Skip to main content

Full text of "USPTO Patents Application 09804625"

See other formats


PATENT 
Customer No. 22,852 
Attorney Docket No. 08702.0039-02000 

AMENDMENTS TO THE SPECIFICATION: 

Please amend the specification as follows: 

Please delete the paragraph on page 5, lines 15-17 and replace it with the 
following paragraph: 

Fig. 1 comprises partial DNA (SEQ ID NO: 1) and derived amino acid sequence (SEQ 
ID NO: 2) of bovine BMP-2 from bacteriophage lambda bP-21, ATCC #40310 further 
described below. 

Please delete the paragraph on page 5, lines 19-21 and replace it with the 
following paragraph: 

Fig. 2 sets forth the DNA (SEQ ID NO: 3) and derived amino acid sequence (SEQ ID 
NO: 4) of human BMP-2 from lambda U20S-39, ATCC #40345 further described below. 

Please delete the paragraph on page 5, lines 23-25 and replace it with the 
following paragraph: 

Fig. 3 sets forth the DNA (SEQ ID NO: 5) and derived amino acid sequence (SEQ ID 
NO: 6) of human BMP-4 from lambda U20S-3, ATCC #40342 further described below. 

Please delete the paragraph on page 19, lines 16-28 and replace it with the 
following paragraph: 

The protein composition of Example MA of molecular weight 28 - 30 kd is reduced as 
described in Example IIC and digested with trypsin. Eight tryptic fragments are isolated 
by standard procedures having the following amino acid sequences: 



-2- 



PATENT 
Customer No. 22,852 
Attorney Docket No. 08702.0039-02000 

Fragment 1:AAFLGDIALDEEDLG (SEQ ID NO: 7) 

Fragment 2:AFQVQQAADL (SEQ ID NO: 8) 

Fragment 3:NYQDMVVEG (SEQ ID NO: 9) 

Fragment 4:STPAQDVSR (SEQ ID NO: 10) 

Fragment 5: N Q E A L R (SEQ ID NO: 11) 

Fragment 6:LSEPDPSHTLEE (SEQ ID NO: 12) 

Fragment 7: F D A Y Y (SEQ ID NO: 13) 

Fragment 8:LKPSN?ATIQSIVE (SEQ ID NO: 14) 

Please delete the paragraph on page 19, line 30 to page 20, line 1 and replace it 
with the following paragraph, recognizing that J. Mol. Biol. Was underlined in the 
original: 

Two probes consisting of pools of oligonucleotides (or unique oligonucleotides) 
are designed according to the method of R. Lathe. J. Mol. Biol.. 183(1) : 1-12 (1985) on 
the basis of the amino acid sequence of Fragment 3 and synthesized on an automated 
DNA synthesizer as described above. 

Probe #1:ACNACCAT [A/G] T C [T/C] T G [A/G] A T (SEQ ID NO: 15) 
Probe # 2: C A [A/G] G A [T/C] ATGGTNGTNGA (SEQ ID NO: 16) 

Please delete the paragraph on page 24, line 34 to page 26, line 8 and replace it 
with the following paragraph: 

Full-length BMP-4 human cDNA clones are obtained in the following manner. 
The 200 bp EcoRI-SacI fragment from the 5' end of the BMP-4 recombinant 11-10-1 is 



-3- 



PATENT 
Customer No. 22,852 
Attorney Docket No. 08702.0039-02000 

isolated from its plasmid subclone, labeled by nick-translation, and hybridized to a set of 

duplicate nitrocellulose replicas of the U-2 OS cDNA library (25 filters/set; representing 

500,000 recombinants). Hybridization and washing are performed under stringent 

conditions as described above. 16 duplicate positives are picked and replated for 

secondaries. Nitrocellulose filter replicas of the secondary plates are made and 

hybridized to an oligonucleotide which was synthesized to correspond to the sequence 

of 11-10-1 and is of the following sequence: 

CGGGCGCTCAGGATACTCAAGACCAGTGCTG (SEQ ID NO: 17) 
Hybridization is in standard hybridization buffer AT 50° C with washing at 50° in 1 X 
sec, 0.1% SDS. 14 recombinant bacteriophage which hybridize to this oligonucleotide 
are plague purified. Plate stocks are made and small scale bacteriophage DNA 
preparations made. After sucloning 3 of these into M13, sequence analysis indicates 
that they represent clones which overlap the original BMP-4 clone. One of these, 
lambda U20S-3, was deposited with the ATCC under accession number 40342 in June 
16, 1987. U20S-3 contains an insert of approximately 1.8 kb. The DNA sequence 
(SEQ ID N0:5) and derived amino acid sequence (SEQ ID NO: 6) of U20S-3 are 
shown below in Figure 3. This clone is expected to contain all of the nucleotide 
sequence necessary to encode the entire human BMP-4 protein. The BMP-4 protein 
encoded by Figure 3 is contemplated to contain the 97 amino acid sequence from 
amino acid #31 1 to #408 or a sequence substantially homologous thereto. This cDNA 
contains an open reading frame of 1224 bp, encoding a protein of 408 amino acids, 
preceded by a 5' untranslated region of 394 bp with stop codons in all frames, and 
contains a 3' untranslated region of 308 bp following the in-frame stop codon. The 8 bp 



-4- 



PATENT 
Customer No. 22,852 
Attorney Docket No. 08702.0039-02000 

region preceding the 5' untranslated region represents a linker used in the cDNA cloning 

procedure. This protein of 408 amino acids has molecular weight of 47kd and is 

contemplated to represent the primary translation product. Mature BMP-4 is 

contemplated to comprise amino acid #293 (Ser, Pro, Lys...) - #408 (Arg) of Figure 3. A 

sequence similar though not identical to tryptic Fragment 3 of Example IV is underlined 

in Figure 3 (SEQ ID NO: 6). The underlined sequence Asn-Tyr-Gln-Glu-Met-Val-Val- 

Glu-Gly (residues 396-404 of SEQ ID NO: 6) differs from the tryptic fragment Asn-Tyr- 

Gln-Asp-Met-Val-Val-Glu-Glv (SEQ ID NO: 9) bv one amino acid in position four. 

Please delete the paragraph on page 30, lines 13-30 and replace it with the 
following paragraph with both E. coll and Biotechnology 84 underlined in the original: 

Plasmid pMT2 CXM is obtained by EcoRI digestion of pMT2-VWF, which has 
been deposited with the American Type Culture Collection (ATCC) , Rockville, MD 
(USA) under accession number ATCC 67122. EcoRI digestion excises the cDNA insert 
present in pMT2-VWF, yielding pMT2 in linear form which can be ligated and used to 
transform E. coli HB 101 or DH-5 to ampicillin resistance. Plasmid pMT2 DNA can be 
prepared by conventional methods. pMT2 CXM is then constructed using loopout/in 
mutagenesis [Morinaga, et al.. Biotechnology 84: 636 (1987)]. This removes bases 
1 075 to 1 145 relative to the Hind III site near the SV40 origin of replication and 
enhancer sequences of pMT2. In addition it inserts the following sequence: 

5" PO-cATGGGCAGCTCGAG-3' (SEQ ID NO: 18) 
at nucleotide 1 145. This sequence contains the recognition site for the restriction 
endonuclease Xho I. A derivative of pMT2CXM, termed pMT23, contains recognition 



PATENT 
Customer No. 22,852 
Attorney Docket No. 08702.0039-02000 

sites for the restriction endonucleases PstI, Eco Rl, Sail and Xhol. Plasmid pMT2 CXM 

and pMT23 DNA may be prepared by conventional methods. 

Please delete the paragraph on page 31 , lines 13-27 and replace it with the 
following paragraph with the nucleotide sequences underlined in the original: 

A derivative of the BMP-2 cDNA sequence set fourth in Figure 2 (SEQ ID NO: 3) 
in which the 5' untranslated region is deleted i s mado by removal of the sequences 
contained between the Sail site at the 5' adapter (from the original cDNA cloning), and 
the Sail site 7 base pairs upstream of the initiator ATG, by digestion with Sail and 
religation. This step is conveniently performed in either SP65 derivatives containing the 
full length BMP-2 cDNA, but can also be performed in pMT2 derivatives. The 3* 
untranslated region is removed using heteroduplex mutagenesis using the mutagenic 
oligonucleotide 

5' GAGGGTTGTGGGTGTCGCTAGTG AGTCGACT ACAGCAAAATT (SEQ ID NO: 19) 

Terminator Sail 

The sequence contains the terminal 3' coding region of the BMP-2 cDNA, followed 
immediately by a recognition site for Sail. 

Please delete the paragraph on page 33, line 25 to page 34, line 4 and replace it 
with the following paragraph with the nucleotide sequences underlined in the original: 

pMT21 was derived from pMT2 through the following two modifications. First, 76 
bp of the 5' untranslated region of the DHFR cDNA including a stretch of 19 G residues 



-6- 



PATENT 
Customer No. 22,852 
Attorney Docket No. 08702.0039-02000 

from G/C tailing for cDNA cloning was deleted. In this process, a Xhol site was inserted 

to obtain the following sequence immediately upstream from DHFR: 

5' - CTGCAG GCGAGCCT GAATTCCTCGAG CCATCATG-3' (SEQ ID NO: 20) 
PstI Eco Rl Xhol 

Second, a unique Clal site was introduced by digestion with EcoRV and Xbal, treatment 
with Klenow fragment of DNA polymerase I, and ligation to a Clal linker (CATCGATG). 
This deletes a 250 bp segment from the adenovirus virus associated RNA (VAI) region 
but does not interfere with VAI RNA gene expression or function. pMT21 was digested 
with EcoRI and Xhol, and used to derive the vector pEMC2B1. 

Please delete the paragraph on page 34, lines 5-26 and replace it with the 
following paragraph with J. Virol. 63 and the nucleotide sequences underlined in the 
original: 

A portion of the EMCV leader was obtained fromm pMT2-ECAT1 [S.K. Jung, 

etal, IViroieS: 1651-1660 (1989)] by digest with Eco Rl and PstI, resulting in a 2752 

bp fragment. This fragment was digested with TaqI yielding an Eco RI-TaqI fragment of 

508 bp which was purified by electrophoresis on low melting agarose gel. A 68 bp 

adapter and its complementart strand were synthesized with a 5' TaqI protruding end 

and a 3' Xhol protruding end which has the following sequence: 

5'-CGAGGTTAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTT 
TaqI 

GAAAAACACGATTGC-3' (SEQ ID NO: 21) 

Xhol 



-7- 



PATENT 
Customer No. 22,852 
Attorney Docket No. 08702.0039-02000 

This sequence matches the EMC virus leader sequence from nucleotide 763 to 827. It 

also changes the ATG at position 10 within the EMC virus leader to an ATT and is 

followed by a Xhol site. A three way ligation of the pMT21 Eco Rl-Xhol fragment, the 

EMC virus EcoRI-TaqI fragment, and the 68 bp oligonucleotide adapter Taql-Xhol 

adapter resulted in the vector pEMC2B1 . 

Please delete the paragraph on page 34, line 35 to page 35 and replace it with 
the following paragraph with the nucleotide sequences underlined in the original: 

A derivative of the BMP-4 cDNA sequence set forth in Figure 3 in which the 3' 
untraslated region is removed i s mad e via heteroduplex mutagenesis with the 
mutagentic oligonucleotide: 

5' GGATGTGGGTGCCGCTGACTCTAGAGTCGACG GAATTC 3' (SEQ ID NO: 22) , 

Terminator EcoRI 

This deletes all of the sequences 3' to the translation terminator codon of the BMP-4 
cDNA, juxtaposing this terminator codon and the vector polylinker sequences. This step 
is performed in an SP65 vector though may be conviently performed in MT2 derivatives 
containing the BMP-4 cDNA. The 5' untraslated region is removed using the restriction 
endonuclease BsmI, which cleaves within the eighth codon of BMP-4 cDNA. 
Reconstruction of the first eighth codon of BMP-4 cDNA. Reconstruction of the first 
eight codons is accomplished by ligation to oliognucleotides: 

EcoRI Initiator BsmI 
5' AATTC ACCATGATTCCTGGTAACC GAATGCT 3' and 
3' GTGGTACTAAGGACCATTGGCTTAC 5' (SEQ ID NO: 23) 



-8- 



PATENT 
Customer No. 22,852 
Attorney Docket No. 08702.0039-02000 

These oligonucleotides form a duplex which has a BsmI complementary cohesive end 

capable of ligation to the BsmI restricted BMP-4 cDNA, and it has an EcoRI 

complementary cohesive end capable of ligation to the EcoRI restricted vector MT2. 

Thus the cDNA for BMP-4 with the 5' and 3' untranslated regions deleted, and retaining 

the entire encoding sequence is contained within an EcoRI restriction fragment of 

approximately 1.2kb. 



-9-