Skip to main content

Full text of "USPTO Patents Application 09804625"

See other formats


WORLD INTELLECTUAL PROPERTY ORGANIZATION 
Internationa] Bureau 




PCX 

INTERNATIONAL APPUCATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) 



(51) International Patent Classification ^ : 
C07K 14/52, A61K 38/19 



Al 



(11) International PublicaUon Number: WO 98/34951 

(43) International Publication Date: 13 August 1998 (13.08.98) 



(21) International Application Number: PCT/AU98/0(X)78 

(22) International Filing Date: 1 1 February 1998 (11.02.98) 



(30) Priority Data: 
PO 5067 
PO 6420 
PO 8963 
PP 0961 



1 1 February 1 997 ( 1 1 .02.97) AU 

24 April 1997 (24.04.97) AU 

3 September 1997 (03.09.97) AU 

1 6 December 1 997 ( 1 6. 1 2.97) AU 



(71) Applicant (for all designated States except US): AMRAD 

OPERATIONS PTY. LTD. [AU/AU]; 576 Swan Street, 
Richmond. VIC 3121 (AU). 

(72) Inventors; and 

(75) Inventors/Applicants (for US only): HILTON. Douglas, J. 
[AU/AU]; 244 Research Road, Warrandytc, VIC 31 13 (AU). 
STANLEY, Edouard, G. [AU/AU]; 5/150 Barkly Street, 
North Fitzroy, VIC 3068 (AU). HARVEY, Richard, P. 
[AU/AU]; 5 George St^ee^ Brunswick. VIC 3050 (AU). 
BIBEN, Christine [AU/FRJ; 6/43 Bank Street. Ascot Vale, 
VIC 3032 (AU). FABRI. Louis [AU/AU]; 8 Lavcr Court. 
Mill Park, VIC 3082 (AU). LAH, Maria [AU/AU]; 6 Kyora 
Parade. North Balwyn, VIC 3104 (AU). NASH, Andrew, D. 
[AU/AU]; 24 Green Street, Northcote, VIC 3070 (AU). 



(74) Agents: HUGHES, E., John, L. et al.; Davies Collison Cave, 1 
Little Collins Street. Melbourne. VIC 3000 (AU). 



(81) Designated States: AL, AM, AT. AU, AZ. BA, BB, BG, BR, 
BY, CA. CH, CN. CU, CZ, DE, DK, EE. ES, FI, GB, GE, 
GH, GM, GW. HU, ID, IL, IS, JP, KE, KG, KP, KR, KZ, 
LC. LK, LR, LS, LT, LU, LV, MD, MG. MK, MN, MW, 
MX, NO. NZ. PL, PT, RO, RU, SD, SE. SG, SI, SK, SL, 
TJ, TM, TR, TT. UA, UG, US. UZ, VN, YU, ZW, ARIPO 
patent (GH. GM, KE, LS. MW, SD. SZ. UG, ZW), Eurasian 
patent (AM, AZ, BY. KG, KZ, MD, RU, TJ, TM). European 
patent (AT. BE, CH. DE. DK. ES, H. FR, GB, GR. IE, IT, 
LU. MC, NL, PT, SE). OAPI patent (BF, BJ, CF. CG. CI, 
CM, GA, GN. ML. MR. NE. SN, TD. TG). 



Published 

With international search report. 

Before the expiration of the time limit for amending the 
claims and to be republished in the event of the receipt of 
amendments. 



(54) Title: A NEW CYTOKINE FAMILY AND USES THEREOF 



AA120122 

tnCoM 

Certierus 

mCer-1 
Ceiberus 

AA120122 

mCer-1 

Cerberus 





V 


V 


K 


M 


V 


i.i El 


V : 


: ti c 


\/ 


V 


K 


V 


V 


ESlM 


V [ 


: I: C 



E R G E E 
S N F H Q 















162 




rj c 


ns 


P 


T 


P 


226 


L 


N c 


Do 


S 


K 


N 


^34 














162 


R 


L L 


L A 


G 


S 


Q 


256 


T 












256 



AA120122 - • 
mC0T*1 G S 

Certerus A 0 



I PGLPASKT 
NMD TSTTL 



N P 
H H 



162 
273 
271 



(57) Abstract 

The present invention relates generally to a new family of cytokine molecules. More particularly, the present invention provides 
mammalian cytokines which constitute a novel family of cytokines and which arc useful in a range of therapeutic and diagnostic applications. 



FOR THE PURPOSES OF INFORMATION ONLY 



codes used to identify Su.«s party .o the PCT on the front pages of pamphlets publishing international applications under the PCT. 



AL 


Albania 


AM 


Annenta 


AT 


Austria 


AU 


Australia 


AZ 


Azerbaijan 


BA 


Bosnia and Hcncgovina 


BB 


Baibados 


BE 


Belgium 


BF 


Buiitna Faso 


BG 


Bulgaria 


BJ 


Benin 


BR 


Brazil 


BY 


Belarus 


CA 


Canada 


CF 


Centra! African Republic 


CG 


Congo 


CH 


Switzerland 


a 


COte d'lvoire 


CM 


Cameroon 


CN 


China 


CU 


Cuba 


CZ 


Cicch Republic 


DE 


Germany 


DK 


Denmark 


EE 


Estonia 



£5 

FI 

PR 

GA 

GB 

GE 

GH 

GN 

GR 

HU 

IE 

IL 

IS 

IT 

JP 

KE 

KG 

KP 

KR 

KZ 

LC 

U 

LK 

LR 



Spain 
Finland 
France 
Gabon 

United Kingdom 

Georgia 

Ghana 

Guinea 

Greece 

Hungary 

Ireland 

Israel 

Iceland 

Italy 

Japan 

Kenya 

Kyrgyzstan 

Democratic People's 

Republic of Korea 

Republic of Korea 

Kazakstan 

Saint Lucia 

Liechtenstein 

Sri Lanka 

Liberia 



LS 

LT 

LU 

LV 

MC 

MD 

MG 

MK 

ML 
MN 
MR 
MW 
MX 
NE 
NL 
NO 
NZ 
PL 
PT 
RO 
RU 
SD 
SE 
SG 



Lithuania 
Luxembourg 
Laivia 
Monaco 

Republic of Moldova 

Madagascar 

The fonncr Yugoslav 

Republic of Macedonia 

Mali 

Mongolia 

Mauritania 

Malawi 

Mexico 

Niger 

Netherlands 

Norway 

New Zealand 

Poland 

Portugal 

Romania 

Russian Federation 

Sudan 

Sweden 

Singapore 



SI 


Slovenia 


SK 


Slovakia 


SN 


Senegal 


SZ 


Swaziland 


TD 


Chad 


TG 


Togo 


TJ 


Tajikistan 


TM 


Turkmenistan 


TR 


Turkey 


TT 


Trinidad and Tobago 


UA 


Ukraine 


UG 


Uganda 


US 


United States of America 


UZ 


Uzbekistan 


VN 


Viet Nam 


vu 


Yugoslavia 


ZW 


Zimbabwe 



wo 98/34951 



PCT/AU98/00078 



A NEW CYTOKINE FAMILY AND USES THEREOF 



FIELD OF THE INVENTION 

5 The present invention relates generally to a new famUy of cytokine molecules. More 
particularly, the present invention provides mammalian cytokines which constitute a novel 
family of cytokines and which are useful in a range of therapeutic and diagnostic applications. 

Bibliographic details of tiie publications numerically referred to in this specification are 
10 collected at the end of the description. Sequence Identity Numbers (SEQ ID NOs.) for the 
nucleotide and amino acid sequences referred to in the specification are defined following the 
bibliography. 

BACKGROUND OF THE INVENTION 

15 

The increasing sophistication of recombinant DNA technology is greatiy facilitating research 
and development in the medical and allied health fields. This is particularly the case in the area 
of cytokine research. 

20 Cytokines represent an important class of proteinaceous molecules involved in regulation of a 
vast array of functions in animals including survival, growth, differentiation and effector 
function of tissue cells. Cytokines generally fall into particular classes encompassing 
interleukins, colony-stimulating factors, lymphokines, monokines and interferons amongst 
many others. The identification of new families of cytokines is an important step in facUitating 

25 the use of cytokines in therapy and diagnosis. 

In accordance with the present invention, a new family of cytokines has been identified 
comprising mammalian homologues of a protein designated "cerberus" from Xenopus laevis 
embryos (1). The ceiberus molecule is a 270 amino acid protein with a role in inducing head 
30 structures in the Xeno/?M5 embryo (1). 



wo 98/34951 



PCT/AU98/00078 



SUMMARY OF THE INVENTION 

Throughout this specification and the claims which follow, unless the context requires 
5 otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be 
understood to imply the inclusion of a stated integer or group of integers but not the exclusion 
of any other integer or group of integers. 

One aspect of the present invention provides an isolated polypeptide of mammalian origin 
10 comprising a signal sequence and a domain conforming to a cystine knot and optionally a long 
N-terminal domain between said signal sequence and cystine knot domain or a derivative of 
said polypeptide. 

Another aspect of tiie present invention is directed to an isolated polypeptide of mammaUan 
15 origin derivative thereof comprising a signal sequence and a domain conforming to tiie criteria 
for a cystine knot and optionally a long N-terminal domain between said signal sequence and 
said cystine knot domain, said polypeptide comprising the amino acid sequence: 

C{AA)Q{AAlH{AA}C{AA}[x'].QN{AA}C{AA)G{AA)C{AA)S{AA}P 

20 

wherein 

{ AA} is an amino acid sequence comprising from about 0 to about 50 amino acid residues; 
X' is V or I; and 
nisOor 1. 

Yet another aspect of the present invention relates to an isolated polypeptide having the 
following characteristics: 

(i) being glycosylated in its naturally occurring form; 
30 (ii) being secretable in its naturaUy occurring form; 

(iii) comprising a signal sequence and a domain conforming to the criteria for a cystine knot. 



W6 98/34951 



PCT/AU98/00078 



-3- 

said cystine knot domain comprising the sequence: 

CxTxPFxQxIxHExCxxxVxQNNLCFGKCxSxxxPx„,CSHCxP [SEQ m N0:1] 

5 wherein x is any amino acid residue and n, is from about 6 to about 10 or comprises a sequence 
in the cystine knot domain having at least 50% identity to SEQ ID NO: 1 excluding the cystine 
and X residues. 

Preferably, the polypeptide further comprises a long N-terminal domain between said signal 
10 sequence and said cystine knot. 

Still another aspect of the present invention provides an isolated polypeptide having tiie 
following characteristics: 

15 (i) being glycosylated in its naturally occurring form; 

(ii) being secretable in its naturally occurring form; 

(iii) comprising a signal sequence and a domain conforming to the criteria for a cystine knot, 
said cystine knot domain comprising the sequence: 

20 CRTVPFNQTIAHEDCQKVVVQNNLCFGKC [SEQ ID NO:2] 

or a sequence having at least 45% similarity to SEQ ID N0:2. 

Preferably, tiie polypeptide furtiier comprises a long N-terminal domain between said signal 
25 sequence and said cystine knot. 

Yet still another aspect of the present invention is directed to a novel polypeptide or a 
modification to a previously known polypeptide characterised by having a cystine knot domain 
comprising the sequence: 

30 

CXXXXXXXXXXHX,CXXXXXXXXXCXGXCXXX^CXXCXP 



W098049S1 



PCT/AU98/00078 



-4- 



wherein: 

X is any amino acid residue; 
a is from about 2 to about 4; and 
5 ^ is from about 6 to about 100. 

Even yet another aspect of the present invention contemplates an isolated secretable polypepude 
or derivative thereof comprising an amino acid sequence having at least 20% homology to the 
cerberus protein from Xenopus laevis defined in Figure 1 . 

10 

Another aspect of the present invention is directed to an isolated secretable polypeptide 
comprising a sequence of amino acids substantially as set forth in SEQ ID N0:4 or having at 
least 50% similarity thereto and which polypeptide has the identifying characteristics of a CRP 
cytokine. The molecule defined in SEQ ID N0:4 is from a mouse and is referred to herein as 
15 "mCRP-l". 

In a related embodiment, there is provided an isolated secretable polypeptide comprising a 
sequence of amino acids substantially as set forth in SEQ ID N0:5 or having at least 50% 
similarity thereto and which polypeptide has the identifying characteristics of a CRP cytokine. 
20 The molecule defined in SEQ ID N0:5 is from a rat and is referred to herein as ••rCRP-2 '. 

Another aspect of the present invention relates to an isolated, secretable polypeptide comprising 
a sequence of amino acids substantially as set fortii in SEQ ID NO:6 or having at least 50% 
similarity thereto and which polypeptide has tiie identifying characteristics of a CRP cytokine. 
25 The molecule defined in SEQ ID N0:6 is from a mouse and is referred to herein as "mCRP-2". 

Yet anotiier aspect of the present invention is directed to a secretable polypeptide comprising 
a sequence of amino acids substantially as set forth in SEQ ID N0:7 or having at least 50% 
similarity thereto and which polypeptide has the identifying characteristics of a CRP cytokine. 
30 The molecule defined in SEQ ID N0:7 is from a human and is referred to herein as "hCRP-2". 



wo 98/34951 



PCT/AU98/00078 



5- 



Sffll,«a„ote aspect of d«pr.scn.tav«.Uonprovidesasec,e*l. polypeptide compnsmg 
. s«,uen« of a^no acids substantially as sc. fonh in SEQ ID N0-.19 and/or 20 o, hav,ng a. 
teasl 50% sintilaHly thc««. a»i ,»hich polypeptide has .he ide„,ifying characeristics of a CRP 
<^ki.e. •mmolec»ledermedbySEQIDNO:19and/or20isSromahu«.a„andisn=ferrcd 

5 .0 herein as "hCRP-r. 

Even ye. anote aspec. of *e p««n. invention relays .0 a secreuble polypeptide comprising 
a sequence of annuo acids subs.an«y as sc. forth to SEQ ID NO:22 or having a. leas. 50% 
similarity d,e.e«> and which polypeptide has tite identifying charac.eristics of a CRP cynotae. 
10 The molecule defined by SEQ ID NO:22 is hCRP-1 bu. wi*out ti« intron and coTCspondmg 

amino acid translation. 

Another aspect of the present invention is directed ,0 a nucleic acid molecule comprising a 
seouence of nucleotides or a complementary sequence of nucleotides which encodes an am.no 
,5acidse,»encese,ectedftomSEQIDNO:4,SEQIDNO:5,SEQroNO:6,SEQIDN0.7SEQ 

ID N0:19. SEQ ID N0:20 and SEQ ID NO:22 or a sequence having a. least 50% sinnlanty 

thereto. 

Yet another aspea of ti« present invention provides a nucleic acid molecule comprismg a 
20 nucleotide sequence substantially as se, ford, in SEQ ID N0:3, SEQ ID N0.8 or SEQ ID 
NO:27 or a sequence having a. leas. 50% similarity ti«,eto or a sequence capab.e of 
hybridiztog to one of the above under low stringency conditions at 42^. 

Still yet anoO^r ^ of ti» present invention contemplates a me«,od for modulating 
25 expressionof a CRP cytokine ta a mammal such as a human, primate or laboratory test ammal, 
said metiKKl comprising contacting a gene encoding said CRP cytokine with an effecuve 
amount of a modulator of CRP cy«.kine expression for a time and under conditions sufHcem 
«> up-regulate or down-regulate or otiierwise modulate expression of ti«= CRPcyrokme. 

30 Even ye, am*er aspect of the p-esent invention is directed to a metiKK. for modulating acUvi^, 
of die CRP cywkine in a mammalian such as a human, said metiiod comprising admrnistermg 



wo 98/34951 



PCT/AU98/00078 



6- 



5 



10 



,0 ^,™n»3.a»odu,a.nge,f«..= amou„,o,a«o,ecu,.foraUm. an. under— 

::I.,„U^o,a«.ea.CRPc,„*i.acU.,,.TH. — n^vbeap— 

lL„.„.ao^e„U^an.™,a>so^adertva«veofaC>^c>.o«naor..U^^^^ 
r^p,„)o,ache™ica,a„.os„e«r— nm».an.ofaCRPcy.o«„cor,«.,gand. 

Suncve„y«ano*.aspec.o,0,cpres.nU„v.„Uo„.,a.es.oapha™«.u.^^^^^^^^^^^ 

I^ln 0, CRP CCne a..ivU, a„a one or .ore p— ca.y aeoep,a«e carr,er. 
and/or diluents. These components are referred to as the acUv. ingredrents. 

even a further aspect of U« present Invention, there is provided a method for detecung CRP 
taablologlcal sample fromasubiect said med,odcompnslngcont,cU„gsa.dh.o.og.ea,sam.e 

:l:tlhodysU-aCRP(orgroupofCRPs,orltsdeHvaUvesorho^^^^^^^ 
atlmeandundercondiUonssufftclentforanandbody^con^'^'ofonn.andthendetecung 

15 said complex. 

another asp^t of the p.se„. InvenUon provides a use of a CRP cytokine or iu ^ncon^ 
aertvativeslnthemanutacntreofamedlcament for the treatment of defecuve or deftcten, CRP 

mediated activities. 

20 

BRDSr DESCRIPTION OF THE FIGURES 

ngur. 1 is a representation of amino acid alignments using Clusta. n^thod with PAM250 

f ccT AAionT?? mCER-1 (mCRP-1) and cerberus 
residue weigh, table, (a) Alignment of EST AA120122. mCER (m 

25 (Figure 1); (b) Alignment of mCER-1 (mCRP-D, cerberus and munne DAN (.nCRP-2), (c 
'^^LlllLUNonieaseaseprotelnandmurlneOANC^^^^^ -S-. 

betLn mCER-1 (mCRP-l) and murtne DAN ,n,CRP-2); ,e) ^'^"'^--^^ 
mouse and rat DAN (hCRP.2, mCRP-2 and ,CRP-2, respecUvely). (f) Altgnment beceen 
cerberus and mCER-1 (mCRP-1)- 

30 

Figure 2 is the nucleotide and amino acid sequence of mCRP-l. 



wo 98/34951 



PCT/AU98/00078 



.7 



3 U U. an. Wes.™ analysis of seated »onse ro«,. 

SuLa™. from COS ceUs ^sfeced wiU, a murine mCRP-2.n^G exp«ss.on vector was 
i:^p.«aove,anan..FLAGa,r.„i.,co,„n.accor.n,.o— n..s.^^^^^ 

ZanKodak«,NewHavenCn.Mono„«ricCHPp™»>nwas..^^^^^ 
5 nidation and subjec .0 N-Wed deglycosylaUon using N-Glyc„s.dase-F (Boehnnge, 
MJIn-,ManJ^Oe„na.y,. ^O.. P--" pHor .» and a.. de^ycosy .0 

was subiec. » SDS-PAOE ge, a^ visuaiised W siiver seining and Wes.e™ MO. us,n, an an,,- 

FLAG antibody. 

,0 Fi6u» 4 is a graphical rep«sen<a,ion showing iransien. DAN expression in cos cells. 



15 



I control transfection 
m\ lipofectamine transfection 

I electroporation 
■ control electroporation 



Figure 5 shows the steps in 
20 chromatography. 



,he purification of mCRP-2 (C-FLAG) using affinity 



r«u«6isapho,o^P«c representaUon showing SDS-PAGE analysis of mCRP.2(C.FLAG). 

r,go« 7 is a graphical represenution showing size exclusion analysis of mCRP-2 KC-FLAG). 
ngu«8isaphotog,aphicrepresenta.io.ofWe«nB,otanalysiso,n,CRP-. postM2amnity 

purification. 

pi™„,isarepresentaUonofSDSPAGE.Wes.en.blo.a,^HPir analysis of purified ^^^^^ 
30 ofn«P-l. (A)SDSPAGEofmCRP.lfol.owing,en.>«.ofca,hohyd,a.e;(B,si^exc,us,o„ 
lysisof nK:RP.l ; (Q tegt^sional analysis of pea. fracUons containing mCRP-l «,n.p3.«. 



wo 98/34951 



PCT/AU98/00078 



-8- 

to standards; (D) N-terminal amino acid sequence analysis of RP-HPLC purified mCRP-1 [SEQ 
ID NO:23]. 

Figure 10 is a representation showing an SDS PAGE. Western blot and HPLC analysis of 
5 mCRP-2. (A) SDS-PAGE-Westem blot with and without carbohydrate molecules; (B) SDS 
PAGE- Silver stain either with or without reduction; (D) and (C) size exclusion analysis 
followed by linear regressional analysis of peak fracUons containing mCRP-2; (E) N-terminal 
amino acid sequencing of mCRP-2 [SEQ ID NO:24]. 

10 Figure 11 is a representation showing the complete genomic sequence of hCRP-1 and 
corresponding amino acid sequences to exons 1 and 2. 

Figure 12 is a representation showing the coding sequence of hCRP-1 without the intron and 
corresponding amino acid translation. 

15 

Figure 13 is a representation showing alignment of the predicted amino acid sequence of 
hCRP-1, mCRP-1 mdXenopus cerberus. The alignment was performed using DNA megalign 
under default conditions. hCRP-1 shares approximately 68% identity with mCRP-1 and 
approximately 25% identity with Xenopus cerberus. 

20 

Figure 14 is a representation showing a comparison of mCRP-1 and cerberus activities in 
Xenopus animal cap assays. A. Formation of cement glands in individualised animal caps 
(stage 35) after mock injection (panel A), or injection of mRNAs encoding mCRP-1 (panel B), 
CFLAG-mCRP-1 (panel C) or cerberus (panel D). A single darkly pigmented cement gland 

25 is induced by injected cerberus mRNAs in some cases (see Figure 3B), but not by mock 
injection. Note in panel B the secretion of sticky exudate. B. Histogram depicting frequency 
of cement gland induction in animal caps after injection of mRNAs encoding cerberus. mCRP- 1 
or CFLAG-mCRP-1, compared to uninjected controls. Data were compiled for each raRNA 
after examination of 100-120 mjected caps. C. RT-PCR analysis of markers induced in animal 

30 caps at stage 28 after injection of mRNAs encoding cerberus (XGer; lane 1), mCRP-1 <mCer; 
lane 2) and BMP4. (lane 5). or after coinjection of 1 : 1 ceri)erus: BMP4 (lane 3), and 1 : 1 mCRP- 



wo 98/34951 



PCT/AU98/00078 



9- 



1 :BMP4 (lane 4), compared to uninjected control caps (lane 7) and whole stage 25 embryos 
(lane 6). iVibc2.3 and Mx2.5 are expressed in cardiac progenitors and anterior pharyngeal 
endoderm T4 globulin is specific to blood, a ventral mesodermal derivative . XeHAND marks 
cardiac and vascular smooth muscle progenitors in lateral mesoderm. NCAM is a pan-neural 
5 marker. Otx2 is a marker of anterior tissues, expressed in midbrain, forebrain, placodes, 
cement gland and anterior mesoderm. Krox20 is expressed in rhombomeres 3 and 5 in the 
hindbrain. CG13 is expressed specific to cement gland. Edd expression is ubiquitous at low 
levels but enriched in endoderm. Equal mRNA was assessed by expression of EF-1 alpha 
(EFla). 

10 

Figure 15 is a photographic representation showing expression of mCRP-1 during gastrulation. 
A-C, H and I show lateral views of embryos where anterior is to the left, posterior to the right; 
the arrowhead represents the embryonic/extra-embryonic junction. A. Three .early primitive 
streak stage embryos showing mCRP-1 expression in a midline stripe on the anterior side (left 

15 embryo), then progressively (middle and right embryos) in migrating mesendodermal wings 
arising in the anterior region of the streak. B. Early streak embryo hybridised with probes for 
both raCRP-1 and brachyury. Nascent mesodermal wings positive for brachyury are seen on 
the posterior side, while the mCRP-1 strip is seen anterioriy. At that stage, most or all of the 
anterior endoderm is of the visceral lineage. C. Late primitive stage embryos hybridised with 

20 an mCRP-1 probe. Expression is confmed to anterior mesendoderm. D. Distal view of the 
same embryo as in C, showing lack of mCRP-1 expression in the region of the node. E. 
Anterior view of the same embryo as in C, showing mCRP-1 expression set back from the 
embryonic/extra-embryonic junction and absent from the cardiac progenitor region (brackets). 
F. Early neurula embryo (anterior view) hybridised with a BMP2A probe. Expression occurs 

25 in the domain of the cardiac progenitors (brackets), but also somewhat into the extra-embryonic 
domain. G. Neurula embryo (anterior view) hybridised with Nkx2-5, specific to the cardiac 
progenitors at that stage (brackets). H. Sagittal section through a late streak embryo 
highlighting expression of mCRP-1 in anterior mesendoderm. The arrowhead indicates the 
position of the node, where expression is absent. I. Enlargement of a section near adjacent to 

30 the one shown in H, depicting mCRP- 1 exjaession in both endoderm and associated mesoderm. 
Note that anterior mesendoderm lacks expression. J. Headfold stage embryo {anterior view) 



wo 98/34951 



PCT/AU98/00078 



-10- 

showing mCRP-1 expression in a wedge of anterior mesendoderm. K. Transverse section 
through the embryo in J showing mCRP-1 expression in anterior mesendoderm underlying the 
neural plate, and excluded firom the more lateral cardiogenic region (brackets). Abbreviations: 
en, endoderm; ep, epiblast; me, mesoderm; np, neural plate. 

5 

Figure 16 is a photographic representation showing expression in anterior axial mesoderm. 
Transverse histological sections of an -E7.75 embryo hybridised in wholemount with an 
mCRP-1 probe at the level of A. prechordal mesoderm; B. notochordal precursos; C. node. 
Expression is seen in prechordal and notochordal plates, but is absent from the note. Arrows 
10 delimit the apparent extent of these structures. The node is clearly recognised by the recessed 
nature of its innermost cells (the "pit"). Notochordal and prechordal plate cells have a 
morphology distinct from surrounding endoderm, consistent with their having a smaller surface 
area ventrally when viewed by scanning electron microscopy. Prechordal plate is wider than 
notochordal precursors, forming a wedge shape. Note mCRP-1 expression is head mesoderm. 

15 

Figure 17 is a photographic representation showing expression of mCRP-1 in paraxial 
mesoderm. A. Early headfold stage embryo showing the mCRP-1 anterior expression domain 
(left; see Figure 15), now faded almost completely, and the first appearance of two strips within 
paraxial mesoderm. B. Ventroanterior view of a late headfold stage embryo showing absence 

20 of mCRP-1 expression in anterior mesendoderm, but stronger expression in paraxial mesoderm. 
C. Dorsal view of the tail region of a E9.5 embryo (anterior to the left) showing mCRP-1 
expression in four stripes in paraxial mesoderm. D. Transverse section through an E8.5 
embryo showing that most or all cells with a paraxial strip express mCRP-1. E. Paraxial 
section through the tail of an E9.5 embryo (anterior to the left) showing all four mCRP- 1 strips 

25 in paraxial mesoderm. The weaker anterior - most strips mark the rostral region of the most 
recently formed somites, while the stronger posterior strips are within the presomitic mesoderm. 
Definitive somite boundaries are indicated by solid arrows. The open arrow indicates the 
poorly condensed boundary between the forming somite and adjacent presomitic mesoderm. 
F. E12.5 embryo showing mCRP-1 expression only within nascent and newly formed somites 

30 within the tail. Abbreviations: nt: neutral tube; s:somites. 



wo 98/34951 



PCTyAU98/00078 



-11- ' 

Figure 18 is a photographic representation showing expression in Otx-T*' embryos. The figures 
shows three Otx-I^ embryos harvested at E6.7 (embryo on the left) and E7.5. In the two most 
affected (and younger) embryos at the left and centre of the panel (see Ang et al 1996), mCER- 
* 1 expression (arrows) is seen on the anterior side, but only distally, while in the less affected 
5 embryo (right), it extends more toward the embryonic/extra-embryonic junction, as in normal 
embryos (see Figure 4). Abbreviations: A, anterior; em, embryonic region; ex, extra-embryonic 
region; P, posterior. 

Figure 19 is a representation showing that mCRP-1 maps to the central region of mouse 

10 chromosome 4 as determined by interspecific backcross analysis. A. Segregation patterns of 
mCRP-1 and linked genes in the 92 backcross animals that were typed for all loci. Each 
column represents the chromosome identified in backcross progeny that was inherited from the 
(C57BL/6JxM. spretus) Fl parent. The shaded boxes represent the presence of the C57BL/6J 
allele and the white boxes represent the presence of the M. spretus allele. The number of 

15 offspring inheriting each type ofchromosome is listed at the bottom of each column. B. Partial 
chromosome 4 linkage map showing the location of mCRP-1 in relation to linked genes. 
Recombination distances between loci in cM are shown to the left of the chromosome and the 
positions of loci in human chromosomes, where known, are shown on the right. References for 
the human map positions of loci cited in this study can be obtained from GDB (Genome Data 

20 Base), a computerised database of human linkage information maintained by the William H. 
Welch Medical Library of The John Hopkins University (Baltimore, MD). C. Southern blot 
analysis of genomic DNAs from wild type {Wt), and those carrying the mutant alleles headblebs 
(heb), meander tail (mea), polysyndactyly (ps) and pintail (pt). These mutants map to 
chromosome 4 in the vicinity of mCRP-1. Restriction endonuclease digestion was with EcoKl 

25 or BamHl, A schematic representation of the mCRP-1 locus is indicated below the panel. The 
map was determined by restriction enzyme and sequence analysis of clones isolated from a 
genomic libraiy of the 129 strain. Restriction enzyme sites relevant to this study are indicated. 
Coding exons of the mCRP-1 gene are boxed. The star indicates the JEcoRI site absent from 
the mCRP-1 allele of pt. 

30 

Figure 20 is a representation showing: A. Western blot analysis of CFLAG-mCRP- 1 protein 



wo 98/34951 



PCT/AU98/00078 



-12- 

purified from CHO cells (see Materials and Methods) before (-) and after (+) treatment with 
N-glycosidaseF(n-gly). B. Western blot analysis of CFLAG-raCRP-1 protein secreted from 
293T cells with (+) and without (-) reduction with lOOmM dithiothreitol (DTT). mCRP-1 
protein was detected with M2 anti-FLAG antibody. The mobility of molecular weight 
5 standards (size shown in kilodaltons) is indicated on the left of each panel. 

Figure 21 is a photograph representation of a Western blot analysis of 293T hCRP-l-I-SPY 
transient expression using I-SPY antibody (Dl 1). 

10 DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT 

One aspect of the present invention provides an isolated polypeptide of mammalian origin 
comprising a signal sequence and a domain conforming to the criteria for a cystine knot and 
optionally a long N-terminal domain between said signal sequence and cystine knot domain or 
15 a derivative of said polypeptide. 

The polypeptide of the present invention is, in its naturally occurring form, secretable and 
glycosylated. The present invention extends, however, to recombinant, synthetic or other 
modified forms which have an altered glycosylation pattern and/or which have an altered 
20 capacity to be secreted from a cell. For example, the signal sequence may be removed or 
otherwise inactivated or a signal sequence from another molecule may be fused to the subject 
polypeptide. The term "signal sequence" is used in its broadest sense and includes a 
hydrophobic leader sequence. The term "cystine knot" is conveniently as described by 
McDonald and Hendrickson (7) and Isaacs (8). 

25 

Reference herein to a "long" N-terminal domain means that the domain is longer relative to 
comparable molecules. For example, for convenience, length may be compared relative to 
Norrie disease protein (NDP) or Differential screening-selected gene Abetrative in 
Neuroblastoma (DANt2]). Preferably, the long N-terminal domain when present in the 
30 polypeptide of the present invention is from about 100 to about 300 amino acids in length and 
more preferably from about 100 to about 200 amino acids in length. 



wo 98/34951 



PCT/AU98/00078 



.13- 

In a particularly preferred embodiment of the present invention, the subject polypeptide 
comprises the long N-terminal domain flanked by the signal sequence and cystine knot domain. 

Another aspect of the present invention provides an isolated polypeptide of manmialian origin 
5 derivative thereof comprising a signal sequence and a domain conforming to the criteria for a 
cystine knot and optionally a long N-terminal domain between said signal sequence and said 
cystine knot domain, said polypeptide comprising the amino acid sequence: 

C(AA)Q{AA)H{AA}C{AA)[x']„QN{AA}C{AA}G{AA}C{AA)S{AA)P 

10 

wherein 

{ AA} is an amino acid sequence comprising from about 0 to about 50 amino acid residues; 

X* is V or I; and 

nisOorl. 

15 

Yet another aspect of the present invention is directed to an isolated polypeptide having the 
following characteristics: 

(i) being glycosylated in its naturally occurring form; 
20 (ii) being secretable in its naturally occurring form; 

(iii) comprising a signal sequence and a domain conforming to the criteria for a cystine knot, 
said cystine knot domain comprising the sequence: 

CxTxPFxQxIxHExCxxxVxQNNLCFGKCxSxxxPxniCSHCxP [SEQ ID NO: 1 ] 

25 

wherein x is any amino acid residue and ni is from about 6 to about 10 or comprises a sequence 
in the cystine knot domain having at least 50% identity to SEQ ID NO: 1 excluding the cystine 
and X residues. 

30 Preferably, the isolated polypeptide comprises an N-terminal domain of from about 100 to 
about 200 amino acids between the signal sequence and the cystine knot domain. 



wo 98/34951 



PCT/AU98/00078 



.14- 

Preferably, the percentage identity of related molecules to SEQ ID N0:1 is at least about 55%, 
more preferably at least about 60%, still more preferably at least about 65%, even mor« 
preferably at least about 70% or greater such as at least about 71-75%, 76-80%, 81-85%, 86- 
90% or 91-100%. 

5 

According to a particularly preferred embodiment of the present invention, there is provided 
an isolated polypeptide having the following characteristics: 

(i) being glycosylated in its naturally occurring form; 
10 (ii) being secretable in its naturally occurring form; 

(iii) comprising a signal sequence and a domain conforming to the criteria for a cystine knot, 
said cystine knot domain comprising the sequence: 

CRTVPFNQTIAHEDCQKWVQNNLCFGKC (SEQ ID N0:2] 

15 

or a sequence having at least 45% similarity to SEQ CD N0:2. 

Preferably, the isolated polypeptide comprises a N-terminal domain of from about 100 to about 
200 amino acids between the signal sequence and the cystine knot. 

20 

Preferably, the percentage identity of related molecules to SEQ ID NO:2 is at least about '55%, 
more preferably at least about 60%, still more preferably at least about ^5%, even more 
preferably at least about 70% or greater such as at least about 71-75%, 76-80%, 81-85%, 86- 
90% or 91-100%. 

25 

The present invention further extends to novel polypeptides or modifications to previously 
known polypeptides characterised by having a cystine knot domain comprising the sequence: 

CXXXXXXXXXXHX3CXXXXXXXXXCXGXCXXX^CXXCXP 

30 

wherein: 



wo 98/34951 



PCT/AU98/00078 



"15- 

X is any amino acid residue; 
a is from about 2 to about 4; and 
„2 is from about 6 to about 100. 

5 Particularly preferred embodiments of these aspects of the present invention comprise a long 
N-terminal domain flanked by a signal sequence and a sequence conforming to the criteria for 
a cystine knot. 

Preferably, according to this aspect of the present invention, the sequences of part of the cystine 
10 knot domain is: 

CXXXXXTQXXXHXXCXXX'XIQNXXCXGXCXSXXVPNX^CXXCXP 
wherein: 

15 

X is any amino acid residue; 

X' is preferably K; and 

„3 is from about 6 to about 13. 

20 Another aspect of the present invention provides an isolated secretable polypeptide or derivative 
thereof comprising an amino acid sequence having at least 20% similarity to the cerberus 
protein from Xenopus laevis defined in Figure 1. 

It is proposed, in accordance with the present invention, that the secretable polypeptide as 
25 hereinbefore defined above constitutes a novel family of cytokines. The jMresent invention 
extends, therefore, to all members as defined to be part of this family and to derivatives thereof. 

For convenience, the novel family of cytokines is hereinafter referred to as the cerb^us related 
protein (CRP) family of cytokines. Individual members are defined by a lower case 4etter 
30 prefix to CRP to indicate the mammalian origin. Where more than one CRP cytokine has been 
identified from a particular species, the abbreviation is followed by a number. For example 



wo 98/34951 



PCT/AU98/00078 



-16- 

"iCRP" refers to a CRP cytokine from a rat, "hCRP" refers to a human CRP and "mCRP- 1 " and 
"mCRP-2" are murine CRPs, 

* In a particular embodiment, the present invention further provides an isolated secretable 
5 polypeptide comprising a sequence of amino acids substantially as set forth in SEQ ID N0:4 
or having at least 50% similarity thereto and which polypeptide has the identifying 
characteristics of a CRP cytokine. The molecule defined in SEQ ID N0:4 is from a mouse and 
is referred to herein as "mCRP-l". 

10 In a related embodiment, the present invention provides an isolated secretable polypeptide 
comprising a sequence of amino acids substantially as set forth in SEQ ID N0:5 or having ai 
least 50% similarity thereto and which polypeptide has the identifying characteristics of a CRP 
cytokine. The molecule defined in SEQ ID NO:5 is from a rat and is referred to herein as 
"rCRP-2". 

15 

A further embodiment of the subject invention provides an isolated, secretable polypeptide 
comprising a sequence of amino acids substantially as set forth in SEQ ID N0:6 or having at 
least 50% similarity thereto and which polypeptide has the identifying characteristics of a CRP 
cytokine. The molecule defined in SEQ ID NO:6 is from a mouse and is referred to herein as 
20 "mCRP-2". 

Still a further embodiment provides a secretable polypeptide comprising a sequence of amino 
acids substantially as set forth in SEQ ID NO:7 or having at least "50% similarity thereto and 
which polypeptide has the identifying characteristics of a CRP cytokine. The molecule defined 
25 in SEQ ID N0:7 is from a human and is referred to herein as "hCRP-2". 

Even yet another embodiment of the present invention is directed to a secretable polypeptide 
comprising a sequence of amino acids substantially as set forth in SEQ ID NO: 19 and/or 20 or 
having at least 50% similarity thereto and which polypeptide has the identifying characteristics 
30 of a CRP cytokine. The molecule defined by SEQ ID NO: 19 and/or 20 is from a human and 
is referred to herein as "hCRP-l". 



wo 98/34951 



PCT/AU98/000'TO 



.17- 

Another embodiment of the present invention provides a secretable polypeptide comprising a 
sequence of amino acids substantially as set forth in SEQ ID NO:22 or having at least 50% 
similarity thereto and which polypeptide has the identifying characteristics of a CRP cytokine. 
The molecule defined by SEQ ID NO:22 is hCRP-1 but without the intron and corresponding 
S amino acid translation. 

Preferably, with respect to the foregoing aspects, the percentage similarity is at least about 60%, 
more preferably at least about 70%, still more preferably at least about 80%, even more 
preferably at least about 90% and yet even more preferably at least about 95% similar to at least 
10 about 5 contiguous amino acids, and more preferably at least about 10 contiguous amino acids 
of SEQ ID NO:4 or 5 or 6 or 7 or 19 and/or 20 or 22. 

The present invention further extends to nucleic acid molecules, preferably in isolated form, 
encoding members of the CRP cytokine family. In one particular embodiment, the nucleic acid 
15 molecule comprises a sequence of nucleotides or a complementary sequence of nucleotides 
which encodes the amino acid sequence set forth in SEQ ID N0:4 or a sequence having at least 
50% similarity thereto. 

In another embodiment, the nucleic acid molecule comprises a sequence of nucleotides or a 
20 complementary sequence of nucleotides which encodes the amino acid sequence set forth in 
SEQ ID NO:5 or a sequence having at least 50% similarity thereto. 

In a further embodiment, the nucleic acid molecule comprises a sequence of nucleotides or a 
complementary sequence of nucleotides which encodes the amino acid sequence set forth in 
25 SEQ ID NO:6 or a sequence having at least 50% similarity thereto. 

In yet a further embodiment, the nucleic acid molecule comprises a sequence of nucleotides or 
a complementary sequence of nucleotides which encodes the amino acid sequence ^et forth in 
SEQ ID N0:7 or a sequence having at least 50% similarity thereto. 

30 

Still yet a further embodiment of the present invention provides a nucleic acid molecule 



wo 98/34951 



PCT/AU98/00078 



-18- 

comprises a sequence of nucleotides or a complementary sequence of nucleotides which 
encodes the amino acid sequence set forth in SEQ ID NO: 19 and/or SEQ ID NO:20 or a 
sequence having at least 50% similarity to either or both thereof, 

5 Another embodiment of the present invention is directed to a nucleic acid molecule comprises 
a sequence of nucleotides or a complementary sequence of nucleotides which encodes the 
amino acid sequence set forth in SEQ ID NO:22 or a sequence having at least 50% similarity 
thereto. 

10 In a particularly preferred embodiment, the nucleotide sequence is as set forth in SEQ ID NO:3 
or a sequence having at least 50% similarity thereto and which is capable of hybridizing under 
low stringency conditions at 42**C to SEQ ID NO:3. The nucleotide sequence set forth in SEQ 
ID N0:3 encodes mCRP-1. 

15 In another particularly preferred embodiment, the nucleotide sequence is as set forth in SEQ 
ID NO; 18 or is a sequence having at least 50% similarity thereto and which is capable of 
hybridizing under low stringency conditions at 42^C to SEQ ID NO: 18. The nucleotide 
sequence set forth in SEQ ID NO: 18 is a genomic sequence encoding hCRP-1. 

20 In yet another particularly preferred embodiment, the nucleotide sequence is as set forth in SEQ 
ID N0:21 or is a sequence having at least 50% similarity thereto and which is capable of 
hybridizing under low stringency conditions at 42°C to SEQ ID N0:21. The nucleotide 
sequence set forth in SEQ ID NO: 18 encodes hCRPl but without the intron. 

25 Reference herein to a low stringency at 42 "C includes and encompasses from at least about 1 % 
v/v to at least about 15% v/v formamide and from at least about IM to at least about 2M salt 
for hybridisation, and at least about IM to at least about 2M salt for washing conditions. 
Alternative stringency conditions may be applied where necessary, such as medium stringency, 
which includes and encompasses from at least about 16% v/v to at least about 30% v/v 

30 formamide and from at least about 0.5M to at least about 0.9M salt for hybridisation, and at 
least about 0.5M to at least about 0.9M salt for washing conditions, or high stringency, which 



wo 98/34951 



PCT/AU98/00078 



-19- 

includes and encompasses from at least about 31% v/v to at least about 50% v/v formamide and 
from at least about 0.0 IM to at least about 0.1 5M salt for hybridisation, and at least about 
0.0 IM to at least about 0.1 5M salt for washing conditions. 

5 Preferably, the percentage nucleotide similarity to SEQ ID N0:3 is at least about 60%, more 
preferably at least about 70%, still more preferably at least about 80%, even more preferably 
at least about 80% and yet even more preferably at least about 95% or above similarity to at 
least about 10 and more preferably at least about 20 contiguous nucleotides in SEQ ID NO:3. 

10 Preferably, the percentage nucleotide similarity to SEQ ID NO: 18 or SEQ ID N0:21 is at least 
about 60%, more preferably at least about 70%. still more preferably at least about 80%, even 
more preferably at least about 80% and yet even more preferably at least about 95% or above 
similarity to at least about 10 and more preferably at least about 20 contiguous nucleotides in 
SEQ ID N0:18 or SEQ ID N0:21. 

15 

The term "similarity" as used herein includes exact identity between compared sequences at the 
nucleotide or amino acid level. Where there is non-identity at the nucleotide level, "similarity" 
includes differences between sequences which result in different amino acids that are 
nevertheless related to each other at the structural, functional, biochemical and/or 
20 conformational levels. Where there is non-identity at the amino acid level, "similarity" includes 
amino acids that are nevertheless related to each other at the structural, functional, biochemical 
and/or conformational levels. The terms "homology" and "identity" as used herein can be 
considered equivalent to the term "similarity". 

25 The CRP cytokines of the present invention are preferably but not exclusively of human, 
primate, laboratory test animal (eg. rabbit, guinea pig, mouse, rat), companion animal (eg. dog, 
cat), livestock animal (eg. sheep, cow, hcH^e, donkey, pig) or captive wild animal (eg. deer, fox, 
kangaroo) origin. 

30 The present invention encompasses a range of derivatives of the CRP cytokines. Derivatives 
include fragments, parts, portions, mutants, homologues and analogues of the CRP polypeptide 



wo 98/34951 



PCT/AU98/00078 



-20- 

and corresponding genetic sequence. Derivatives also include single or multiple amino acid 
substitutions, deletions and/or additions to the CRP cytokine or single or multiple nucleotide 
substitutions, deletions and/or additions to the genetic sequence encoding the CRP cytokine. 
"Additions" to amino acid sequences or nucleotide sequences include fusions with other 
5 peptides, polypeptides or proteins or fusions to nucleotide sequences. Reference herein to the 
"CRP*" cytokine includes reference to all derivatives thereof including functional and non- 
functional derivatives. 

Analogues of the CRP cytokines contemplated herein include, but are not limited to. 
10 modification to side chains, incorporating of unnatural amino acids and/or their derivatives 
during peptide, polypeptide or protein synthesis and the use of crosslinkers and other methods 
which impose conformational constraints on the proteinaceous molecule or their analogues. 

Examples of side chain modifications contemplated by the present invention include 
15 modifications of amino groups such as by reductive alkylation by reaction with an aldehyde 
followed by reduction with NaBH4; amidination with methylacetimidate; acylation with acetic 
anhydride; carbamoylation of amino groups with cyanate; trinitrobenzylation of amino groups 
with 2, 4, 6-trinitroben2ene sulphonic acid (TNBS); acylation of amino groups with succinic 
anhydride and tetrahydrophthalic anhydride; and pyridoxylation of lysine with pyridoxal-5- 
20 phosphate followed by reduction with NaBH4. 

The guanidine group of arginine residues may be modified by the formation of heterocyclic 
condensation products with reagents such as 2,3-butanedione, phenylglyoxal and glyoxal. 

25 The carboxyl group may be modified by carbodiimide activation via O-acylisourea formation 
followed by subsequent derivitisation, for example, to a corresponding amide. 

Sulphydryl groups may be modified by methods such as carboxymethylalion with iodoacetic 
acid or iodoacetamide; performic acid oxidation to cysteic acid; formation of a mixed 
30 disulphides with other thiol compounds; reaction with maleimide, maleic anhydride or other 
substituted maleimide; formation of mercurial derivatives using 4-chloromercuribenzoate, 4- 



wo 98/34951 



PCT/AU98/0(M)78 



- 21 - 

chloromercuriphenylsulphonic acid, phenylmercury chloride, 2-chloromercuri-4-nitrophenol 
and other mercurials; carbamoylation with cyanate at alkaline pH. 

Tryptophan residues may be modified by, for example, oxidation with N-bromosuccinimide or 
5 alkylation of the indole ring with 2-hydroxy-5-nitrobenzyl bromide or sulphenyl halides. 
Tyrosine residues on the other hand, may be altered by nitration with tetranitromethane to form 
a 3-nitrotyrosine derivative. 

Modification of the imidazole ring of a histidine residue may be accomplished by alkylation 
10 with iodoacetic acid derivatives or N-carbethoxylation with diethylpyrocarbonaie. 

Examples of incorporating unnatural amino acids and derivatives during peptide synthesis 
include, but are not limited to, use of norieucine, 4-amino butyric acid, 4-amino-3-hydroxy-5- 
phenylpentanoic acid, 6-aminohexanoic acid, t-butylglycine, norvaline, phenylglycine, 
15 ornithine, sarcosine, 4-amino-3-hydroxy-6-methylheptanoic acid, 2-thienyl alanine and/or D- 
isomers of amino acids. A list of unnatural amino acid, contemplated herein is shown in Table 
1. 

Crosslinkers can be used, for example, to stabilise 3D conformations, using homo-bifunctional 
20 crosslinkers such as the bifunctional imido esters having (CH2)n spacer groups with n=l to 
n=6, glutaraldehyde, N-hydroxysuccinimide esters and hetero-bifunctional reagents which 
usually contain an amino-rcactive moiety such as N-hydroxysuccinimide and another group 
specific-reactive moiety such as maleimido or dithio moiety (SH) or carbodiimide (COOH). 
In addition, peptides can be conformationally constrained by, for example, incorporation of Q 
25 and N^-methylamino acids, introduction of double bonds betw-een C„ and Cp atoms of amino 
acids and the formation of cyclic peptides or analogues by introducing covalent bonds such as 
forming an amide bond between the N and C termini, between two side chains or between a 
side chain and the N or C terminus. 

30 The present invention further contemplates chemical analogues of the CRP cytokines capable 
of acting as antagonists or agonists of the CRP cytokine or which can act as functional 



wo 98/34951 



PCT/AU98/00078 



-22- 

analogues of CRP cytokines. Chemical analogues may not necessarily be derived from the CRP 
cytokine but may share certain conformational similarities. Alternatively, chemical analogues 
may be specifically designed to mimic certain physiochemical properties of the CRP cytokine. 
Chemical analogues may be chemically synthesised or may be detected following, for example, 
5 natural product screening. 

These types of modifications may be important to stabilise the CRP cytokine if administered 
to an individual or for use as a diagnostic reagent. 

10 Other derivatives contemplated by the present invention include a range of glycosylation 
variants from a completely unglycosylated molecule to a modified glycosylated molecule. 
Altered glycosylation patterns may result from expression of recombinant molecules in 
different host cells. 



15 



W098A34951 



PCT/AU98/00078 



-23- 



TABLE 1 



Non-conventional 


Code 


Non-conventional 


Code 


amino acid 




amino acid 




a-aminobutvric acid 


Abu 


L-N-methylalanine 


Nmala 


a-amino-a-methylbutyrate 


Mgabu 


L-N-methylarginine 


Nmarg 


aminocvclooroDane"- 


Cpro 


L-N-methylasparagine 


Nmasn 


carboxvlate 




L-N-methylaspartic acid 


Nmasp 


10 aminoisobutyric acid 


Aib 


L-N-methylcysteine 


Nmcys 


aminonorbomyl- 


Norb 


L-N-methylglutamine 


Nmgln 


carboxylate 




L-N-methylglutamic acid 


Nmglu 


cyclohexylalanine 




Chexa L-N-methylhistidine 


Nmhis 


cyclopentylalanine 


Cpen 


L-N-methylisoUeucine 


Nmile 


15 D-alanine 


Dal 


L-N-methylleucine 


Nmleu 


D-ar&inine 


Dare 


L-N-methyllysine 


Nnilys 


D-aspartic acid 


Dasp 


L-N-methylmethionine 


Nmmet 


D-cysteine 


Dcys 


L-N-methylnorleucine 


Nmnle 


D-glutamine 


Dgln 


L-N-methylnorvaline 


Nmnva 


20 D-gluiamic acid 


Dglu 


L-N-methylomithine 


Nmorn 


D-histidine 


Dhis 


L-N-methylphenylalanine 


Nmphe 


D-isoleucine 


Dile 


L-N-methylproline 


Nmpro 


D-leucine 


Dleu 


L-N-methylserine 


Nmser 


D-lvsine 


Dlvs 


L-N-methylthreonine 


Nmthr 


25 D-methionine 


Dmet 


L-N-methyltryptophan 


Nmtrp 


D-omithine 


Dorn 


L-N-methyltyrosine 


Nmtyr 


D-phenylalanine 


Dphe 


L-N-methylvaline 


Nmval 


D-proline 


Dpro 


L-N-methylethylglycine 


Nmetg 


D-serine 


Dser 


L-N-methyl-t-butylglycine 


Nmtbug 


30 D-lhreonine 


Dthr 


L-norleucine 


Nle 


D-tryptophan 


Dtrp 


L-norvaline 


Nva 



wo 98/34951 



PCT/AU98/00078 



-24- 



D-tyrosine 


Dtyr 


a-methyl-aminoisobutyrate 


Maib 


D-valine 


Dval 


a-methy 1- Y -aminobutyrate 


Mgabu 


D-a-methylalanine 


Dmala 


a-methylcyclohexylalanine 


Mchexa 


D-a-methylarginine 


Dmarg 


a-methylcylcopentylalanine 


Mcpen 


5 D-a-methylasparagine 


Dmasn 


a-methyl-a-napthylalanine 


Manap 


D-a-methylaspartate 


Dmasp 


a-methylpenicillamine 


Mpen 


D-a-methylcysteine 


Dmcys 


N-(4-aminobutyl)glycine 


Nglu 


D-a-methylglmamine 


Dmgln 


N-(2-aminoethyl)gIycine 


Naeg 


D-a-methylhistidine 


Dmhis 


N-(3-aminopropyl)glycine 


Norn 


10 D-a-methylisoleucine 


Dmile 


N-amino-a-methylbutyrate 


Nmaabu 


D-a-methylleucine 


Dmleu 


a-napthylalanine 


Anap 


D-a-methyllysine 


Dmlys 


N-benzylglycine 


Nphe 


D-a-methylmethionine 


Dmmet 


N-(2-carbamylethyl)glycine 


Ngln 


D-a-methylomithine 


Dmom 


N-(carbamylmethyl)glycine 


Nasn 


15 D-a-methylphenylalanine 


Dmphe 


N-(2-carboxyethyl)glycine 


Nglu 


D-a-methylproline 


Dmpro 


N-(carboxymethyl)glycine 


Nasp 


D-a-methylserine 


Dmser 


N-cyclobutylglycine 


Ncbut 


D-a-methylthreonine 


Dmthr 


N-cycloheptylglycine 


Nchep 


D-a-methyltryptophan 


Dmtrp 


N-cyclohexylglycine 


Nchex 


20 D-a-methyltyrosine 


Dmty 


N-cyclodecylglycine 


Ncdec 


D-a-methylvaline 


Dmval 


N-cylcododecylglycine 


Ncdod 


D-N-methylalanine 


Dnmala 


N-cyclooctylglycine 


Ncoct 


D-N-melhylarginine 


Dnmarg 


N-cyclopropylglycine 


Ncpro 


D-N-methylasparagine 


Dnmasn 


N-cycloundecylglycine 


Ncund 


25 D-N-methylaspartate 


Dnmasp 


N-(2,2-diphenylethyl)glycme 


Nbhm 


D-N-methylcysieine 


Dnmcys 


N-(3,3-diphenylpropyl)glycine 


Nbhe 


D-N-methylglutamine 


Dnmgln 


N-(3-guanidinopropyl)glycine 


Narg 


D-N-methylglulamaie 


Dnmglu 


N-( 1 -hydroxyethy l)glycine 


Nthr 


D-N-methylhistidine 


Dnmhis 


N-(hydroxyethyl))glycine 


Nser 


30 D-N-methylisoleucine 


Dnmile 


N-(imidazolylethyl))glycine 


Nhis 


D-N-methylleucine 


Dnmleu 


N-(3-indolylyethyl)glycine 


Nhtrp 



wo 98/34951 

-25 



D-N-methyllysine Dnmlys 
N-methylcycIohexylalanine Nmchexa 
D-N-methylomithine Dnmorn 



N-methylglycine 


Nala 


5 N-methylaininoisobutyrate 


Nmaib 


N-( 1 -melhylpropyl)glycine 


Nile 


N-(2-methyIpropyl)glycine 


Nleu 


D-N-methyltryptophan 


Dnmtrp 


D-N-methyltyrosine 


Dnmtyr 


10 D-N-melhyl valine 


Dnmval 


y-aminobutyric acid 


Gabu 


L-?-butylglycine 


Tbug 


L-ethylglycine 


Etg 


L-homophenylalanine 


Hphe 


15 L-a-methylarginine 


Marg 


L-a-methylaspartate 


Masp 


L-a-methylcysteine 


Mcys 


L-a-methylglulamine 


Mgln 


L-a-meihylhistidine 


Mhis 


20 L-a-methylisoleucine 


Mile 


L-a-methylleucine 


Mleu 


L-a-methylmethionine 


Mmet 


L-a-methylnorvaliiie 


Mnva 


L-a-methylphenylalanine 


Mphe 


25 L-a-methylserine 


Mser 


L- a-methy Itryptophan 


Mtrp 


L-a-methylvaline 


Mval 



PCT/AU98/00078 



N-methyl- Y -aminobuty rate 


Nmgabu 


D-N-methylmethionine 


Dnnmiet 


N-methylcyclopentylalanine 


Nmcpen 


D-N-methylphenylalanine 


Dnmphe 


D-N-methylproline 


Dnmpro 


D-N-methylserine 


Dnmser 


D-N-methylthreonine 


Dnmthr 


N-( 1 -methy Ieihyl)glycme 


XT .-.1 

Nval 


N-methyla-napthylalanine 


Nmanap 


N-methylpenicillamine 


Nmpen 


N-(/?-hydroxyphenyl)glycine 


Nhtyr 


N-(thiomethyl)glycine 


Ncys 


penicillamine 


Pen 


L-a-methylalanine 


Mala 


L-a-methylasparagine 


Masn 


L-a-methyl-r-butylglycine 


Mtbug 


L-methylethylglycine 


Metg 


L-a-methylglutamate 


Mglu 


L-a-methylhomophenylalanine 


Mhphe 


N-(2-methylthioethyl)glycme 


XT 1. 

Nmet 


L-a-methyllysine 


Mlys 


L-a-methylnorleucine 


Mnle 


L-a-methylomithine 


Mom 


L-a-methylproline 


Mpro 


L-a-methylthreonine 


Mthr 


L-a-methyltyrosine 


Mtyr 


L-N-methylhomophenylalanine 


Nmhphe 



wo 98/34951 



-26- 



PCT/AU98/00078 



N-(N-(2,2-diphenylethyl) Nnbhm 

carbamylmethyl)glycine 

1 -carboxy- 1 -(2,2-diphenyl- Nmbc 

ethylainino)cyclopropane 



N-(N-(3 ,3-diphenylpropyl) 
carbainylmethyl)glycine 



Nnbhe 



5 



The identification of a new family of CRP cytokines allows definition of a consensus protein 
motif which may be used to identify further family members by, for example, PCR analysis 
of cDNA and/or genomic libraries. 



The identification of the CRP cytokines of the present invention also permits the generation 
of a range of therapeutic molecules capable of modulating expression of the CRP cytokine or 
modulating the activity of the cytokine. Modulators contemplated by the present invention 
includes agonists and antagonists of CRP cytokine expression. Antagonists of CRP cytokine 
15 expression include antisense molecules, ribozymes and co-suppression molecules. Agonists 
include molecules which increase promoter activity or interfere with negative regulatory 
mechanisms. Antagonists of the cytokine include antibodies, inhibitor peptide fragments and 
soluble receptors. 

20 Another embodiment of the present invention contemplates a method for modulating 
expression of a CRP cytokine in a manmial such as a human, primate or laboratory test 
animal, said method comprising contacting a gene encoding said CRP cytolane with an 
effective amount of a modulator of CRP cytokine expression for a time and under conditions 
sufficient to up-regulate or down-regulate or otherwise modulate expression of the CRP 

25 cytokine. For example, a nucleic acid molecule encoding the CRP cytokine or a derivative 
thereof may be introduced into a cell to enhance the ability of that^ell to produce CRP or, 
through co-suppression reduce CRP gene expression. Alternatively. CRP cytokine antiserise 
sequences such as oligonucleotides may be introduced to decrease CRP expression in any cell 
expressing the endogenous CRP cytokine gene. 



Another aspect of the present invention contemplates a method of modulating activity of the 



10 



30 



wo 98/34951 



PCT/AU98/00078 



-27- 

CRP cytokine in a mammalian such as a human, said method comprising administering to said 
mammal a modulating effective amount of a molecule for a time and under conditions 
sufficient to increase or decrease CRP cytokine activity. The molecule may be a proteinaceous 
molecule or a chemical enuty and may also be a derivative of a CRP cytokine or its ligand (eg. 
5 a receptor) or a chemical analogue or truncation mutant of a CRP cytokine or its ligand. 

Modulating CRPs may be important in a number of respects, such as but not limited to 
modulating early embryo development. For example, CRPs may have a role in somite 
patterning and in muscles of the body and limbs. The function of the CRPs may be in the 

10 muscles themselves (autocrine role), or may be to act on neighbouring tissue of the somite, 
the dermatome (forming skin) and schlerotome (forming bone). CRP may be involved in 
craniofacial development and useful clinically as an inductive, maintenance, survival, 
proliferative, anti-proliferative or differentiation factor in pathologies related to muscle, bone 
and skin. Furthermore, it may act as a tumour suppressor suggesting a function as an 

15 antiproliferative factor in a broad range of cancers, including breast cancer, lymphoma and 
leukaemia, melanoma, colorectal cancer, pancreatic cancer, lung cancer, stomach cancer and 
neuroblastoma. 

The CRPs are also good candidates for a inductive factor that either induce or give anterior 
20 character to, early neural tissue. Such as they may be clinically useful as an inductive, 
maintenance, survival, proliferative, anti-proliferative or differentiation factor in any 
degenerative neuropathy or in any grafting procedure involving foetal or neural tissue grafted 
to correct familial or acquired deficiencies, or to repair neural tissue after trauma. Anterior 
lateral endoderm is also known to be the source of inducers and suppressors of cardiogenesis 
25 and the CRPs may comprise these factors. They may also be useful clinically as an inductive, 
maintenance, survival, proliferative, anti-proliferative or differentiation factor for 
cadiomyocytes in any interventionist procedure to correct cardiomypathgy, including any 
grafting technique aimed at repairing infarcts (cardiomyoplasty) or valvular defects, . 
modification (including inhibition) or familial or secondary hypertrophy, or induction of 
30 compensatory cardiomycyte growth during ageing. 



wo 98/34951 



PCT/AU98/00078 



-28- 

Accordingly, the present invention contemplates a pharmaceutical composition comprising 
one or more CRP cytokines or derivatives thereof or a modulator of CRP cytokine expression 
or CRP cytokine activity and one or more pharmaceutically acceptable carriers and/or diluents. 
These components are referred to as the active ingredients. 

5 

The pharmaceutical forms suitable for injectable use include sterile aqueous solutions (where 
water soluble) and sterile powders for the extemporaneous preparation of sterile injectable 
solutions. It must be stable under the conditions of manufacture and storage and must be 
preserved against the contaminating action of microorganisms such as bacteria and fungi. The 

10 carrier can be a solvent or dispersion medium containing, for example, water, ethanol. polyol 
(for example, glycerol, propylene glycol and Uquid polyethylene glycol, and the like), suitable 
mixtures thereof and vegetable oils. The proper fluidity can be maintained, for example, by 
the use of a coating such as licithin. The preventions of the action of microorganisms can be 
brought about by various antibacterial and antifungal agents, for example, parabens, 

15 chlorobutanol, phenol, sorbic acid, thimerosal and the like. In many cases, it will be 
preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged 
absorption of the injectable compositions can be brought about by the use in the compositions 
of agents delaying absorption, for example, aluminum monostearate and gelatin. 

20 Sterile injectable solutions are prepared by incorporating the active compounds in the required 
amount in the appropriate solvent with various of the other ingredients enumerated above, as 
required, followed by filtered sterilization. In the case of sterile powders for the preparation 
of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the 
freeze-drying technique which yield a powder of the active ingredient plus any additional 

25 desired ingredient from previously sterile-filtered solution thereof. 

When the active ingredients are suitably protected they may be orally administered, for 
example, with an inert diluent or with an assimilable edible carrier, or it may be enclosed in 
hard or soft shell gelatin capsule, or it may be compressed into tablets, or it may be 
30 incorporated directly with the food of the diet. For oral therapeutic administration, the active 
compound may be incorporated with excipients and used in the form of ingestible tablets. 



AVO 98/34951 



PCT/AU98/00078 



-29- 

buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. Such 
compositions and preparations should contain at least 1 % by weight of active compound. The 
percentage of the compositions and preparations may, of course, be varied and may 
conveniently be between about 5 to about 80% of the weight of the unit. The amount of active 
5 compound in such therapeutically useful compositions in such that a suitable dosage will be 
obtained. Preferred compositions or preparations according to the present invention are 
prepared so that an oral dosage unit form contains between about 0.01 //g and about 2000 mg 
of active compound. Alternative amounts include between about 1.0 //g and about 1500 ng, 
between about l;/g and about 1000 mg and between about 10 /ig and about 500 mg. 

10 

The tablets, troches, pills, capsules and the like may also contain the components as listed 
hereafter: A binder such as gum, acacia, corn starch or gelatin; excipients such as dicalcium 
phosphate; a disintegrating agent such as com starch, potato starch, alginic acid and the like; 
a lubricant such as magnesium stearate; and a s\yeetening agent such a sucrose, lactose or 

15 saccharin may be added or a flavouring agent such as peppennint, oil of wintergreen, or cherry 
flavouring. When the dosage unit form is a capsule, it may contain, in addition to materials 
of the above type, a liquid carrier. Various other materials may be present as coatings or to 
otherwise modify the physical form of the dosage unit. For instance, tablets, pills, or capsules 
may be coated with shellac, sugar or both. A syrup or elixir may contain the active compound, 

20 sucrose as a sweetening agent, methyl and propylparabens as preservatives, a dye and 
flavouring such as cherry or orange flavour. Of course, any material used in preparing any 
dosage unit form should be pharmaceutically pure and substantially non-toxic in the amounts 
employed. In addition, the active compound(s) may -be incorporated into sustained-release 
preparations and formulations. 

25 

The present invention also extends to forms suitable for topical application such as creams, 
lotions and gels. 

Pharmaceutically acceptable carriers and/or diluents include any and all solvents, dispersion 
30 media, coatings, antibacterial and antifungal agents, isotonic and absorption -delaying agents 
and the like. The use of such media and agents for pharmaceutical active substances is well 



wo 98/34951 



PCT/AU98/00078 



-30- 

known in the art. Except insofar as any conventional media or agent is incompatible with the 
active ingredient, use thereof in the therapeutic compositions is contemplated. Supplementary 
active ingredients can also be incorporated into the compositions. 

5 It is especially advantageous to formulate parenteral compositions in dosage unit form for ease 
of administration and uniformity of dosage. Dosage unit form as used herein refers to 
physically discrete units suited as unitary dosages for the mammalian subjects to be treated; 
each unit containing a predetermined quantity of active material calculated to produce the 
desu-ed therapeutic effect in association with the required pharmaceutical carrier. The 

10 specification for the novel dosage unit forms of the invention are dictated by and directly 
dependent on (a) the unique characteristics of the active material and the particular therapeutic 
effect to be achieved, and (b) the limitations inherent in the art of compounding such an active 
material for the treatment of disease in living subjects having a diseased condition in which 
bodily health is impaired as herein disclosed in detail. 

15 

The principal active ingredient is compounded for convenient and effective administration in 
effective amounts with a suitable pharmaceutically acceptable carrier in dosage unit form. A 
unit dosage form can, for example, contain the principal active compound in amounts ranging 
from 0.01 \xg to about 2000 mg. Expressed in proportions, the active compound is generally 

20 present in from about 0.5 \xg to about 2000 mg/ml of carrier. In the case of compositions 
containing supplementary active ingredients, the dosages are determined by reference to the 
usual dose and manner of administration of the said ingredients. Alternatively, amounts 
administered may be represented in terms of amounts/kg body weight. In this case, amounts 
range from about 0.001 /zg to about 1000 mg/kg body weight may be administered 500 mg/kg 

25 body weight or about 10.01 //g to about or above 0.1 /ig to about 250 mg/kg body weight are 
contemplated by the present invention. 

The pharmaceutical composition may also comprise genetic molecules such as a vector 
capable of transfecting target cells where the vector carries a nucleic acid molecule capable 
30 of modulating GRP expression or CRP activity. The vector may, for example, be a viral 
vector. 



wo 98/34951 



PCT/AU98/00078 



-31 - 

Still another aspect of the present invention is directed to antibodies to CRP cytokines and 
their derivatives. Such antibodies may be monoclonal or polyclonal and may be selected from 
naturally occurring antibodies to CKP cytokines or may be specifically raised to CRP 
cytokines or derivatives thereof. In the case of the latter, a CRP cytokine or its derivative may 
5 first need to be associated with a carrier molecule. The antibodies and/or recombinant CRP 
cytokine or its derivatives of the present invention are particularly useful as therapeutic or 
diagnostic agents. 

For example, a CRP cytokine and its derivatives can be used to screen for naturally occurring 
10 antibodies to CRP cytokines. These may occur, for example in some autoimmune diseases. 
Alternatively, specific antibodies can be used to screen for CRP cytokines. Techniques for 
such assays are well known in the art and include, for example, sandwich assays and ELIS A. 
Knowledge of CRP cytokines levels may be important for diagnosis of certain cancers or a 
predisposition to cancers or for monitoring certain therapeutic protocols. 

15 

Antibodies to CRP cytokines of the present invention may be monoclonal or polyclonal. 
Alternatively, fragments of antibodies may be used such as Fab fragments. Furthermore, the 
present invention extends to recombinant and synthetic antibodies and to antibody hybrids. 
A "synthetic antibody" is considered herein to include fragments and hybrids of antibodies. 
20 The antibodies of this aspect of the present invention are particularly useful for 
immunotherapy and may also be used as a diagnostic tool for assessing apoptosis, cancer, 
tissue regeneration or development, muscle development or health of neural tissue or for 
monitoring the program of a therapeutic regimin. 

25 For example, specific antibodies can be used to screen for CRP proteins. The latter would be 
important, for example, as a means for screening for levels of a CRP in a cell extract or other 
biological fluid or purifying a CRP made by recombinant means from culture supernatant 
fluid. Techniques for the assays contemplated herein are known in the art and include, for 
example, sandwich assays and ELISA. 

30 

It is within the scope of this invention to include any second antibodies (monoclonal, 



wo 98/34951 



PCT/AU98/00078 



-32- 

polyclonal or fragments of antibodies or synthetic antibodies) directed to the first mentioned 
antibodies discussed above. Both the first and second antibodies may be used in detection 
assays or a first antibody may be used with a commercially available anti-immunoglobulin 
antibody. An antibody as contemplated herein includes any antibody specific to any region 
5 of GRP. 

Both polyclonal and monoclonal antibodies are obtainable by immunization with the enzyme 
or protein and either type is utilizable for immunoassays. The methods of obtaining both types 
of sera are well known in the art. Polyclonal sera are less preferred but are relatively easily 
10 prepared by injection of a suitable laboratory animal with an effective amount of a CRP, or 
antigenic parts thereof, collecting serum from the animal, and isolating specific sera by any 
of the known immunoadsorbent techniques. Although antibodies produced by this method are 
utilizable in virtually any type of immunoassay, they are generally less favoured because of 
the potential heterogeneity of the product. 

15 

The use of monoclonal antibodies in an inmiunoassay is particularly preferred because of the 
ability to produce them in large quantities and the homogeneity of the product. The 
preparation of hybridoma cell lines for monoclonal antibody production derived by fusing an 
immortal cell line and lymphocytes sensitized against the inrununogenic preparation can be 
20 done by techniques which are well known to those who are skilled in the art. 

Another aspect of the present invention contemplates a method for detecting CRP in a 
biological sample from a subject said method comprising contacting said biological sample 
with an antibody specific for a CRP(or group of CRP s) or its derivatives or homologues for 
25 a time and under conditions sufficient for an antibody-CRP complex to form, and then 
detecting said complex. 

The presence of CRP may be accomplished in a number of ways such as by Western blotting 
and ELIS A procedures. A wide range of immunoassay techniques are available as can be 
30 seen by reference to US Patent Nos. 4,016,043, 4, 424,279 and 4,018,653. These, of course, 
includes both single-site and two-site or "sandwich" assays of the non-competitive types, as 



wo 98/34951 



PCT/AU98/00078 



- 33 - 

well as in the traditional competitive binding assays. These assays also include direct binding 
of a labelled antibody to a target. 

Sandwich assays are among the most useful and commonly used assays and are favoured for 
5 use in the present invention. A number of variations of the sandwich assay technique exist, 
and all are intended to be encompassed by the present invention. Briefly, in a typical forward 
assay, an unlabelled antibody is immobilized on a solid substrate and the sample to be tested 
brought into contact with the bound molecule. After a suitable period of incubation, for a 
period of time sufficient to allow formation of an antibody-antigen complex, a second 

10 antibody specific to the antigen, labelled with a reporter molecule capable of producing a 
detectable signal is then added and incubated, allowing time sufficient for the formation of 
another complex of antibody-antigen-labelled antibody. Any unreacted material is washed 
away, and the presence of the antigen is determined by observation of a signal produced by 
the reporter molecule. The results may either be qualitative, by simple observation of the 

15 visible signal, or may be quantitated by comparing with a control sample containing known 
amounts of hapten. Variations on the forward assay include a simultaneous assay, in which 
both sample and labelled antibody are added simultaneously to the bound antibody. These 
techniques are well known to those skilled in the art, including any minor variations as will 
be readily apparent. In accordance with the present invention the sample is one which might 

20 contain CRP including cell exu*act, tissue biopsy or possibly serum, saliva, mucosal secretions, 
lymph, tissue fluid and respiratory fluid. The sample is, therefore, generally a biological 
sample comprising biological fluid but also extends to fenmentation fluid and supernatant fluid 
such as from a cell culture. 

25 In the typical forward sandwich assay, a first antibody having specificity for the CRP or 
antigenic parts thereof, is either covalently or passively bound to a solid surface. The sohd 
surface is typically glass or a polymer, the most commonly used polymers being cellulose, 
polyacrylamide, nylon, polystyrene, polyvinyl chloride or polypropylene. The solid supports 
may be in the form of tubes, beads, discs of microplates, or any other surface suitable for 

30 conducting an immunoassay. The binding processes are well-known in the art and generally 
consist of cross-linking covalently binding or physically adsorbing, the polymer-antibody 



wo 98/34951 



PCT/AU98/00078 



-34- 

complex is washed in preparation for the test sample. An aliquot of the sample to be tested 
is then added to the solid phase complex and incubated for a period of time sufficient (e.g. 2- 
40 minutes or where more convenient, overnight) and under suitable conditions (e.g. for about 
20°C to about 40°C) to allow binding of any subunit present in the antibody. Following the 
5 incubation period, the antibody subunit solid phase is washed and dried and incubated with 
a second antibody specific for a portion of the hapten. The second antibody is linked to a 
reporter molecule which is used to indicate the binding of the second antibody to the hapten. 

An alternative method involves immobilizing the target molecules in the biological sample and 
10 then exposing the inmiobilized target to specific antibody which may or may not be labelled 
with a reporter molecule. Depending on the amount of target and the strength of the reporter 
molecule signal, a bound target may be detectable by direct labelling with the antibody. 
Alternatively, a second labelled antibody, specific to the first antibody is exposed to the target- 
first antibody complex to form a target-first antibody-second antibody tertiary complex. The 
15 complex is detected by the signal emitted by the reporter molecule. 

By "reporter molecule" as used in the present specification, is meant a molecule which, by its 
chemical nature, provides an analytically identifiable signal which allows the detection of 
antigen-bound antibody. Detection may be either qualitative or quantitative. The most 

20 commonly used reporter molecules in this type of assay are either enzymes, fluorophores or 
radionuclide containing molecules (i.e. radioisotopes) and chemiluminescent molecules. 
In the case of an enzyme immunoassay, an enzyme is conjugated to the second antibody, 
generally by means of glutaraldehyde or periodate. As will be readily recognized, however, 
a wide variety of different conjugation techniques exist, which are readily available to the 

25 skilled artisan. Commonly used enzymes include horseradish peroxidase, glucose oxidase, 
beta-galactosidase and alkaline phosphatase, amongst others. The substrates to be used with 
the specific enzymes are generally chosen for the production, upon hydrolysis by the 
corresponding enzyme, of a detectable colour change. Examples of suitable enzymes include 
alkaline phosphatase and peroxidase. It is also possible to employ fluorogenic substrates, 

30 which yield a fluorescent product rather than the chromogenic substrates noted above. In all 
cases, the enzyme-labelled antibody is added to the first antibody hapten complex, allowed to 



wo 98/34951 



PCT/AU98AKW78 



-35- 

bind, and then the excess reagent is washed away. A solution containing the appropriate 
substrate is then added to the complex of antibody-antigen-antibody. The substrate will react 
with the enzyme linked to the second antibody, giving a qualitative visual signal, which may 
be further quanlitated, usually spectrophotometrically, to give an indication of the amount of 
5 hapten which was present in the sample. "Reporter molecule" also extends to use of cell 
agglutination or inhibition of agglutination such as red blood cells on latex beads, and the like. 

Alternately, fluorescent compounds, such as fluorescein and rhodamine, may be chemically 
coupled to antibodies without altering their binding capacity. When activated by illumination 

10 with light of a particular wavelength, the fluorochrome-labelled antibody adsorbs the light 
energy, inducing a state to excitability in the molecule, followed by emission of the light at 
a characteristic colour visually detectable with a light microscope. As in the EIA, the 
fluorescent labelled antibody is allowed to bind to the first antibody-hapten complex. After 
washing off the unbound reagent, the remaining tertiary complex is then exposed to the light 

15 of the appropriate wavelength the fluorescence observed indicates the presence of the hapten 
of interest Immunofluorescene and EIA techniques are both very well established in the art 
and are particularly preferred for the present method. However, other reporter molecules, such 
as radioisotope, chemiluminescent or bioluminescent molecules, may also be employed. 

20 Although many variations exist for such inununologically bas«d assays another alternative is 
to identify and isolate the cytokine receptor and immobilize this to a solid support in such a 
way that it can still bind the cytokine. A sample containing the cytokine is brought into 
contact with the immobilized receptor to permit the receptor cytokine complex to form. 
Bound cytokine is then identified using an antibody to the cytokine. The antibody may be 

25 labelled or detected using another anti-immunoglobulin antibody which is labelled. 

The present invention also contemplates genetic assays such as involving PGR analysis to 
detect a CRP gene or its derivatives. Alternative methods or methods used in conjunction 
include direct nucleotide sequencing or mutation scanning such as single stranded 
30 conformation polymorphoms analysis (SSCP) as specific oligonucleotide hybridisation, as 
methods such as direct protein truncation tests. 



wo 98/34951 



PCT/AU98/00078 



-36- 

The nucleic acid molecules of the present invention may be RNA or DNA. When the nucleic 
acid molecule is in DNA form, it may be genomic DNA or cDNA. RNA forms of the nucleic 
acid molecules of the present invention are generally mRNA. 

5 Although the nucleic acid molecules of the present invention are generally in isolated form, 
they may be integrated into or ligated to or otherwise fused or associated with other genetic 
molecules such as vector molecules and in particular expression vector molecules. Vectors 
and expression vectors are generally capable of replication and, if applicable, expression in 
one or both of a prokaryotic cell or a eukaryotic cell. Preferably, prokaryotic cells include E. 
10 colU Bacillus sp and Pseudomonas sp. Preferred eukaryotic cells include yeast, fungal, 
mammalian and insect cells. 

Accordingly, another aspect of the present invention contemplates a genetic construct 
comprising a vector portion and a mammalian such as a human CRP gene portion, which CRP 
15 gene portion is capable of encoding a CRP polypeptide or a functional or immunologically 
interactive derivative thereof. 

Preferably, the CRP gene portion of the genetic construct is operably linked to a promoter on 
the vector such that said promoter is capable of directing expression of said CRP gene portion 
20 in an appropriate cell. 

In addition, the CRP gene portion of the genetic construct may comprise all or part of the gene 
fused to another genetic sequence such as a nucleotide sequence encoding glutathione-S- 
transferase or part thereof. It is also within the scope of the present invention -to include 
25 fusions between CRP cytokines. Such fusion molecules may have increased pleiotropy and/or 
provides a means of, for example, "humanising" a non-human CRP. 

The present invention extends to such genetic constructs and to prokaryotic or eukaryotic cells 
comprising same. 

30 

The present invention also extends to any or all derivatives of CRP cytokines including 



wo 98/34951 



PCT/AU98/00078 



-37- 

mutants, part, fragments, portions, homologues and analogues or their encoding genetic 
sequence including single or multiple nucleotide or amino acid substitutions, additions and/or 
deletions to the naturally occurring nucleotide or amino acid sequence. 

5 The CKP cytokines and their genetic sequences of the present invention will be useful in the 
generation of a range of therapeutic and diagnostic reagents and will be especially useful in 
the detection of ligands (eg. receptors) capable of interacting with CRP cytokines. For 
example, a recombinant CRP may be bound or fused to a reporter molecule capable of 
producing an identifiable signal, contacted with a cell or group of cells putatively carrying a 

10 CRP ligand (eg. a receptor) and screening for binding of the labelled CRP to a ligand. 
Alternatively, labelled CRP may be used to screen expression libraries of putative ligands. 

CRP cytokines are important for the regulation, maintenance and survival of a diverse array 
of cell types such as but not limited to muscle tissue, bone, skin and/or neural tissue. 
15 Accordingly, it is proposed that CRP cytokines or their functional derivatives be used to 
regulate development, maintenance or regeneration in an array of different cells and tissues 
in vitro and in vivo. For example, CRPs are contemplated to be useful in modulating neuronal 
proliferation, differentation and survival. 

20 Soluble CRP polypeptides are also contemplated to be useful in the treatment of disease, injury 
or abnormality in the nervous system, e.g. in relation to central or peripheral nervous system 
to treat Cerebral Palsy, trauma induced paralysis, vascular ischaemia associated with stroke, 
neuronal tumours, motoneurone disease, Parkinson's disease, Huntington's disease, 
Alzheimer's disease, Multiple Sclerosis, peripheral neuropathies associated with diabetes, 

25 heavy metal or alcohol toxicity, renal failure and infectious diseases such as herpes, rubella, 
measles, chicken pox, HIV or HTLV-1. 

A membrane bound CRP may be used in vitro oh nerve -cells or tissues to modulate 
proliferation, differentiation or survival, for example, in grafting procedures or transplantation. 

30 

As stated above, the CRP cytokines of the present invention or their functional derivatives may 



wo 98/34951 



PCT/AU98/00078 



-38- 

be provided in a pharmaceutical composition together with one or more pharmaceutically 
acceptable carriers and/or diluents. In addition, the present invention contemplates a method 
of treatment comprising the administration of an effective amount of a CRP of the present 
invention. The present invention also extends to antagonists and agonists of CRP molecules 
5 and their use in therapeutic compositions and methodologies. 



W09804951 



PCT/AU98/00078 



-39- 

SUMMARY OF SEQ ID NOs 

Sequence 



Cystine knot region amino acid sequences 
nucleotide sequence of mCRP-1 
amino acid sequence of mCRP-1 
amino acid sequence of rCRP-2 
amino acid sequence of mCRP-2 
amino acid sequence of hCRP-2 
oligonucleotide primers 
F1.AG epitope 

genomic nucleotide sequence of hCRP-1 
part amino acid sequence of genomic hCRP-1 
part amino acid sequence of genomic hCRP-1 
coding sequence of hCRP-1 without intron 
amino acid sequence of SEQ ID NO:20 
N-terminal amino acid sequence of mCRP-1 
N-terminal amino acid sequence of mCRP-2 



SEQ ID NO. 



1.2 

3 

4 

5 

6 

7 

8-16 

17 

18 

19 

20 

21 

22 

23 

24 



wo 98/34951 



PCT/AU98/00078 



-40- 

The following single and three letter abbreviations are used for amino acid residues: 



Amino Acid Three-letter One-letter 

Abbreviation Symbol 



Alanine 


Ala 


A 


Arginine 


Arg 


R 


Asparagine 


Asn 


N 


Aspartic acid 


Asp 


D 


Cysteine 


Cys 


C 


Glutamine 


Gin 


Q 


Glutamic acid 


Glu 


E 


Glycine 


Gly 


G 


Histidine 


His 


H 


Isoleucine 


lie 


I 


Leucine 


Leu 


L 


Lysine 


Lys 


K 


Methionine 


Met 


M 


Phenylalanine 


Phe 


F 


Proline 


Pro 


P 


Serine 


Ser 


S 


Threonine 


Thr 


T 


Tryptophan 


Trp 


W 


Tyrosine 


Tyr 


Y 


Valine 


Val 


V 


Any residue 


Xaa 


X 



wo 98/34951 



PCT/AU98/00078 



-41 - 
EXAMPLE 1 

Figure 1 is an alignment of amino acid sequences comparing Xenopus laevis cerberus and 
members of the CRP family from mouse, rat and human sources. CRP proteins share 
approximately 30% identity and 40% similarity over an 88 amino acid region. mCRP-1 and 
mCer-l are used interchangeably in the specification to refer to the same molecule. Xcer 
refers to cerberus. 

EXAMPLE 2 
CRP is a secretable molecule 

To examine whether CRP is secreted, mouse CRP-2 (mCRP-2) with a FLAG epitope fused 
to its C-terminus was transiently expressed in COS cells. A single epitope-tagged protein of 
29kDa was secreted from mCRP-2-transfected cells (Figure 4), but not from those transfected 
with empty FLAG vector. Indicative of passage through the rough ER and golgi, secreted 
CRP was N-glycosylated (Figure 4). Secreted mCRP-2 ran at approximately 30 kDa after 
deglycosylation. N-terminal amino acid sequence determination confirmed the identity of 
secreted mCRP-2 and the fact that the hydrophobic signal peptide had been processed (see 
Figure 1). 

EXAMPLE 3 
Isolation of a full length cDNA encoding a mouse CRP 

A full length cDNA encoding a mouse CRP (mCRP-1) was isolated using oligonucleotides 
based on the Genbank EST AA120122, a mouse embryonic day 7.5 cDNA, in combination 
with oligonucleotides corresponding to vector sequences of the plasmid pSport-1. The 
nucleotide and conresponding amino acid sequence is shown in Figure 2. A comparison of the 
mCRP-1 and cerberus sequence is shown in Figure L 

An amount of 50 ng of mouse embryonic region cDNA library was used as template in PCR 
which contained two primers. 



Reaction 1: Oligo 1 (CTTGGAAGATTCTGGAAGAAACCTG (SEQ ID N0:8]) X ml3 



wo 98/34951 



PCT/AU98/00078 



.42- 

forward (CGCCAGGGTTTTCCCAGTCACGAC [SEQ ID N0:9]) 

Reaction 2: Oligo 3 (GCCCCTTCTCCGGGAAAACGAATG [SEQ ID NO:10]) X ml3 
reverse (GGAAACAGCTATGACCATGATTAC [SEQ ID NO: 1 1]) 

The PGR was peiformed using 1 unit of Promega Taq polymerase in the buffer supplied in the 
presence of 200m M dNTPs and 2.5 mM MgClj for 30 cycles at [94 "^C, 60°C, 73*^0] and 10, 
30, 60 seconds]. The products of these reactions were diluted 1 in 100 in water and a second 
PGR was then performed on the diluted sample. 

Reaction 3 (template = diluted reaction 1) Oligo 2 (CAGGACTGTGCCCTTCAACCAGAC 
[SEQ ID N0:13]) X Atttohind (GACGTCGCATGCACGCGTACGTAAG [SEQ ID N0:12]) 

Reaction 4 (template = diluted reaction 2) Oligo 4 (CGGTCTCAGGTTTCTTCCAGAATC 
[SEQ ID N0:13]) X PsttoEco (CTGCAGGTACCGGTCCGGAATTCC [SEQ ID NO:14]) 

All PCRs contained 50 ng of each primer. 

Each of these reactions yielded a prominant product of approximately 500 base pairs. The 
products were gel purified using Bresaclean fragment purification system and cloned into the 
Hindi site of pBluscript SK+(Stratagene). Recombinant plasmids were purified and their 
inserts sequenced using the ml 3 forward and reverse primers described above in standard ABI 
sequencing reactions. The sequence data obtained from these were combined with the EST 
data to construct a continuous 1000 base pair sequence from which the putative full length 
protein homologous to Xenopus cerberus could be translated. Two further primers Oligo 6 
(CCATCTGTGAATCTAACCTCAGTCTC (SEQ ID N0:15] and Oligo 7 
(AACTCACATAACATTTCCAGATTG [SEQ ID NO: 16]) lying at the extremities of this 
sequence were used in PGR under the same conditions as above (with the day 7.5 embryo 
library as template) to generate a DNA fragment completely encompassing the putative coding 
sequence. 



wo 98/34951 



PCT/AU98/00078 



-43" 

EXAMPLE 4 
Production and analysis of mouse CRP-l protein 

Protein Production 

For analysis of structure and functional activity, mouse CRP (mCRP-2) with a FLAG epitope 
(DYKDDDDK [SEQ ID NO: 18]) fused to its C-terminus was transiently expressed in COS 
cells. COS cells were transfected with the mCRP-2 cDNA using a polycationic liposome 
transfection reagent (Lipofetamine, GibcoBRL) or electroporation (Gene Pulser, Biorad). For 
lipofectamine mediated transfection, COS cells grown to approximately 70-80% confluence 
in 100 mm petri-dishes were washed in serum free DMEM media then exposed to a mixture 
of mCRP cDNA and lipofectamine diluted in DMEM according to the manufacturers 
instructions. After 5 hrs incubation at 37°C with 5%v/v COj the cells were washed once with 
DMEM and incubated for a further 16 hrs in DMEM supplemented with 10% v/v FCS, 
glutamine and antibiotics (DM10). At this time the DM10 was removed and replaced with a 
further 8 ml/dish of fresh DM10 and transfected cells incubated from a further 48 hrs. 
Supematents containing secreted mouse CRP were recovered, centrifuged and filtered to 
remove cell debris, then stored at 4°C. For electroporation 1 x lO' COS cells were 
resuspended in 400 lA of DMEM and transferred to a 0.4 cm electroporation cuvette 
containing 20 /zg of mCRP cDNA and incubated for 10 min at room temperature. After 
electroporation (0.3 kV, 960 //FD) cells were incubated at room temperature for a further 10 
min then transferred to a 150 cm^ tissue culture flask containing 40 ml of DM10. Supernatant 
containing secreted mCRP-2 protein was recovered after 72 hrs, centrifuged and filtered to 
remove cell debris, then stored at 4°C. 

Protein Analysis 

Expression of mCRP-2 was monitored by biosensor analysis and western blot analysis. 
Samples were monitored for expression using a biosensor (BL\core™) employing surface 
plasmon resonance detection. M2 antibody, specific to FLAG sequence, was immobilised to 
the sensor surface using NHS-EDC coupling chemistry according to the manufacturers 
instructions. The running buffer for all biosensor analysis was 10 mM HEPES, 150mM NaCl, 
3.4mM EDTA, 0.005% v/v Tween 20 (HBS buffer). The buffer was degassed under vacuum 



wo 98/34951 



PCT/AU98/00078 



-44- 

for 10 minutes prior to use to prevent bubble fonnation. The flow rate was 5 /il/min. For 
immobilisation of M2 antibody, 50mM N-hydroxysuccinimide and 200mM N-ethyl- 
'dimethylaminopropyl carbodiimide were mixed in a 1:1 ratio and 35 fA of this mixture 
injected onto the sensorchip for surface activation. After 7 minutes, 35 //I of M2 antibody 
(100 /ig/ml in 20mM Sodium Acetate pH 4.2) was injected. After a further 7 minutes, 75 //I 
ethanolamine was injected to quench any remaining free esters generated during the NHS- 
EDC activation. 

For analysis of binding, 35 /zl of sample supernatant was injected onto the sensor surface and 
allowed to bind to the M2 derivitised channel. The differential between the signal prior to 
injection and post injection (450 seconds) was recorded as the specific response units 
(resonance units). Post sample analysis, 10 /il of 50mM diethylamine pH 12.0 was used to 
desorb the sensor surface prior to the subsequent analysis. mCRP-2 expression was monitored 
on days 1, 2 and 3 post-transfection and compared to a control supernatant generated by 
transfection of a cDNA encoding an unrelated protein (P-galactosidase). Biosensor results are 
shown in Figure 4. 

Protein expression was confirmed by western blot analysis. Samples were separated on the 
basis of size using SDS-PAGE analysis. Samples were then blotted onto PVDF using 
Tris/glycine/Methanol buffer at 30 V for 1 hour using a Novex blot apparatus. Transfers were 
performed according to manufacturers instructions. PVDF membranes were then blocked 
overnight in 2% w/v BSA in TBS buffer (20mM Tris pH 7.4, 150 mM NaCl, 0.02 v/v Tween 
20). Membranes were washed extensively between addition of antibodies with 10 washes of 
TBS. Blots were probed with primary antibody (M2) for Ihr at a final concentration of 10 
//g/ml. Bound M2 was detected using an appropriately conjugated secondary antibody (goat 
anti-mouse HRP, Silenus) at a dilution of 1 :5(X)0 for 1 hour. Bound secondary antibody was 
visualised by autoradiography after addition of ECL reagent. 

Protein Purification 

Proteins were purified using the strategy outline in Figure 5. Binding was monitored on the 
Biosensor and elution performed, after extensive washing in TBS (200 column volumes), 



wo 98/34951 



PCT/AU98/00078 



-45- 

using 4 X 5 ml fractions of Flag peptide (60 //g/ml) in TBS. Fractions were analysed by SDS- 
PAGE analysis under reducing conditions using the PHAST system (Pharmacia) and protein 
visualised by silver staining and western blot analysis. 

Protein Characterisation 

Using SDS-PAGE under non reducing and reducing conditions (Figure 6) mCRP-2 was 
examined to determine the size of the expressed protein. Under non-reducing conditions a 65 
kD protein was observed, whereas under reducing conditions mCRP-2 had an apparent 
molecular weight of 30 kD. These data suggest that the bulk of the mCRP-2 is expressed as 
a disulphide bonded homodimer. This observation was confirmed by size exclusion analysis 
of CRP using a Superose 12 PC 3.2/30 column. Column fractions containing mCRP were 
detected by biosensor analysis and the size of the expressed protein determined by linear 
regression analysis (Figure 7). 

EXAMPLES 
Production and analysis of mouse CRP-l protein 

Protein Production 

For analysis of structure and functional activity, mCRP-1 with a FLAG epitope fused to is C- 
terminus was transiently expressed in COS cells. COS cells were transfected with the mCRP- 
1 cDNA using a polycationic liposome transfection reagent (Lipofectamine, GibcoBRL). 
Cells grown to approximately 70-80% confluence in 100 mm petri-dishes were washed in 
serum free DMEM media then exposed to a mixture of mCRP- 1 cDNA and lipofectamine 
diluted in DMEM according to the manufacturers instructions. After 5 hrs incubation at 37°C 
with 5% CO2 the cells were washed once with DMEM and incubated for a further 16 hrs in 
DMEM supplemented with 10% v/v FCS, glutamine and antibiotics (DM10). At this time the 
DM10 was removed and replaced with a further 8 ml/ dish of fresh DM10 and transfected cells 
incubated for a further 48 hrs. Supematents containing secreted mouse CRP were recovered, 
centrifuged and filtered to remove cell debris, then stored at 4°C, 



wo 98/34951 



PCT/AU98/00078 



^46" 

Protein expression 

Expression of m CRP-1 from transfected COS was analysed by biosensor analysis using the 
M2 sensorchip (as above). mCRP-1 was purified from positive samples by M2 affinity 
chromatography and then purified fractions analysed by SDS-PAGE and western blot analysis. 
Preliminary data indicate mCRP-1 under reducing conditions is a 30 kD protein (Figure 8). 

EXAMPLES 
Expression Pattern of mCRP-l 

Expression of mCRP-1 has been studied in mouse embryos. The expression pattern is similar 
to that of frog cerberus, with some differences, mCRP-1 is first expressed at the onset of 
gastrulation in midline anterior endoderm extending to the embryonic/extra-embryonic 
boundary. This expression is likely to be in primitive endoderm, which will eventually be 
displaced into the exu-a-embryonic region. By mid-gastrulation, expression is also seen in 
anterior-lateral endoderm, tissue which is likely to be the migrating wings of definitive 
endoderm which displaces the primitive endoderm. By the end of gastrulation, endoderm and 
mesoderm in the anterior half of the embryo expresses mCRP- 1 . Endoderm underlying the 
cardiac progenitors seems not to express mCRP-1. Shortly afterwards, the anterior expression 
fades, at first laterally, then from the midline, then is lost completely. 

The very early and uransient expression of mCRP-1 within anterior endoderm is very similar 
to that of Xenopus cerberus, and it is anticipated that mCRP-1 and cerberus are functionally 
homologous. Increasing evidence implicates midline anterior endoderm in patterning the 
midbrain and forebrain (5). raCRP-1 is, therefore, a good candidate for a inductive factor that 
either induces, or gives anterior character to, early neural tissue. As such, it may be clinically 
useful as an inductive, maintenance, survival, proliferative, anti-proliferative or differentiation 
factor in any degenerative neuropathy or in any grafting procedure involving foetal or other 
neural tissue grafted to correct familial or acquired deficiencies, or to repair neural tissue after 
trauma. Anterior lateral endoderm is also known to be the source of inducers and suppressors 
of caniiogenesis (4) and mCRP-1 may be one of these factors. It may be useful clinically as 
an inductive, maintenance, survival, proliferative, anti-proliferative or differentiation factor 



wo 98/34951 



PCT/AU98/00078 



.47- 

for cardiomyocytes in any interventionist procedure to correct cardiomyopathy, including any 
grafting technique aimed at repairing infarcts (cardiomyoplasty) or valvular defects, 
modification (including inhibition) of familial or secondary hypertrophy, or induction of 
compensatory cardiomyocyte growth during aging. 

Unlike Xenopus cerberus, mCRP-1 is also expressed in developing somites. Expression 
prefigures a restricted anterior compartment of the two next-to-form somites within the 
presomitic mesoderm, and occurs in a similar compartment of the two most recently formed 
somites. This expression is extremely transient and does not occur in more mature somites. 
mCRP-1 may be involved in establishing compartments within newly forming somites. In 
developing chick embryos neural crest migrates through only the anterior portion of the 
somite. Hence, mCRP-1 may initially give anterior character to somites, defining its 
interaction with neural crest. mCRP-1 may, therefore, be useful as an inductive factor in 
imparting particular positional qualities to engrafted tissues. 

EXAMPLE 6 
Biological activity ofCRP 

RNA encoding mCRP-1 or mCRP-2 was injected into first cleavage stage Xenopus embryos 
and resulted in induction of ectopic cement gland formation at later embryonic stages. As 
cement gland formation is often an indicator of the presence of impending appearance of 
neural tissue, it is likely that mCRP-1 has the capability of inducing anterior neural tissue. 
This conjecture is entirely consistent with the established properties of Xenopus cerberus. The 
capacity of mCRP-2 to mimic the action of Xenopus cerberus further suggests that this 
molecule has an underiying biological significance as a secreted molecule and not as 
transcription factor. 



wo 98/34951 



PCT/AU98/00078 



-48- 
EXAMPLE? 

Stable Production and Characterisation of mCRP-1 Protein 

A cDNA fragment containing the entire coding sequence of mCRP-1 was cloned into the 
expression vector pEFBOS-S-FLAG for production of C-terminal FLAG tagged protein. 
Transient expression following transfection of COS cells resulted in a low yield of 
predominantly aggregated material which, following purification by affinity and size exclusion 
chromatography, was found to be heterogenous at the N-terminus, most likely as a result of 
adverse proteolytic activity. For stable long term production, the construct and a vector 
incorporating a gene encoding puromycin resistance were co-transfected into CHO cells 
(DMEM, 10% v/v FCS, glutamine, penicillin, streptomycin, 37°C. 10% v/v CO^) using 
Lipofectamine (Gibco BRL, USA) according to the manufacturer's instructions. Following 
selection in puromycin (25 p,g/ml, Sigma, USA), resistant colonies were picked by micro- 
manipulation, expanded and assayed for mCRP-l-CFLAG production by binding to immobilised 
M2 antibody (Kodak Eastman, USA; Biosensor 2000, Pharmacia, Sweden). Several potential 
candidate clones were identified with clone (CL) 47 selected for further analysis. CL47 was 
recloned by limit dilution. 

For protein production and characterisation, CL47 was expanded into Roller bottles and 
cultured until 3 days post confluence. An amount of 2.5 L of conditioned media was 
concentrated tenfold (Easy flow diafiltration apparatus, 10 kDa cut-off, Sartorius, USA). 
Concentrated mCRP-1 was applied to 2 ml of M2 affinity resin (Kodak Eastman) and the 
unbound fraction reloaded onto the column 4 times prior to extensive washing in tris-buffercd 
saline (TBS, 500 ml). Elution (4 x 5ml) was performed using FLAG peptide (-60 ^g/ml, Kodak 
Eastman) in TBS. Fractions were monitored by SDS PAGE and Western Blot analysis for 
appropriate pooling of samples for further purification. Pooled M2 fractions were further 
purified by RP-HPLC using a Brownlee C8 colunm (100 x 2. 1 mm I.D; Perkin Elmer, USA). 
Chromatography was developed using the SMART™ SYSTEM (Phamacia, Sweden) at a flow 
rate of 1(K) \i\ I min. A linear gradient formed betweenO.15% v/v Triflouroacetic acid (TFA) 
and 0.13% v/v TFA containing 60% v/v n-propanol over 60 minuses with positive fractions 
monitored by biosensor analysis and SDS-PAGE. 



wo 98/34951 



PCT/AU98/00078 



. 49 - 

SDS PAGE and Western blot analysis of the purified protein showed the majority of mCRP-1 
to have an apparent niolecular weight of 38kDa under reducing conditions. Following removal 
of carbohydrate the protein migrated with an apparent molecular weight of 34 kDa (Panel A, 
Fig 9; N-glycosidase F, Boehringer Mannheim, Germany). An identical molecular weight was 
also apparent under non-reducing conditions suggesting that mCRP-1 is secreted by CHO cells 
as a monoHKric protein (not shown). Size exclusion analysis (Superose 12, 300 x 3.2 mm l.D, 
100 ^il / min; Pharmacia) and subsequent linear regressional analysis of peak fractions compared 
to standards confirmed this observation (Panel B & C, Fig 9 ). The RP-HPLC purified mCRP- 1 
was subjected to N-temiinal sequence analysis (Hewlett Packard, USA). The resultant 30 cycles 
of N terminal sequence generated a single sequence with the indicated N-terminus at D41 (Panel 
D, Figure 9 ). The sequence was consistent with the yanslated cDNA sequence. 

EXAMPLES 

Anti'BMP'like activity of mCRP-l in Xenopus animal caps 

Cerberus has been shown to have an anti-BMP-like activity when expressed in Xenopus animal 
cap assays, inducing Otx-2, a marker of anterior embryonic structures, as well as markers of 
neural tissue, cement gland and endoderm. To examine whether mC!RP-l shared this property, 
the activities of mCRP-1 and cerberus were compared in animal cap assays after injection of 
synthetic mRNAs at the fertilised egg stage. First, formation of cement glands in individual 
animal caps was scored at stage 35, since these were easily recognisable as superficial darkly 
pigmented patches secreting a sticky exudate. Both native mCRP-1 and CFLAG-mCRP-1 
were able to induce pigmented cement glands (Figure 14) with equal frequency (Figure 14). 
although at only one quarter the frequency of cerberus. 

Next, RT-PCR analysis was used to assess expression of various markers in pools of 25-30 
animal caps derived from injected and uninjected embryos (Figure 14). Both mCRP-1 and 
cerberus mRNA s showed near identical activities. mCRP-1 induces the pan-neural maker N- 
CAM (9), although rather weakly, the cement gland marker CG13 (10) and the endoderm- 
enriched marker Edd (11). induced tissues apparently had anterior character, since Otx-2, a 



wo 98/34951 



PCT/AU98/00078 



-50- 

marker of anterior embryonic structures such as forebrain, midbrain and cement gland was 
strongly induced, while Krox20, a hindbrain marker was not. The related homeobox genes, 
XNkx-2.5 and -2.3, normally expressed in cardiogenic mesoderm and anterior (pharyngeal) 
endoderm were strongly induced. There was no induction of the cardiac-specific 
differentiation marker, XMLC2a, even when caps were cultured beyond the equivalent of 
stage 40. Thus, the homeobox markers may be expressed in endoderm, in which case they 
would indicate foregut character (11). However, it is also possible that early stages of 
cardiogenesis are activated, without realization of the whole program. 

The inductive activities of mCRP-1 and cerberus in animal caps are characteristic of a partial 
inhibition of BMP signalling. In animal caps, BMPs can act as both mesoderm-inducing and 
ventralising agents, whilst strongly inhibiting formation of neural tissue. The inventors found 
that BMP4 induced expression of T4 globin and XeHAND makers of ventral and lateral 
mesoderm, respectively (Figure 14C). To examine the relationship between cerberus and 
BMP4 signalling and to further compare the activities of the mouse and frog proteins, mCRP-1 
and cerberus were co-expressed with BMP4 in animal caps by coinjection of equimolar 
amounts of their mRNAs into eggs. Both mCRP-1 and cerberus antagonised BMP4 responses, 
whilst BMP4 antagonised mCRP-1 and cerberus responses (Figure 14C). Thus, markers 
induced specifically by mCRP-1 and cerberus but not BMP4 (XNkx-2.3, XNkx-2.5, NCAM, 
Otx2, CGI 3, Edd) were reduced, as were those specifically induced by BMP4 but not mCRP-1 
or cerberus (T4 globin, XeHAND). It was found that coinjected BMP4 mRNA extinguished 
cerberus-induced NCAM and CG13. However, other markers, XNkx-2.3, XNkx-2.5 and Edd 
(Xcer-induced) and T4 globin and XeHAND (BMP4-induced), were diminished but not 
extinguished, leaving open the possibility that cerberus and BMP4 act in a mutually 
antagnostic way through the same pathway. Although only semi-quantitative, the RT-PCR 
results indicate that BMP4 more readily overrides the inductive effects of mCRP-1 versus 
those of cerberus (Figure 14C), consistent with the mouse gene being less potent in the animal 
cap assay. 



wo 98/34951 



PCT/AU98/00078 



-51- 

EXAMPLE 9 
mCRP'l expression in gastrulating embryos 

Expression of mCRP-1 was examined during post-implantation development by in situ 
hybridization using a wholemourit protocol and digoxygenin-labelled RNA probes, mCRP-1 
U^scripts were first evident at or just before the onset of gastrulation in a stripe, several cell 
diameters in width, along one side of the egg cylinder. This snipe extended proximally from 
the embryonic/extra-embryonic junction to just short of the distal tip (ISA) and was on the 
opposite side of the egg cylinder to the primitive streak, abutting the future anterior region of 
epiblast fated to form anterior neurectoderm. This location was confirmed by hybridising 
early streak embryos with probes for both mCRP-1 and brachyary (bra) which makes 
prospective mesodermal cells immediately after passage through the streak (Figure 15B). 

EXAMPLE 10 
mCRP'l expression in nascent somites 

mCRP-1 expression faded completely from the anterior region during headfold stages. When 
expression was reduced to a trace at the anterior ventral midline (Figure 16A), two stripes 
became apparent in anterior paraxial mesoderm (Figure 16A, B). In progressively older 
embryos, expression was detected in 3 or 4 stripes at more and more posterior positions along 
the axis (Figure 16), with no other regions expressing the gene, even as late as E12.5 (Figure 
16F). Histological sections of an E9.5 embryo revealed that the paraxial stripes spanned the 
zone of new somite formation (Figure 16E). Two stripes were restricted to the rostral half of 
the two most recently formed somites, while the additional stripes were positioned within 
proximal presomitic mesoderm. Transverse sections showed that within the cranial aspect of 
a single somitic stripe, expression occurred in all cells (Figure 16D). 

EXAMPLE 11 
mCRP'l expression in adult tissues 

mCRP-1 expression was analysed in adult tissues by RNase protection, using an mCRP-1 



wo 98/34951 



PCT/AU98/00078 



-52- 



specific probe and a cyclophilin probe to control RNA recovery and integrity. Under 
conditions employed, no high level expression was detected in adult tissues including brain, 
skeletal muscle, salivary gland, tongue, thymus, heart, lung, stomach, spleen, liver, pancreas, 
intestine, kidney, bladder, uterus, testes and ovary. 

EXAMPLE 12 
mCRP-1 expression in Otx-l''' embryos 

Anterior primitive endoderm is known to be essential for patterning the anterior epiblast and 
neural plate as is anterior embryonic mesendoderm at later stages. Since mCRP-1 is expressed 
in both of these zones, it could participate in the patterning function, either as an inducer, or 
an inhibitor. Another gene that may be involved is Otx-2, which encodes a homeodomain 
protein related to Drosophila orthodenticle and empty spiracles, both involved in head 
development in the fly. Otx-2 is initially expressed throughout the epiblast of the gastrula, 
before becoming restricted to anterior tissues including chordamesoderm, forebrain and 
midbrain. Targeted Otx-2-'- mutants show severe abnormalities at gastnilation, including 
defective formauon of chordamesoderm and loss of all brain compartments anterior to 
rhombomere 3. A possible role for Otx-2 in the patterning function of primitive endoderm 
was suggested by examination of null embryos canying a LacZ reporter gene, which showed 
that while Otx-2 could be expressed in primitive endoderm in the mutant context, it could not 
be induced and/or maintained in anterior neural plate. 

mCRP-1 expression was examined in Otx-2^- embryos by wholeraount in situ hybridisation 
(Figure 17) and found that it was still expressed in an anterior region, although to varying 
extents. In more severely affected embryos, expression was restricted to the distal tip and was 
absent at the embryonic/extra-embryonic junction, marker by a prominent constriction. As 
noted above, mCRP-1 would normally extend up to this point. In the less affected Otx-2-'- 
mutant examined (Figure 17), mCRP-1 expression tended more towards the norla pattern, 
although, since anterior patterning is still disturbed in these embryos, it istUfficult to say to 
what extent. 



wo 98/34951 



PCT/AU98/00078 



- 53 - 

EXAMPLE 13 
Stable Production and Characterisation 
ofmCRP-2 Protein 

A cDNA fragment containing the entire coding sequence of mCRP-2 was cloned into the 
expression vector pEFBOS-S-FLAG for production of C-terminal FLAG tagged protein. 
Transient expression following transfection of COS cells resulted in good yields of 
predominantly dimeric mCRP-2. For stable, long term production the construct and a vector 
incorporating a gene encoding puromycin resistance were co-transfected into rat SR-3Y1 cells 
(DMEM, 10% v/v FCS, glutamine, penicillin, streptomycin, 37°C, 10% v/v COj) using 
Lipofectamine (Gibco BRL, USA) according to the manufacturers instructions. Following 
selection in puromycin (25 Jig/ml, Sigma, USA), resistant colonies were picked by micro- 
manipulation, expanded, and assayed for mCRP-2-CFLAG production by binding to 
immobilised M2 antibody (Kodak Eastman, USA; Biosensor 20CX), Pharmacia, Sweden). 
Several potential candidate clones were identified with clone (CL) 23 selected for further 
analysis, CL23 was recloned following culture and micro-manipulation from soft agar. 

For protein production and characterisation CL23 was expanded into Roller bottles and 
cultured until 3 days post confluence. An amount of 2.5 L of conditioned media was 
concentrated tenfold (Easy flow diafiltration aj^aratus, 10 kDa cut-off, Sartorius, USA). The 
sanple was also bufier exchanged after concentration into 20mM Tris, 0. 1 5% w/v NaCl, 0. 1 % 
v/vTween 20 (TBS). Concentrated mCRP-2 was applied to 2 ml of M2 affinity resin (Kodak 
Eastman) and the unbound fraction reloaded onto the column 4 times prior to extensive 
washing in Tris-buffered saline (TBS, 500 ml). Elution (4 x 5ml) was performed using FLAG 
peptide (60 fig/ml, Kodak Eastman) in TBS. Fractions were monitored by SDS PAGE and 
Western Blot analysis for appropriate pooling of samples for further purification. 

Pooled M2 fractions were applied to G25 Sepharose resin (Pharmacia) packed into an XK 
column (400 x 26mm I.D.) to remove free peptide from the previous step. The column was 
operated at 4ml/min. using an FPLC with online UVj^q absorbance and conductivity detection. 



wo 98/34951 



PCT/AU98/00078 



- 54 - 

The column buffer was 20mM Tris, O.IM NaCl, 0.02%v/v Tween 20, 0.05% w/v azide pH 7.5. 
Fractions were collected at 2.5 min. intervals and monitored on the biosensor. Peak fractions 
were diluted 1:1 with 2QmM Tris, 0,02%v/v Tween 20, 0.05% w/v azide pH 7.5 (Buffer A) and 
applied to a previously equilibrated MonoQ 5/5 column (Pharmacia, 50 x 5 mm I.D,) via a 
superloop. After sample loading was complete, the column was re-equilibrated into Buffer A 
and a gradient developed over 50 min from Buffer A to 1 .OM NaCl in Buffer A. Fractions 
containing mCRP-2 were monitored by biosensor analysis and SDS PAGE. Typically 400|jg 
of mCRP-2 was recovered in fractions 18/19 which eluted at 0.35-0.4 M NaCl and was 
essentially pure (>95%). 

Protein estimations were determined by SDS PAGE analysis (comparison to known standard 
concentrations), Western blot, and also by comparison of lOpg Bovine serum albumin under 
identical ion exchange chromatographic conditions. Reducing conditions on SDS PAGE ( 0.05 
% v/v P mercaptoethanol ) resulted in a single band residing at 27 kD (Panels A and B, Fig 10). 
Following removal of carbohydrate the protein was reduced to an apparent molecular weight 
of 24 kDa (Panel A, Fig 10; N-glycosidase F, Boehringer Mannheim, Germany). Under non- 
reducing conditions a single band residing at approximately 55kD was apparent (Panel B, 
Figure 10) suggesting that under native conditions mCRP-2 exists as a homodimer. Size 
exclusion analysis of 1 \ig of high purity mCRP-2 (Superose 12, 300 x 3.2 mm I.D, 100 |il / 
min; Pharmacia) and subsequent linear regressional analysis of peak fractions compared to 
standards confirmed this observation (Panel D and C, Fig 10 ). High purity DAN (5 |Xg) was 
subjected to N-tem^nal sequence analysis (Hewlett Packard, USA). The resultant 30 cycles of 
N terminal sequence generated a single sequence with the indicated N-terminus at Alaj, (Panel 
E, Figure 10). The sequence was consistent with the translated cDNA sequence and identified 
a N linked glycosylation site at Njg. 



wo 9834951 



PCT/AU98/0(M)78 



-55- 

EXAMPLE 14 
- Isolation of a genomic DNA encoding human CRP-l 

A human genomic DNA clone encoding a human CRP (hCRP-1) was isolated by screening 
a human genomic library (lambda DASH 11, Stratagene) with cDNA encoding mCRP-1. 
Library screens were performed using hybridisation conditions described by Sambrook et al 
(6). Hybridisation and washing conditions were performed at relatively high stringency at 
65°C and 65"^ 2 xSSC/0.1% w/v SDS, respectively. The probe was generated by random 
priming of the cDNA encoding mCRP-1. 

The genomic clone, hCRP-1 was sequenced and found to contain a full open reading frame, 
encompassing two exons and one intron and parts of the 5'UTR and 3'UTR. The sequence 
data obtained were used to construct a continuous 3,150 base pair sequence from which the 
putative full length protein could be translated. The complete genomic nucleotide sequence 
and corresponding amino acid sequence to exons 1 and 2 is shown in Figure 11. The putative 
coding sequence without intron and corresponding protein translation is shown in Figure 12. 
Although initial Southern blot analysis using hCRP-1 as a probe on mouse genomic DNA 
indicated that this gene was not the mCRP-1 equivalent, more recent analysis now shows that 
hCRPl is the mCRP-1 equivalent. 

The translated sequence shows sequence similarities with mCRP-1 and Xenopus laevis 
Cerberus. A protein comparison of hCRP-1, mCRP-1 and Xenopus laevis cerberus is shown 
in Figure 13. 

Southern blol/PCR analysis on a panel of CHO human hybrids indicated that the hCRP-1 ^ene 
maps to 9q23 which is syntenic with the central region of mouse chromosome 4 that harbours 
the mCRP-1 gene. 



wo 98/34951 



PCT/AU98/00078 



-56- 

EXAMPLE 15 
Chromosome location ofmCRP'l 

The mouse chromosomal location of mCRP-1 was determined by interspecific backcross 
analysis of a panel of progeny derived from matings of [(C57BL/6J/ x Mus spretus) Fl x 
C57BL/6J] mice. This interspecific backcross panel has been typed for over 2400 loci that are 
well distributed among all autosomes as well as the X chromosome (12). DNA isolation, 
restriction enzyme digestion, agarose gel electrophoresis, Southern transfer to Hybond-N+ and 
hybridisations were performed essentially as described (13). The probe for mCRP-1 
encompassed nucleotides 288-640 and was radiolabelled with [^^P]-CTP using a random 
priming kit (Straiagene). Washing of Southern filters was performed in 1 x SSCP, 0.1% w/v 
SDS at 65°C. A major fragment of 6-kb was detected in 5acl-digested C57BL/6J DNA and 
a major fragment of 3-kb was detected in 5acl-digested M. spretus DNA. The presence or 
absence of the 3-kb SadM. spretus fragment was followed in backcross mice. A description 
of probes and RFLPs for loci linked to mCRP-1 has been (14, 15) previously reported. 
Recombination distances were calculated using the Map Manager program (version 2.6.5). 
Gene order was determined by minimizing the number of recombination events r-equired to 
explain the allele distribution patterns. 

The results indicate that mCRP-1 is located in the central region of mouse chromosome 4, 
linked to Tyrpl, Ifiia, Jun and Pgml (Figure 18). Ninety-two mice were analysed with all of 
these markers, although for some marker pairs up to 175 mice were typed. To calculate 
recombination frequencies, each locus was analysed in pairwise combinations using the 
additional data. The ratios of the total number of mice exhibiting recombinant chromosomes 
to the total number of mice analysed for each pair or loci, and most the likely gene or-der are: 
cenu-ometer - Tyrpl - 1/163 -mCer-1 2/1 16 - Ifna - 0/122 - Jun -5/174 - Pgml. 

Recombination frequencies (expressed as genetic distances in centiMorgans (cM)±standard 
error) are Tyrpl - 0.6±0.6 - mCer-l - 2.6±1 .5 • {IJha, Jun] - 2.9±1.3. No recombinants were 
detected between Ifna and Jun in 122 animals types, suggesting that the two loci are within 
2. 5 cM of each other (upper 95% confidence limit). 



wo 98/34951 



PCT/AU98/(M)078 



-57- 



The inventors have compared the interspecific map of chromosome 4 with a composite mouse 
linkage map that reports the location of many uncloned mutations (provided by the Mouse 
Genome Database, a computerised databased maintained at the Jackson Laboratory, Bar 
Harbor, ME, USA). A number of mouse mutations map with 5 cM of the chromosomal 
position determined for mCRP- 1 : pintail (pt) ( 1 6), polysyndactyly (ps) (17,18), meander tail 
(mea) (19) and head blebs (heb) (20). All of these mutations result in phenotypes which 
include defects in head or tail development and could conceivably be associated with mutation 
of mCRP-1 or perturbation of its expression. To test this possibility, genomic DN A derived 
from heterozygous or homozygous individuals of each mutant strain was analysed by Southern 
blotting using an mCRP-1 probe that detected both coding exons (Figure 18). 10//g of each 
DNA was digested separately with EcoRl and BaniHi, resolved by agarose gel electrophoresis 
and Southern blotted. After hybridisation, filters were washed in 0.1 x SSC, 0.1% w/v SDS 
at 65°C. For EcoRi digests, major fragments of 4.5 and 5.5 kb were detected in wildtype and 
all mutant strains except pt, in which a polymorphism resulted in a 5.5-kb doublet (Figure 18). 
Since the pt sample analysed was from a heterozygote animal, complete loss of the 4.5-kb 
fragment indicated that the observed polymorphism was not specific to the pt allele. For 
BamilL digests, a single 4.3-kb fragment was detected. The Southern analysis showed that the 
mCRP-1 locus is not grossly rearranged in the mutant strains. If total deletion of the mCRP-1 
locus had occunred in stains for which heterozygous DNA was analysed (pt and ps), the 
Southern banding pattern produced would be the same, although the signal would be half the 
intensity. This was shown not to be the case by controlling for DNA loading with a probe 
corresponding to the homeobox gene Nfcx2-5 (21), located on chromosome 17 (22). To 
examine the possibility that small deletions or point mutations in the mCRP-1 coding region 
were responsible for any mutant phenotype, the inventors amplified the mCRP-1 coding 
region from each strain by polymerase chain reaction and determined its DNA sequence 
directly. The results showed no candidate mutations. Within homozygote samples (mea and 
heb), no base changes that led to amino acid changes were detected. For heterozygote samples 
(ps and pt), a candidate mutation would manifest as an ambiguous base. No such ambiguities 
were detected, although a few polymorphisms were present. The inventors conclude that gross 
rearrangement or coding region nriutations in mCRP-1 do not account for any of the miitant 
phenotypes. 



wo 98/34951 



PCT/AU98/00078 



-58- 

EXAMPLE 16 
mCRP'l is a secreted N-terminally processed glycoprotein 

Methods 

pEFBOS I FLAG vector carrying the mCRP-1 insert was co-transfected with a puromycin 
resistance plasmid into CHO cells using Lipofectamine (Gibco BRL) according to 
manufacturer's instructions. Following puromycin selection (Sigma; 25mg/ml), resistant 
clones were picked and expanded, and culture supernatant was assayed fro CFLAG-mCRP- 1 
-1 by analysis of binding to inmiobilised M2 (anti-FLAG) antibody (Kodak Eastman) on a 
Biosensor 2000 (Pharmacia). CFLAG-mCRP- 1 was purified from conditioned medium of 
clone CL47 using M2 affinity resin (Kodak Eastman), eluding with FLAG peptide (60 /ig/ml; 
Kodak Eastman) in Tris-buffered saline. Fractions were monitored by Western blotting 
probed with M2 antibody. Pooled fractions were further purified by reversed phase-HPLC 
using a Brownlee C8 column (100 mm x 2.1 nmi LD.; Perkin Elmer, USA) on a SMART 
system (Pharmacia) using a flow rate of 100 //1/min and a linear gradient between 0. 15% (v/v) 
trifluoroacetic acid (TFA) and 0.13% (v/v) TFA containing 60% (v/v) n-propanol. Fractions 
were monitored on the Biosensor and by SDS-PAGE. For N-glycosylation analysis, purified 
protein (l/zg) was treated with N-glycosidase F (Boehringer), as per manufacturer's 
instructions, before Western blotting. Purified material, subjected to automated unambiguous 
sequence over 30 cycles concordant with the predicted open reading frame of mCRP-1. 

293T fibroblast cells were transfected (Lipofectamine) with an pEFBOS construct encoding 
a C terminal flag tagged mCRP-l. Three days post transfection supernatant was harvested and 
expression assessed by biosensor analysis. mCRP-l-C was affinity purified M2 (anti-falg 
antibody) resin (1ml). Flag peptide was used to elute mCRP-1 from the column at a 
concentration of 100//g/ml (5ml). Purified fractions were monitored by Biosensor and by 
SDS-PAGE. Preliminary Western analysis indicated a 38kDa polypeptide under reducing 
conditions and a 74kDa polypeptide under non-reducing conditions. N-terminal amino acid 
sequence analysis of mCRP-1 derived from 293T cells was done and the sequence was the 
same as that derived from mCRP-1 expressed from CHO cells. 



wo 98/34951 



PCT/AU98/00078 



-59- 

Results 

A PCR-generated cDNA fragment spanning the mCRP-1 coding region was cloned into the 
expression vector pEFBOS I FLAG for production of recombinant protein carrying a C- 
terminal FLAG epitope. CFLAG-mCRP-1 could be recovered from culture supematans of 
both Chinese hamster ovary (CHO) cells, after stable integration of vector, as well as from 
293T cells after transient transfection (Fig. 20A, B). CFLAG-mCRP-1 purified from CHO 
cells using immobilised M2 (anti-FLAG) antibody and reversed phase-HPLC migrated 
principally at 38kD on reducing and denaturing gels. It size was reduced to 32kD after 
treatment with N-glycosidase F (Fig. 20A), demonstrating that mCRP-1, as expected of a 
secreted protein, is N-glycosylated. To assess whether CFLAG-mCRP-1 was processed, N- 
terminal amino acid sequence analysis was performed on purified material. The sequence 
unambiguously showed cleavage after the basis peptide RGRR, at a position 40 amino acids 
into the native protein. However, examination of CHO cell preparations on denaturing and 
non-reducing gels, and by gel filtration, indicated that most unaggregated protein migrated as 
monomer, with little dimer detected. Since all known cystine knot cytokines are secreted as 
homo- or heterodimers (9), CHO cell-derived material may be abnormally processed or 
secreted. The inventors examined, CFLAG-mCRP-1 secreted from 293T cells, and in this 
case found dimers, with no monomer detected (Fig. 20B). These data demonstrate that 
mCRP-1 is a secreted, N-terminally processed glycoprotein that can form predominantly 
disulphide bonded dimers when secreted from certain cell types. 

EXAMPLE 17 

A gene encoding hCRP-1 was isolated from a human genomic library (see Example 14). TCR 
was used to generate probes specific for putative hCRP-1 exons 1 and 2 which were used to 
screen a number of cDNA libraries constructed from various fetal and adult tissues. No cDNA 
clones encoding hCRP-1 were isolated. 

To express hCRP-1 protein, an artificial hCRP-1 cDNA was constructed using standard 
techniques such as splice overlap extension PCR (SOE-PCR). Two separate PCR*s were 



wo 98/34951 



PCT/AU98/00078 



-60- 

performed to generate exon 1 and exon 2 specific hCRP-I cDNA, the PCR fragments purified 
and used in a third PCR to generate a full length cDNA torn which the intron has been excised. 
Attempts were made to clone this cDNA into the expression vector pEFBOS I FLAG for 
production of a recombinant protein carrying a C-terminal FLAG epitope. This construct 
proved to be unstable so other epitope tags were enployed. A stable using the pEFBOS vector 
with an I-SPY epitope tag (peptide seq: LNQYPALTE; AMRAD Biotech) at the C-terminus 
of hCRP-1 was generated (C'-I-SPY-hCRP-l). 

For transient expression of hCRP-1, 293T human fibroblast cells were transfected 
(Lipofectamine, Gibco BRL) with the pEFBOS I-SPY-hCRP-1 construct according to the 
manufacturers instructions. Three days post transfection supernatant was harvested and 
expression assessed by biosensor analysis where I-SPY antibody (Dl 1) was immobilised to the 
sensorchip at 100 ng/ml. C-I-SPY-hC3lP-l was affinity purified from the supernatant using an 
I-SPY antibody coupled resin (AMRAD Biotech). Purified material was analysed by Western 
blot analysis using the I-SPY antibody conjugated with HRPO and subsequent ECL detection. 
Results presented in Fig 21 demonstrate that under reducing conditions the major species of 
protein was a monomer migrating with an apparent molecular weight of approximately 40 kDa. 
Other minor species present under reducing conditions are non-reduced dimers, as well as a 
small amount of aggregated material Under non-reducing conditions the monomeric form was 
replaced by a dimer of approximately 80 kDa and a large anx)unt of aggregated material. These 
results indicate that like mCRP-1 and other cystine knot cytokines, hCRP-1 exists primarily as 
a dimeric molecule. 

To further confirm the relationship between hCRP-1 and mCRP-1, experiments were 
undertaken to determine if the human and mouse molecules would from heterodimers when 
simultaneously expressed in the same cells. To this end 293T cells were cod-ansfected with 
vectors encoding C-FLAG-mCRP-1 and C-I-SPY-hCRP-1 respectively. In a number of 
experiments the I-SPY specific antibody was shown to immunoprecipitate a protein of the 
appropriate molecular weight that contained a FLAG epitope tag as assessed in Western blot 
analysis. These results indicated that hCRP-1 and mCRP-1 mononoers will, under appropriate 
conditions, interact to form disulphide linked heterodimers. 



wo 98/94951 



PCT/AU98/00078 



-61 - 

EXAMPLE 18 
EXPRESSION PATTERNS OF inCRP-2 

In the mouse embryo, mCRP-2 is expressed from the beginning of organogenesis (embryonic 
day 8.5) within the segnienting paraxial mesoderm. mCRP-2 expression prefigures the next-to- 
form somite within unsegmented mesoderm and in the most recently fonned somite. Thus, both 
mCRP'2 and mCRP-1 are expressed during somite formation, and may be involved in the same 
type of process. In contrast to mCRP-1, however, mCRP-2 expression is strongest in the 
posterior region of somites. mCRP-2 and mCRP-1 may therefore act in compartmentalisation 
of the posterior and anterior regions of the somite, respectively. After dropping considerably 
in newly formed somites, mCRP-2 expression increases as somites mature. Somites 
differentiate into three compartments along the dorso-ventral axis, fated to give rise to the 
dermis dorsally (dermatome), the back and limb muscles (myotome) and the vertebrae ventrally 
(sclerotome). mCRP-2 expression in somites is strongest medially and dorsally. mCRP-2 is 
also expressed in the limb musculature and in craniofacial epithelium and mesenchyme. 

These expression domains suggest a number of roles for mCRP-2 in early embryos. First, in 
somite patterning, perhaps performing an analogous role to mCRP-1 . Secondly, in miiscles of 
the body and limbs. The function of mCRP-2 may be tissues of the somite, the dermatome 
(forming skin) and schlerotome (forming bone). Thirdly, in craniofacial development. mCRP-2 
may be useful clinically as an inductive, maintenance, survival, proliferative, anti-proliferative 
or differentiation factor in pathologies related to muscle, bone and skin. Funbermore, its 
proposed role as a tumour suppressor suggests a function as an anti-proliferative factor in a 
broad range of cancers, including breast cancer, lymphoma and leukaemia, melanoma, 
colorectal cancer, pancreatic cancer, lung cancer, stomach cancer and nueroblastoma. 

mCRP-2 is expressed in all adult tissues examined with ^e exception of the liver. Strongest 
expression levels were observed in bladder, uterus and lungs. 



wo 98/34951 



PCT/AU98/00078 



-62- 

EXAMPLE 19 
mCRP-1 AND niCRP-2 FORM HETERODIMERS 

Results indicated that mCRP-1 and mCRP-2 are capable of either asscx:iating, or existing in a 
helerodimeric complex, with each other. This possibility is raised by analysis of supematants 
recovered from cells which had been transfected with expression vectors for mCRP-1 and 
mCRP-2. Briefly, DNA expression vectors designed to produce c-terminally flag tagged 
mCRP-1 and c-terminaDy myc tagged mCRP-l were transfected, either individually or together, 
into 293T cells using the Lipofectamine transfection protocol described previously. 72 hours 
later, the supematants from the various transfections were harvested, clarified by low speed 
centrifugation and then treated in two different ways. First, 5 fj\ samples of each supernatant 
was analysed by SDS PAGE and Western blotting to assess the level of mCRP-l-flag and 
niCRP-2-myc proteins. Second, 1 ml of the supernatant was incubated with 10 ;il of M2 anti- 
flag antibody affinity resin to bind proteins containing the flag epitope. The resin was washed 
a number of times prior to elution of bound proteins with 20 /il of 5 /ig/ml M2 peptide. The 
eluate from this procedure was also subjected to analysis by SDS PAGE and western blotting. 
In all the procedures the western blots were probed with either the anti-flag M2 antibody or the 
9EI0 anti-myc antibody. Following binding of the HRP-conjugated secondarj' antibody, the 
proteins were then detected using ECL. 

This analysis showed that the amount of mCRP-2-myc recovered from the flag affinity purified 
raCRP-l/mCRP-2 supernatant was significantly more than that recovered from a parallel 
sanples from which the mCRP-l-flag protein was absent. Tliis result suggests that mCRP-2- 
myc has copurified with mCRP-l-flag raising the possibility that the two proteins either 
associate of dimerize. Given both proteins share a degree of structural similarity it would not 
be unusual if the proteins could form heterodimers. Heterodimeric molecules are conmionly 
observed with the TBF-P class of cystine knot proteins. 

The existence of heterodimers between mOlP-l and -2 raises the following possibilities. First, 
the activity of the heterodimer may be different from homodimers of -either mCRP-1 or -2. A 
heterodimer may be able to bind to distinct receptors, if they exist, and«licit novel responses 



wo 98/34^51 



PCT/AU98/00078 



-63- 

in the cells that possess them. A heterodimer may possess distinct biochemical properties, in 
terms of its stability and or solubility. It is also possible that the biological potency of a 
heterodimer may exceed that of molecules being homodimeric examples of its constituents. 

Those skilled in the art will appreciate that the invention described herein is susceptible to 
variations and modifications other than those specifically described. It is to be understood that 
the invention includes all such variations and modifications. The invention also includes all 
of the steps, features, compositions and compounds referred to or indicated in this 
specification, individually or collectively, and any and all combinations of any two or more 
of said steps or features. 



wo 98/34951 



PCT/AU98/00078 



-64- 

BIBLIOGRAPHY 

1. Bouwmeester etal. Nature 382: 595-601,1996. 

2. Ozaki and Sakiyama Proc. Natl. Acad-Sci. USA 90: 2593-2597, 1993. 

3. Enomoto et al Oncogene 9: 2785-279 1 , 1 994. 

4. Schultheiss, et al. Genes Dev. 11: 451-462, 1997. 

5. Thomas and Beddington, Current Biology 6: 1487-1496, 1996. 

6. Sambrook et al. Cloning: A Laboratory Manual. Cold Spring Harbour, NY, USA; 
Second Edition; 1989. 

7. McDonald and Hendrickson Cell 75;421-424, 1993. 

8. Isaacs Current Opinion in Structural Biology 5;391-395, 1995. 

9. Kinter and Melton Development 99: 3 1 1-325, 1987. 

10. Jamrich and Sato Development 105: 779-786, 1989. 

1 1 . Sasai et al EMBO J 15: 4547-4555, 1996. 

12. Copeland and Jenkins Trends Genet 7: 113-1 18, 1991. 

1 3 . Jenkins et al J. Virol 43: 26-36, 1 982. 

14. Smith et al Cell 73: 1349-1360. 1993. 

15. Ceci et al Genomics 5: 699-709, 1989. 

1 6. Hollander and Strong J. Hered 42.- 1 79- 1 82, 1 95 1 . 

17. Batchelor et al Mutation Research 3: 218-229, 1968. 

1 8. Johnson J Embryol. Exp. Morphol. 21: 285-294, 1969. 

19. Hollander and Waggie J. Hered 68: 403-406, 1977. 

20. Vamum and Fox J. Hered 72: 293, 1 98 1 . 

21 . Lints et al Development 119: 419-43 1 , 1993. 

22. Himmelbauer et al Mammalian Genome 5; 814-816, 1995. 



wo 98/34951 



PCT/AU98/00078 



.65- 



SEQUENCE LISTING 



(1) GENERAL INFORMATION: 

(i) APPLICANT: AMRAD OPERATIONS PTY LTD 

OTHER THAN US: HILTON Douglas J, STANLEY, Edouard G, HARVEY Richard 
P, BIBEN Christine, FABRI Louis, IJJJ Maria and NASH Andrew D 

(ii) TITLE OF INVENTION: NOVEL MOLECULES AND USES THEREOF 

(iii) NUMBER OF SEQUENCES: 23 

(iv) CORRESPONDENCE ADDRESS: 

(A) ADDRESSEE: DAVIES COLLISON CAVE 

(B) STREET: 1 LITTLE COLLINS STREET 

(C) CITY: MELBOURNE 

(D) STATE: VICTORIA 

(E) COUNTRY: AUSTRALIA 

(F) ZIP: 3000 

(V) COMPUTER READABLE FORM: 

(A) MEDIUM TYPE: Floppy disk 

(B) COMPUTER: IBM PC compatible 

(C) OPERATING SYSTEM: PC-DOS/MS-DOS 

(D) SOFTWARE: Patentin Release #1.0, Version #1.25 

(vi) CURRENT APPLICATION DATA: 

(A) APPLICATION NUMBER: PCT INTERNATIONAL (PCT) 

(B) FILING DATE: ll-FEB-1998 

(C) CLASSIFICATION: 

(vii) PRIOR APPLICATION DATA: 

(A) APPLICATION NUMBER: P08963 

(B) FILING DATE: 3-SEP-1997 

(C) CLASSIFICATION: 

(vii) PRIOR APPLICATION DATA: 

(A) APPLICATION NUMBER: PO5067 

(B) FILING DATE: ll-FEB-1997 

(C) CLASSIFICATION: 



(vii) PRIOR APPLICATION DATA: 

(A) APPLICATION NUMBER: PO6420 

(B) FILING DATE: 24-APR-1997 

(C) CLASSIFICATION: 

(vii) PRIOR APPLICATION DATA: 

(A) APPLICATION NUMBER: PP0961 

(B) FILING DATE: 16-DEC-1997 

(C) CLASSIFICATION: 

(viii) ATTORNEY /AGENT INFORMATION: 

(A) NAME: HUGHES, DR E JOHN L 

(C) REFERENCE/DOCKET NUMBER: EJH/AF 

(ix) TELECOMMUNICATION INFORMATION: 

(A) TELEPHONE: +61 3 9254 2777 

(B) TELEFAX: +61 3 9254 2770 

(C) TELEX: AA 31787 



wo 9S34951 



PCT/AU98/00078 



. 66 - 

(2) INFORMATION FOR SEQ ID N0:1: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 42 amino acids 

(B) TYPE: amino acid 

iC) STRANDEDNESS : single 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: Protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:1: 

Cys Xaa Tyr Xaa Pro Phe Xaa Gin Xaa He Xaa His Glu Xaa Cys Xaa Xaa Xaa Val 

5 10 15 

Xaa Gin Asn Asn Leu Cys Phe Gly Lys Cys Xaa Ser Xaa Xaa Xaa Pro Xaa^j Cys Ser 

20 25 30 35 

His Cys Xaa Pro 
40 

(2) INFORMATION FOR SEQ ID NO: 2: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 29 amino acids 

(B) TYPE: amino acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: Protein 

(xi) SEQUEIiCE DESCRIPTION: SEQ ID NO: 2: 



Cys Arg Tyr Val Pro Phe Asn Gin Tyr He Ala His Glu Asp Cys Gin Lys Val Val 

5 10 15 

Val Gin Asn Asn Leu Cys Phe Gly Lys Cys 



wo 98/34951 



PCT/AU98/00078 



-67- 

{21 INFORMATION FOR SEQ ID NO: 3: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 995 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA 



(ix) FEATURE: 

(A) NAME/KEY: CDS 

(B) LOCATION: 54. .869 



(xi) SEQUENCE DESCRIPTION: SEQ . ID N0:3: 

TTTTAGGCCC GTCCATCTGT GAATCTAACC TCAGTCTCTG GGAATCAGGA AGC ATG 56 

Met 
1 

CAT CTC CTC TTA GTT CAG CTG CTT GTT CTC TTG CCT CTG GGG AAG GCA 104 
His Leu Leu Leu Val Gin Leu Leu Val Leu Leu Pro Leu Gly Lys Ala 
5 10 15 

GAC CTA TGT GTG GAT GGC TGC CAG AGT CAG GGC TCT TTA TCC TTT CCT 152 
Asp Leu Cys Val Asp Gly Cys Gin Ser Gin Gly Ser Leu Ser Phe Pro 
20 25 30 

CTC CTA GAA AGG GGT CGC AGA GAT CTC CAC GTG GCC AAC CAC GAG GAG 200 
Leu Leu Glu Arg Gly Arg Arg Asp Leu His Val Ala Asn His Glu ^lu 
35 40 45 

GCA GAA GAC AAG CCG GAT CTG TTT GTG GCC ATG CCA CAC CTC ATG ISGC 248 
Ala Glu Asp Lys Pro Asp Leu Phe Val Ala Met Pro His Leu Met Gly 
50 55 60 65 

ACC AGC CTG GCT GGG GAA GGT CAG AGG CAG AGA OGG AAG ATG CTG TCC 296 
Thr Ser Leu Ala Gly Glu Gly Gin Arg Gin Arg Gly Lys Met Leu Ser 
70 75 80 



AGG CTT GGA AGA TTC TGG AAG AAA CCT GAG ACC GAA TTT TAC CCC CCA 
Arg Leu Gly Arg Phe Trp Lys Lys Pro Glu Thr Glu Phe Tyr Pro Pro 
85 90 95 



344 



wo 98/34951 PCT/AU98/00078 



-68- 



AGG GAT GTG GAA AGC GAT CAT GTC TCA TCG GGG ATG CAG GCC GTG ACT 392 
Arg Asp Val Glu Ser Asp His Val Ser Ser Gly Met Gin Ala Val Thr 
100 105 110 

CAG CCA GCA GAT GGG AGG AAA GTG GAG AGA TCA CCT CTA CAG GAG GAA 440 
Gin Pro Ala Asp Gly Arg Lys Val Glu Arg Ser Pro Leu Gin Glu Glu 
115 120 125 



GCC AAG AGG TTC TGG CAT CGG TTC ATG TTC AGA AAG GGC CCG GCG TTC 4 88 

Ala Lys Arg Phe Trp His Arg Phe Met Phe Arg Lys Gly Pro Ala Phe 
130 135 140 145 



CAG GGA GTC ATC CTG CCC ATC AAA AGC CAC GAA GTA CAC TGG GAG ACC 53 6 

Gin Gly Val He Leu Pro He Lys Ser His Glu Val His Trp Glu Thr 
150 155 160 

TGC AGG ACT GTG CCC TTC AAC CAG ACC ATT GCC CAT GAA GAC TGT CAA 584 
Cys Arg Thr Val Pro Phe Asn Gin Thr He Ala His Glu Asp Cys Gin 
165 170 175 



AAA GTC GTT GTC CAG AAC AAC CTT TGC TTT GGC AAA TGC AGT TCC ATT 632 
Lys Val Val Val Gin Asn Asn Leu Cys Phe Gly Lys Cys Ser Ser He 
180 185 190 



CGT TTT CCC GGA GAA GGG GCA GAT <3CC CAC AGC TTC TGC TCC CAC TGC 680 
Arg Phe Pro Gly Glu Gly Ala Asp Ala His Ser Phe Cys Ser His Cys 
195 200 205 

TCG CCC ACC AAA TTC ACC ACC GTG CAC TTG ATG CTG AAC TGC ACC AGC 728 
Ser Pro Thr Lys Phe Thr Thr Val His Leu Met Leu Asn Cys Thr Ser 
210 215 220 225 



CCA ACC CCC GTG GTC AAG ATG GTG ATG CAA GTA GAA GAG TGT CAG TGC 
Pro Thr Pro Val Val Lys Met Val Met Gin Val Glu Glu Cys Gin Cys 
230 235 240 



776 



ATG GTG AAG ACG GAA CGT GGA GAG GAG CGC CTC CTA CTG GCT <K5T TCC 
Met Val Lys Thr Glu Arg Gly Glu Glu Arg Leu Leu Leu Ala Gly Ser 
245 250 255 



824 



CAG GGT TCC TTC ATC CCT GGA CTT CCA <;CT TCA AAA ACA AAC CCA 
Gin Gly Ser Phe He Pro Gly Leu Pro Ala Ser Lys Thr Asn Pro 
260 ■ 265 270 



8£9 



TGAATTACCT CAACAGAAAG CAAAACCTCA ACAGAATAGG 



TGAGGTTATT CAATCTGGAA 929 



wo 98/34951 



PCT/AU98/00078 



-69- 

ATGTTATGTG AGTTTATATA AAGATCAGTG GAAAATAAAA AAAAAAAAAA AAAAAAAAAA 989 
AAAAAA 995 

(2) INFORMATION FOR SEQ ID NO: 4: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 272 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:4: 

Met His Leu Leu Leu Val Gin Leu Leu Val Leu Leu Pro Leu Gly Lys 
15 10 15 

Ala Asp Leu Cys Val Asp Gly Cys Gin Ser Gin Gly Ser Leu Ser Phe 
20 25 30 

Pro Leu Leu Glu Arg Gly Arg Arg Asp Leu His Val Ala Asn His Glu 
35 40 45 

Glu Ala Glu Asp Lys Pro Asp Leu Phe Val Ala Met Pro His Leu Met 
50 55 60 

Gly Thr Ser Leu Ala <=ly Glu Gly Gin Arg Gin Arg Gly Lys Met Leu 
65 70 75 80 

Ser Arg Leu Gly Arg Phe Trp Lys Lys Pro Glu Thr Glu Phe Tyr Pro 
85 90 95 

Pro Arg Asp Val Glu Ser Asp His Val Ser Ser Gly Met Gin Ala Val 
100 105 110 

Thr Gin Pro Ala Asp Gly Arg Lys Val Glu Arg Ser Pro Leu Gin Glu 
115 120 125 

Glu Ala Lys Arg Phe Trp His Arg Phe Met Phe Arg Lys Gly Pro Ala 
130 135 140 

Phe Gin Gly Val lie Leu Pro lie Lys Ser His Glu Val His Trp Glu 
145 150 155 160 



wo 98/34951 



PCT/AU98/00078 



70- 



Thr Cys Arg Thr Val Pro Phe Asn Gin Thr lie Ala His Glu Asp Cys 
165 170 175 

Gin Lys Val Val Val Gin Asn Asn Leu Cys Phe Gly Lys Cys Ser Ser 
180 185 190 

lie Arg Phe Pro Gly Glu Gly Ala Asp Ala His Ser Phe Cys Ser His 
195 200 205 

Cys Ser Pro Thr. Lys Phe Thr Thr Val His Leu Met Leu Asn Cys Thr 
210 215 220 

Ser Pro Thr Pro Val Val Lys Met Val Met Gin Val Glu Glu Cys Gin 
225 230 235 240 

Cys Met Val Lys Thr Glu Arg Gly Glu Glu Arg Leu Leu Leu Ala Gly 
245 250 255 

Ser Gin Gly Ser Phe lie Pro Gly Leu Pro Ala Ser Lys Thr Asn Pro 
260 265 270 



(2) INFORMATION FOR SEQ ID NO: 5: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 178 amino acids 

(B) TYPE: amino acid 

(C) STRANDEDNESS : single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5: 

Met Leu Trp Val Leu Val Gly Ala Val Leu Pro Val Met Leu Leu Ala 
15 10 15 

Ala Pro Pro Pro lie Asn Lys Leu Ala Leu Phe Pro Asp Lys Ser Ala 
20 25 30 

Trp Cys Glu Ala Lys Asn lie Thr <51n He Val Gly His Ser Gly Cys 
35 40 45 



W098/34<^1 



PCT/AU98/00078 



71 



Glu Ala Lys Ser lie Gin Asn Arg Ala Cys Leu Gly Gin Cys Phe Sex 
50 55 60 

Tyr Ser Val Pro Asn Thr Phe Pro Gin Ser Thr Glu Ser Leu Val His 
65 70 75 80 . 

Cys Asp Ser Cys Met Pro Ala Gin Ser Met Trp Glu lie Val Thr Leu 
85 90 95 

Glu Cys Pro Asp His Glu Glu Val Pro Arg Val Asp Lys Leu Val Glu 
100 105 110 

Lys lie Val His Cys Ser Cys Gin Ala Cys Gly Lys Glu Pro Ser His 
115 120 125 

Glu Gly Leu Asn Val Tyr Val Gin Gly Glu Asp Ser Pro Gly Ser Gin 
130 135 140 

Pro Gly Pro His Ser His Ala His Pro His Pro Gly Gly <3ln Thr Pro 
145 150 155 160 

Glu Pro Glu Glu Pro Pro Gly Ala Pro Gin Val Glu Glu Glu Gly Ala 
165 170 175 

Glu Asp 

(2) INFORMATION FOR SEQ ID NO: 6: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 178 amino acids 

(B) TYPE: amino acid 

(C) STRANDEDNESS : single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO : 6 : 

Met Leu Trp Val Leu Val Gly Ala Val Leu Pro Val Met Leu Leu Ala 
1 5 10 15 

Ala Pro Pro Pro lie Asn Lys Leu Ala Leu Phe Pro Asp Lys Ser Ala 
20 25 30 



wo 98/34951 



PCT/AU98/00078 



-72 



Trp Cys Glu Ala Lys Asn He Thr Gin He Val Gly His Ser Gly Cys 
35 40 45 

Glu Ala Lys Ser He Gin Asn Arg Ala Cys Leu Gly Gin Cys Phe Ser 
50 55 60 

Tyr Ser Val Pro Asn Thr Phe Pro Gin Ser Thr Glu Ser Leu Val His 
65 70 75 80 

Cys Asp Ser Cys Met Pro Ala Gin Ser Met Trp Glu He Val Thr Leu 
85 90 95 

Glu Cys Pro Asp His Glu Glu Val Pro Arg Val Asp Lys Leu Val Glu 
100 105 110 

Lys He Val His Cys Ser Cys Gin Ala Cys Gly Lys Glu Pro Ser His 
115 120 125 

Glu Gly Leu Asn Val Tyr Val Gin Gly Glu Asp Ser Pro Gly Ser Gin 
130 135 140 



Pro Gly Pro His Ser His Ala His Pro His Pro Gly Gly Gin Thr Pro 
145 150 155 160 



Glu Pro Glu. Glu Pro Pro Gly Ala Pro Gin Val Glu Glu Glu Gly Ala 
165 170 175 

Glu Asp 

(2) INFORMATION FOR SEQ ID NO: 7: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 186 amino acids 

(B) TYPE: amino acid 

iC) STRANDEDNESS : single 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7: 

Met Leu Arg Val Leu Val Gly Ala Val Leu Pro Ala Met Leu Leu Ala 



wo 98/34951 



PCT/AU98/00078 



-73 



1 5 10 15 

Ala Pro Pro Pro He Asn Lys Leu Ala Leu Phe Pro Asp Lys Ser Ala 
20 25 30 

Trp Cys Glu Ala Lys Asn He Thr Gin He Val Gly His Phe Thr Ser 
35 40 45 

Gly Cys Glu Ala Lys Ser He Gin Asn Arg Ala Cys Leu Gly Gin Cys 
50 55 60 

Phe Ser Tyr Ser Val Pro Asn Thr Phe Pro Gin Ser Thr Glu Ser Leu 
65 70 75 80 

Val His Cys Asp Ser Cys Met Pro Ala Gin Ser Met Trp Glu He Val 
85 90 95 

Thr Leu Glu Cys Pro Gly His Glu Glu Val Phe Thr Pro Arg Val Asp 
100 105 110 

Lys Leu Val Glu Lys He Leu His Cys Ser Cys Gin Ala Cys Gly Lys 
115 120 125 

Glu Pro Ser His Glu Gly Leu Ser Val Tyr Val Gin Gly Glu Asp Gly 
130 135 140 

Pro Gly Ser Gin Pro Gly Thr His Pro His Pro His Pro His Pro His 
145 150 155 160 

Pro Gly Gly Gin Thr Pro Glu Phe Thr Pro Glu Asp Pro Pro <51y Ala 
165 170 175 

Pro His Thr Glu Glu Glu Gly Ala Glu Asp 
180 185 



(2) INFORMATION FOR SEQ ID NO: 8: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 25 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS : single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA 



wo 98/34951 



PCT/AU98/00078 



-74- 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8: 



- CTTGGAAGAT TCTGGAAGAA ACCTG 



(2) INFORMATION FOR SEQ ID NO: 9: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 24 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS : single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9: 



CGCCAGGGTT TTCCCAGTCA CGAC 



(2) INFORMATION FOR SEQ ID NO:iO: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 24 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10: 
GCCCCTTCTC CGGGAAAACG AATG ' 



wo 98/34951 



PCT/AU98/00078 



-75- 

(2) INFORMATION FOR SEQ ID NO: 11: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 24 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS : single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11: 



GGAAACAGCT ATGACCATGA TTAC 



(2) INFORMATION FOR SEQ ID NO: 12: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 24 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 12: 



CAGGACTGTG CCCTTCAACC AGAC 



(2) INFORMATION FOR SEQ ID NO: 13: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 24 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA 



wo 98/34951 



PCT/AU98/00078 



-76- 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13: 



CGGTCTCAGG TTTCTTCCAG AATC 



(2) INFORMATION FOR SEQ ID NO: 14: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 14 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS : single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 14: 



CTGCAGGTAC CGGTCCGGAA TTCC 



(2) INFORMATION FOR SEQ ID NO: 15: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 26 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 15: 



CCATCTGTGA ATCTAACCTC AGTCTC 



(2) INFORMATION FOR SEQ ID NO: 16: 



wo 98/34951 



PCTMU98/00078 



-77- 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 24 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS : single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 16: 



AACTCACATA ACATTTCCAG ATTG 
(2) INFORMATION FOR SEQ ID NO: 17: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: B amino acids 

(B) TYPE: amino acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: Protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 17: 

Asp Tyr Lys Asp Asp Asp Asp Lys 
5 

(2) INFORMATION FOR SEQ ID NO: 18: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 3150 base pairs 

(B) TYPE; nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

<ii) MOLECULE TYPE: DNA 



(ix) FEATURE: 

(A) NAME/KEY: CDS 

(B) LOCATION: 406., 912 



wo 98/34951 



PCT/AU98/a0078 



78- 



(ix) FEATURE: 

(A) NAME/KEY: CDS 

(B) LOCATION: 2693.-2986 



(xi) SEQUENCE DESCRIPTION: SEQ ID N0:1B: 

TATTCTATTC CAGCACAAGG CAGATGCACA GCAAATGTGA GCTGACTCTA GTCCTTCTTC 60 

TGAAAACAGC CATGGGAAAT TTAGGCAAAG AATGTGTTGT CTTTGCTAAT ACTGCTCTTT 120 

AAGCCCCAGA CATAGCTAAA CTCTTAGCTA ATTACCCCCT GGGTCCCAGG CTTTCACTGG 180 

GGCCTTTTAA AATACACAAA ACCAAAGTGA CGGCAGGAGG CCATTAGCAC TACATAATTC 240 

AAGCAAACAA TAAATGTGTT TATTCTGCCT GGCTACTGAC CACCTGCCTT CCCATCCCGC 300 

CAGGCAGGTA TCTATATATA CGATTTCCTT TTTCCCAGTC CTGCAGAGAA TGAGCCTCTC 360 

CTTTGGGCCT CATCATTTAC AAAAGAAGCT TGGGCCCCTG ACAGC ATG CAT CTC 414 

Met His Leu 
1 

CTC TTA TTT CAG CTG CTG GTA CTC CTG CCT CTA GGA AAG ACC ACA CGG 462 
Leu Leu Phe Gin Leu Leu Val Leu Leu Pro Leu Gly Lys Thr Thr Arg 
5 10 15 

CAC CAG GAT GGC CGC CAG AAT CAG AGT TCT CTT TCC CCC GTA CTC CTG 510 
His Gin Asp Gly Arg Gin Asn Gin Ser Ser Leu Ser Pro Val Leu Leu 
20 25 30 35 

CCA AGG AAT CAA AGA GAG CTT CCC ACA GGC AAC CAT GAG GAA GCT GAG 558 
Pro Arg Asn Gin Arg Glu Leu Pro Thr Gly Asn His Glu Glu Ala Glu 
40 45 50 

GAG AAG CCA GAT CTG TTT GTC GCA GTG CCA CAC CTT GTA GCC ACC AGC 606 
Glu Lys Pro Asp Leu Phe Val Ala Val Pro His Leu Val Ala Thr Ser 
55 60 65 

CCT GCA GGG GAA GGC CAG AGG CAG AGA GAG AAG ATG CTG TCC AGA TTT 654 
Pro Ala Gly Glu Gly Gin Arg Gin Arg Glu Lys Met Leu Ser Arg Phe 
70 75 80 

GGC AGG TTC TGG AAG AAG CCT GAG AGA GAA ATG CAT CCA TCC AGG GAC 702 
Gly Arg Phe Trp Lys Lys Pro Glu Arg Glu Met His Pro Ser Arg Asp 



wo 98/34951 PCT/AU98/00078 

-79- 

85 90 95 

TCA GAT AGT GAG CCC TTC CCA CCT GGG ACC CAG TCC CTC ATC CAG CCG 750 
Ser Asp Ser Glu Pro Phe Pro Pro Gly Thr Gin Sex Leu lie Gin Pro 
- 100 105 110 115 

ATA GAT GGA ATG AAA ATG GAG AAA TCT CCT CTT CGG GAA GAA GCC AAG 798 
lie Asp Gly Met Lys Met Glu Lys Ser Pro Leu Arg Glu Glu Ala Lys 
120 125 130 

AAA TTC TGG CAC CAC TTC ATG TTC AGA AAA ACT CCG GCT TCT CAG GGG 846 
Lys Phe Trp His His Phe Met Phe Arg Lys Thr Pro Ala Ser Gin Gly 
135 140 145 

GTC ATC TTG CCC ATC AAA AGC CAT GAA GTA CAT TGG GAG ACC TGC AGG 894 
Val lie Leu Pro lie Lys Ser His Glu Val His Trp Glu Thr Cys Arg 
150 155 160 

AC A GTG CCC TTC AGC CAG GTATGTGTTC TGGGGGGAGA <5CAGGTAAGA 942 
Thr Val Pro Phe Ser Gin 
165 

GTTTGCAGGT GGTAGTGGAC AGCTGGGATG GATGGAGAGT AGGGGAAAAG GCTGTCAGGA 1002 

GCCTGACTCT AGCTTAACTA CAGATTTGGT CCTTGGGCAT TCATCATAtSG ATTTGGCAAA 1062 

GATTAAGTTT CCTTCTGGCC TTTACCATTT TTTCTTGGCA TTGTGGAAAT GCTGCAAGAA 1122 

TGATATGATG ATACTGTCAA TATCAGTAAT CATTCATTCA CACTGAAGAC ACAGAGCTCT 1182 

GTTTTATTTA TTTATTTTTG CATTGGAGGT GATCTACTCA GAGATATAAG TCAGACTGTA 1242 

CCCTCAGTTA GGAAACTGAG AATPTAGAGT AATCACCAGA ACTCCTCT<5T AGCTATCTTT 1302 

CTGCACTCTA TTAATATGTG GATGAGCAGG TCAACTCCAT TTGTTGATAA AGTGGGGTGC 1362 

ATTGGACTCC TTCCCAAATA CTCTCATATC CATTTACGAT GGTCTTAATC CCCATAGTCC 1422 

ATACTTAATT ACTTTATAGG TTTATGAGGG ACTTCTTTAA TAGCTTGCTA AAGCTATCCC 1482 

ACAACCTCAA AGTACGTTGA GGTTCTCAGG CAAAAGTTGT CATATCATTT CTAGTATTAT 1542 

GATAGCAAAA AAGTGATTTT CTTTCACTTA TTTTCTCATA TGAGCTTTTT AAAAAATCAA 1602 

TCTTGATGTG AGATCATATC TCCTCCCCTT A<3AAGTACCT TTCTCCTGAT TCATGTTGTG 1662 



wo 98/34951 



PCT/AU98/00078 



-80- 

TTGGCTGATT TGTAGTTATT ATGATCAATT CCATGCTATT AAGACAAAGG GACATCCTAC 1722 

TGTCTACTTC CTCTGGCAAT ATCTACATTC CAAATGTTAA ATTAAAATTG AGAACTTGCA 1782 

TTAGGTCCTT AAACATGAAG ATATTGAACC AAAAACATGC AGGGTAGAGT AAAATTTTAT 1842 

AGTCGAGTAA TGCTACCCAA TTAAGCAAGC AATAGAATAG GGCAATTGAC TGTTCAAGGC 1902 

AGTTAAGTAT TCTGCCTGAA AAGGCAAGGA TATGTAGCAA TGGCAAGTCA ATTATCAAAT 1962 

AATAATGACT ACTCTGTTGG CCATGTGCAA TTAGAAAATT ACCCCTAAGA ATCAGGCAAT 2022 

CAAATTTCTT TTGAAATTCT TCTTTTGAAT TCTATTGCTA ATTAAATTAA AACTAAGATG 2082 

TTTGACTCTT ACATATTTTG AAAGGCATAT AAAGCTAGGT GCTTGGAGTT ATGAGAGGTA 2142 

AAGGTGATGT AATATACAAT GATTTGCAGG CATATGCATT GTAACTCTGC TTGCATACAA 2202 

CTTCATAGAC TTGAATGTAC TACAGGTCTT GCAKSAATAGG ATAGAATTAA ACCTAGAATG 2262 

TTCTGATCTA TTCTACGATC AATGTAACAA ATATGTATTG GGAGCCTACT ATGCACAAAG 2322 

CCCTGTGAGG AATAAAAAAG TAAGGCACAT TACTTATGTA AGATAATTAC CATTAGAATT 23 82 

TTTCAATCGC TCACATCCAA TTAGACAAAA TTGCTTAAGG TTTTGCACGA ATAATGTAGA 2442 

GTAAAATATT TTTTATGTTA ACTTAGGGAT TCCCTAAAGG CTGTTTAATA ATTTACTCAA 2502 

TAAAGAAAAT TTAATTGAGG TGGTTCTGTG CCCTTATAGA TACCATCACT TGCATATTGC 2562 

AAATTGTATC CAAAATTGGA AAGCTTTGAA ATTTTTAAAT TATCCTCACA TTTACAGTCC 2622 

ATAGCTTCTG CATTATGTGT GITAAAGAAA TAATTCAAAA TAACGTAATG GAAATGTGTT 2682 

TGCTTTTTAG ACT ATA ACC CAC GAA <3GC TGT GAA AAA GTA <3TT GTT CAG 2731 
Thr lie Thr His Glu <51y Cys Glu Lys Val Val Val Gin 
,1 5 10 

AAC AAC CTT TGC TTT GGG AAA TGC GGG TCT GTT CAT TTT CCT GGA <3CC 2779 
Asn Asn Leu Cys Phe Gly Lys Cys <51y Ser Val His Phe Pro Gly Ala 
15 20 25 

GCG CAG CAC TCC CAT ACC TCC TGC TCT CAC TGT TTG CCT OCC AAG TTC 2827 
Ala Gin His Ser His Thr Ser Cys Ser His Cys Leu Pro Ala Lys Phe 
30 35 40 45 



wo 98/34951 



PCT/AU98/00078 



-81- 

ACC ACG ATG CAC TTG CCA CTG AAC TGC ACT GAA CTT TCC TCC GTG ATC 2875 
Thr Thr Met His Leu Pro Leu Asn Cys Thr Glu Leu Ser Ser Val lie 
50 55 60 

- AAG GTG GTG ATG CTG GTG GAG GAG TGC CAG TGC AAG GTG AAG ACG GAG 2923 
Lys Val Val Met Leu Val Glu Glu Cys Gin Cys Lys Val Lys Thr Glu 
65 70 75 

CAT GAA GAT GGA CAC ATC CTA CAT GCT GGC TCC CAG GAT TCC TTT ATC 2971 
His Glu Asp Gly His lie Leu His Ala Gly Ser Gin Asp Ser Phe lie 
80 85 90 

CCA GGA GTT TCA GCT TGAAGAGCTA TCCCACTATT ACCTTTGAAA AGCAAAACCA 3 026 
Pro Gly Val Ser Ala 
95 

CAACAGCAAA GATGCTGATT ATTCAGTCTG AAAATGTTAA GTGGGTACAT AACATTTTCA 3086 

GGGAAAGGTG ACTTGAAACG TAGTTTTAAA TTAGAACGAT AGAGGAAATG ATATTAGTCT 3146 

AGTT 3150 

(2) INFORMATION FOR SEQ ID NO: 19: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 169 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 19: 

Met His Leu Leu Leu Phe Gin Leu Leu Val Leu Leu Pro Leu <31y Lys 
1 5 10 15 

Thr Thr Arg His Gin Asp Gly Arg Gin Asn Gin Ser Ser Leu Ser Pro 
20 25 30 

Val Leu Leu Pro Arg Asn <51n Arg Glu Leu Pro Thr Gly Asn His Glu 
35 40 45 

Glu Ala Glu <31u Lys Pro Asp Leu Phe Val Ala Val Pro His Leu Val 
50 55 60 



wo 98/34951 



PCT/AU98/00078 



-82- 



Ala Thr Ser Pro Ala Gly Glu Gly 
€5 70 

Ser Arg Phe Gly Arg Phe Trp Lys 
85 

Ser Arg Asp Ser Asp Ser Glu Pro 
100 

lie Gin Pro lie Asp Gly Met Lys 

115 120 

Glu Ala Lys Lys Phe Trp His His 
130 135 

Ser Gin Gly Val He Leu Pro He 
145 150 

Thr Cys Arg Thr Val Pro Phe Ser 
165 



Gin Arg Gin Arg Glu Lys Met Leu 
75 80 

Lys Pro Glu Arg Glu Met His Pro 
90 95 

Phe Pro Pro Gly Thr Gin Ser Leu 
105 110 

Met Glu Lys Ser Pro Leu Arg Glu 
125 

Phe Met Phe Arg Lys Thr Pro Ala 
140 

Lys Ser His Glu Val His Trp Glu 
155 160 

Gin 



(2) INFORMATION FOR SEQ ID NO: 20: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 98 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 20: 

Thr He Thr His Glu Gly Cys Glu Lys Val Val Val Gin Asn Asn Leu 
15 10 15 

Cys Phe Gly Lys Cys Gly Ser Val His Phe Pro Gly Ala Ala Gin His 
20 25 30 

Ser His Thr Ser Cys Ser His Cys Leu Pro Ala Lys Phe Thr Thr Met 
35 40 45 



His Leu Pro Leu Asn Cys Thr Glu Leu Ser Ser Val He Lys Val Val 
50 55 60 



wo 98/34951 PCT/AU98/00078 



83- 



Met Leu Val Glu Glu Cys Gin Cys Lys Val Lys Thr Glu His Glu Asp 
65 70 75 80 

Gly His lie Leu His Ala Gly Ser Gin Asp Ser Phe lie Pro Gly Val 
85 90 95 

Ser Ala 

(2) INFORMATION FOR SEQ ID NO: 21: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 508 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA 



(ix) FEATURE: 

(A) NAME/KEY: CDS 

(B) LOCATION: 66.. 434 



(xi) SEQUENCE DESCRIPTION: SEQ ID N0:21: 

CTGCAGAGAA TGAGCCTCTC CTTTGGGCCT CATCATTTAC AAAAGAAGCT TGGGCCCCTG 60 

ACAGC ATG CAT C7C CTC TTA TTT CAG CTG CTG GT.\ CTC CTG CCT CTA 107 
Met His Leu Leu Leu Phe Gin Leu Leu Val Leu Leu Pro Leu 
1 5 10 

GGA AAG ACC ACA CGG CAC CAG GAT GGC CGC CAG ACT ATA ACC CAC GAA 155 
Gly Lys Thr Thr Arg His Gin Asp Gly Arg Gin Thr lie Thr His Glu 
15 , 20 25 30 

GGC TGT GAA AAA GTA GTT GTT CAG AAC AAC CTT T<3C TTT GGG AAA TGC 203 
Gly Cys Glu Lys Val Val Val Gin Asn Asn Leu Cys Phe Gly Lys Cys 
35 40 45 

GGG TCT GTT CAT TTT CCT GGA GCC GCG CAG CAC TCC CAT ACC TCC T<3C 251 
Gly Ser Val His Phe Pro Gly Ala Ala Gin His Ser His Thr Ser Cys 
50 55 60 

TCT CAC TGT TTG CCT GCC AAG TTC ACC ACG ATG CAC TTG CCA CTG AAC 299 



wo 98/34951 



PCT/AU98/00078 



-84- 



Ser His Cys Leu Pro Ala Lys Phe Thr Thr Met His Leu Pro Leu Asn 
65 70 75 

TGC ACT GAA CTT TCC TCC GTG ATC AAG GTG GTG ATG CTG GTG GAG GAG 347 
Cys Thr Glu Leu Ser Ser Val lie Lys Val Val Met Leu Val Glu Glu 
80 85 90 

TGC CAG TGC AAG GTG AAGACG GAG CAT GAA GAT GGA CAC ATC CTA CAT 395 
Cys Gin Cys Lys Val Lys Thr Glu His Glu Asp Gly His lie Leu His 
95 100 105 110 

GCT GGC TCC CAG GAT TCC TTT ATC CCA GGA GTT TCA GCT TGAAGAGCTA 444 
Ala Gly Ser Gin Asp Ser Phe lie Pro Gly Val Ser Ala 
115 120 

TCCCACTATT ACCTTTGAAA AGCAAAACCA CAACAGCAAA GATGCTGATT ATTCAGTCTG 504 

AAAA 508 



(2) INFORMATION FOR SEQ ID NO: 22: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 123 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 22: 

Met His Leu Leu Leu Phe Gin Leu Leu Val Leu Leu Pro Leu Gly Lys 
15 10 15 

Thr Thr Arg His Gin Asp Gly Arg Gin Thr lie Thr His <51u Gly Cys 
20 25 30 

Glu Lys Val Val Val Gin Asn Asn Leu Cys Phe Gly Lys Cys Gly Ser 
35 40 45 

Val His Phe Pro Gly Ala Ala Gin His Ser His Thr Ser Cys Ser His 
50 55 60 



Cys Leu Pro Ala Lys Phe Thr thr Met His Leu Pro Leu Asn Cys Thr 
65 ' 70 75 80 



wo 98/34951 



PCT/AU98/00078 



-85- 

Glu Leu Ser Ser Val He Lys Val Val Met Leu Val Glu Glu Cys Gin 
85 90 95 

Cys Lys Val Lys Thr Glu His Glu Asp Gly His He Leu His Ala Gly 
100 105 110 

Ser Gin Asp Ser Phe He Pro Gly Val Ser Ala 
115 120 



(2) INFORMATION FOR SEQ ID NO:23: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 25 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 23: 



Asp Leu His Val Ala Asn His Glu Glu Ala Glu Asp Lys Pro Asp Leu Phe Val Ala 

5 10 15 

Met Pro His Leu Met Gly 
20 25 



{2) INFORMATION FOR SEQ ID NO: 24: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 30 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 24: 

Ala Pro Pro Pro He Asn Lys Leu Ala Leu Phe Pro Asp Lys Ser Ala Trp Cys Glu 

5 10 15 

Ala Lys Asn He Thr Gin He Val Gly His Ser 
20 25 30 



wo 98/34951 



PCT/AU98/00078 



-86- 

CLAIMS: 

1. An isolated polypeptide of mammalian origin comprising a signal sequence and a 
domain conforming to the criteria for a cystine knot and optionally a long N-terminal domain 
between said signal sequence and cystine knot domain or a derivative of said polypeptide. 

2. An isolated polypeptide according to claim 1 comprising the amino acid sequence: 
C(AA}Q{AA}H{AA}C{AA}[X*]„QN{AA}C{AA)G{AA}C{AA}S{AA}P 

wherein 

{ AA} is an amino acid sequence comprising from about 0 to about 50 amino acid residues; 

X* is V or I; and 

nisOorl, 

3. An isolated polypeptide according to claim 2 wherein said polypeptide exhibits the 
following characteristics: 

(i) being glycosylated in its naturally occurring form; 

(ii) being secretable in its naturally occurring form; 

(iii) comprising a signal sequence and a domain conforming to the criteria for a cystine 
knot, 

said cystine knot domain comprising the sequence: 

CxTxPFxQxIxHExCxxxVxQNNLCFGKCxSxxxPx„,CSHCxP [SEQ ID NO:l] 

wherein x is any amino acid residue and n, is from about 6 to about 10 -or comprises a 
sequence in the cystine knot domain having at lea^t 50% identity to SEQ ID N0:1 excluding 
the cystine and x residues. 

4. An isolated polypeptide according to claim 3 wherein the cystine knot domain 



wo 98/34951 



PCT/AU98/00078 



- 87 - 

comprises the amino acid sequence: 

CRTVPFNQTIAHEDCQKVVVQNNLCFGKC [SEQ E) N0:2] 
or a sequence having at least 45% similarity to SEQ ID N0:2. 

5. An isolated polypeptide according to any one of claims 1 to 4 comprising an amino 
acid sequence having at least 20% similarity to cerberus protein from Xenopus laevis as 
defined in Figure 1. 

6. An isolated polypeptide according to any one of claims 1 to 4 comprising a sequence 
of amino acids substantially as set forth in SEQ ID N0:4 or having at least 50% similarity 
thereto and which polypeptide has the identifying characteristics of a CRP cytokine. 

7. An isolated polypeptide according to any one of claims 1 to 4 comprising a sequence 
of amino acids substantially as set forth in SEQ ID N0:5 or having at least 50% similarity 
thereto and which polypeptide has the identifying characteristics of a CRP cytokine. 

8. An isolated polypeptide according to any one of claims 1 to 4 comprising a sequence 
of amino acids substantially as set forth in SEQ ID N0:6 or having at least 50% similarity 
thereto and which polypeptide has the identifying characteristics of a CRP cytokine. 

9. An isolated polypeptide according to any one of claims 1 to 4 comprising a sequence 
of amino acids substantially as set forth in SEQ ID N0:7 or having at least 50% similarity 
thereto and which polypeptide has the identifying characteristics of a CRP cytokine. 

10. An isolated polypeptide according to any one of claims 1 to 4 comprising a sequence 
of amino acids substantially as set forth in SEQ ID NO: 19 and/or 20 or having at least 30% 
similarity thereto and which polypeptide has the identifying characteristics of a CRP cytokine. 

11. An isolated polypeptide according to any one of claims 1 to 4 comprising a sequence 



wo 98/34951 



PCT/AU98/00078 



-88- 

of amino acids substantially as set forth in SEQ ID NO:22 or having at least 50% similarity 
thereto and which polypeptide has the identifying characteristics of a CRP cytokine. 

12. An isolated nucleic acid molecule having a nucleotide sequence encoding a signal 
sequence and a domain conforming to the criteria for a cystine knot and optionally a long N- 
tenninal domain between said signal sequence and cystine knot domain or a derivative of said 
polypeptide. 

13. An isolated nucleotide acid molecule according to claim 12 encoding the amino acid 
sequence: 

C{AA}Q{AA}H{AA}C{AA}[X']„QN{AA)C{AA)G{AA}C{AA}S{AA}P 

wherein 

{ AA} is an amino acid sequence comprising from about 0 to about 50 amino acid residues; 
X* is V or I; and 
nisOor 1. 

14. An isolated nucleic acid molecule according to claim 13 encoding a polypeptide 
exhibiting the following characteristics: 

(i) being glycosylated in its naturally occurring form; 

(ii) being secretable in its naturally occurring form; 

(iii) comprising a signal sequence and a domain conforming to the criteria for a cystine knot, 
said cystine knot domain comprising the sequence: 

CxTxPFxQxIxHExCxxxVxQNNLCFGKCxSxxxPx^jCSHCxP {SEQ ID NO: 1] 

wherein x is any amino acid residue and ni is from about 6 to about 10 or comprises a sequence 
in the cystine knot domain having at least 50% identity to SEQ ID NO: 1 excluding the cystine 
and X residues. 



wo 98/34951 



PCT/AU98/00078 



-89- 

15. An isolated nucleic acid molecule according to claim 14 encoding a polypeptide 
comprising a cystine knot domain comprises the amino acid sequence: 

CRTVPFNQTIAHEDCQKVVVQNNLCFGKC [SEQ ID N0:2] 

or a sequence having at least 65% similarity to SEQ ID NO:2. 

16. An isolated nucleic acid molecule according to any one of claims 12 to 15 encoding a 
polypeptide with an amino acid sequence having at least 20% homology to cerberus protein 
from Xenopus laevis as defined in Figure 1 . 

17. An isolated nucleic acid molecule according to any one of claims 12 to 15 encoding a 
polypeptide with a sequence of amino acids substantially as set forth in SEQ ID NO:4 or having 
at least 50% similarity thereto and which polypeptide has the identifying characteristics of a 
CRP cytokine. 

18. An isolated nucleic acid molecule according to any one of claims 12 to 15 -encoding a 
polypeptide with a sequence of amino acids substantially as set forth in SEQ ID NO: 5 or having 
at least 50% similarity thereto and which polypeptide has the identifying characteristics of a 
CRP cytokine. 

19. An isolated nucleic acid molecule according to any one of claims 12 to 15 encoding a 
polypeptide with a sequence of amino acids substantially as set forth in SEQ ID NO:6 or having 
at least 50% similarity thereto and which polypeptide has the identifying characteristics of a 
CRP cytokine. 

20. An isolated nucleic acid molecule according to any one of claims 12 to 15 encoding a 
polypeptide with sequence of amino acids substantially as set forth in SEQ ID N0:7 or having 
at least 50% similarity thereto and which polypeptide has the identifying characteristics of a 
CRP cytokine. 



wo 98/34951 



PCT/AU98/00078 



-90- 

21 . An isolated nucleic acid molecule according to any one of claims 12 to 15 encoding a 
polypeptide with a sequence of amino acids substantially as set forth in SEQ ID NO: 19 and/or 
20 or having at least 50% similarity thereto and which polypeptide has the identifying 
characteristics of a CRP cytokine. 

22. An isolated nucleic acid according to any one of claims 12 to 15 encoding a polypeptide 
with a sequence of amino acids substantially as set forth in SEQ ID NO:22 or having at least 
50% similarity thereto and which polypeptide has the identifying characteristics of a CRP 
cytokine. 

23. A method for modulating expression of a CRP cytokine in a mammal, said method 
comprising contacting a gene encoding said CRP cytokine with an effective amount of a 
modulator of CRP cytokine expression for a time and under conditions sufficient to up- 
regulate or down-regulate or otherwise modulate expression of the CRP cytokine. 

24. A method for modulating activity of the CRP cytokine in a manunalian, said method 
comprising administering to said mammal a modulating effective amount of a molecule for 
a time and under conditions sufficient to increase or decrease CRP cytokine activity. The 
molecule may be a proteinaceous molecule or a chemical entity and may also be a derivative 
of a CRP cytokine or its ligand or a chemical analogue or truncation mutant of a CRP cytokine 
or its ligand. 

25. A composition comprising one or more CRP cytokines or derivatives thereof or a 
modulator of CRP cytokine expression or CRP cytokine activity and one or more 
pharmaceutically acceptable carriers and/or diluents. 

26. A method for detecting CRP in a biological sample from a subject said method 
comprising contacting said biological sample with an antibody specific for a CRP or group of 
CRPs or their derivatives or homologues for a time and under conditions sufficient for an 
antibody-CRP complex to form,. and then detecting said complex. 



wo 98/34951 



PCT/AU98/00078 



-91- 

27. Use of a CRP cytokine or its functional derivatives in the manufacture of a medicament 
for the treatment of defective or deficient CRP mediated activities. 



wo 98/34951 PCT/AU98/0Q078 

1/A8 



FIG 1A 



FIG 1A(i) 



FIG 1A(ii) 



SUBSTITUTE SHEET (Rule 26) 



PCT/AU98/00a78 



2/AB 



o 

CO 



o 

CO 



CO 
CD 
O 

CO 

O 

O 
CD 
O 
> 

o 

—I 
o 
< 

CD 



UJ 

cc 

CD 
LU 
CO 
X 

^ 

CD 
< 
CD 
Q 

> 



CO 


CM 

in 


o 

CO 


Q 


Q 


£^ 


LU 


lU 


— 1 


< 


< 


CD 


LU 


LU 


)^ 


LU 


LU 


H- 


X 


X 


2 




z 


> 


< 


< 




> 


> 




X 


X 




— 1 


-J 




Q 


Q 


1 CO 


(X 


CC 


X 


1 


X 


X 



< 
o 

X 



Q- O 


t 


LU 


-1 > 


t 






■ 


X 


> - 




IL 




■ 


> 




CD 


CD 


ox . 1 


X 


X 


> -J 


LU 


CO 


-J > 


-J 


2 


-1 2 


-J _J 


-J -i^^H 


CL 


CO 


X -J 


Li. 


> 




CO 





01 


a. 


CO 








o 


CD 


X 


X 





00 in 
<j> o ^ 

iD ^ ^ 



CD CDI 

CO CO I 
CO CO 

> > 

X X 
D D 

CO to 

LU LU 

> > 
Q D 
XXX 
X CL 
X X 

> 
LJ_ LL 
LU LU 



CO 



CO in O) 
cn CO ^ CM 

CJ> T- -r- 



LL li_ LL 
X X 
X X 

LL LL LL 

X x| 

^ 

< < < 

LU LU 
LU LU 
O O 



LU 



UJ 



00 in 
CO 



CO 



CO 



1^ 



m 

CO 

o. 
I 

CO 




CM 

^ to 

< O 0) 

< £ O 



CVi 

CM w <D 

< O 55 

< E O 



CM 



(A 
3 



CM w <D 

Q) ^ 

< o s 

< e o 



CM 

CM *1 2 

< o i 

< € O 



CM 

Ji! CO 

5 - S 

CM © 

< o ^ 

< E O 



CM 

^ to 

< o i 

< € O 



AMENDED SHEET (ARTICLE 19) 



PCT/AU98/00078 

3/48 



0> 00 

in cn 



lO 

o 

CVJ 



C\J 00 Tj- 
CD CVJ CO 
t- CM C\J 



CM 00 00 

<D to in 

T- CM CVJ 



CVJ CO -r- 
CD N. 
-t- CM CM 



. 5 H 



. > 2 



, CO -J 




O H 



. o 



. 5 > 



. a. X 

. Z X 

. h- -J 

. )^ H 

. CO H 

. < CO 










> 


> 


, CO O 


> 


> 





CM 
CM 



CM w g 

< o 5> 

< £ O 



o - 2 

CM »1 0) 

< 0 

< £ O 



CM 

CM il- $ 

< O 5 

< EG 



CM 
CM 

O 

CM 



CO 
3 



< o 5 

< £ o 



SUBSinvre sheet <Ruk 26) 



wo 98/34951 



PCT/AU98/00078 



4/48 



m 



0) 
3 

il 



00 in 
o 1-* ^ 

1-t rH fSS 




GO 


in 




in 




r-t 


> 




o 


s 


o 












o 








s 


a: 






> 










o: 




X 




3: 
u. 




OS 




:^ 




< 




pa 


O 


us 


CU 


o 






w 


a 




w 


> 


a: 








> 








OS 




o 


O 


Q 




< 


CO 




d: 


a 








> 


iu 


< 




o 






OS 


fH 




1 





in iH o 



in o 
in in ^ 

(N 03 1-H 



m rH 

CN oa th 




u u u 




u u u 



W .J S 






1 1 




t a. 








> > 


> 


1 < 














> > 


Q 






> 


1 a 



> 


>l 


0^ 




> 


> 










03 


CO 






-£l1 


O 


Ou 


w 




< 




SUBSTITUTE SH^ (Rule 26) 



wo 98/34951 



PCT/AU98y00078 



5/48 



o in o -r- 
co in O) GO 



O 
Q) 



Q- CO 



N O 


CVJ 


o 




CO 




H -J 




CO 


< 




o 






LU 


-1 > 




CD 


cr aim 




o 






> 


O > 






. LU 




> 


t LU 






. X 




-J 


o o 




CD 


CO Ol 




LU 


o om 




X 


CL UJ 




CO 


BB 




Q. 






LU 


-1 > 


CO 




< 


CO O 


^ UJ 


o 


o 




LU 


< 




LU O 


CO coH 


o 


O 


H O 


X 


CO 


Q < 


o 


o 


BIB 


CO 


X 


a: S 


— 1 


> 



CVJ o 
CO N. 



CVJ o> 



O CO 
X O 



Q.Z CLZ <l2 Cl2 
Q< Q< Q< Q< 
ZQ ZO ZQ ZQ 



GC LU 
> > 



o 

< 
CD 
CL 
CL 
LU 
LU 
CL 
LU 
CL 

o 

CD 
CD 
Q. 
X 
Q- 
X 
< 
X 
CO 
X 
Q. 
<D 
Q. 

o 

CO 
CD 
CL 



O 
LU 
< 

CD 
LU 
LU 
LU 
> 



CL Z CL Z CL Z 

Q < a < Q < 

Z Q Z Q Z Q 



SUBSTITUTE SHEET (RULE 26) 



PCT/AU98/00078 



6/48 



oco 
zr CM 



CD CM 



7Z 
O 

cr 
o 

q: 
a 

CD 



< 



CO 



X 
Q- 

< 
> 

-J 
Q 

Q 
LxJ 
< 
UJ 
UJ 
X 

2: 

X 



o 

C\J CD 
^ CM 



a 
o 
< 

O 
I— 
> 
< 

o 

C/D 
CO 

> 
X 

o 

CO 
UJ 

> 

Q 

cr 

Ql 
Q. 
>- 
U. 
UJ 



0- 

q: 

CD 

— I 
cr 

CO 



o 

CDCVJ 
— CO 

UJ < 

:5 CO 

X ^ 
> Q 
UJ CL 
X U- 
CO -J 



CJ 

o 

U- 

< 

CL 
CD 



cr 

X 
U- 

cr 

< 
ui 

Ul 

o 

CL 
CO 



GO 

C35CM 

— 



cu : 



q: CO 
— >- 



"CO u_ 



sr CM — CM 

CO in 

CM^ CM 



CO a> 

CM — 



:c UJ 



2: 1- 

CL Z 
> ^ 
h- < 

UJ 



2 X 
I- < 
X 



5^ ^^Ma~) CO 



1 o 

> Q_ 



Q. UJ 
t— UJ 
0- X 
CO Q 
Q. 




CO > 
X _J 

< CO 

•Q UJ 

< ^- 

C3 CO 

UJ a 



< X 



—I o 

CD a. 

O 

— CO 
U- CJ 
CO CL 
CD CO 

a o 

CO UJ 



<. a 
—I > 

I 7 



on o 



UJ X 
C3 CO 



> < 
n a 



a CO 



UJ X 
UJ > 



a ^ 



< 

UJ 
UJ 
UJ 

> 
o 

CL 
< 
CD 

a. 

CL 
UJ 
UJ 
CL 
UJ 

a. 

•o 
o 
o 

CL 



I I 
L L 

0) Z (1) 2 

O < CJ < 

e o e o 



CJ < 

G Q 



u 

o < 

e o 



L 

o < 



I I 
L U 

O < C-) < 



SUBSTITUTE SHE€T (RULE 26) 



PCT/AU98/a0078 



7/48 



=r =r 



— oo 

00 CO CO 



^ O O — 00 00 
CMCMOO CDLOin 



C\JO) 

CO 



h- t— H- 




o o o 




--^ 


O <_) o 


Z Z 2 


1 I I 


CO CO CO 


^ ^ ^ 


CO CO CO 




<. ^ <. 


LlJ LlI UJ 


-1 — 1 — r 

^ ^ 


UJ LlJ LU 


h— 




O CJ LJ 


CO CO CO 




^ 3 3 


o a a 


>^ ^ M 


< < < 


O. 0. 0- 


LU LU LlI 


CO to CO 


U- Li- U_ 


> > > 


:^ i<i 


1 — (— H- 


— 1 — 1 «J 


Q O O 


2 2 2 


ixl ^ 


Q, a. CL 


Q_ Q- Q. 


o o o 


Li_ U- U_ 


>• > > 


> > >■ 


_J -J —I 


CO CO CO 


q: or 


< < < 


>- >- 5- 


CL 0- 0- 


-J -J _) 


CO CO CO 


> > > 


ii^: 


U- Li- Li_ 


LU LU UJ 


2 2 2 


O CJ CJ 


LU LU LJ 




a o o 


XXX 


CL Q- Q. 


O C3 CJ 






_) -J -J 


Q_ Q- 0. 


Q- Q- 0. 


O CJ o 


LJ ej o 


< < < 


<t < <t 


LU LU LU 


< < < 


or 


-J -t -J 


_l _J -J 


2 2 2 


i— h- »— 


_( -J -J 


a a o 


> > > 



i:: s n 

a>> 

0- 0- CL 
U -J ^ 

> > > 

< <Q 

CD CD 

> > > 
J -J -J 

> > > 

-J .J -J 
s: z: i: 

' C 0) 
O U) 

3 O O 

X 



CO CO CO 

:^ ^ ^ 
< < <t 

LU LU LU 
O CJ O 
O O O 
CO CO CO 
XXX 
O C3 CD 
^ -> > 

o a o 
c 0) 

e D 
D o o 
X 31 or 




cr 



LU LU LU 

3 5 3 
c ± 

CO CO CO 

oo o 
< < < 

Q. Q_ 0- 
21 C 21 
O O CJ 
CO COCO 
QOO 
CJ CJ CJ 

C Q? 

o to 

D O O 

X 2: a: 



O Q Q 



SUBSTITUTE SHEET {RULE 26) 



wo 93/34951 



PCT/AU98/00078 



8/48 



o q\ 



in 00 



0) 
3 

il 




03 


00 
(N 
CM 


00 
^ VD 
CM 




CU 


CO 






to < 


CO 




CU 


o 


CO 


I J 






Q O 


u 


U 


■ 2 0- 






e M 










:s 


O CO 


.J 




1 < o 


n: 


X 


1 : a 




> 


I CO 


.J 


Eh 




















1 ' ^ 




£- 


1 .J 


a. 


a 


1 ^ a: 




CO 


o w 


u 


u 


1 X w 


n: 


X 




cn 




1 z: 


u 


u 


1 CO W 






z: 


CO :r: 


cc 


X 


: < > 


cr; 


< 


: to 2 


a 


c 


u u 



CN CM 




SUBSTITUTE SHEET (RULE 26) 



wo 98/34951 



PCT/AU98/0007S 



CM 
O 
3 

il 



Q 




o 




O 




o 








€NJ 




< 




O 




< 




< 


Ui 










C9 


u 


(3 




C9 




< 


Ui 


C9 








fr- 


-J 


O 




O 




< 


X 






o 






a 


o 




O 




< 




o 




< 






_i 










o 


< 






C9 




I- 


-J 


C9 








H- 


> 


1- 




C9 




»— 


> 


O 




o 




< 


X 


1- 




(-) 




1- 




LJ 




o 




h- 


-J 


o 










-1 






o 




< 


o 










< 


o 


< 










oc 






< 




>- 


> 














< 









8 

CO 



< X 

< 

o 

< 

CD 
< 

< 
< 

C3 

I— 
U 
t- 

< 

>- 

o 



< 
< 



< 

u 
o 
»- 

CJ 
LJ 
U 
U 
C9 
CD 
< 



C5 CD 

< 
< 

< UJ 
< 

I- -J 
CJ 



cj to 



o to 

I— 

o 

o o 

o 

o 

< o 



CO 
o 



< 

< 

u 
o 

C3 CJ 

o 



o 

C3 OC 
< 

o 

O CO 



< 

o 

o 
< 

< 

< o 

CJ 

o 
< 

CD 

< o 

CJ 

C9 C3 

o 
< 

< UJ 
C9 

CD C5 

C9 

»— 

CJ < 

a 
o 

H- -I 

CJ 

CJ 

CD to 

< 

CJ 

CJ I- 

< 

CJ 

CD CD 

C3 

CD 



CJ 

^ I 

CJ 

< 

u a- 

CJ 

< 

CJ 

CJ < 

C3 

U 

> 

CD 



C3 



< 

> 

CD 
»- 

CD CJ 
< 

-J 

CJ 

CJ 

< o 

.CD 
< 

u < 

CD 

C5 



< O 

CJ 
C5 

< ^ 
< 

CJ 

< o 

CD 
< 

< UJ 

< 

o < 



o 
o 
a- 

t-> < 

< 
CJ 

< O 

o 
I- 

o »- 
< 

CD 

I- > 

y < 

C3 

C3 

< O 
O 

CD 

< 

CD C3 

CJ CO 

I- 

< 

CJ CO 



»- > 

I— 

< X 
CJ 

h- 

< O 
C3 

U 

ca CO 

< 

< 

< UJ 
CD 

C2 

H- > 

< o 

C5 
C5 

< 
< 

u 

CJ 

u a 

CJ 
CJ 

< >- 



< 

< UJ 

o 

CJ 

< 

< UJ 

»- 

u a 

u 

< 

< ^ 
< 

CD 

< 
CD 

CD 3 



< 

< 
< 

O CD 
O 



§ 




o 

Q 












f > 






















o 
























> 










W 








CD 








CD 




f il 








CJ 




CJ 








CJ 








' 
















o 








CJ 








CD 








C5 




CJ 




CJ 




h~ 




CJ 




C9 


CJ 


CJ 








O 




CJ 




O 






u 


CD 








•< 








< 




< 


UI 






O 












< 




< 


X 


CJ 




CJ 




>— 


u. 


O 








o 




o 




CD 








»— 




< 




»— 




CJ 




< 




1— 


u. 


CJ 




H- 




CJ 


>- 


C5 




< 




CD 








CJ 




< 


o 






CJ 




< 


X 


CJ 




CJ 




< 


z 


CD 




< 




C3 


:» 


u 




»— 






u. 


CJ 




»— 




>— 




CJ 




»— 




u 


Q. 



CD 

CD cr 
< 

< 

CJ 

CJ < 
< 

< UJ 

ca 
cr 

< Ui 

o 

<^ ^ 

< o 

CJ 

< 



CJ o. 

CJ 

< 

CJ cn 
< 

C3 Oe: 
< 

< U 

o 

C5 

»- > 

C3 

< 

< ^ 

< 
CD 

CD o: 

< 

o 

CD O 
CD 



< 
< 



CJ 
CD 

»- 

< 
o 

CD Q£ 

< 

CJ 

ca CJ 
I- 

CJ 

CJ t- 

< 

ca 

< UI 

ca ^ 
I- 

CJ 
< 

»- > 
< 

< UJ 
CJ 

< X 

u 

CJ 

CD to 

< 

< 

< ^ 
< 

u 

< 
U 

u 

CD 



o 




o 




o 






o 




6 




o 










00 




5 




^> 






CJ 




< 




CD 






< 


UI 


< 




CD 


(J 








CJ 




< 


(J 




< 




1— 




< 






C9 


CD 


CJ 




< 






C5 




CJ 




< 




Up 


H* 




< 




< 








Q£ 


< 




< 










< 




< 










< 




< 








UI 






<- 


w 








CD 




< 






o 




< 




< 






(J 




< 




< 














< 










CD 




< 










< 




< 


CD 














CJ 


CO 










< 


h~ 






>. 






< 


CJ 














C9 


CJ 










< . 
















CJ 








CJ 






^ 




CJ 










CJ 




CD 


CJ 








CJ 














CJ 




W 
























CJ 




CJ 




w 






CD 


CJ 


^ 














CD 










CJ 




►~ 




CJ 








U. 


CD 




CJ 










^ 


UJ 








CJ 




CD 










CD 


CO 


















UJ 








CJ 




CD 




CJ 






< 


X 










CD 


CJ 












CD 


CJ 




c? 










CJ 












CD 








o 


< 


CO 


< 










CJ 


tj 




o 


CD 










CD 












< 










(J 


< 


CD 


CJ 




CD 




CD 




< 


ca 






> 


< 




< 






O 




u 


Q. 


< 


C9 


C3 


CD 






















< 


















UJ 










< 






< 




< 


CD 












CD 




o 


CD 


o 




CD 




h- 


o 




*— 


> 






CD 






Cfl 




CJ 


0. 


< 


(_> 


0- 


CD 




o 




CD 


(J 




»— 


> 


CJ 










CD 








CD 




u. 


CJ 














CJ 




CJ 




< 






CJ 




*— 


u. 


»- 




DC 


CJ 




t- 




1- 


CJ 




O 




CJ 


CO 


CD 


1— 




< 




CJ 




»- 




< 




H- 




< 


< 




o 


CL 


f- 


<D 


< 


CJ 




CJ 




CD 


< 


CJ 


CO 


CJ 




CD 




CD 


fr- 




o 


CO 


CD 




CD 


»— 




< 




< 


O 


»- 




to 


CJ 




CJ 




CJ 


< 




CJ 




CJ 


CO 


»- 


CJ 




< 




u 


< 


ca 


CJ 


CJ 




»- 




< 






CD 


CJ 


»- 


CD 


o 


< 




f- 




CD 


f— 


< 


^ 


CJ 




CD 




»- 


< 




< 


z 


H- 




< 


u 








CJ 






CD 


C9 


CD 




CD 






C3 






—1 


CD 




CD 






CJ 








CD 


»- 


U. 


CD 




CJ 






h- 




»- 


z: 


< 




< 


CJ 




< 








CD 


O 


CJ 


CD 




u 




»— 


1— 




H- 


-J 


CJ 




CD 






»- 






-J 


CD 






CJ 




u 




< 






< 


X 


CJ 






CJ 




CJ 




CD 


QC 


< 


< 


z 


CD 




CJ 




< 


< 




H- 


> 


CD 




CD 


CJ 




CD 




< 


UI 


< 


< 


z 


CJ 




CD 




CJ 



SUBSTITUTE SHEET (RULE 26) 



wo 98/34<^l 



PCT/ATO8/00078 




SUBSTITUT€ SHEET (RULE 26) 



wo 98/34951 



PCT/AU98/00078 




SUBSTITUTE SHEET (RULE 26) 



wo ^734951 



PCT/AU98/00078 



12/48 



QQ3 Qell (LipQtectamine transfection) 
co^^^bie^ was harvested 




FIG 5 



SUBSTITUTE SHEET (RULE 26) 



wo 98/34951 



PCT/AU98/00078 




SUBSTITUTE SHEET (RULE 26) 



wo 98/34951 



PCT/AU98/00078 



14/48 

FIG 7 




SUBSTTTUIE SHEET (Rule 26) 



wo 98/34»51 



PCT/AU98/00078 




SUBSTITUTE SHEET (RULE 26) 



wo 98/34951 



16/48 



PCr/AU98/00078 



FIG. 9A 




SUBSTITUTE SHEET (RULE 26) 



\V0 98/34951 



PCT/AU98/00078 




SUBSTITUTE SHEET (RULE 26) 



wo 98/34951 



PCT/AU98/00078 



18/48 




SUBSTITUIS SH^ (Rule 26) 



wo 98/34951 



19/48 



PCT/AU98/00078 



X 
Q. 

$ 
Li- 

o 

Q. 

a 

Ml 

< 

UJ 
lU 
X 

z 

X 



D 
LI- 



SUBSTITUTE SHEET (RULE 26) 



wo 98/34951 



PCr/AU98/00078 



20/A8 



00 
O 




0 
> 

I 

LU 
O 



CO 



i 



o 
c 

"S 
o 

Q. 

S 

i— 

E 



i 111 1 i 

5 CO r- CO o P. 

O O) CO CO CN r- 



< 

o 



CD 
u. 



..-:0 














:^ 














Hi. 

O, 














i 






III 




■ 1 


O 

o 


PAGE- 














ii 

« CM O 

2 " 


1 

o 
in 


i 1 

fO o 


1 






1 SDS 















SUBSTITUTE SHEET^RUUE 26) 



wo 98/34951 



PCT/AU98/00078 



21/48 




SUBSTITUTE SHEET <flULE 26) 



wo 98/34951 



PCT/AU98/00078 



22/48 




5 10 15 20 25 30 



Retention time (fnin.) 

FIG 10D 



SUBSTTTUTC SHEET (Rule 26) 



PCT/AU98/00078 

WO 98/34951 



23/48 



0) 

"C 

c 

3 



.2 
'to 
> 

To 
c 

(0 
0) 

o 
c 

0) 
3 

a 
o 

(A 



C 

1 
0) 



O O lO 
O O CM ^ CO 

^ CX) rH t— t tH 



1^ 



CO 



U4 



Cu 



> 

> 



cn 
cia 

H 
CO 
O 
Cu 

> 

cn 

CO 

o 

O 

o 
>^ 
o 
<c 
a: 
:s 
a 



O Cl4 

CJ H 

CO O 

U O 



a: 

CO 

a: 
cu 

a; o ^ 
o 

> o 



Ci3 CO 
Ci3 O 



D 
Q 

o 

Q 



Cu 

a CO 

Cu Q 
O Q 
WOW 

o < 
> 

> 



C3 O 



> 

M 
CO 

o 3: 



O 
> 



Caa CU 



> 

> 



CO 

> 
o 



<C CO O 
CU Cu cu 

w cu 
o w 

CO CD 

Q o cu 
o < w 



LU 
O 



SUBSTITUTE SHEET (RULE 26) 



wo 98/34951 



PCT/AU98/00078 



24/Afi 



FIG 11 



FIGIKi) 



FIG IKii) 



FIG IKiii) 



FlGIKiv) 



FIG 11 (v) 



FIG 11 (vi) 



FIG 11 (vii) 



SUBSTITUT€ SHEET <RULE 26) 



wo 98/34951 



PCT/AU98/00078 



O 
IT) 



O 

o 



o 
in 



O 
O 
CN3 



O 
LO 
CN 



O 

o 

CO 



o 
in 
ro 



o 
o 



00 



Eh 
E-t 
fr* 
Eh 
U 
U 
O 
O 

O 
O 
Eh 
U 
< 
U 

EH 

Eh 
Eh 
U 

O 
O 
< 
U 

u 
u 

o 
o 
u 

Eh 

O 
U 
U 

u 

Eh 
Eh 

< 



< 

< 

u 
o 

£h 
U 

U 

Eh 

o 

U 
U 
U 
Eh 

■Eh 
Eh 

Eh 
Eh 
U 
U 
Eh 
Eh 
Eh 
< 
O 
U 

< 
Eh 

Eh 

< 
Eh 
•< 
Eh 
U 
Eh 

tH 

o 
o 
< 
u 
u 
o 
< 
u 





Eh O 




U >-l 






o 




Eh 


o :3 


U 


Eh Q) 


u 


u J 


U 




U 


u ;3 


O 


Eh <U 


O 




CD 


iH o 


Eh 




Eh (t3 tH 


Eh 


o > 


U 










t-r Q) 


< 


r \ 'H 


o 






U 3 








r \ T 








„^ 1 

rt| r— 1 




U \D 


r_, 
t"" 




r . 
tH 




r . 








r \ 

yJ 




r 1 




s 




u 


Eh J 


Eh 


u :3 


u 


Eh tl) 


u 


U J 


U 




O 


U ::3 


O 


Eh (U 


Eh 


U iJ 


Eh 




Eh 


Eh W 


U 


< -H 




U ffi 


U 




Eh 


o -«-> 


U 


Eh <U 


Eh 


< S 


U 




U 


U 


O 




< 


< 


O 




Eh 





Eh 

O 0) 

<; tn 
u o 

Eh C 
^ (0 

< < 

o am 

< iH <N 

u o 
o u 



u 
o 



CO 

< 



o a 



u 
u 



Ui o 
•H (N 



O Cn 
U < 

< Vh 
U ^ 

< Eh 

U iH 

U ^! 

< Eh 

O Ui 

i< >iin nr 

O rH 

CD o 5: 



< p 

Eh Q) 
U J 



SUBSTITUTE SHEET <RULE 26) 



wo 98/34951 



26/A8 



PCT/AU98/00078 



in 



U O 



^ ^ CTj 

o r^a 

if) ^ ^ ^ 



WW urH oa OW <>t 

33 So 83 

f:S t^^ S& 3o ^& 

UiJ HP^ OU HEh <w o < 

OP 0^3 <^ UQJ iJft <^ 

<rH HQ) '^rH tHjC t^r-H 

OO UJ OO HCU 0< <H 

rf:o3in O-Hr- UMco UO^o U^tH 

r<C <0 <fd U>i Oft OC 

SrH UVH OrH <M <rH 

uo u o < OO o<: OO 



OW EhO HO) op 

OM tH^: qu 

OG) o;3 u u o>^ o^ 

<CrH OO) OVj 0<U 

OO <W OJ 

<:o o;3 OM o^ < o u u 

U U rfrH O^! OO) 05-I OO) 

UOI OO <S OO. HW 

O^iin E-ifCo U(Oir> 0^30 tHtnin OCo 

E-i(Um u r-{ ID UrH»x) H<Uco <C-Hcr» JST^II 

u iJ o <: o <: o hii ok o o h 

UP rti'-i o-u o-u o>^ 

HQJ S-^ tH'C EhO) O^ 

uj OO o> <s <:s 

<:rH OP EHP OW <P 0>1 

H (0 < rH Eh 0) < >1 OrH 

0> OO OJ OO OO 

UO HW UW OP ^tJ) EhO 

U^ <.H <.H <rH 0>j OM 

u P4 o a: UK OO <: o 

U^ UC rtlO" <pi OP < o 

OO) <w o>-i q u oj^ 

EHpo 0>ii^ OrHO OCu^ £hOO OQJtn - 

EHQJm OrH^ Eh(vJ>X) <:rHr- <J UCF\ t^^<=! 

UJ OO 0> OO O 04 8h 04 rH f 

^ u < u <;<d otj) qw pp 15 

u <i) o^ UrH qu < >^ uu lj 

Eh W <C €h O < <C < <I O 04 



SUBSTITUTE SHEET {RULE 26) 



wo 98/34951 



PCT/AU98/00078 



27/48 



o 

00 



00 



00 



CN 


CN 


CN 


CN 












o 


O 








rH 


rH 



U 0) 
Eh 42 
Eh 




O CO 

U (d o 

U iH ro 
O < rH 

^ rH 

O CD 

o o 

U < 



Eh 
Eh 
U 



:3 



H O in 

U >-l CM 

U rH 

Eh }>4 

U (U 

Eh W 




O 4J 
Eh (1) 




Eh <U 



U 
Eh 
O 



(0 
> 



o u 
o c 

< rH 

u o 

Eh M IT) 
Eh CO tH 
Eh to 

o <: 

O O 

U >H 

U 

u ,c: 

< Eh 




< D)0 

< i< rH 

U 0) 

Eh X 

Eh Ph 



O 
Eh 

< 

U 
Eh 
Eh 



u a 

u w in 
< -H m 

U ffi rH 

o u 

Eh fH 



O U 

< < 

U in 
O > 
fr> U 

U U 
U ^ 

O 13 O 
rtj iH 
U O rH 

o a 
o u 

Eh 

Eh W 

< -H 

u tc 

< iH 

o > 

% iH 

Eh W in 
(< -H in 

U a rH 

u ^ 




u o 

u u 

U 

O ;3 O 

Eh <U in 

Eh ►J tH 



H 



E-- 
O 

u 
o 

< 

o 
o 
o 
o 
o 
o 

u 

o 

Eh 

o 

Eh 
< 

en 
o 

o c 

< iH 



u 
o 
< 

u 

Eh 
Eh 

U 
U 



0) 
CO 

0) 

o 
u 



U On 



o 

Eh 



iH in 

(0 \£> 
> H 



< Vh 

u ^ 

< Eh 



Eh 
< 
U 
O 
O 
O 
Eh 
£h 

u 
u 

Eh 

o 
o 

Eh 

Eh 
< 

< 

u 

Eh 

Eh 
€h 

u 

tH 

(J 

u 
< 

O 
Eh 
U 
U 
O 

CD 

U 

Eh 
O 
Eh 
U 
CD 



SUBSTITUTE SHEET <RULE 26) 



wo 98/34951 



PCT/AU98/00078 



28/48 



C\3 


CN 


CN 




CN 


CN 


CN 


CN 


CN 


CN 


CN 


CN 


(T\ 














'"^^ 










tH 


CN 


CN 


m 


m 






IT) 


LO 








tH 


rH 


rH 


xH 


rH 


tH 




tH 


rH 




tH 


tH 



< 

Eh 
< 

H 
E-i 
E-" 
O 

Eh 
U 
Eh 
U 

< 

< 
u 

Eh 
U 

<: 
u 

< 
u 

Eh 
Eh 

u 

Eh 
Eh 



Eh 

o 
< 
u 

Eh 
< 
Eh 



Eh 

o 

U 

< 
u 

Eh 

Eh 
< 
Eh 

< 

< 
u 

tH 

u 
< 

&H 

u 
< 

CD 

Eh 
O 

< 

O 
O 
Eh 

< 
U 

o 

Eh 
Eh 

e" 

Eh 

< 
Eh 
Eh 

tH 



Eh 
O 

u 

U 
U 

u 
< 

< 

u 
u 
<: 

Eh 



Eh 

O 
< 

< 

Eh 



Eh 
U 

u 

Eh 
U 

U 
Eh 

O 

<c 
u 
o 
< 
o 

Eh 
< 

o 
o 

tH 

o 

tH 

< 

tH 



Eh 
< 

tH 

U 

tH 

u 
o 

tH 

u 

tH 
tH 
tH 

u 

tH 

<: 

Eh 

u 



o 
o 
< 

tH 

tH 
fH 
tH 
U 

tH 

s 

tH 
tH 
U 

u 
u 

tH 

o 
<: 

tH 

< 
u 
<j 
u 

u 

tH 

€h 

tH 

U 

tH 

o 
o 

tH 

o 
< 

tH 
tH 
tH 

U 



u 

tH 

u 
u 

u 
< 

u 
u 
u 

tH 

u 



tH 

u 
o 

tH 
tH 

u 
o 
<: 

tH 
tH 

€h 

tH 

o 

tH 
tH 
U 
< 

o 
o 

o 

tH 
< 
tH 
tH 
tH 



tH 
tH 

u 

tH 
< 

o 

tH 
tH 
< 
tH 
tH 
O 
< 
tH 
O 
tH 

tH 
tH 
< 

o 

tH 

u 
o 
u 

tH 
tH 

o 

tH 
O 
fH 
tH 
O 
tH 
< 

a 

tH 
tH 

< 
o 

€h 

u 
a 

tH 

u 

tH 
tH 



SUBSTITUTE SHEET (RULE 26) 



wo 98/34951 



PCT/AU98/00078 



29/48 







CN 


CN 


CM 


r" 


CN 


CN 


CN 


CN 


CN 


CN 






o^ 








o\ 




a\ 




a^ 






CO 


C30 


a\ 




o 


O 


rH 


rH 


CN 


CN 




rH 




rH 






CN 


CN 


(N 


CN 


CN 


CN 


CN 




SUBSTITUTE SHEET tRULC 26) 



wo 98/34951 



PCT/AU98/00078 



30/48 





03 


<>3 




CN 


CN 


CN 




a\ 












cn 


m 


ro 






ID 


in 








rs3 




CM 


CN 


CN 


CSI 


CN 


CN 



u 
o 
u 

Eh 

U 
Eh 
Eh 
Eh 

Eh 
H 

< 
Eh 

< 

U 

U 
< 
Eh 
Eh 

Eh 

< 

Eh 
O 
Eh 
< 
Eh 
Eh 
U 
< 
Eh 

Eh 
<C 
CJ 

U 

o 

Eh 




U C in 

ft m 

< < 

<; iH 
u o 

Eh rH 
Eh (0 

O > 

Eh ,H 
&H (d 
O > 

< iH O 
Eh (0 ,H 
O > 




O O 
Eh 01 
Eh U 
U >i 

o o 

< 13 in 

rH 

u o 

O CO 

<; 'H 

U EC 

u u 

U Xi 

< Eh 

< Q) 

Eh rH 
fi, H 

Eh M tH 
U ^ 

< Eh 



03 
00 

O <d o 

U rH ro 

o <: 

o < 
< >i 

U rH 

o o 

tH O 

u u 

U On 
Eh Q) 

tH ^ 

Eh 04 

Eh to in 
<; -H 
U K 

Eh rH 
£h 10 
O > 

tH ^ 
U Q) 
Eh CO 

O >i 
O rH 
O O 

O W 

o > 
€h u 




•Eh <D 

Eh ^ 
£h CU 

u m 

O > 

fH U 

Eh :3 
8h 0) 



CN 
00 
CN 




U 0) 




0 CO 




U rH 
0 < 




Eh 0 

u u 

U 




0 :3 

Eh (U 
Eh kI) 




Eh CO 
0 >i 

tH U 




u w 
<: -H 




tH >^ 

Eh to 




u ro 

Eh U 




u u 

Eh <0 




0 u 




tH w 

U X 




<J u 

u d) 

Eh CO 




u w 

< -H 

U E 




0 C 

<C rH 

u 0 





SUBSTITUTE SHEET (RULE 26) 



wo 98/34951 



PCT/AU98/00078 



31/48 



O 



in 
m 



o 
m 



CN 




(N 








o 








O 


ir» 


o 


if) 


CX3 


a\ 




O 


o 




rH 


CN 


CN 


CN 


m 


m 


ro 





o 

Eh 
O 



iH O 

> 



u ^ 
U (U 

u ^ 
u (y 

Eh W 

Eh ^ 
Eh <U 
U tJ 

o o 

Eh M in 
U ^ in 
< Eh 

U w 
U >i 
Eh U 



U 
O 

Eh 



0} 



O 



U 

O 3 o 

Eh (U in 

Eh J 

U to 

U EC 



o 

< 

o 
u 
< 

u 
u 



4J 

s 

U 
Eh 



O > 

3^ 

u w 
o >i 

o c 
o o 

U M O 

O 3 

l«C rH 

o o 

< rH 



o 

£h 
O 

o 

Eh 
U 



> 

0) 



O -P in 
Eh 0) vo 
< S 



Eh 



(d 

> 



Eh to 

O > 

O to 

< >i 

< J 

U Q) 

Eh rH 

< H 



Eh ftO 

o < 
o c 
u o 
u u 

U Q) 

Eh W 

u >. 

u o 

Eh <d 

U rH 

o < 

Eh to in 
<; -H 00 

U K 

< :3 

Eh (D 
U J 

U 0) 
Eh rH 

< M 

o to 
<; -H 
u K 

< >i 

O rH 
O O 

Eh ftO 

< to 00 

o < 
o o 



Eh 

u 



to 

•H 



O 13 

rtj rH 

o o 

< Eh 



Eh 
H 
< 
Eh 
U 
< 
O 

u 
u 

Eh 

<: 

Eh 
U 
O 
< 

o 

Eh 



Eh d 




U rH 




O < 


U 




O 


< U 


< 


U Q) 




Eh W 




Eh rH 




Eh (0 




O > 


< 




u 


< > 


u 






o o 




< 0 




u ^ 


u 




o 




< 


u (y 




Eh rH 




< H 


i 


Eh 




Eh ^ 


Eh 


Eh 


Eh 




Eh 


U ^ 


U 


U Q) 


U 


Eh W 


< 



ID 



SUBSTITUTE SHEET <RUL£ 26) 



wo 98/34951 



PCT/AU98/00078 



32/A8 



FIG 12 



FIG 12(i) 



F{Q12(ii) 



SUBSTITUTE SHEET tRULE 26) 



wo 98/34951 



PCT/AU98/00078 



33/Aa 



o 



LD 



< 
o 
<: 
u 
u 

Eh 

u 



< iH O 

O > 

O P 

Eh <U 

U J 

O 3 

Eh Q) 

U J 

o c 

< rH 

u u 

Eh Q) 
Eh 

< 13 in 
Eh 0) 

u :3 

Eh 0) 

U J 

u :3 

Eh QJ 

U J 

Eh W 

< -H 
U K 

O -U r-l 

Eh OJ 

< S 

U 
O 
< 

< 
o 

Eh 
U 
U 
U 
U 
O 
O 
O 
6h 



o 



O C in 

<; rH CN 

u o 

U Cn 

O >H 
U i< 

U >i 

O rH 

o o 
o 

<; rH 

u o 
o m o 

< -H CVJ 

u u 
u < 

<; ^ 

o X 

<: Eh 

u u 
u ^ 

< Eh 

O w 
"< >iir) 

O rH tH 

o o 

&H Q) 

U J 

Eh O 
U U 
U ^ 

O ^ 
Eh CD 
U J 

O ^3 

Eh Q) 

U 



in 

00 



U 

3 



C o 
to '^C 



u c 

< < 

U O 

B rH 
Eh (d 
U > 

Eh rH 

£h (0 

u > 

< rH in 

Eh Jd ro 
o > 




Eh CO 

B u 
U >i 

3 o 

rH m 
O O 

O W 



U 
U 
< 



0) 



o 



O (0 in 
U rH in 
O < 

U (6 

U rH 

o <: 
o o 



Eh 
U 



O 
^1 



CJ 

H 0) 
Eh 45 
Eh 

Eh CO O 
< -H in 
U X 

Eh rH 
Eh tC 
O > 

U Q) 
H W 

O >i 

O rH 

o u 

U CO 

U >i 



in 

CM 



U 0) o 
Eh 43 r- 

u to 

U rH 

o < 

Eh O 
U 5h 

O P 

Eh <U 
Eh 

Eh to in 

Eh U 

U CO 

< -H 

u a: 

Eh V^ 

en ui 

CJ to 
O >i 
B u 

<J >H 

U <1) 
H W 

O >H O 

U 4:^ U3 

< Eh 

Eh CO 

U K 
U 

U Q) 

Eh W 



iH 

U X! 
< Eh 



U 



to 

•H 

rH 



o 

CM 

n 




O rH 

Eh fO 
O > 




U U 
U <U 
Eh 03 




u u 
£h cn 




Eh Q) 
U J 




^ rH 
O U 




Eh ^ 

u 4: 

< Eh 




TGC 
3n Cys 




CTG Al 
Leu As 




< 0 
u u 
u ^ 




0 :j 

Eh Q) 
Eh J 




(J CO 

< -H 

U K 




< s 




0 Sh 


CSl 


U 

u 4: 

< Eh 


15 



SUBSTITUTE SHEET (RULE 26) 



wo 98/34951 



PCT/AU98/00078 



34/48 



LD 



o 

tH 



LO 



O 

in 



00 

o 

LD 



in 

00 



o 

00 



if) 



o 

Eh 

o 



Ui o 
>iO 



> 



U 03 

u to 

Eh U 

O C 

u o 

U w in 

Eh u 

o o 

< rH 

O O 



Eh 

o 
o 

H 
U 



(6 
> 



O -P O 
Eh <D crt 
< S 

O rH 
Eh (0 
O > 

O > 
O CO 

U Q) 

£h rH . 



Eh am 

<< TO tH 
O << tH 

O C 

< iH 

u o 
u ^ 

U OJ 
Eh W 

U >i 

o o 

tH (0 
U rH 

o < 

Eh TO O 

< -H tH 
U K rH 

< =J 

Eh Q) 
U J 

U Q) 
Eh rH 

< H 

U TO 

< -H 

U E 

< >i 

U rH 
O O 

Eh am 

< TO O 
O < rH 

o o 

Eh To 

U ffi 

O P 
rtj i-H 

O Jh 
U ^ 

< Eh 



Eh 
Eh 
< 

tH 
U 
< 

u 
u 
u 

Eh 

u 
o 

o 

Eh 

&H (0 
O rH 

o <: 

< >H 
U 0) 
Eh Kn 

fH rH 
Eh (d 
O > 

<; >iO 
O rH 03 
O O rH 

< O 
U }H 



Eh 
Eh 
-Eh 

U 
U 
Eh 



CM 



SUBSTITUTE SHEET (RULE 26) 



wo 98/34951 



35/48 



PCT/AU98/00078 



FIG 13 (ii) 



FIG 13(i) 



FIG 13 



SUBSTITUTE SHEET (RULE 26) 



wo 98/34951 



PCT/AU98/00078 



36/48 



Ci3 



I 

O 

cc 

X 

X 
X 
CO 

CO 

X 

a 

X 

a 

X 

o 

Q 
X 
X 
X 
X 
X 

o 

> 

1^ 
a 

X 

2: 



o 

in ' 



o 



o 

CsJ 



cu M CO 



CO o g; 
2 CO g; 



o 



o 

CSJ 



O 

X 
Ou 

CO 
X 

w 

X 
X 

o 

Q 
X 

o 

X 
X 
X 

o 

X 

o 

CO 
X 
X 
X 
X 
CO 
X 
X 
Q 

cc 

X 
Ou 
X 
X 

la 

X 
X 

o: 

CO 



00 00 
tH t-H CVJ 
CM CM CN 

PC o 



00 00 lo 
(N CM m 




o 
h o 



TST lco c7?1 
cu CO I 
On > I 
04 E I 

PJ Q CD 

CO COi Z 
Q &3 >H 
CO > < 

CO cu PC 

&i cuK 

CO 




X 
H 

X 

o 
a: 

CO 

o 

X 
X 

oc 

X 

o 
o 

X 
X 

o 

04 
CX4 

a: 

X 
CO 
X 

o 

o 

2: 

o 
> 
> 
> 

X 

o 

X 

ad 

X 

M 

H 
O 



- ro - 




CM 


2 > s 








H H H 




tu C£4 pLl 




^ ^ 








OU O4 04 




h^JIoIh:? 


o 


u 0 0 


- CM - 




CM 


CO CO CO 




000 




CO H 




H CO 2: 




X xioi 




CO <DC 








iOl<IOl 


O 


< c:) 0 


- t—i - 


<: w s 


CM 


^ oL* 




Oi Ou O4 i 








xJoclsJ 

> M 




CO CO CO 1 




C5 CO M 




u u u 


O 


^ ^ ^ 




\y \2J KD 


CM 


Ctj CX4 U4 








h:i t-:! 




2i S 2 








000 




> >IBI 




> >S 


O 


> >f2 


- cr» - 




1—1 


Ci3 0 Q 




0 CJ) Ul 




0 Q 2 




03 tx3 W 




XXX 




H <; ^ 




M MM 1 








0 o» on 



CO 

a 







r- CM 


0 














CM CM 


CM 


X 




Oj 


X 


X 






X 


X 




H 


>A 


X 


0 




H 


X 


- 00 - 


CO 




< 


CM 


<: < CO 


X 




CO O4 




X 




> ^ 


I 


CD 






a 


O4 




cu cu 




M 




M M- 




C14 




Ct4 C14 




CO 




cn.,.ca. 


n" 


X 




Q 0 


1 







CO 








CO 








CO 








CO 








:3 








13 








































M 








u 








<U 








<u 








0) 








Q) 








JQ 


CO 






XI 


CO 








CO 






XI 


CO 






M 


:3 






M 


p 






M 


:3 










>1 




CD 




>i 






M 






<D 


M 






(D 




-p 






<u 


-P 






0) 








<U 


-p 




U 




•H 


M 






•H 


M 




XI 


•H 


M 




XI 


•H 


M 




X 




1 


0) 


M 


M 


1 


0) 


M 




1 


(U 


u 


M 


1 


<U 


M 


0 


Cu 


CO 


<U 


0 


■ Ou 


to 


o; 




Oj 


CO 




0 


CO 


<D 




cc 


:3 




•r^ 


cc 




u 




o: 




u 


•m 


cc 


:3 


0 


fO 


0 


0 




fO 


0 


0 






u 


0 




<0 


0 


0 




2 


jC 


e 


X 






B 


X 


2 


X 


e 


X 




x: 


s 


X 



SUBSTITUTE SHEET <RULE 26) 



wo 98/34951 



PCT/AU98/00078 



37/48 



00 00 <Ti 

oo 



00 00 LO 

Ko ^ 









1 


X 






Q 


a: 




a: pd 


04 


a 




a o 




PC 




a: ot:: 




o 




O Oi 




o 




o o 


IS 


w 








o 




o o 


3C 


< 










O 
' 00 " 




o: 


CO 




CO CO 










CO 


X 




<: o 


Q 


X 




> s 












a: 






w 










> 




> > 






o 


< < 




> 


" * 


> > 


o 
















Q 


Q 




Q Q 


o 






Ou 0^ 


X 










X 




CiD Q 


M 










< 






Ed 










. o . 










X ac 


1^ 








o 


X 




CD < 






H]>{E] 


X 




Cu X 




l-q 




h4 > 


1 




1 1 




1 
1 




t 1 
1 1 


IL 



o 

Xh 00 
U* 

> 

o; 
o 

15 
X 
> 

X 
CO 



o 



04 

M 

> 

o 

X 

04 

X 

a; 

U4 

X 
X 

X 



o 



O 

- in 



CO U4 Qj 

Oj OiI TT 
HO 12 




O 



CO 

<: 

X 

X 
X 
X 
X 
X 
X 

w 
> 

X 

u 

Oi 

u 
w 

[xl 

> 

X 

> 
> 



o 
eg 



> 

X 
X 
X 
X 

u 

X 



eg 



o 
h if) 

esj 



o 
- ^ 

es] 



00 


00 




in 


LO 


lD 




evi 


CN 


a o 




CO 


CO 




o 




Eh 
























X 


o: 




o 


[il 




Q 


tJ 






o 




X 






C£l 




CO 




H 








X 


> 


> 


< 



o o oj 
o aEI 
o CJ o 

CO {z3 Ciil 
Ci3 Ci3 CJ 
> > > 




CO 04 :2 

CO Eh t< 

»J5 04 CO 

Ci3 CO (J 

h EH ^ 

O O O 

s s z: 
J 







CO 








CO 








CO 
















:3 








:3 
















>H 








M 








(U 








<U 








CU 








XI 


CO 








CO 






XI 


CO 








:3 






u 








M 


D 


>1 




<u 


M 


>i 






u 


>1 




0) 








u 


Q) 


4-) 




U 


0) 






0 


0) 


•H 






JQ 


•H 


1—! 








rH 




n 


Sh 


1 


Q) 




U 


I 


0) 


u 




1 


<1> 


u 


o 


a. 


CO 


0) 


o 


. a. 


CO 


d) 


o 


O4 


CO 


<D 




cc 




(J 




a: 


D 


o 




a: 








u 


0 






CJ 


0 






u 


0 




2 


x: 


E 


X . 






e 


X 






E 


X 



SUBSTITUTE SHEET (RULE 26) 



wo 98/34951 



38/48 



PCT/AU98/00078 




FIG 14A 



SUBSTITUTE SHEET (RULE 26) 



wo 98/34951 



PCT/AU98/00078 



39/48 



FIG 14B 



to 

c 
J3 



80- 
60- 



40- 



c 
cu 

^ 20H 

S5 



0 



I 



T3 c 
Of <y 



9L X 



ai 



< 



SUBSTTIVre SHEET (Rule 26) 



40/48 



+ + 5 s. 



XNkx2.3 
XNkx2.5 

XeHAND 




GG13 
EF1a 

Edd 





1 2 3 4 5 6 7 

FIG 14C 



SUBSTITUTE SHEET (RULE 26) 



wo 98/34951 



PCT/AU98/00078 



41/48 




FIG 15 



SUBSTITUTE SHEET (RULE 26) 



wo 98/34951 



PCT/AU98/00078 



42/48 




FIG 16 



SUBSTITUTE SHEET (RULE 26) 



wo 98/34951 



43/48 



PCT/AU98/00078 




WO^/34951 



PCT/AU98/00078 



44/48 




FIG 18 



SUBSTITUTE SHEET^RULE 26) 



wo 98/34951 



PCT/AU98/00078 



457A8 



FIG19A 



Tyrp] 












Cerl 




■ □ 


□ ■ 


□ ■ 


□ ■ 


Ifha 


■ □ 


■ □ 


■ □ 


□ ■ 


□ ■ 


Jun 


■ □ 


■ □ 




■ □ 


□ ■ 


Pgm2 


■ □ 


■ □ 


■ □ 


■ □ 


■ □ 




36 50 


1 0 


0 2 


0 0 


0 3 



FIG 19B 



0-64- 
2-6 



2-9 



Tyrpl 9p23 
Cerl 



Ifna 9p22 
Jun Ip32-p31 



Pgm2 lp22.1 



SUBSTITUTE SHEET (RULE 26) 



wo 98/34951 



PCT/AU98/00078 




SUBSTITUTE SHEET (RULE 26) 



wo 98/34951 



PCT/AU98/C6078 




SUBSTITUTE SHEET (RULE 26) 



wo 98/34951 



PCT/AU98/00078 




SUBSTITUTE SHEET (RULE 26) 



INTERNATIONAL SEARCH REPORT 



International Application No. 
PCT/AU 98/00078 



A. CLASSIFICATION OF SUBJECT MATTER 

Int Cl^: C07K 14/52, A61K 38/19 

According to International Patent Classification (IPC) or to both national classification and IPC 

B. FIELDS SEARCHED 

Minimum documentation searched (classification system followed by classification symbols) 
As below. 



I>ocumentation searched other than minimum documentation to the extent that such documents are included in the fields searched 



Electronic data base consulted during the international search (name of data base and, where practicable, search terms used) 
see attached sheet 



DOCUMENTS CONSIDERED TO BE RELEVANT 



Category* 



(pitation of document, with indication, where appropriate, of the relevant passages 



Relevant to claim No. 



WO 97/48275 (THE REGENTS OF THE UNIVERSITY OF 
CALIFORNL\) 24 December 1997 
see Figure 1 

Chemical Abstracts 125:217338 & Nature volume 382 No: 6592 issued 
(1996) Bouwmeester, T et al "Cerberus is a head-inducing secreted factor 
expressed in the anterior endoderm of Spemann's organizer page 595-601 
see abstract 



1-5,7-9,12-16,18- 
20,23-27 



1-27 



Further documents are listed in the 
continuation of Box C 



X See patent femily annex 



* Special categories of cited documents: 

"A" document defining the general state of the art which is 
not considered to be of particular relevance 

"E" earlier document but published on or after the 
international filing date 

"L" document which may throw doubts on priority claim{s) 
or which is cited to establish the publication date of 
another citation or other special reason (as specified) 

"O" document referring to an oral disclosure, use, 
exhibition or other means 

document published prior to the international filing 



"X" 



later document published after the international filing date or 
priority date and not in conflict with the application but cited to 
understand the principle or theory underlying the invention 
document of particular relevance; the claimed invention cannot 
be considered novel or cannot be considered to involve an 
inventive step when the document is taken alone 
document of particular relevance; the claimed invention cannot 
be considered to involve an inventive step when the document is 
combined with one or more other such documents, such 
combination being obvious to a person skilled in the ait 
document member of the same patent family 



Date of the actual completion of the international search 
17 June 1998 


Date of mailing of the international search report 

22JUNt998 


Name and mailing address of the ISA/AU 
AUSTRALIAN PATENT OFHCE 
POBOX 200 
WODEN ACT 2606 
AUSTRALIA 

Facsimile No.: f02) 6285 3929 


Authorized officer 
K.F. PECK 

Telephone No.: (02) 6283 2263 



Form PCT/ISA/2 10 (second sheet) (July 1992) copbko 



INTERNATIONAL SEARCH REPORT 



international Application No. 
PCT/AU 98/00078 



C (Continuation) DOCUMENTS CONSIDERED TO BE RELEVANT 


Category* 


Citation of document, with indication, where appropriate, of the relevant passages 


Relevant to claim No. 


X 


ChemicaJ Abstract 124:142381 & Japan J Cancer Research Volume 87 No: 1 
issued (1 996) Ozaki, T et al "Cloning of mouse DAN cDNA and its down- 
regulation in transformed ceils" pages 58-61 
see abstract 


1-27 


X 


Chemical Abstract 122:179709 & Adv Enzvme Recul Volume 34 issued 
(1 994) Sakiyama, S et al "Molecular cloning and characterization of a cDNA 
showing tumor-suppressive activity in v-src-transformed 3Y1 rat fibroblasts" 
pages 247-255 
see abstract 


1-27 


X 


Chemical Abstract 122:2407 & Oncoeene Volume 9 No: 10 issued (1994> 
Enomoto, H et al ^^Identification of human DAN gene mapping to the putative 
neuroblastoma tumor suppressor locus" pages 2785-2791 
see abstract 


1-27 


X 


Chemical Abstracts 1 19:21591 & Proc Natl Acad Sci USA Volume 90 No: 7 
issued (1993) Ozaki. T et al ''Molecular cloning and characterization of a 
cDNA showing negative regulation in v-src-transformed 3Y1 rat fibroblasts" 
pages 2593-2597 
see abstract 


1-27 


Y 


Journal of Biolo&ical Chemistrv Volume 272 No: 5 issued (31 January 1997) 
Nakao, A et al "Identification of Smad 2, a human mad-related protein in the 
transforming grov^^ factor beta signalling pathway" pages 2896-2900 
see discussion pages 2899-2900 


1,5,12,16,23-27 




Current opinion in Genetics and Development Volume 6 No: 4 issued (August 
1996) Hogan, B L "Bone morphogenetic proteins in development" pages 432- 
8 

see abstract 




Y 


1,5,12,16,23-27 


A 


Medline 97180932 & EMBO Journal Volume 16 No: 2 issued (15 January, 
1997), Guenda, A et al "Activation of stress-activated protein kinase-3 
(SAPK3) by cytokines and cellular stresses is mediated via SAPKK3 
(mKK6); comparison of the specificities of SAPK3 and SAPK2" pages 295- 
305 

see abstract 


1-27 


A 


Medline 95408268 & Biochanical and Biophvsical Research 
Communications Volume 214 No: 2 issued (14 September 1995) 
Tsujimura, A et al "Developmental and differential regulations in^ene 
expression of Xenopus pleiotrophic factors - alpha and - beta" pages 432-439 
see abstract 

Roux's Arch Dev Biol Volume 205 No: 5-6 issued (1996) Nakamura, H et al 
"Isolation of Xenopus HGF gene promoter and its functional analysis in 
embryos and animal caps" pages 300^ 10 


1-27 


A 


see discussion on pages 308-309 


1,5,12,16,23-27 



Form PCT/ISA/210 (continuation of second sheet) (July 1992) copbko 



INTERNATIONAL SEARCH REPORT 



international Application No. 
PCT/AU 98/00078 



Box 1 



Observations where certain claims were found unsearchable (Continuation of item 1 of first sheet) 



This Iniemalional Search Report has not been established in respect of certain claims under Article n(2)(a) for the following 
reasons: 



1. 



□ 



Claims Nos.: 

because they relate to subject matter not required to be searched by this Authority, namely: 



2. 



Claims Nos.: 

because they relate to pans of the international application that do not comply with the prescribed requirements 
to such an extent that no meaningful international search can be carried out, specifically: please see comments 
for explanation in the continuation of Box 1 . 



3. 



□ 



Claims Nos.: 

because thev are dependent claims and are not drafted in accordance with the second and third sentences of Rule 
6.4(a) 



Box n Observations where unit>' of invention is lacking (Continuation of item 2 of first sheet) 



This International Searching Authority found multiple inventions in this international application, as follows: 



□ 
□ 
□ 



As ail required additional search fees were timely paid by the applicant, this international search report covers 
all searchable claims 

As all searchable claims could be searched without effort justifying an additioiud fee, this Authorit>' did not 
invite payment of any additional fee. 

As only some of the required additional search fees were timely paid by the applicant, this international search 
report covers only those claims for which fees were paid, specifically claims Nos.: 



□ 



No required additional search fees were timely paid by the applicant. Consequently, this international search 
report is restricted to the invention first mentioned in the claims; it is covered by claims Nos.: 



Remark on Protest | [ The additional search fees were accompanied by the applicant's protest. 

I I No protest accompanied the payment of additional search fees. 



Fomi PCT/ISA/210<continuation of first sheet(l))<July 1992)copbko 



INTERNATIONAL PRELIMINARY EXAMINATION REPORT 



International Application No. 
PCT/ AU 98/00078 



Supplemental Box 

(To be used when the space in any of Boxes I to VIII is not sufficient) 
Continuation of Box No: Electronic Data Base 



Electronic data base consulted. 



Medline: 


Cerberus 


CA 


xenopus and cytokine 


Orbit : 


signal(s) sequence and cyst:ne 


STN 


Peptide sub sequence search 


STN 


QNNLCFGKC/SIQNRACLGQC/QGVILPILSHEVHWETCRTVPF 



INTERNATIONAL SEARCH REPORT 



international Application No. 
PCT/AU 98/00078 



Box I (continued) 



Claims 1. 11 and 23-27 

No meaningfijl search could be conducted as the terms "signal sequence", "cystine knot domain" and "cerberus 
related protein" or "CRP" are not effective keywords (search terms). 

Claims 2 and 13 

No meaningful search could be conducted due to the large number of variables, as indicated by { AA} (any amino 
acid from 0 to 50 residues). 

Claims 4. 5-1 L 14 and 16-22 

No meaningful search could be conducted where only partial similarity is needed to the given amino acid 
sequence. 



Fomi PCT/ISA/210 (extra sheet) (July 1 992) copbko 



INTERNATIONAL SEARCH REPORT 

Information on patent family members 



International Application No. 
PCT/AU 98/00078 



This Annex lists the known "A" publication level patent family members relating to the patent documents cited 
in the above-mentioned international search report. The Australian Patent Office is in no way liable for these 
particulars which are merely given for the purpose of information. 



Patent Document Cited in Search Patent Family Member 

Repon 

WO,A 97/48275 AU 35765/97 



END OF ANNEX 



Form PCT/ISA/210 (extra sheet) (July 1992) copbko 



This Page is Inserted by IFW Indexing and Scanning 
Operations and is not part of the Official Record 

BEST AVAILABLE IMAGES 

Defective images within this document are accurate representations of the original 
documents submitted by the applicant. 

Defects in the images include but are not limited to the items checked: 

□ BLACK BORDERS 

□ IMAGE CUT OFF AT TOP, BOTTOM OR SIDES 
□TfaDED TEXT OR DRAWING 

□f BLURRED OR ILLEGIBLE TEXT OR DRAWING 

□ SKEWED/SLANTED IMAGES 

□ COLOR OR BLACK AND WHITE PHOTOGRAPHS 

□ GRAY SCALE DOCUMENTS 

□ LINES OR MARKS ON ORIGINAL DOCUMENT 

□ REFERENCE(S) OR EXHIBIT(S) SUBMITTED ARE POOR QUALITY 

□ OTHER: 

IMAGES ARE BEST AVAILABLE COPY. 
As rescanning these documents will not correct the image 
problems checked, please do not report these problems to 
the IFW Image Problem Mailbox.