions of the Budapest Treaty on the International 
Recognition of the Deposit of Microorganisms for the Purpose of Patent Procedure and the 

i 5 Regulations Jhereunder (Budapest Treaty). This assures maintenance of a viable culture for 

30 years from the date of deposit. The organisrTrwiil be-made-available-by^ATCCjj^^ 
terms of the Budapest Treaty, and subject to an agreement between Genentech, Inc. and 
ATCC, which assures permanent and unrestricted availability of the progeny of the culture 
^to_the_pubiicjjpon issuance of the peninent U.S. patent or upon laying open to the public of 

20 any U.S. or foreign patent application^ whicheve'rxomes-first,-and-assures_aj/ailab 

progeny to one determined by the U.S. Commissioner of Patents and Trademarks to be 
entitled thereto according to 35 USC §122 and the Commissioner's rules pursuant thereto 
{including 37 CFR §1.14 with particular reference to 886 OG 638). 

in respect of those designations in which a European patent is sought, a sample of the 

25 deposited microorganism will be made available until the publication of the mention of the 
grant of the European patent or until the date on which the application has been refused or 
withdrawn or is deemed to be withdrawn, only by the issue of such a sample to an expert 
nominated by the person requesting the sample. (Rule 28(4) EPC) 

The assignee of the present application has agreed that if the culture on deposit should 

30 die or be lost or destroyed when cultivated under suitable conditions, it will be promptly 
replaced on notification with a viable specimen of the same culture. Availability of the 
deposited strain is not to be construed as a license to practice the invention in contravention 
of the rights granted under the authority of any government in accordance with its patent 
laws. 

35 The foregoing written specification is considered to be sufficient to enable one skilled 

in the art to practice the invention. The present invention is not to be limited in scope by the 
construct deposited, since the deposited embodiment is intended as a single illustration of one 
aspect of the invention and any constructs that are functionally equivalent are within the 



wo 91/18047 



PCr/US91/03540 



-18- 

scope of this invention. The deposit of material herein does not constitute an adnnission that 
the wrinen description herein contained is inadequate to enable the practice of any aspect 
of the invention, including the best mode thereof, nor is it to be construed as limiting the 
scope of the claims to the specific illustration that it represents. Indeed, various 
5 modifications of the invention in addition to those shown and described herein wilt become 
apparent to those skilled in the art from the foregoing description and fall within the scope 
of the appended claims. 



wo 91/18047 



PCr/US9l/03540 



10 



-19- 

SEQUENCE LISTING 

(1) GENERAL INFORMATION: 

(i) APPLICANT: GENENTECH, INC. 
(ii) TITLE OF INVENTION: Mammalian Expression of the BMP-2 Family 
(iii) NUMBER OF SEQUENCES: 12 



(iv) CORRESPONDENCE ADDRESS: 

(A) ADDRESSEE: Genentech, Inc. 

(B) STREET: 460 Point San Bruno Blvd 

(C) CITY: South San Francisco 
15 (D) STATE: California 

(E) COUNTRY: USA 

(F) ZIP: 94080 

(V) COMPUTER READABLE FORM: 
20 (A) MEDIUM TYPE: 5.25 inch, 360 Kb floppy disk 

• (B) COMPUTER: IBM PC compatible 

(C) OPERATING SYSTEM: PC-DOS/MS-DOS 

(D) SOFTWARE: pat in (Genentech) 

25 (vi) CURRENT APPLICATION DATA: 

^ -{-AO^APPLICATION NUMBER: 

(B) FILING^D^ATE:- 



( C ) CLASSIFICATION : 



30 (vii) PRIOR APPLICATION DATA: 

(A) APPLICATION NUMBER: U.S. Ser. No. 07/528,300 

(B) FILING DATE: 24 May 1990 

(viirr^TTORNEY/AGENT— INFORMATION: 

35 (A) NAME: Hasak, Janet E. ^ — 

(B) REGISTRATION NUMBER: 28,616 

(C) REFERENCE /DOCKET NUMBER: 623 

(ix) TELECOMMUNICATION INFORMATION: 
40 (A) TELEPHONE: 415/266-1896 

(B) TELEFAX: 415/952-9881 

(C) TELEX: 910/371-7168 



45 



(2) INFORMATION FOR SEQ ID N0:1: 



(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 68 bases 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 
50 (D) TOPOLOGY: linear 

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:1: 
55 CGACCATGGT GGCCGGGACC CGCTGTCTTC TAGCGTTGCT GCTTCCCCAG 50 

GTCCTCCTGG GCGGCGCG 68 



60 



(2) INFORMATION FOR SEQ ID NO: 2: 



(i) SEQUENCE CHARACTERISTICS: 
65 (A) LENGTH: 60 bases 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 



wo 91/18047 



PCr/US91/03540 



10 



-20- 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2: 

AATGAAAAGG TTGTATTAAA GAACTATCAG GACATGGTTG TGGAGGGTTG 50 
TGGGTGTCGC 60 

(2) INFORMATION FOR SEQ ID NO: 3: 



(i) SEQUENCE CHARACTERISTICS: 
(A) LENGTH: 78 bases 
15 (B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 



20 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3: 

ATGATTCCTG GTAACCGAAT GCTGATGGTC GTTTTATTAT GCCAAGTCCT 50 
25 GCTAGGAGGC GCGAGCCATG CTAGTTTG 78 



30 



(2) INFORMATION FOR SEQ ID NO: 4 J 



(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 63 bases 

(B) TYPE: nucleic acid 
( G)- STRANDED.NES_S^ single 

35 (D) TOPOLOGY: linear 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4: 
40 CAGGAGATGG TAGTAGAGGG ATGTGGGTGC CGCTGAGATC AGGCAGTCCT 50 

TGAGGATAGA CAG 63 



45 



(2) INFORMATION FOR SEQ ID NO: 5: 



(i) SEQUENCE CHARACTERISTICS: 
50 (A) LENGTH: 50 bases 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

55 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5: 

AGTGTCCCGC AGCGACGCCG GGAGCCGACG CGCCGCGCGG GTACCTAGCC 50 



60 



(2) INFORMATION FOR SEQ ID NO: 6: 



(i) SEQUENCE CHARACTERISTICS: 
65 (A) LENGTH: 50 bases 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 



wo 91/18047 



PCr/US91/03540 



-21- 

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:6: 

TACCCTAACA TGACAGTAGA GTCTTGCGCT TGCAGATAAC CTGGCAAAGA 50 



(2) INFORMATION FOR SEQ ID NO: 7: 

10 (i) SEQUENCE CHARACTERISTICS! 

(A) LENGTH:' 20 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

15 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7: 

-Leu Leu Gly Gly Ala Ala Gly Leu Val Pro Glu Leu Gly Arg Arg 
15 10 15 

Lys Phe Ala Ala Ala 
20 



20 



25 



30 



35 



40 



45 



50 



55 



60 



65 



(2) INFORMATION FOR SEQ ID NO: 8: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 396 amino acids 
^( B )"~Ty PE :— amino_acid_ 
(D) TOPOLOGY: linear 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8: 

Met Val Ala Gly Thr Arg Cys Leu Leu Ala Leu Leu Leu Pro Gin 
1 5 10 15 

Val Leu Leu cTT^ly^ATa- Ala--G-l-y-Leu-Val__Pro^ Glu Leu Gly Arg 
20 25 — — 30_ 

Arq Lys Phe Ala Ala Ala Ser Ser Gly Arg Pro Ser Ser Gin Pro 
^ 35 40 45 

Ser Asp Glu Val Leu Ser Glu Phe Glu Leu Arg Leu Leu Ser Met 
50 55 60 

Phe Gly Leu Lys Gin Arg Pro Thr Pro Ser Arg Asp Ala Val Val 
65 70 75 

Pro Pro Tyr Met Leu Asp Leu Tyr Arg Arg His Ser Gly Gin Pro 
80 85 90 

Gly Ser Pro Ala Pro Asp His Arg Leu Glu Arg Ala Ala Ser Arg 
95 100 105 

Ala Asn Thr Val Arg Ser Phe His His Glu Glu Ser Leu Glu Glu 
110 115 120 

Leu Pro Glu Thr Ser Gly Lys Thr Thr Arg Arg Phe Phe Phe Asn 
125 130 135 

Leu Ser Ser He Pro Thr Glu Glu Phe He Thr Ser Ala Glu Leu 
140 145 150 

Gin Val Phe Arg Glu Gin Met Gin Asp Ala Leu Gly Asn Asn Ser 
155 160 165 

Ser Phe His His Arg He Asn He Tyr Glu He lie Lys Pro Ala 
170 175 180 

Thr Ala Asn Ser Lys Phe Pro Val Thr Ser Leu Leu Asp Thr Arg 



wo 91/18047 



PCr/US91/03540 



•22- 



185 



190 



195 



Leu Val Asn Gin Asn Ala Ser Arg Trp Glu Ser Phe Asp Val Thr 

200 205 210 

Pro Ala Val Met Arg Trp Thr Ala Gin Gly His Ala Asn His Gly 

215 220 225 



10 



15 



20 



25 



Phe Val Val Glu Val Ala His Leu Glu Glu 
230 235 



Lys Gin Gly Val 



Lys Arg His Val Arg He Ser Arg Ser Leu His Gin Asp Glu 
245 250 

Ser Trp Ser Gin He Arg Pro Leu Leu Val Thr Phe Gly His 
260 265 

Gly Lys Gly His Pro Leu His Lys Arg Glu Lys Arg Gin Ala 
275 280 

His Lys Gin Arg Lys Arg Leu Lys Ser Ser Cys Lys Arg His 
290 295 

Leu Tyr Val Asp Phe Ser Asp Val Gly Tro Asn Asp Trp He 
305 310 



Ser 
240 

His 
255 

Asp 
270 

Lys 
285 

Pro 
300 

Val 
315 



Ala Pro Pro Gly Tyr His Ala Phe Tyr Cys His Gly Glu Cys 

-32-0-^ ^ 325 



Pro 
330 



30 Phe Pro Leu Ala Asp His Leu Asn Ser Thr 

335 340 




"35-- 



40 



Gin Thr Leu Val Asn Ser Val Asn Ser Lys 
350 355 

Cys Val Pro Thr Glu~Teu~ Ser^Al-a—rie-Ser- 
365 370 



He Pro Lys Ala 



Cys 
360 



Met-Leu. .Tyj:_Le^u^ Asp 
y75~ 



Glu Asn Glu Lys Val Val Leu Lys Asn Tvr Gin Asp Met Val 
380 385 

Glu Gly Cys Gly Cys Arg 
395 396 

45 (2) INFORMATION FOR SEQ ID NO: 9: 



Val 
390 



50 



55 



60 



65 



(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 409 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9: 

Met He Pro Gly Asn Arg Met Lys Met Val 
15 10 

Val Leu Leu Gly Gly Ala Ser His Ala Ser 
20 25 

Gly Lys Lys Lys Val Ala Glu He Gin Gly 
35 40 

Arg Ser Gly Gin Ser His Glu Lys Lys Arg 
50 55 

Leu Leu Gin Met Phe Gly Leu Arg Arg Arg 
65 70 



Val Leu Leu Cys Gin 
15 

Leu He Pro Glu Thr 
30 

His Ala Gly Gly Arg 
45 

Asp Phe Glu Ala Thr 
60 

Pro Gin Pro Ser Lys 
75 



wo 91/18047 



PCr/US9 1/03540 



-23- 



10 



15 



20 



25 



30 



35 



40 



45 



50 



55 



60 



65 



Ser Ala Val He Pro Asp Tyr Met Arg Asp Leu Tyr Arg Leu Gin 
80 85 90 

ser Gly Glu Glu Glu Glu Glu Gin He His Ser Thr Gly Leu Glu 
$5 100 105 

Tyr Pro Glu Arg Pro Ala Ser Arg Ala Asn Thr Val Arg Ser Phe 
110 120 

His His Glu Glu His Leu Glu Asn He Pro Gly Thr Ser Glu Asn 
125 130 135 

Ser Ala Phe Arg Phe Leu Phe Asn Leu Ser Ser He Pro Glu Asn 
140 145 150 

Glu Val He Ser Ser Ala Glu Leu Arg Leu Phe Arg Glu Gin Val 
155 160 165 

Asp Gin Gly Pro Asp Trp Glu Arg Gly Phe His Arg He Asn He 
170 175 ISO 

Tvr Glu Val Met Lys Pro Pro Ala Glu Val Val Pro Gly His Leu 
^ 185 190 195 

He Thr Arg Leu Leu Asp Thr Arg Leu Val His His Asn Val Thr 
200 205 210 



Arg Trp Glu ThT^PhT^^A^p^V^T^SelT^Pro-^^^^ 

Arg Glu Lys Gin Pro Asn Tyr Gly Leu Ala He Glu Val Thr His 
230 235 240 

-Leu-Hi-s-Gln-Thr__Arg Thr His Gin Gly Gin His Val Arg He Ser 

245 250 255^ 

Arg Ser Leu Pro Gin Gly Ser Gly Asn Asn Ala Gin Leu Arg Pro 
260 265 270 

Leu Leu Val Thr Phe Gly His Asp Gly Arg Gly His Ala Leu Thr 
275 280 285 

Arq Arq Arq Arg Ala Lys Arg Ser Pro Lys His His Ser Gin Arg 
^ 290 295 300 

Ala Arg Lys Lys Asn Lys Asn Cys Arg Arg His Ser Leu Tyr Val 
305 310 315 

Asp Phe Ser Asp Val Gly Trp Asn Asp Trp He Val Ala Pro Pro 
320 325 330 

Glv Tyr Gin Ala Phe Tyr Cys His Gly Asp Cys Pro Phe Pro Leu 
■ 335 340 345 

Ala Asp His Leu Asn Ser Thr Asn His Ala He Val Gin Thr Leu 
350 355 360 

Val Asn Ser Val Asn Ser Ser He Pro Lys Ala Cys Cys Val Pro 
365 370 375 

Thr Gin Leu Ser Ala He Ser Met Leu Tyr Leu Asp Glu Tyr Asp 
380 385 390 

Lys Val val Leu Lys Asn Tyr Gin Gin Met Val Val Glu Gly Cys 
395 400 405 



Gly Cys Arg 



409 



wo 91/18047 



PCr/US91/03540 



-24- 

(2) INFORMATION FOR SEQ ID NO: 10: 

(i) SEQUENCE CHARACTERISTICS: 
(A) LENGTH: 400 amino acids 
5 (B) TYPE: amino acid 

(D) TOPOLOGY: linear 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10: 

10 Met Val Ala Gly Thr Arg Cys Leu Leu Ala Leu Leu Leu Pro Gin 

15 10 15 

Val Leu Leu Gly Gly Ala Ala Gly Leu Val Pro Glu Leu Gly Arg 
20 25 30 

Arg Lys Phe Ala Ala Ala Ser Ser Gly Arg Pro Ser Ser Gin Pro 
35 40 45 



15 



Ser Asp Glu Val Leu Ser Glu Phe Glu Leu Arg Leu Leu Ser Met 

20 50 55 60 

Phe Gly Leu Lys Gin Arg Pro Thr Pro Ser Arg Asp Ala Val Val 

65 70 75 

25 Pro Pro Tyr Met Leu Asp Leu Tyr Arg Arg His Ser Gly Gin Pro 

80 85 90 



30 



45 



55 



60 



Gly Ser Pro Ala Pro Asp His Arg~Leu-Giu-^Arg-Ala^Ala_Ser Arg 
95 100 105 

Ala Asn Thr Val Arg Ser Phe His His Glu Glu Ser Leu Glu Glu 
110 115 120 



— Leu_PrcL_Glu__Thr^Ser Gly Lys Thr Thr Arg Arg Phe Phe Phe Asn 

35 125 — - — 130 135 

Leu Ser Ser lie Pro Thr Glu Glu Phe He Thr Ser Ala Glu Leu 
140 145 150 

40 Gin Val Phe Arg Glu Gin Met Gin Asp Ala Leu Gly Asn Asn Ser 

155 160 165 



Ser Phe His His Arg He Asn He Tyr Glu He He Lvs Pro Ala 

170 175 ' 180 

Thr Ala Asn Ser Lys Phe Pro Val Thr Arg Leu Leu Asp Thr Arg 

185 190 195 



Leu Val Asn Gin Asn Ala Ser Arg Trp Glu Ser Phe Asp Val Thr 
50 200 205 210 



Pro Ala Val Met Arg Trp Thr Ala Gin Gly His Ala Asn His Gly 

215 220 225 

Phe Val Val Glu Val Ala His Leu Glu Glu Lys Gin Gly Val Ser 

230 235 240 

Lys Arg His Val Arg He Ser Arg Ser Leu His Gin Asp Glu His 

245 250 255 

Ser Trp Ser Gin He Arg Pro Leu Leu Val Thr Phe Gly His Asp 

260 265 270 



Gly Arg Gly His Ala Leu Thr Arg Arg Arg Arg Ala Lys Arg Ser 

o5 275 280 285 

Pro Lys His His Ser Gin Arg Ala Arg Lvs Lys Asn Lys Asn Cys 

290 295 300 



wo 91/18047 



PCr/US91/03540 



-25- 

Arq Arq His Ser Leu Tyr Val Asp Phe Set Asp Val Gly Trp Asn 
305 310 315 

ASP Trp He Val Ala Pro Pro Gly Tyr Gin Ala Phe Tyr Cys His 
320 325 330 

Gly Asp Cys Pro Phe Pro Leu Ala Asp His Leu Asn Ser Thr Asn 
^ TTt; 340 345 



10 



15 



His Ala He Val Gin Thr Leu Val Asn Ser Val Asn Ser Ser He 
350 355 360 

Pro Lys Ala Cys Cys Val Pro Thr Glu Leu Ser Ala He Ser Met 
365 370 375 

Leu Tyr Leu Asp Glu Tyr Asp Lys Val Val Leu Lys Asn Tyr Gin 
380 385 390 



Glu Met Val Val Glu Gly Cys Gly Cys Arg 
20 395 400 

(2) INFORMATION FOR SEQ ID NO: 11: 

(i) SEQUENCE CHARACTERISTICS: - 
25 (A) LENGTH: 56 amino acids 

^ ~ -(30_^TXPEi_^nij^o acid 

(D) TOPOLOGYl^'rinear — 



30 



35 



40 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11: 

Lys Arg His Val Arg He Ser Arg Ser Leu His Gin Asp Glu His 
15 10 15 

~Ser"l^p'"Ser Gin -He-Arg-Pro^Leu^ J.eu Thr Phe Gly His Asp 

20 ~25 — 3P_ 

Gly Lys Gly His Pro Leu His Lys Arg Glu Lys Arg Gin Ala Lys 
35 40 45 

His Lys Gin Arg Lys Arg Leu Lys Ser Ser Cys 
50 55 56 

(2) INFORMATION FOR SEQ ID NO: 12: 



45 (i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 60 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 



50 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 12: 

Glv Gin His Val Arg He Ser Arg Ser Leu Pro Gin Gly Ser Gly 
15 10 15 

Asn Asn Ala Gin Leu Arg Pro Leu Leu Val Thr Phe Gly His Asp 
20 25 30 

Gly Arq Gly His Ala Leu Thr Arg Arg Arg Arg Ala Lys Arg Ser 
35 40 45 

Pro Lys His His Ser Gin Arg Ala Arg Lys Lys Asn Lys Asn Cys 
50 55 60 



55 



60 



wo 91/18047 



pCr/US91/03540 



-26- 

WHAT IS CLAIMED IS: 

1 . A DNA construct comprising DNA encoding a nnature BMP-2 upstream of which Is DNA 
encoding a precursor portion of a mammalian protein other than that of BMP-2. 

2. The DNA construct of claim 1 wherein the BMP-2 is human BMP-2. 

3. The DNA construct of claim 2 wherein the BMP-2 is human BMP-2B. 

4. The DNA construct of claim 1 wherein the precursor portion comprises a signal 
sequence. 

5. The DNA construct of claim 1 wherein the precursor portion has at least 25% amino 
acid sequence identity to the native precursor portion of the BMP-2 from the N- 
terminus of the BMP-2 precursor to the first cysteine residue in the mature region of 
the BMP-2. 

6. The DNA construct of claim 5 wherein the precursor portion is from a different BMP-2. 

7. The DNA construct of claim 6 wherein the mature BMP-2 is mature BMP-2B and the 
precursor portion is from BMP-2A. 

8. The DNA construct of claim 7 wherein the BMP-2A and BMP-2B are human BMPs. 

9. An expression vector comprisingnhe-DNA-eonstruct-of^claim 1. 

10. An expression vector comprising the DNA construct of claim 5. 

11. An expression vector comprising the DNA construct of claim 7. 

1 2. The expression vector of claim 1 1 that is pRK5.bmp2/4-1 .1 . 

13. A mammalian h~os"t transformed-with-the expression_vector^f clajm 9. 

14. A mammalian host transformed with the expression vector of claim 10. 

15. A mammalian host transformed with the expression vector of claim 1 1 . 
16- A mammalian host transformed with the expression vector of claim 12. 

17. An E. co/ihosx transformed with the expression vector of claim 12 deposited as ATCC 
No. 68,330. 

18. The host of claim 13 that is a 293 or Chinese hamster ovary cell line, 

19. In a method for expressing DNA encoding a BMP-2 in mammalian cells, the 
improvement which comprises employing as the host the host of claim 13. 

20. In a method for expressing DNA encoding a BMP-2 in mammalian cells, the 
improvement which comprises employing as the host the host of claim 14. 

21. In a method for expressing DNA encoding a BMP-2 in mammalian cells, the 
improvement which comprises employing as the host the host of claim 15. 

22. In a method for expressing DNA encoding mature BMP-2B in mammalian cells, the 
improvement which comprises employing as the host the host of claim 16. 



wo 91/18047 



PCT/US91/03540 



1 / 5 




CD 




CO 




CO 




CSJ 


CSJ 


CM 


CNJ 


CNJ 




Cl 


a 


OL 


d 


Cl 


Cl 


S 


E 


E 






E 






JD 









wo 91/18047 , PCr/US91/03540 

2/5