Skip to main content

Full text of "USPTO Patents Application 09804625"

See other formats


Searching PAJ 



Page 1 of 2 



PATENT ABSTRACTS OF JAPAN 



(11 )Publication number: 05-178756 
(43)Date of publication of application : 20.07.1993 



(51)lnt.CI. 



A61K 37/02 



(21) Application number : 03-345189 

(22) Date of filing : 26.12.1991 



(71) Applicant 

(72) lnventor : 



TORAY IND INC 



IDA NOBUTAKA 
OKAMOTO SUSUMU 



OKANO KIYOSHI 
SATO YUlCHIRO 



NARUTO MASANOBU 



(54) PREVENTING AND TREATING AGENT FOR HEPATOPATHY 

(57)Abstract: 

PURPOSE: To obtain a preventing and therapeutic agent for hepatopathy containing 
interleukin 6 and/or interleukin 11 as an active ingredient. 

CONSTITUTION: The objective preventing and therapeutic agent is obtained by including 
interleukin 6 and/or interleukin 11 as a principal ingredient. This interleukin 6 or 11 or both are 
obtained by culturing a cell derived from a human. This agent is administered by intervenous, 
subcutaneous or intramuscular injection, intravenous instillation or local infusion or 
transmucosal administration such as peroral, percutaneous, transpulmonary or enteral 
administration or the percutaneous administration. The dose is 0.0001-300ng per day and kg 
body weight. This agent is excellent in function to lower the glutamic-oxaloacetic 
transaminase(GOT) value and the glutamic-pyruvic transaminase(GPT) value raised by 
various hepatopathies and useful for the hepatopathies such as viral hepatitis, bacterial or 
parasitic infectious hepatitis, hepatopathies caused by autoimmune diseases, akx)hblic 
hepatopathies, hepatopathies caused by medicines or poisonous substances, tiepatoma or 
ischemic hepatopathies caused by hepatic transplantation, surgical operatkjn or cardiac 
infarction. 



LEGAL STATUS 

[Date of request for examination] 24.12. 1-998 

http://wwwl9.ipdl.ncipi.go.jp/PA] /resuit/detail/main/wAAAFyaa;MDA405 1 78756P1 .htm 2/8/2005 



Searching PAJ 



Page 2 of 2 



[Date of sending the examiner's decision of 03.07.2001 
rejection] 

[Kind of final disposal of application other than 
the examiner's decision of rejection or 
application converted registration] 

[Date of final disposal for application] 

[Patent number] 

[Date of registration] 

[Number of appeal against examiner's 
decision of rejection] 

[Date of requesting appeal against examiner's 
decision of rejection] 
[Date of extinction of right] 

Copyright (C); 1998,2003 Japan Patent Office 



http://www]9jpdl.ncipi.gojp/PAl/r€sult/detail/main/^ 2/8/2005 



Page 1 of 13 



♦NOTICES* 

JPO and NCI PI are not responsible for any 
damages caused by the use of this translation. 

] .This document has been translated by computer. So the translation may not reflect the original 
precisely. 

2.**** shows the word which can not be translated. 
3 Jn the drawings, any words are not translated. 



DETAILED DESCRIPTION 



[Detailed Description of the Invention] 
[0001] 

[Industrial Application] This invention relates to prevention and the remedy of new liver disease. 
(0002] 

[Description of the Prior Art] When a living body maintains HOMEO star cis- (homeostasis), the role 
which liver plays is very large and the object is mainly attained by metabolism. There are carbohydrate 
metabolism, lipid metabolism, a protein metabolic turnover, a ****** metabolic turnover, a bilirubin 
metabolic turnover, a vitamin metabolic turnover, a hormone metabolic turnover, drug metabolism, etc. 
in the metabolism of a liver, and the enzyme which participates in these processes reaches at least 1000 
or more things which have become clear (a liver disease handbook, Haruo Kameda work, a MEJIKARU 
friend company, 1 982). Thus, a liver is the core of the metabolism in a living body, and they bring [ the 
depression and abolition are critical or ] about a death-dealing result. The abnormalities in a liver 
function are induced by various causes. For example, the thing based on existence of the thing and 
neoplasm which are depended on chemicals, such as infection by the virus, bacteria, a worm, etc., a 
thing to depend on an autoimmune disease, an alcoholic thing, a drug, and poison, growth, etc. is 
various. The symptoms are similarly classified into acute hepatitis, the chronic hepatitis, fiilminant 
hepatitis, a fatty liver, liver cirrhosis, hepatic carcinoma, etc. according to clinical findings, such as a 
cause and a progress situation of a condition, and a diagnosis. 

[0003] As liver disease diagnostics, full use of expensive devices, such as liver scintiscanning, 
abdominal CT, a celiac arteriography method, a laparoscopy, and hepatobiopsy, and an advanced 
technique is made. However, the meaning of clinical biochemistry parameter measurement as a means to 
detect the abnormalities in a liver function in first is very high. There are various things in a serological 
liver function parameter, for example, blood serum transaminase, the blood serum alkaline phosphatase, 
gamma glutamyl transpeptidase, a leucine aminopeptidase, lactate dehydrogenase, choline -esterase 
activity, etc. are the example of representation. GOT (glutamic oxaloacetic transaminase) and GPT 
(glutamic pyruvic transaminase) are especially contained in hepatocyte, and the transmigration is carried 
out into a blood flow with the denaturation of hepatocyte, and a necrosis, and since it changes sharply 
compared with other enzymes, it is widely used on clinical as the manifestation of liver disease, and a 
restorative monitor enzyme (a liver disease handbook, Haruo Kameda work, a MEJIKARU friend 
company, 1982). 

[0004] As pharmacotherapy to liver disease, an ammonia metabolic turnover related substance and 
various cholekinetics, such as hormone, such as nucleic-acid precursors, such as antidotes, such as **** 
factors, such as an infusion solution of nutrients, such as sugar, comprehensive amino acid, and blood 
serum concentration albumin, a methionine, and a choline, glucuronic acid, and an SH compound, 
various vitamins, an orotic acid, AICA, and a nucleotide, ACTH, and adrenocorticosteroid, glutamic 
acid, and an aspartic acid, diuretic, etc. are prescribed for many years, for example. These answer the 
cause of liver disease, and a symptom, and although used together and used, independent or the results 
for which satisfaction dies is not necessarily acquired. In recent years, the application to the liver disease 



http://www4.ipdl.ncipi.go.jp/cgi-bin/tran_web_cgi_ejje 2/8/2005 



Page 2 of 13 



of the peptide sex hormone called lymphokine and cytokine attracts attention. For example the 
effectiveness (it Immunobiolog(ies) Greenberg, H.B.et al., N.EnglJ.Med., 295, and 517- 522, 1976, 
Hess, and G.et al. -) of the interferon to chronic hepatitis B the possibility (Hoofnagle, J.H.et ah, 
N.EnglJ.Med., and 315 -) of the interferon application to 172, 255-261, 1986, or C mold (un-A un-B 
molds) chronic hepatitis 1 575-1578, 1986 Di Bisceglie, A.M.et al., N.Engl.J.Med., 321, 1506-1510, and 
1 986 are reported, and the expectation as a viral hepatitis remedy is growing. The proteinic discovery 
and the structure determination which were named HGF (Hepatocyte Growth Factor) of molecular 
weight 84kd which promotes the fissiparity of hepatocyte are similarly tried on in vitro (the Ichihara **, 
Biomedica., 6, 1 151-1 155, 1991), and the application as a remedy which leads liver regeneration 
acceleration is expected. 

[0005] On the other hand, interleukin 6 (it abbreviates to lL-6 hereafter) is, Interferon beta 2 (2537 
Zilberstein, A.et.at., and EMBO J, 5, 2529- 1986), B cell defferentiating factor (BSF-2): (76 T. Hirano, 
et.al., Nature, 324, 73- 1986), A 26-KDa protein (Hageman, G.et.al., Eur.J.Biochem., 159,625-632, 

1986) , A hybridoma / plasma site-Ma grov/th factor (919 VanDamme, J.et.al., J.Exp.Med., 165,914- 

1987) , Hepatocyte stimulator (HSF) : (7255 221 1 8 -22, 1987; Andus, T.et.al., FEBS Lett., Gauldie, 
J.et.aL, Proc.NatLAcad.Sci.USA, 84, 7251- 1987) etc.. It turned out that the physiological active 
substance studied independently is the same molecule, being referred to as IL-6 from the bioactive 
versatility \yas advocated, and the name is established. IL-6 promote the maturation of megakaryocyte 
other than the physiological function accompanying the discovery in recently and in vitro, as described 
above. (Ishibashi, T. et al., Proc.NatLAcad.Sci.USA, 86, 5953-57 and 1989), and in vivo Administration 
reports that a platelet increases (for example, Asano, S. et al., Blood, 75, 1602-1605, 1990). [ for 
example, ] 

[0006] As bioactive of IL-6, in addition, lifting of the A CTH -concentration in blood (Naitoh, Y., 
Biochem.Biophys.Res.Commun., 155, 1459, 1988), Acceleration of the various hormone (PRL, GH, 
LH, FSH) production from a hypophysis (Spangeol, B., Endocrinology, 125, 575, 1989), The insulin 
production sthenia from the pancreas (Sandler, S., Endocrinology, 126, 1228, 1990), a nervous system - 
although the acceleration of differentiation of a cell, a survival maintenance operation (Satoh, T., 
Mol.Cell.BioL, 8, 3546, and 1988), etc. are continuing variably The position as the matter with which 
these knowledge is industrially meaningful to IL-6 promptly, i.e., a remedy, is not necessarily given, 
and, for that purpose, rational and scientific certification is required. 

[0007] About the meaning of an operation to the liver of IL-6, it is indefinite similarly. That is, IL-6 are 
(Andus, T., FEBS Letter, 221, 18, and 1987) as a hepatoc>^e stimulator, A fibrinogen, alpha 1 -acid 
glycoprotein, As a production promoter of acute stage proteins, such as alpha2-maeroglobulin, (Geiger, 
T., Eur.J.Immunol., 18, 717, 1988, Heinrich, P., Biochem.J., 265, 621, and 1990), The report of (Ritchie, 
D., Am.J.Physiol., 258, E57, and 1990) as a liver glucose new promoter A certain thing, It is indefinite 
in whether these operations are reactions usefiil for a living body, or to be disadvantageous reactions, 
and one side. Myxoma in an atrium () [ Hirano, T., ] [ Proc] In connection with Natl.Acad.Sci.USA., 
84, 228-231, and 1987 and CASL Mann syndrome (Yoshizaki, K., Blood, 74, 1360-1367, and 1989), 
IL-6 are identified among the blood of a large quantity, The image of minus exists as a common idea. 
The acute stage protein production sthenia same with discovering the operation to a liver at the time of 
the inflammation which accompanies bacterial infection etc. to a minus image is strong. 
[0008] On the other hand, interleukin 1 1 (it abbreviates to IL-1 1 hereafter) is the cytokine discovered as 
a blood-making factor which a stromata c-ell and fibroblast produce at the beginning (Paul.S.R.et al., 
Proc.Natl.Acad.Sci.USA, 87, 7512-7516, 1990). There is [ bioactive / the ] a field which is not solved in 
detail yet about IL-1 1. 
[0009] 

[Problem(s) to be Solved by the Invention] Originally the object of this invention is fi-om the 
physiological active substance which has an operation in the living body to offer prevention and the 
remedy of the outstanding liver disease. 
[0010] 

[Means for Solving the Problem] Said object is completed by the following this inventions. 



http://www4.ipdl.ncipi.gojp/cgi-bin/tran_web_cgi_ejje 2/8/2005 



Page 3 of 13 



[001 i] That is, this invention relates to the liver function protection which makes IL-6 and/or IL-1 1 an 
active principle, an improvement, liver disease prevention, and a liver disease therapy. This invention 
becomes the cause of various hepatic insufficiency and liver disease and is biological if it states in more 
detail. The carcinostatic substance chosen as a representative is prescribed for the patient from from 
among chemical and physical factors. Medicate the induced liver disease animal with IL-6 and/or IL-11 , 
and GOT w^hich occupies the position steadfast to detection of liver disease and a liver function 
abnormal condition, and a GPT value are made into an index in clinical biochemistry. lL-6 and/or liver 
function protection of IL-1 1 , an improvement, liver disease prevention, and a liver disease curative 
effect were proved, and it was completed for the first time. 

[0012] Bleedoff into the blood of GOT and GPT which are the marker enzyme of hepatocyte does not 
ask that it is direct and indirect, but is uniquely brought about by the denaturation of hepatocyte, and 
destruction. This invention showed that there was an operation which GOT which reached abnormality 
level in the hepatdpathy model animal, and a GPT value limit to a shift or normal level in the normal 
level direction by administration of IL-6 and/or IL-1 1 . 

[001 3] The reason using the carcinostatic substance by which current regarding as questionable is 
carried out as the abnormality model production approach in a liver function by this invention in the 
medical site is that the practical convenience of carcinostatic substance loading in completion of this 
invention can expect promptly according to hepatotoxicity relief of the cancer patient at the time of a 
carcinostatic substance activity or the object, and a symptom. Therefore, the application of this invention 
of be [ it / what is limited only to the cancer treatment field ] is clear, is especially clear also from the 
above-mentioned GOT and the clinical meaning of GPT enzyme activity measurement, and can be 
applied to the situation that all the hepatic insufficiency that may be accompanied by hepatocyte 
denaturation and destruction, liver disease conditions, or these stages may be arrived at, preclusively and 
in therapy. 

[0014] There is especially no limit in IL-6 used by this invention, and IL-6 obtained by the known 
approach are used suitably. For example, recombinant IL-6 obtained by the thing which cultivated the 
IL-6 production cell and was obtained, or the modifying-gene method is sufficient. What cultivates an 
IL-6 production human cell and is obtained is used more preferably. 

[0015] Since IL-6 which IL-6 acquired from the culture human cell can avoid mixing of the impurity of 
the seed origin of those other than Homo sapiens, and are obtained become a thing near lL-6 which 
originally work in the living body, they are desirable. That is, since an antibody production can be 
relatively eliminated when Homo sapiens is medicated as a remedy, since structure including a sugar 
chain and detailed quahfication becomes a thing near lL-6 Homo sapiens in the living body, it is 
desirable. Therefore, IL-6 which a Homo sapiens cultured cell produces can expect in the living body 
and more efficient effectiveness. 

[0016] If IL-6 obtained by cultivating the cell of the Homo sapiens origin are meant and being specified 
further, as for IL-6 which the culture human cell of this invention produces, IL-6 obtained by cultivating 
a normal cell, i.e., adhesion which have not cancerated (extreme transformation) or is not the cancer cell 
origin, human cell are desirable. IL-6 obtained according to these conditions have the structure which 
the sugar chain usually added. Especially although it is especially used suitably since fibroblast, the 
endothelial cell, the stromata cell, etc. are considered to be one of the sources of IL-6 in the living body 
and the part can be especially cultivated in the form near a normal cell as a normal human cell which is 
not the cancer cell origin, it is not limited to these. 

[0017] Since especially a suitable cell is adhesion among the above-mentioned normal human cells, it 
can cultivate on general cell culture conditions. Although the cultivation using a common culture flask, a 
roller bottle, and a micro carrier (particle) etc. is used suitably, it is not limited to this. In this way, 
according to the usual purification method, almost pure IL-6 can be obtained from the culture medium 
obtained by culture of a human cell. Although an example shows the example about these culture and a 
purification method, of course, it is not limited to this. 

[0018] On the other hand, recombinant IL-6 can be manufacmred by the known approach. Although the 
example which made Escherichia coli the host was shown as an example as an example, it can 



ht^;//wvm4.ipdl ^ncipi .go jp/cgi-bin/tran_web_cgi__ejje 



2/8/2005 



Page 4 of 1 3 



manufacture by using the genetic manipulation method widely learned also except this. For example, it 
can prepare also by connecting IL-6 gene with lower streams of rivers, such as a promotor who 
functions by the host, and introducing into animal cells, such as prokaryotic cells, such as a Bacillus 
subtilis, yeast, and a hamster cell, a mouse cell, an ape cell, a human cell, an insect cell, and an insect 
object with gestalten, such as DNA or a virus. 

[0019] There is especially no limit in IL-1 1 used by this invention, and IL-1 1 obtained by the known 
approach are used suitably. For example, recombinant IL-1 1 obtained by the thing which cultivated the 
lL-1 1 production cell and was obtained, or the modifying-gene method is sufficient. 
[0020] Recombinant IL-l 1 can be manufactured by the known approach. Although the example which 
made Escherichia coli the host was shown as an example as an example, it can manufacture by using the 
genetic manipulation method widely learned also except this. For example, it can prepare also by 
connecting IL-1 1 gene with lower streams of rivers, such as a promotor who functions by the host, and 
introducing into animal cells, such as prokaryotic cells, such as a Bacillus subtilis, yeast, and a hamster 
cell, a mouse cell, an ape celi, a human cell, an insect cell, and an insect object with gestalten, such as 
DNA or a virus. 

[0021 ] Since IL-1 1 which IL-1 1 acquired from the culture human cell can, on the other hand, avoid 
mixing of the impurity of the seed origin of those other than Homo sapiens, and are obtained become a 
thing near IL-U which originally work in the living body, they are desirable. That is, since an antibody 
production can be relatively eliminated when Homo sapiens is medicated as a remedy, since structure 
including a sugar chain and detailed qualification becomes a thing near lL-1 1 Homo sapiens in the 
living body, it is desirable. Therefore, lL-1 1 which a Homo sapiens cultured cell produces can expect in 
the living body and more efficient effectiveness. 

[0022] If IL-1 1 obtained by cultivating the cell of the Homo sapiens origin are meant and being 
specified further, as for lL-1 1 which the culture human cell of this invention produces, IL-1 1 obtained 
by cultivating a normal cell, i.e., adhesion which have not cancerated (extreme transformation) or is not 
the cancer cell origin, human cell are desirable. IL-1 1 obtained according to these conditions have the 
structure which the sugar chain usually added. Especially although it is especially used suitably since 
fibroblast, the endothelial cell, the stromata cell, etc. are considered to be one of the sources of IL-1 1 in 
the living body and the part can be especially cultivated in the form near a normal cell as a normal 
human cell which is not the cancer cell origin, it is not limited to these. 

[0023] Since especially a suitable cell is adhesion among the above-mentioned normal human cells, it 
can cultivate on general cell culture conditions. Although the cultivation using a common culture flask, a 
roller bottle, and a micro carrier (particle) etc. is used suitably, it is not limited to this. In this way, 
according to the usual purification method, almost pure IL-1 1 can be obtained from the culture medium 
obtained by culture of a human cell. 

[0024] Prevention and the remedy of this invention contain Homo sapiens IL-6 manufactured by the 
approach mentioned above, and/or IL-1 1 as a principal component. A common excipient is chosen as 
other components, of course, there is no additive - ** - the object of this invention is attained. An 
additive is added for stabilization general mainly. As such an excipient, it is chosen from the protein 
which can be used as an excipient and/or the saccharides which were indicated by the station method. 
Especially suitably, out of a human serum albumin (HSA), gelatin, a mannitol, a sorbitol, a lactose, 
trehalose, etc., although combined and chosen, they are not proper or the thing limited to these, of 
course. 

[0025] A living body is medicated with the constituent which uses as a principal component IL-6 
obtained in this way and/or IL-1 1 in order to attain concretely the liver function protection which is the 
object of this invention, an improvement, liver disease prevention, and a liver curative effect. The 
hepatopathy prevention accompanying cancer chemotherapy although it does not limit especially as an 
object for administration. The living body which needs administration of existence of the living body 
which needs relief and a therapy, and the other diseases which may induce a hepatopathy directly and 
indirectly, or a therapy, a hepatopathy is induced - it is - it is - the various kinds in which are made to 
carry out and it deals - surgical or the living body which needs physical treatment - various 



http://www4.ipdl.ncipi.go.jp/cgi-bin/tran_web_cgi_ejje 



2/8/2005 



Page 5 of 13 



hepatopathies [, such as an infectious agent, an autoimmune disease and a neoplasm, ] based on a 
biological cause, such as a living body with the hepatopathy induction by chemicals, such as alcohol and 
poison, or its fear, a virus, and bacteria, were occurred - it is - it is - a living body with the fear can be 
mentioned. As a concrete gestalt of such liver disease that can apply this invention, the ischemic 
hepatopathy accompanying the hepatopathy by viral hepatitis, bacteria and parasitic infectious hepatitis, 
the hepatopathy by the autoimmune disease, alcoholic liver injury, the drug, and poison, hepatic 
carcinoma or a liver transplantation, a surgical operation, myocardial infarction, etc. is mentioned. 
However, of course, it is not limited to the symptoms described here, and is not restrained by the 
existence of a comphcation, and the concurrence situation, either. 

[0026] Although the medication method of the compound of this invention according to the symptoms 
here must be chosen if in charge of applying this invention to these symptoms, that does not limit the 
range of this invention. One [ suitable ] out of the general injection as a medication method, i.e., an 
intravenous injection, subcutaneous injection, an intramuscular injection, drop-by-drop-titration 
intravenous injection, partial impregnation, etc. is chosen, and it is *♦**. The permucosal prescribing 
[ for the patient ]-a medicine method or dermal administration methods, such as taking orally, 
transderma, ****, and ****, are also suitably enforced by the case. 

[0027] As an effective dose, it is chosen out of per [ 0.0001 ] weight per day of 1kg in the range of 
300microg. It is suitably chosen in the range of 0.001-1 Omicrog per weight of 1kg. Of course, there is no 
above-mentioned dose what changes also with symptoms and is limited to these values. 
[0028] Although usually chosen in 1 time of the range as a count of administration on several [ 1 thru/or 
2 times, or / 2 thru/or ] for one day, it is not limited to this. When a living body is already in a 
hepatopathy condition as a stage prescribed for the patient so that clearly also from the resuh of this 
invention, or when there is the fear, although it is possible, it is not uniquely limited especially through 
the condition of the both, respectively, that is, a liver should call the organ of silence - as for the 
meaning of therapy-application being used preclusively from the first, IL-6 and/or lL-1 1 are very larger 
than the data that the actual condition which cannot carry out **** detection -easily, and the example of 
this invention showed the claustrum damage condition clearly so that it may be carried out. 
[0029] 

[Example] Although an example explains this invention more concretely more below at a detail, of 
course, this invention is not restricted by this. 

[0030] In addition, the activity appraisal method of IL-6 was performed by the following approaches. 
The appraisal method of bioactive: Stock cell 7TD1 (IL-6 of a suitable amount are added to it using an 
IL-6 dependence hybridoma cell (J.vanSnick et al., European J.lmmunol., 18, 193-197 (1988))) The cell 
proliferation of 7TD1 was measured by the MTT method, and the comparison with the grovy^h activity 
about the phase dilution sample of standard IL-6 performed bioactive assessment of IL-6 separately. The 
same thing as being attached to the Toray Industries, Inc. Homo sapiens IL-6ELISA kit shown below as 
standard IL-6 was used. 

[0031] The activitv appraisal method of IL-1 1 was performed inlaid reference (Paul.S.R.et al., 
Proc.Natl.Acad.Sci.USA, 87, 75 1 2-75 1 6, 1 990) using Tl 1 65 cell according to the approach of a 
publication. 

[0032] ELISA (enzyme immunity appraisal method) - law: - anti-IL-6 antibody (N. Ida et al., 
Biochem.Biophys.Res.Commun., 1 65,728-734, (1 989)) It measured by the used ELISA method. IL-6 
were evaluated using the Toray Industries, Inc. manufacture, the Torre FUJIBAIONIKUSU sale, and the 
Homo sapiens IL-6ELISA kit. 

[0033] Preparation of example 1 Escherichia-coli origin IL-6: The IL-6 expression vector which makes a 
frame IL-6cDNA with the same gene sequence as known reference (324 T.Hirano et al.. Nature, vol. 73 
( 1 986)) was created by the following approach. 

[0034] thyroid cancer origin cell strain NIM-1 cell (a copy - the PGR reaction was performed 
[ mixture / which was compounded with reverse transcriptase / cDN A ] by making two following DNA 
oligomer CCGATCGATGCCAGTACCCCCAGGA(s) and GCCACGGATCCTACATTTGCCGAAG 
into a primer from mRNA which cultivated **** et ah, the Japanese Society of Hematology journal, 53 



http://www4.ipdl.ncipi.go.jp/cgi-bin/tran_web_cgi_ejje 



2/8/2005 



Page 6 of 13 



volumes, and 805 (1 990), and was prepared by the usual approach.) It is the Escherichia coli expression 
vector pKM6 (Tanaka et al., J.lnterferon Res., 6,429-35 (1986)) about the DNA fragment obtained after 
digesting the obtained magnification DNA with restriction enzymes Clal and BamHI. It inserted 
between the Clal part and the Bglll part, and manifestation lL-6 vector pKMIL-6 were obtained. These 
pKMIL-6 were introduced into Escherichia coli HE one 101, and recombinant was obtained. This 
recombinant was cultivated as follows and Escherichia coli recombinant IL-6 were prepared. 
[0035] Escherichia coli HBlOl/pKMIL-6 holding a Homo sapiens interleukin-6 manifestation plasmid 
were cultivated using 30L ** jar. The culture medium for grovvlh of 30L (phosphoric-acid 1 potassium 
0.3% and phosphoric-acid disodium 0.6%, 0.5% [ of sodium chlorides ], 0.1% [ of ammonium 
chlorides ], and glucose 0.5%, 0.5% of casamino acids, magnesium sulfate ImM, ferrous-sulfate 
3microM, vitamin Bl 6microg [ // ml ] and ampicillin 50microg/m]) was taught to 30L ** jar, and 
inoculation of the above-mentioned recombinant was carried out. The jar was operated on number of 
stirring 300rpm, quantity-of-airflow 1 VVM, and 25-degree C conditions. The Indore acrylic acid which 
is the inductor of a tryptophan operon was added, and it cultivated for 60 hours, adding a glucose and 
casamino acids. Culture biomasses were collected by centrifugal separation actuation for [ 10,000xg ] 20 
minutes. About 895g of biomasses was obtained. It is OD550nm to 50mM tris hydrochloric-acid buffer 
pH 8,0 which contains ImMEDTA and lOOmMNaCl for the collected biomasses. It suspended so that it 
might be set to 20. The biomass was crushed by MANTON gaulin, centrifugal separation was 
performed, and crushing extracts were collected. The amount of proteins in an extract was 235g, and 
interieukin -6 was 495mg. The amount of IL-6 was measured by the aforementioned ELISA method 
here (it is below the same). 

[0036] The extract was made to stick to silica column 5.5L, and it was eluted with the acidic solution. 
IL-6 [ 462mg ] were collected. The anmionium sulfate was added final concentration 1.33M to the 
eluate, and centrifugal removed the insoluble impurity. Next, it was made to stick to butyl column (butyl 
TOYOPARU TOSOH CORP. make) 200ml, and was eluted with the low-sah neutral solution. lL-6 
[ 237mg ] of 84% of purity were obtained with SDS-PAGE purity assay. IL-6 eluted were made to stick 
to heparin column (AF heparin TOYOPARU TOSOH CORP. make) 80ml as it is. It was eluted in the 
neutral salt buffer. IL-6 [ 1 14mg ] of 91% of purity were obtained. The eluate was further refined again 
by butyl column (butyl TOYOPARU TOSOH CORP. make) 200m], and IL-6 [ 66mg ] were obtained. 
The purity of IL-6 prepared above was 95% or more by the opposite phase HPLC method. It checked 
that the above-mentioned IL-6 were IL-6 which had activity by the above-mentioned appraisal method. 
[0037] Preparation of example 2 human-cell origin IL-6: lL-6 of this invention were adjusted by the 
following approach as an example. In the MEM culture medium which contains 5% of NCS of IL in the 
glass cultivation tank of 2L, bead culture of the Homo sapiens fibroblast was carried out so that the 
number of cells might be set to 1 06/ml (bead: "site DEKKUSU 1 (Pharmacia Corp.), 37 degrees C). 
Then, the culture medium was exchanged for non-blood serum MEM culture-medium IL containing a 
small amount of carboxymethyl cellulose, and the Homo sapiens natural mold interferon beta of 100,000 
units / L was added as a priming, the next day - fiirther - Pori I: - poly C - cycloheximide 10 mg/L 
addition was carried out 50 mg/L. 4 mg/L charge of the actinomycin-D was carried out the 4 hours after, 
it permuted by the MEM culture medium which contains methyl cellulose little as a production culture 
medium 1 more hour after, and super induction processing was performed. Culture was continued as it 
was for two days after that (37 degrees C). 

[0038] After stopping churning and making a micro carrier sediment, the v^ashings in supernatant liquid 
and a production culture medium was filtered, and IL was moved to another container with churning 
equipment. "Blue Sepharose CL-6BFF" (Pharmacia Corp.) which sterilized in this production liquid is 
supplied, and batch adsorption was carried out, agitating for 1 5 degrees C and four days. After the 
churning halt, blue support was made to sediment and supernatant liquid was moved to another 
container. After carrying out autoclave sterilization (121 degrees C, 30 minutes) of the silica support in 
the sodium phosphate buffer solution, every 4ml two columns were filled up with it, and it was 
connected to the serial. To this, the bypassing supernatant liquid of blue support was passed by rate-of- 
flow 20 ml/hr. After carrying out a whole-quantity style, two columns w^re refined independently. After 



http://www4.ipdl.ncipi.go.jp/cgi-bin/tran_web_cgi_ejje 



2/8/2005 



Page 7 of 13 



pouring 25ml of sodium phosphate buffer solutions, respectively, 20mM hydrochloric acid was poured 
and 10ml of interieukin-6 content fractions was collected. It added so that an ammonium sulfate might 
be further set to 1 .33M in this hydrochloric-acid recovery liquid, and 4 degrees C was agitated gently 
one evening, precipitate - 3000rpm and 30-minute centrifugal separation <4 degrees C) - it removed. 
[0039] It was made to pass and stick to the column filled up with butyl TOYOPA-RU 650M"]ml 
(TOSOH CORP.) which is the support for hydrophobic chromatographies about the separated 
supernatant liquid. After 20mM hydrochloric acid which contains the ammonium sulfate of 1 .33M for 
this column, and 50mM sodium phosphate buffer solution containing the ammonium sulfate of 1 .33M 
washed, 50mM sodium phosphate buffer solution recovered. Then, gradient elution was carried out 
using the high performance chromatography (Shimazu LC-4A) equipped with the ODS column (CI 8) 
(YMC-Pack ODS A-31 2 S-5 1 20A and YMC) which is the chromatography of an opposite phase system 
by the water which contains triphloroacetic acid 0.1%, and the acetonitrile which contains 
triphloroacetic acid 0.1%, and Homo sapiens natural mold interieukin -6 peak was isolated 
preparatively. In this way, interieukin -6 solution which uses 5mM formic acid as a solvent, carries out 
the gel filtration of the obtained Homo sapiens natural mold interieukin -6 by "sephadex G- 
25" (Pharmacia Corp.), and does not contain an acetonitrile was obtained. 

[0040] The purity of IL-6 prepared above was 95% or more by the opposite phase HPLC method. It 
checked that the above-mentioned IL-6 were IL-6 which had activity by the appraisal method shown 
above. 

[0041] After medicating C57BL/6 mouse of six example 3 groups with cisplatin (it omits Following 
CDDP) 9.7mg/kg once intraperitoneal, 280microg/kg/day was administered hypodermically every day at 
1 time per of a rate day for IL-6 from the next day. The said capacity administration of the physiological 
saline was carried out instead of IL-6 at the control group. It set up as one groups [ six ], the mouse of 
each group was slaughtered with time, and plasma was extracted. The result of having measured Plasma 
GOT was shown in a table 1 . 
[0042] 
[A table 1] 



http://www4.ipdl.ncipi.go.jp/cgi-bin/tran_web_cgi_ejje 2/8/2005 



Page 8 of 13 



40 



OD 

m 

+6 

I 



DD 

m 
o 
5S 
Si 



±5 

Q 
O 



>4- 







A 








o 






Csl 










+1 




OD 


+1 




-hi 


CD 


CM 




CM 




CO 


CM 


CO 




oo 










o 








o 


cn 




CO 




CO 


m 


41 


+1 


+1 


CD 


o 




CO 




CO 






C^ 


U3 




to 








o 




CM 














OD 


+1 




+1 


CD 


CM 


oc> 






CM 


CD 






CO 


CO 










CD 














+1 


+1 












o 


<^ 


CD 




UO 


m 








>♦♦- 
















tSi 








4? 


w- 




>*■ 




|{^) 








CO 








t 

-J 






+ 






+ 
a 


D. 






Q 


Q 






Q 


Q 




4H 


O 


O 



[0043] Lifting of the liver GOT value by CDDP administration is the 4th day, was already accepted, and 
continued till the 1 5th. On the other hand, by the group w^hich used lL-6 administration of CDDP 
administration together, the preventive effect which a GOT value is low maintained also in which assay 
date, and the equivalent is mostly indicated to be the mouse group which only continued medicating 
cisplatin the mouse non-prescribing a medicine for the patient with a physiological saline, and shows 
cisplatin induction hepatotoxicity relief and liver protection was accept-ed clearly. Each value in a table 
shows the average ** standard error of n= 6, and significant difference assay is Student's. It carried out 



http://www4.ipdl.ncipi.-go.jp/cgi-bin/tran_webjCgi_ejje 



2/8/2005 



Page 9 of 13 



by the T-test method. * The mark expresses p< 0.005 and ** mark expresses p< 0.01 . (It is the same 
hereafter) 

[0044] As example 4 example 3 showed, the CDDP induction hepatopathy is already discovered on the 
4th day of CDDP administration. The results of a table 2 examined whether there would be any 
operation which reduces the GOT value which once rose to IL-6. That is, IL-6 administration initiation 
was performed by hypodermic administration (280microg/kg/day) every day from the 7th after CDDP 
administration. The plasma GOT value on the 1 5th (this eight-day eye) showed distinct lowering to the 
control group on the 9th (after lL-6 administration the 2nd day) after experiment initiation, and it was 
checked that there is an operation which lowers the GOT value which once rose to lL-6, i.e., a curative 
effect. 
[0045] 
[A table 2] 



to 
I J 



■ia 
jjg 

-R 
QD 
HI 
l> 
H 

VO 

I 

•-3 



« 

cvj 



m 
m 
o 

4a 



p 



tnh 



\ 

m 

h 
O 
O 

m 



m 
m 

m 



no 
m 



40 

IS 



(N3 



csi 
+1 

en 
00 



CO 

CO 

+1 
ifi 

CO 



to 

LO 

+i 

o 
cji 



ay 
+1 
o 

■nil 
DjTI 

+ 

Q 
Q 
O 



00 

+1 

CO 

to 



+1 

LO 



CD 
J 



+ 

CL 
Q 
Q 
O 



http://www4.ipdl .ncipi.go.jp/cgi-bin/'tranwebcgiejye 2/8/2005 



Page lOofn 



[0046] Although example 5G0T (glutamic oxaloacetic trans aminase) is a useful blood biochemical 
marker which detects a hepatopathy, it is known that the value will rise also in the new disease except 
liver disease etc. Then, it measured by making a GPT (glutamicpyruvic transaminase) value with more 
high liver singularity into an index. 

[0047] It is GDDP9.7mg/kg after single-dose administration and from the next day to intraperitoneal in 
e57BL/6 mouse (six groups) lL-6 280microg/kg/day was administered hypodennically every day and 
the plasma OPT value was measured with time. Four days after CDDP administration, lifting of a GPT 
value was observed by the result as shown in a table 3. By the group which continued at CDDP 
administration and prescribed lL-6 for the patient on the other hand, although there was no difference, 
lowering of a clear GPT value was accepted in the 15th day on the 9th in the 4th day. 
[0048] 
[A table 3] 



http://www4jpdl.ncipi.go.jp/cgi-bin/tran_web_cgi_ejje 



2/8/2005 



Page 11 of 13 



•f 

CD 

I 

_J 

K3 

W 

m 

r< 
A 

a 

PA 

m 



-3D 
•R 

QD 

m 

tH 

VO 

I 

J 



OD 

m 
o 



H 
CU 
Q 
P 
U 



3M- 



CD 




in 


CO 


CVJ 




+1 


+1 


+1 








oi 






CM 


CSJ 





mi I 







in 


CM 










QD 


+1 


+1 


+1 


□3 




o 




o> 


o 
c\i 




lO 




in 


o 


CO 




c\i 


CM 


CD 


QD 


+1 


+1 


+1 


CD 


o 


CSJ 


oq 




00 


O) 
CM 


CO 












+1 


41 


+1 




CO 


00 


GO 






ai 
if*- 


oi 



mil 
Bin 

+ 
Q. 

a 
a 
o 



CO 

I 



+ 

Q 
Q 
O 



[0049] IL-6 administration (280microg/kg/day, hypodeimically, every day) was started on the 7th after 
example 6CDDP administration (9.7 mg/kg, intraperitoneal, single time), and the existence of a curative 
effect was investigated. The mouse was considered as a six group configuration by C57BL/6. As shown 
in a table 4, the clear GPT value reduction operation was seen by measurement on the 1 5th (this eight- 
day eye) on the 9th (after IL-6 administration the 2nd day), and the curative effect was accepted by the 
result. 
[0050] 



http://www4.ipdl.ncipi.gO;jp/cgi-bin/tran_web_cgi_ejje 



2/8/2005 



Page 12 of 13 



[A table 4] 



4Q 



■R 
OD 

HI 
l> 
H 

VD 



OD 

m 
o 

40 



Q 



40 

■fSlk 



\ 

h 













CM 






CO 


OD 


+ 1 


41 


IS 




CO 


IT) 




(6 






rr- 



m 

OS 



AO 



IBP 



* 

CD 

+1 
O 



+1 

CO 



0 



mtl 

Uill 

+ 

CL 
Q 
Q 
O 



CO 
CD 

41 

00 



to 

CO ^ 



41 
00 



CO 

I 



+ 

a. 

Q 
Q 
O 



[0051] C57BL/6 mouse of six example 7 groups was medicated with mitomycin-C (it omits Following 
MMC) 2 mg/kg single time intraperitoneal, lL-6 of 1 280microg/kg/day were administered 
hypodermically once per day ever>' day from the next day, and the GPJ value of the plasma which 
collected blood on the 7th was measured. The GPT value before experiment initiation was 24.8**1 .4 
units/a liter, and the GPT value on the 7th of the group which administered only the physiological valine 
hypodermically by MMC un-prescribing a medicine for the patient was completely equivalent to 
23.0**1.5 units/the liter. On the other hand, the GPT value on the 7th of the group which used together 
MMC administration and physiological saline administration showed 35.3**3.5 units/the liter and the 
clear high price, and the hepatopathy operation of MMC appeared. However, the GPT value 
normalization operation with the as clear GPT value on the 7th of the group which used MMC 



http://www4.ipdl.ncipi.go.jp/'Ggi-bin/tran_web_cgi_ejje 2/8/2005 



Page 13 of 13 



administration and IL-6 administration together as 21 .8**3,0 uriits/a liter was observed. 
[0052] Preparation of example 8IL-1 1 : mRNA prepared from Homo sapiens thyroid cancer origin cell 
strain NlM-1 (copy **** et al., the Japanese Society of Hematology, 53 (5), 805 (1990)) From Imicrog, 
the 2 chain cDNA was compounded for the cDNA composition kit using (BERINGA). Technique 
followed the approach of cDNA composition kit assignment. 

[0053] Next, in order to acquire IL-1 IcDNA, the two DNA oligomers as follows were compounded. 
IL-1 IN CCGAATTGGGACATGAACTGTGTT 1 C CCGAATTCGTCACAGCCGAGTCTT 
[0054] PGR - DNA thermal FUIKURA PJIOOO (PerkinElmer SHITASU) - using - thermal 
denaturation 94-degree-C for [ 1 minute ] and annealing 50degree C - the conditions for 2 minutes and 
for [ chain expanding reaction 72 degrees-C ] 3 minutes - 40 cycle The sample suppressed the- 

five effect of the variation in an experiment (reading error in PGR) using what was prepared as follows. 
H2 O 78.5micro liter Tenx reaction buffer 10 mu liter lOmM dNTP Mixture 2 mu liter Primer IL-1 IN 
(50 muM) 2 mu liter Primer IL-1 1 C (50 muM) 2 mu liter cDNA 5 mu liter AmplitagTM (TAKARA 
SHUZO) 0.5micro liter (whole-quantity 100 mu liter) 

(Tenx reaction buffer: lOOmM tris and a hydrochloride (pH8.3), 500mM kCl 15mM MgC12, 0.1% 
gelatin) 

[0055] It chloroform[ a phenol/]-processed (2 times), and chloroform processing was carried out and 
ethanol precipitate recovered amplified DNA. DNA is a restriction enzyme EcoRJ. It cut, and low 
melting temperature agarose electrophoresis separated 1%, and the fragmentation of about 0.6 kbs was 
refined. This DNA fragment is EcoRl about vector pSRalpha (Y.Takebe et al., Mol.Cell.Biol., 8, 466- 
472 (1988)). It is [ having ligation-carried out dephosphorization by BAP (Bacterial Alkaline 
Phosphatase) processing after cutting (a ligation kit activity, TAKARA SHUZO) and ] Escherichia coli 
HB one 101 . Transformation was carried out to the competent eel (TAKARA SHUZO). 
[0056] DNA of five obtained clones was acquired, array analysis for a connection was performed, and 
lL-1 1 manifestation plasmid pSRIL-1 1 made into the object were obtained. After introducing this 
DNAipSRIL -1 1 into CQS-1 cell by the DEAE-dextran method and cultivating for two days by the 
culture medium containing 5% of PCS blood serums, the cell was washed by the serum free medium, 
the serum free medium was added, and it cultivated for 24 hours. What filtered this culture supernatant 
with the 0.22-micrometer filter was used for the pharmacology experiment. 
[0057] C57BL/6 mouse of six example 9 groups was medicated once with CDDP907mg/kg 
intraperitoneal (the 0th day), and the capacity of 1 1 OOmicroper one per time per day 1 was administered 
hypodermically every day from the next day (the 1st day) for IL-1 1 (solution obtained in the example 8) 
(A group). The control group after CDDP administration was medicated with lOOmicro of IL-solutions 1 
which carried out transfection only of the vector to the COS cell, and obtained it instead of 1 1 (B group). 
Furthermore, the group which did lOOmicrol administration of a reference solution every day was 
prepared in the group which does not prescribe CDDP for the patient separately (C group). About each 
group, it learned from the example 3, and slaughtered and collected blood on the 9th, and Plasma GOT 
and GPT was measured. 

[0058] Consequently, for the GOT value of 19.5**2.1 and B group, 78.1 **9.5 and a GPT value were 
[ the GOT value of A group / 57.0**7.2 and a GPT value / 54.4**6.9 and the GPT value of the GOT 
value of 26.3**2.8 and C group ] 20.1 **2.7. 
[0059] 

[Effect of the Invention] Since the operation which reduces the GOT value and GPT value which rose 
by various kinds of hepatopathies is excellent, IL-6 or IL-1 1 are usefiil as a liver function protective 
agent, and prevention and the remedy of liver disease. 



[Translation done.] 



http://v^ww4.ipdl.ncipi.go.jp/cgi-bin/tran_web_cgi_ejje 2/8/2005 



This Page is Inserted by IFW Indexing and Scanning 
Operations and is not part of the Official Record 

BEST AVAILABLE IMAGES 

Defective images within tliis document are accurate representations of the original 
documents submitted by the applicant. 

Defects in the images include but are not limited to the items checked: 

□ BLACK BORDERS 

□ IMAGE CUT OFF AT TOP, BOTTOM OR SIDES 
FADED TEXT OR DRAWING 

BLURRED OR ILLEGIBLE TEXT OR DRAWING 

□ SKEWED/SLANTED IMAGES 

□ COLOR OR BLACK AND WHITE PHOTOGRAPHS 

□ GRAY SCALE DOCUMENTS 

□ LINES OR MARKS ON ORIGINAL DOCUMENT 

□ REFERENCE(S) OR EXHIBIT(S) SUBMITTED ARE POOR QUALITY 

□ OTHER: . 

IMAGES ARE BEST AVAILABLE COPY. 
As rescanning these documents will not correct the image 
problems checked, please do not report these problems to 
the IFW Image Problem Mailbox.