Skip to main content

Full text of "USPTO Patents Application 09804625"

See other formats


WORLD INTELLECTUAL PROPERTY ORGANIZATION 
International Bureau 




PCX 

INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) 



(51) International Patent Classification ^ : 

C12N 15/12, 15/79, 5/10, C07K 14/51, 
19/00, 16/22, A61K 38/18, C07K 17/02 



Al 



(11) International PubUcation Number: WO 96/36710 

(43) Internationa] Publication Date: 21 November 1996 (21.1 1.96) 



(21) International Application Number: PCT/US96/06540 

(22) International Filing Date: 8 May 1996 (08.05.96) 



(30) Priority Data: 
08/446.924 



18 May 1995 (18.05.95) 



US 



(71) Applicants: GENETICS INSTITUTE, INC. [US/US]; 87 Cam- 

bridgePark Drive. Cambridge. MA 02140 (US). VANDER- 
BILT UNIVERSITY [US/US]; 305 Kirland HaU. Nashville. 
TN 37240 (US). 

(72) Invent(H*s: CELESTE, Anthony. J.; 86 Packard Street. Hudson, 

MA 01749 (US). DUBE. Jennifer. L.; 15 Churchill Avenue. 
Arlington. MA 02174 (US). LYONS. Kaien. M.; 4919 Stem 
Avenue. Sherman Oaks. CA 91423 (US). HOGAN. Brigid; 
103 Robert E. Lee Lane, Brentwood. TN 37207 (US). 

(74) Agent: LA2AR, Steven, R.; Genetics Institute Inc., 87 Cam- 
bridge Park Drive. Cambridge, MA 02140 (US). 



(81) Designated States: AU. CA, Fl. JP, KR. NO, European patent 
(AT. BE, CH. DE. DK, ES. FI. FR, GB. GR. IE, IT. LU. 
MC. NL, PT. SE). OAPI patent (BF, BJ. CF. CG. CI, CM. 
GA. GN, ML. MR. NE. SN, TD. TG). 



Published 

With international search report. 



(54)TiUe: BMP- 15 COMPOSITIONS 
(57) Abstract 



Purified BMP-15-reIatcd proteins and processes for producing them are disclosed. DNA molecules encoding the BMP-15-related 
proteins are also disclosed. The proteins may be used in the treatment of bone and cartilage and/or other connective tissue defects and in 
wound healing and related tissue repair. 



FOR THE PURPOSES OF INFORMATION ONLY 



Codes used to identify States party to the PCT on the front pages of pamphlets publishing international 
applications under the PCT. 



AM 


Annenia 


GB 


United Kingdom 


MW 


Malawi 


AT 


Austria 


GE 


Georgia 


MX 


Mexico 


AU 


Australia 


GN 


Guinea 


NE 


Niger 


BB 


Barbados 


GR 


Greece 


NL 


Netherlands 


BE 


Belgium 


HU 


Hungary 


NO 


Norway 


BF 


Burkina Faso 


IE 


Ireland 


NZ 


New Zealand 


BG 


Bulgaria 


IT 


Italy 


PL 


Poland 


BJ 


Benin 


JP 


Japan 


PT 


Portugal 


BR 


Brazil 


KE 


Kenya 


RO 


Romania 


BY 


Belarus 


KG 


Kyrgystan 


RU 


Russian Federation 


CA 


Canada 


KP 


Democratic People's Republic 


SD 


Sudan 


CF 


Central African Republic 




of Korea 


SE 


Sweden 


CG 


Congo 


KR 


Republic of Korea 


SG 


Sing^re 


CH 


Switzerland 


KZ 


Kazakhstan 


SI 


Slovenia 


CI 


Cdte dMvoirt 


U 


Liechtenstein 


SK 


Sk)vakia 


CM 


Cameroon 


LK 


Sri Lanka 


SN 


Senegal 


CN 


Chine 


LR 


Liberia 


sz 


Swaziland 


OS 


Czechoslovakia 


LT 


Lithuania 


TD 


Chad 


CZ 


Czech Republic 


LU 


Luxembourg 


TG 


Togo 


D£ 


Germany 


LV 


Latvia 


TJ 


Tajikistan 


DK 


Denmaric 


MC 


Monaco 


TT 


Trinidad and Tcbago 


EE 


Estonia 


MD 


Republic of Moldova 


UA 


Ukraine 


£S 


Spain 


MG 


Madagascar 


UG 


Uganda 


F] 


Finland 


ML 


Mali 


US 


United States of America 


FR 


France 


MN 


Mongolia 


uz 


Uzbekistan 


OA 


Gabon 


MR 


Mauritania 


VN 


Viet Nam 



wo 96/36710 



PCT/US96/06540 



TITLE OF THE INVENTION 

BMP.15 COMPOSITIONS 

5 The present invention relates to a novel family of purified proteins 

designated BMP-15 and BMP-15-related proteins, DNA encoding them, and 
processes for obtaining them. These proteins may be used to induce bone and/or 
canilage or other connective tissue formation, and in wound healing and tissue 
repair. These proteins may also be used for augmenting the activity of other bone 

10 morphogenetic proteins. 

BACKGROUND OF THE INVENTION 
The search for the molecule or molecules responsible for the bone-, 
canilage-, and other connective tissue-inductive activity present in bone and other 
tissue extracts has led to the discovery of a novel set of molecules called the Bone 

15 Morphogenetic Proteins (BMPs). The strucmres of several proteins, designated 
BMP-1 through BMP- 14, have previously been elucidated. The unique inductive 
activities of these proteins, along with their presence in bone, suggests that they 
are important regulators of bone repair processes, and may be involved in the 
normal maintenance of bone tissue. There is a need to identify whether additional 

20 proteins exist which play a role in these processes. The present invention relates 
to the identification of such a protein, which the inventors have designated BMP- 
15. 

SUMMARY OF THE INVENTION 

25 As used herein, the term "BMP-15-related protein" refers to the human 

BMP- 15 protein, having the amino acid sequence specified in SEQUENCE ID 
N0:4, as well as homologues of this protein found in other species; and other 
proteins which are closely related strucmrally and/or functionally to BMP- 15. 
Examples of "BMP-15-related proteins" include murine PC-3 protein, having the 

30 amino acid sequence of SEQUENCE ID N0:2, as well as homologues in other 
species, particularly human. 
Murine PC-3 

The murine PC-3 DNA sequence (SEQ ID NO: 1) and amino acid sequence 
(SEQ ID NO: 2) are set forth in the Sequence Listings. BMP-15-related proteins 



wo 96/36710 



PCTAJS96/06540 



are capable of inducing the formation of cartilage, bone, or other connective 
tissue, or combinations thereof. PC-3 proteins may be further characterized by the 
ability to demonstrate cartilage and/or bone and/or other connective tissue 
formation activity in the rat bone formation assay described below. 
5 Murine PC-3 may be produced by culturing a cell transformed with a 

DNA sequence comprising nucleotide a DNA sequence encoding the mature PC-3 
polypeptide, comprising nucleotide #634 to nucleotide #1008 as shown in SEQ ID 
NO: 1, and recovering and purifying from the culture medium a protein 
characterized by the amino acid sequence comprising amino acids #1 to #125 as 

10 shown in SEQ ID N0:2 substantially free from other proteinaceous materials with 
which it is co-produced. For production in manunalian cells, the DNA sequence 
further comprises a DNA sequence encoding a suitable propeptide 5' to and linked 
in frame to the nucleotide sequence encoding the mature PC-3 polypeptide. The 
propeptide may be the native PC-3 propeptide, or may be a propeptide from 

15 another protein of the TGF-j3 superfamily. 

It is expected that other species, particularly human, have DNA sequences 
homologous to murine PC-3. The invention, therefore, includes methods for 
obtaining the DNA sequences encoding human PC-3, the DNA sequences obtained 
by those methods, and the human protein encoded by those DNA sequences. This 

20 method entails utilizing the murine PC-3 nucleotide sequence or portions thereof 
to design probes to screen libraries for the human gene or coding sequences or 
fragments thereof using standard techniques. Thus, the present invention includes 
DNA sequences from other species, particularly, human, which are homologous 
to murine PC-3 and can be obtained using the murine PC-3 sequence. A DNA 

25 sequence encoding the complete mamre human BMP-15 protein (SEQ ID N0:3) 
and the corresponding amino acid sequence (SEQ ID N0:4) are set forth herein. 
As described herein, these sequences were isolated using a portion of the murine 
PC-3 sequence as a probe. The human BMP-15 sequence of SEQUENCE ID 
NO: 3 may also be used in order to design probes to obtain the complete human 

30 BMP-15 gene or coding sequences through standard techniques. The murine PC-3 
and human BMP-15 sequences, or portions thereof, may also be used as probes, 
or to design probes, in order to obtain other related DNA sequences. The BMP- 



2 



wo 96/36710 PCTAJS96/06540 

15-related proteins of the present invention, such as human BMP-15, may be 
produced by culmring a cell transformed with the correlating DNA sequence, such 
as the BMP-15 DNA sequence, and recovering and purifying protein, such as 
BMP'15, from the culture medium. The purified expressed protein is substantially 
5 free from other proteinaceous materials with which it is co-produced, as well as 
from other contaminants. The recovered purified protein is contemplated to 
exhibit cartilage and/or bone and/or connective tissue formation activity. The 
proteins of the invention may be further characterized by the ability to demonstrate 
cartilage and/or bone and/or other connective tissue formation activity in the rat 

10 bone formation assay described below. 

Another aspect of the invention provides pharmaceutical compositions 
containing a therapeutically effective amount of a BMP- 15-related protein, such as 
murine or human PC-3 or BMP-15 protein, in a pharmaceutically acceptable 
vehicle or carrier. These compositions of the invention may be used in the 

15 formation of bone. These compositions may further be utilized for the formation 
of cartilage, or other connective tissue, including tendon, ligament, meniscus and 
other connective tissue, as well as combinations of the above, for example 
regeneration of the tendon-to-bone attachment apparams. The compositions of the 
present invention, such as compositions of human BMP-15, may also be used for 

20 wound healing and tissue repair. Compositions of the invention may further 
include at least one other therapeutically useful agent such as the BMP proteins 
BMP-1, BMP-2, BMP-3, BMP-4, BMP-5, BMP-6 and BMP-7, disclosed for 
instance in United States Patents 5,108,922; 5,013,649; 5,116,738; 5,106,748; 
5,187,076; and 5,141,905; BMP-8, disclosed in PCT publication WO91/18098; 

25 and BMP-9, disclosed in PCT publication WO93/00432, BMP-10, disclosed in 
PCT application W094/26893; BMP-1 1, disclosed in PCT application 
W094/26892, or BMP-12 or BMP-13, disclosed in co-pending patent application, 
serial number 08/362,670, filed on December 22, 1994. Other compositions 
which may also be useful include Vgr-2, and any of the GDFs, including those 

30 described in PCT applications WO94/003,140; W094/15949; WO95/01801; 
WO95/01 802; W094/21681 ; W094/15966; and others. Also useful in the present 
invention may be BIP, disclosed in WO94/01557; and MP52, disclosed in PCT 



3 



wo 96/36710 



PCT/US96/06S40 



application W093/ 16099. The disclosures of all of the above applications are 
hereby incorporated by reference. 

The compositions of the invention may comprise, in addition to a BMP- 15- 
related protein, other therapeutically useful agents including growth factors such 
5 as epidermal growth factor (EGF), fibroblast growth factor (FGF), transforming 
growth factor (TGF-a and TGF-)3), activins, inhibins, and insulin-like growth 
factor (IGF). The compositions may also mclude an appropriate matrix for 
instance, for supporting the composition and providing a surface for bone and/or 
cartilage and/or other connective tissue growth. The matrix may provide slow 

10 release of the osteoinductive protein and/or the appropriate environment for 
presentation thereof. 

The BMP-15-related compositions may be employed in methods for treating 
a number of bone and/or cartilage and/or other connective tissue defects, 
periodontal disease and healing of various types of tissues and wounds. The tissue 

15 and wounds which may be treated include epidermis, nerve, muscle, including 
cardiac muscle, and other tissues and wounds. These methods, according to the 
invention, entail administering to a patient needing such bone and/or cartilage 
and/or other connective tissue formation, wound healing or tissue repair, an 
effective amount of a BMP-15-related protein. The BMP-15-related compositions 

20 may also be used to treat or prevent such conditions as osteoarthritis, osteoporosis, 
and other abnormalities of bone, cartilage or other connective tissue and other 
tissues. These methods may also entail the administration of a protein of the 
invention in conjunction with at least one other BMP protein as described above. 
In addition, these methods may also include the administration of a BMP- 15- 

25 related protein with other growth factors including EGF, FGF, TGF-a, TGF-/3, 
activin, inhibin and IGF. 

Still a further aspect of the invention are DNA sequences coding for 
expression of a BMP-15-related protein. Such sequences include the sequence of 
nucleotides in a 5' to 3' direction illustrated in SEQ ID NO: 3, DNA sequences 

30 which, but for the degeneracy of the genetic code, are identical to the DNA 
sequence SEQ ID NO: 3, and encode the protein of SEQ ID NO: 4. Further 
included in the present invention are DNA sequences which hybridize under 



4 



wo 96/36710 



PCT/US96/06540 



Stringent conditions with the DNA sequence of SEQ ID NO: 3 and encode a 
protein having the ability to induce the formation of cartilage and/or bone and/or 
other connective tissue. Preferred DNA sequences include those which hybridize 
under stringent conditions [see, T. Maniatis et al. Molecular Cloning fA 
5 Laboratory ManuaH . Cold Spring Harbor Laboratory (1982), pages 387 to 389]. 
It is generally preferred that such DNA sequences encode a polypeptide which is 
at least about 80% homologous, and more preferably at least about 90% 
homologous, to the mature human BMP- 15 amino acid sequence shown in SEQ 
ID N0:4. Finally, allelic or other variations of the sequences of SEQ ID NO: 3, 
10 whether such nucleotide changes result in changes in the peptide sequence or not, 
but where the peptide sequence still has BMP- 15 activity, are also included in the 
present invention. 

A further aspect of the invention includes vectors comprising a DNA 
sequence as described above in operative association with an expression control 

15 sequence therefor. These vectors may be employed in a novel process for 
producing a BMP-15-related protein of the invention in which a cell line 
transformed with a DNA sequence encoding a BMP-15-related protein in operative 
association with an expression control sequence therefor, is cultured in a suitable 
culture mediimi and a BMP-15-related protein is recovered and purified therefrom. 

20 This process may employ a number of known cells both prokaryotic and eukaryotic 
as host cells for expression of the polypeptide. The vectors may be used in gene 
therapy applications. In such use, the vectors may be transfected into the cells of 
a patient in vitro, and the cells may be reintroduced into a patient. Alternatively, 
the vectors may be introduced into a patient in vivo through targeted transf«ction. 

25 The purified proteins of the present inventions may be used to generate 

antibodies, either monoclonal or polyclonal, to human BMP-15 and/or other BMP- 
15-related proteins, using methods that are known in the an of antibody 
production. Thus, the present invention also includes antibodies to human BMP-15 
and/or other BMP-15 related proteins. The antibodies may be useful for 

30 purification of BMP-15 and/or other BMP-15 related proteins, or for inhibiting or 
preventing the effects of BMP-15 related proteins. The proteins or<:ompositions 
of the present invention may also be useful for treating cell populations, such as 



5 



wo 96/36710 PCTAJS96/06540 

embryonic cells or stem cell populations, to enhance or enrich the growth and/or 
differentiation of the cells. The treated cell populations may be useful for gene 
therapy applications. 
Description of the Sequences 
5 SEQ ID N0:1 is a nucleotide sequence encoding the entire mature murine 

PC-3. 

SEQ ID N0:2 is the amino acid sequence containing the mamre murine 
PC-3 polypeptide. 

SEQ ID NO: 3 is a nucleotide sequence encoding the entire mamre human 
10 BMP-15. 

SEQ ID N0:4 is the amino acid sequence containing the mamre human 
BMP-15 polypeptide, 

SEQ ID N0:5 is a consensus sequences of members of the BMP/TGF- 
^/Vg-1 family of proteins; wherein the first Xaa is either Gin, Asn or Asp; the 
15 second Xaa is either Asp, Glu or Asn; and the third Xaa is either Val or He. 

SEQ ID N0:6 is primer #1, directed to the consensus sequence of SEQ ID 

N0:5. 

SEQ ID N0:7 is a consensus sequence of members of the BMP/TGF-i3/Vg- 
1 family of proteins; wherein the Xaa is either Val or Leu, 
20 SEQ ID NO:8 is primer #2, directed to the consensus sequences of SEQ 

ID NO:7. 

SEQ ID NO: 9 is the nucleotide sequence of a fragment of murine PC-3 
isolated using the primers of SEQ ID NO: 6 and SEQ ID NO:8. 

SEQ ID NO: 10 is the derived amino acid sequence encoded by the 
25 nucleotide sequence of SEQ ID NO: 9. 

SEQ ID NO: 11 is the nucleotide sequence of oligonucleotide primer #3, 
directed to the murine PC-3 DNA sequence, used to isolate a full-length mPC-3 
gene. 

SEQ ID NO: 12 is the nucleotide sequence of oligonucleotide primer #4, 
30 directed to the murine PC-3 DNA sequence, used to isolate a full-length mPC-3 
gene. 



6 



wo 96/36710 



PCT/US96/06540 



SEQ ID NO: 13 is the nucleotide sequence of oligonucleotide primer #5, 
directed to the murine PC-3 DNA sequence, used to isolate a full-length human 
BMP-15 gene. 

SEQ ID NO: 14 is the nucleotide sequence of oligonucleotide primer #6, 
5 directed to the murine PC-3 DNA sequence, used to isolate a full length human 
BMP-15 gene. 

Detailed Description of the Invention 
BMP-15 

10 The murine PC-3 nucleotide sequence (SEQ ID NO: 1) and encoded amino 

acid sequence (SEQ ID NO: 2) are set forth in the Sequence listings herein. The 
coding sequence of the mamre murine PC-3 protein begins at nucleotide #634 and 
continues through nucleotide #1008. Purified murine PC-3 proteins of the present 
invention are produced by culturing a host cell transformed with a DNA sequence 

15 comprismg the DNA coding sequence of SEQ ID NO: 1 from nucleotide #634 to 
#1008, or from nucleotide #490 to #1008, and recovering and purifying from the 
culture medium a protein which contains the amino acid sequence or a substantially 
homologous sequence as represented by amino acids #-48 to #125 or # 1 to #125 
of SEQ ID NO: 2. 

20 The human BMP-15 sequence of the present invention is obtained using the 

whole or fragments of the murine PC-3 DNA sequence, or a partial human BMP- 
15 sequence, as a probe. Thus, the human BMP-15 DNA sequence comprise the 
DNA sequence of nucleotides #1002 to #1376 of SEQ ID NO: 3. This sequence 
of the human BMP-15 DNA sequence corresponds well to nucleotides #634 to 

25 #1008 of the murme PC-3 DNA sequence shown in SEQ ID NO: 1 . The human 
BMP-15 protein comprises the sequence of amino acids #1 to #125 of SEQ ID 
NO: 4. 

It is expected that BMP-15 protein, as expressed by manmialian cells such 
as CHO cells, exists as a heterogeneous population of active species of BMP-15 
30 protein with varying N-termini. It is expected that active species will comprise an 
amino acid sequence beginning with the cysteine residue at amino acid #24 of SEQ 
ID N0:4, or will comprise additional amino acid sequence further in the N- 



7 



wo 96/36710 PCT/US96/06540 

terminal direction. Thus, it is expected that DNA sequences encoding active 
BMP- 15 proteins will comprise a nucleotide sequence comprising nucleotides 
#576, #813, #1(X)2 or #1071 to #1373 or #1376 of SEQ ID NO: 3. Accordingly, 
active species of human BMP- 15 are expected to include those comprising amino 
5 acids #-142, #-63, #1 or #24 to #124 or #125 of SEQ ID N0:4. 

A host cell may be transformed with a coding sequence encoding a 
propeptide suitable for the secretion of proteins by the host cell is linked in proper 
reading frame to the coding sequence for the mature PC-3 or BMP-15 protein. 
For example, see United States Patent 5, 168,050, the disclosure of which is hereby 

10 incorporated by reference, in which a DNA encoding a precursor portion of a 
mammalian protein other than BMP-2 is fused to the DNA encoding a mature 
BMP-2 protein. See also the specification of co-pendmg patent application, serial 
number 08/362,670, filed on December 22, 1994, in which the propeptide of 
BMP-2 is fused to the DNA encoding a mature BMP-12 protein. The disclosure 

15 of both of these references are hereby incorporated by reference. Thus, the 
present invention includes chimeric DNA molecules comprising a DNA sequence 
encoding a propeptide from a member of the TGF-iS superfamily of proteins, other 
than BMP-15, is linked in correct reading frame to a DNA sequence encoding a 
BMP-15-related protein, such as PC-3 or BMP-15 protein. The term "chimeric" 

20 is used to signify that the propeptide originates from a different polypeptide than 
the BMP-15-related protein. 

The N-terminus of one active species of human BMP-15 is expected to be 
experimentally detennined by expression in E. coli to be as follows: 
[MJQADGISAE. Thus, it appears that the N-terminus of this species of BMP-15 

25 is at amino acid #1 of SEQ ID NO: 3, and a DNA sequence encoding said species 
of BMP-15 would comprise nucleotides #1002 to #1376 of SEQ ID NO: 3. The 
apparent molecular weight of human BMP-15 monomer is expected to be 
experimentally determined by SDS-PAGE to be approximately 10-17 kd on a 
Novex 16% tricine gel. The human BMP-15 protein is expected to exist as a 

30 clear, colorless solution in 0.1% trifluoroacetic acid. 

It is expected that other BMP-15-related proteins, such as PC-3, as 
expressed by manunalian cells such as CHO cells, also exist as a heterogeneous 



8 



wo 96/36710 



PCT/US96/06540 



population of active species of BMP-15-related protein with varying N-tennini. 
For example, it is expected that active species of PC-3 will comprise an amino 
acid sequence beginning with the cysteine residue at amino acid #24 of SEQ ID 
N0:2, or will comprise additional amino acid sequence further in the N-terminal 
5 direction. Thus, it is expected that DNA sequences encoding active PC-3 proteins 
include those which comprise a nucleotide sequence comprising nucleotides #427, 
#490, #634, #640, #664 or #703 to #1005 or #1008 of SEQ ID NO: 1. 
Accordingly, active PC-3 proteins include those comprising amino acids #-69, #- 
48, #1, #3, #11 or #24 to #124 or #125. 

10 The BMP-15-related proteins of the present invention, include polypeptides 

having a molecular weight of about 10-17 kd in monomeric form, said polypeptide 
comprising the amino acid sequence of SEQ ID NO: 10 and having the ability to 
induce the formation of cartilage and/or bone and/or other connective tissue in the 
Rosen-Modified Sampath-Reddi ectopic implant assay, described in the examples. 

15 The BMP-15-related proteins recovered from the culture medium are 

purified by isolating them from other proteinaceous materials from which they are 
co-produced and from other contaminants present. BMP- 15-related proteins may 
be characterized by the ability to induce the formation of cartilage and/or bone 
and/or other connective tissue, for example, in the rat bone formation assay 

20 described below. 

The BMP- 15-related proteins provided herein also include factors encoded 
by the sequences similar to those of SEQ ID N0:1 or SEQ ID N0:3, but into 
which modifications are naturally provided (e.g. allelic variations in the nucleotide 
sequence which may result in amino acid changes in the polypeptide) or 

25 deliberately engineered. For example, synthetic polypeptides may wholly or 
partially duplicate continuous sequences of the amino acid residues of SEQ ID 
N0:2 or SEQ ID N0:4. These sequences, by virme of sharing primary, 
secondary, or tertiary structural and conformational characteristics with bone 
growth factor polypeptides of SEQ ID NO: 2 or SEQ ID NO: 4 may possess bone 

30 growth factor biological properties in common therewith. Thus, they may be 
employed as biologically active substimtes for naturally-occurring BMP- 15 and 
other BMP-15-related polypeptides in therapeutic processes. 



wo 96/36710 PCT/US96/06540 

Other specific mutations of the sequences of BMP-15-related proteins 
described herein involve modifications of glycosyiation sites. These modifications 
may involve 0-linked or N-linked glycosyiation sites. For instance, the absence 
of glycosyiation or only partial glycosyiation results from amino acid substitution 
5 or deletion at asparagine-linked glycosyiation recognition sites. The asparagine- 
linked glycosyiation recognition sites comprise tripeptide sequences which are 
specifically recognized by appropriate cellular glycosyiation enzymes. These 
tripeptide sequences are either asparagine-X- threonine or asparagine-X-serine, 
where X is usually any amino acid. A variety of amino acid substitutions or 

10 deletions at one or both of the first or third amino acid positions of a glycosyiation 
recognition site (and/or amino acid deletion at the second position) results in non- 
glycosylation at the modified tripeptide sequence. Additionally, bacterial 
expression of BMP-15-related protein will also result in production of a non- 
glycosylated protein, even if the glycosyiation sites are left unmodified. 

15 The present invention also encompasses the novel DNA sequences, free of 

association with DNA sequences encoding other proteinaceous materials, and 
coding for expression of BMP-15-related proteins. These DNA sequences include 
those depicted in SEQ ID NO: 1 and SEQ ID NO: 3 in a 5' to 3' direction and 
those sequences which hybridize thereto under stringent hybridization conditions 

20 [for example, O.IX SSC, 0.1% SDS at eS^'C; see, T. Maniatis et al, Molecular 
Cloning (A Laboratorv Manual) . Cold Spring Harbor Laboratory (1982), pages 
387 to 389] and encode a protein having cartilage and/or bone and/or other 
connective tissue inducing activity. These DNA sequences also include those 
which comprise the DNA sequence of SEQ ID NO: 1 or SEQ ID NO: 3 and those 

25 which hybridize thereto under stringent hybridization conditions and encode a 
protein having cartilage and/or bone and/or other connective tissue inducing 
activity. 

Similarly, DNA sequences which code for BMP-15-related proteins coded 
for by the sequences of SEQ ID NO: 1 or SEQ ID NO: 3, or BMP-15-related 
30 proteins which comprise the amino acid sequence of SEQ ID NO: 2 or SEQ ID 
NO: 4, but which differ in codon sequence due to the degeneracies of the genetic 
code or allelic variations (naturally-occurring base changes in the species 



10 



wo 96/36710 



PCTAJS96/06540 



population which may or may not result in an amino acid change) also encode the 
novel factors described herein. Variations in the DNA sequences of SEQ ID NO: 
1 or SEQ ID NO: 3 which are caused by point mutations or by induced modifi- 
cations (including insertion, deletion, and substitution) to enhance the activity, 
5 half-life or production of the polypeptides encoded are also encompassed in the 
invention. 

Another aspect of the present invention provides a novel method for 
producing BMP-15-related proteins. The method of the present invention involves 
culturing a suitable cell line, which has been transformed with a DNA sequence 

10 encoding a BMP-15-related protein of the invention, under the control of known 
regulatory sequences. The transformed host cells are cultured and the BMP-15- 
related proteins recovered and purified from the culture medium. The purified 
proteins are substantially free from other proteins with which they are co-produced 
as well as from other contaminants. 

15 Suitable cells or cell lines may be manmialian cells, such as Chinese 

hamster ovary cells (CHO). The selection of suitable mammalian host cells and 
methods for transformation, culture, amplification, screening, product production 
and purification are known in the art. See, e.g., Gething and Sambrook, Nature . 
291:620-625 (1981), or alternatively, Kaufman et al, Mol. Cell. Biol. . 5(7): 1750- 

20 1759 (1985) or Howley et al, U.S. Patent 4,419,446. Another suitable mammalian 
cell line, which is described in the accompanying examples, is the monkey COS-1 
cell line. The mammalian cell CV-1 may also be suitable. 

Bacterial cells may also be suitable hosts. For example, the various strains 
of E. coli (e.g., HBlOl, MC1061) are well-known as host cells in the field of 

25 biotechnology. Various strains of B. subtilis . Pseudomonas . other bacilli and the 
like may also be employed in this method. For expression of the protein in 
bacterial cells, DNA encoding the propeptide of BMP-15-related is generally not 
necessary. 

Many strains of yeast cells known to those skilled in the art may also be 
30 available as host cells for expression of the polypeptides of the present invention. 
Additionally, where desired, insect cells may be utilized as host cells in the 



wo 96/36710 PCTAJS96/06540 

method of the present invention. See, e.g. Miller et al. Genetic Engineering . 
8:277-298 (Plenum Press 1986) and references cited therein. 

Another aspect of the present invention provides vectors for use in the 
method of expression of these novel BMP-15-related polypeptides. Preferably the 
5 vectors contain the full novel DNA sequences described above which encode the 
novel factors of the invention. Additionally, the vectors contain appropriate 
expression control sequences permitting expression of the BMP-15-relaled protein 
sequences. Alternatively, vectors incorporating modified sequences as described 
above are also embodiments of the present invention. Additionally, the sequence 

10 of SEQ ID N0:1, SEQ ID N0:3 or other sequences encoding BMP-15-related 
proteins could be manipulated to express a mamre BMP-15-related protein by 
deleting BMP-15-related propeptide sequences and replacing them with sequences 
encoding the complete propeptides of other BMP proteins or members of the TGF- 
0 superfamily. Thus, the present invention includes chimeric DNA inolecules 

15 encoding a propeptide from a member of the TGF-jS superfamily linked in correct 
reading frame to a DNA sequence encoding a BMP-15-related polypeptide. 

The vectors may be employed in the method of transforming cell lines and 
contain selected regulatory sequences in operative association with the DNA coding 
sequences of the invention which are capable of directing the replication and 

20 expression thereof in selected host cells. Regulatory sequences for such vectors 
are known to those skilled in the art and may be selected depending upon the host 
cells. Such selection is routine and does not form part of the present invention. 

A protein of the present invention, which induces cartilage and/or bone 
and/or other connective tissue formation in circumstances where such tissue is not 

25 normally formed, has application in the healing of bone fractures and cartilage or 
other coimective tissue defects in htimans and other animals. Such a preparation 
employing a BMP-15-related protein may have prophylactic use in closed as well 
as open fracture reduction and also in the improved fixation of anificial joints. De 
novo bone formation induced by an osteogenic agent contributes to the repair of 

30 congenital, iraxmna induced, or oncologic resection induced craniofacial defects, 
and also is useful in cosmetic plastic surgery. A BMP-15-related protein may be 
used in the treatment of periodontal disease, and in other tooth repair processes. 

12 



wo 96/36710 



PCTAJS96/06540 



Such agents may provide an environment to attract bone-forming cells, stimulate 
growth of bone-forming cells or induce differentiation of progenitors of 
bone-forming cells, and may also support the regeneration of the periodontal 
ligament and attachment apparatus, which connects bone and teeth. BMP- 15- 
5 related polypeptides of the invention may also be useful in the treatment of 
osteoporosis. A variety of osteogenic, cartilage-inducing and bone inducing factors 
have been described. See, e.g., European patent applications 148,155 and 169,016 
for discussions thereof. 

The proteins of the invention may also be used in wound healing and 

10 related tissue repair. The types of wounds include, but are not limited to bums, 
incisions and ulcers. (See, e.g. PCT Publication WO84/01106 for discussion of 
wound healing and related tissiie repair). It is further contemplated that proteins 
of the invention may increase neuronal survival and therefore be useful in 
transplantation and treatment of conditions exhibiting a decrease in neuronal 

15 survival. The proteins of the invention may further be useful for the treatment of 
conditions related to other types of tissue, such as epidermis and muscle. 

A further aspect of the invention is a therapeutic method and composition 
for repairing fracmres and other conditions related to cartilage and/or bone and/or 
other connective tissue defects or periodontal diseases. The invention further 

20 comprises therapeutic methods and compositions for wound healing and tissue 
repair. Such compositions comprise a therapeutically effective amount of at least 
one of the BMP-15-related proteins of the invention in admixture with a 
pharmaceutically acceptable vehicle, carrier or matrix. It is further contemplated 
that compositions of the invention may increase neuronal survival and therefore be 

25 useful in transplantation and treatment of conditions exhibiting a decrease in 
neuronal survival. Compositions of the invention may further include at least one 
other therapeutically useful agent, such as members of the TGF-jS superfamily of 
proteins, which includes the BMP proteins BMP-1, BMP-2, BMP-3, BMP-4, 
BMP-5, BMP-6 and BMP-7, disclosed for instance in United States Patents 

30 5,108,922; 5,013.649; 5,116,738; 5,106,748; 5,187,076; and 5,141,905; BMP-8, 
disclosed in PCT publication WO91/18098; BMP-9, disclosed in PCT publication 
WO93/00432; BMP-10, disclosed in PCT application W094/26893; BMP-1 1, 



13 



wo 96/36710 



PCT/US96/06S40 



disclosed in PCT application W094/26892, or BMP-12 or BMP-13, disclosed in 
co-pending patent application, serial number 08/362,670, filed on December 22, 
1994. Other compositions which may also be useful include Vgr-2, and any of the 
GDFs, including those described in PCT applications WO94/003,140; 
5 W094/15949; WO95/01801; WO95/01802; W094/21681; W094/15966; and 
others. Also useful in the present invention may be BIP, disclosed in 
WO94/01557; and MP52, disclosed in PCT application WO93/16099. The 
disclosures of the above applications are hereby incorporated by reference herein. 
It is expected that BMP- 15 and BMP-15-related proteins may exist in namre 

10 as homodimers or heterodimers. To promote the formation of dimers of BMP- 15 
and BMP-15-related proteins with increased stability, one can genetically engineer 
the DNA sequence of SEQUENCE ID N0:1 or SEQUENCE ID N0:3 to provide 
one or more additional cysteine residues to increase potential dimer formation. 
The resulting DNA sequence would be capable of producing a "cysteine added 

15 variant" of BMP-15 or a BMP-15 related protein. In a preferred embodiment, one 
would engineer the DNA sequence of SEQUENCE ID NO:3 so that the codon 
appearing at nucleotides #1266 to #1268 is altered to a nucleotide triplet encoding 
a cysteine residue, such as TGT or TGC. Similarly, one could alter the DNA 
sequence of SEQUENCE ID N0:1 to replace the codon triplet at nucleotides #898 

20 to #900 to a triplet encoding a cysteine residue, such as TGT or TGC. 
Alternatively, one can produce "cysteine added variants" of BMP-15 or BMP- 15- 
related proteins by altering the sequence of the protein at the amino acid level, for 
example, by altering the amino acid sequences of SEQUENCE ID N0:2 or 
SEQUENCE ID N0:4 at amino acid residue #89 from Ser to Cys. Production of 

25 "cysteine added variants" of proteins is described in United States Patent 
5,166,322, the disclosure of which is hereby incorporated by reference. 

It is expected that the proteins of the invention may act in concert with or 
perhaps synergistically with other related proteins and growth factors. Further 
therapeutic methods and compositions of the invention therefore comprise a 

30 therapeutic amoimt of at least one BMP-15-related protein of the invention with a 
therapeutic amount of at least one other member of the TGF-j3 superfamily of 
proteins, such as the BMP proteins disclosed in the applications described above. 



14 



wo 96/36710 



PCT/US96/06540 



Such combinations may comprise separate molecules of the BMP proteins or 
heteromolecules comprised of different BMP moieties. For example, a method 
and composition of the invention may comprise a disulfide linked dimer 
comprising a BMP-15-related protein subunit and a subunit from one of the 
5 "BMP" proteins described above. Thus, the present invention includes a purified 
BMP-15-related polypeptide which is a heterodimer wherein one subunit comprises 
the amino acid sequence from amino acid #1 to amino acid #125 of SEQ ID N0:2 
or amino acid #1 to #125 of SEQ ID N0:4, and one subunit comprises an amino 
acid sequence for a bone morphogenetic protein selected from the group consisting 

10 of BMP-1, BMP^2, BMP-3, BMP-4, BMP.5, BMP-6, BMP-7, BMP-8, BMP-9, 
BMP-10, BMP-1 1 or BMP-12 or BMP-13, disclosed in co-pending patent 
application, serial number 08/362,670, filed on December 22, 1994. A further 
embodiment may comprise a heterodimer of BMP-1 5-related moieties, for example 
of human BMP-15 and the human homologue of murine PC-3. Further, BMP-15- 

15 related proteins may be combined with other agents beneficial to the treatment of 
the bone and/or cartilage and/or other connective tissue defect, wound, or tissue 
in question. These agents include various growth factors such as epidermal growth 
factor (EGF), fibroblast growth factor (FGF), platelet derived growth factor 
(PDGF), transforming growth factors (TGF-a and TGF-^), activins, inhibins, and 

20 k-fibroblast growth factor (kFGF), parathyroid hormone (PTH), leukemia 
inhibitory factor (UF/HILDA/DIA), insulin-like growth factors (IGF-I and IGF- 
II). Portions of these agents may also be used in compositions of the present 
invention. 

The preparation and formulation of such physiologically acceptable protein 
25 compositions, having due regard to pH, isotonicity, stability and the like, is within 
the skill of the art. The therapeutic compositions are also presently valuable for 
veterinary applications due to the lack of species specificity in BMP proteins. 
Particularly domestic animals and thoroughbred horses in addition to humans are 
desired patients for such treatment with the BMP-15-related proteins of the present 
30 invention. 

The therapeutic method includes administering the composition topically, 
systemically, or locally as an implant or device. When administered, the 



15 



wo 96/36710 



PCT/US96/06540 



therapeutic composition for use in this invention is, of course, in a pyrogen-ftee, 
physiologically acceptable form. Further, the composition may desirably be 
encapsulated or injected in a viscous form for delivery to the site of bone, cartilage 
or other connective tissue or other tissue damage. Topical administration may be 
5 suitable for wound healing and tissue repair. Therapeutically useful agents other 
than the BMP-15-related proteins which may also optionally be included in the 
composition as described above, may alternatively or additionally, be administered 
simultaneously or sequentially with the BMP composition in the methods of the 
invention. 

10 Preferably for bone and/or cartilage and/or other connective tissue 

formation, the composition includes a matrix capable of delivering BMP- 15 -related 
or other BMP proteins to the site of bone and/or cartilage and/or other connective 
tissue damage, providing a structure for the developing bone and cartilage and 
other connective tissue and optimally capable of being resorbed into the body. The 

15 matrix may provide slow release of BMP-15-related and/or other bone inductive 
protein, as well as proper presentation and appropriate environment for cellular 
infiltration. Such matrices may be formed of materials presently in use for other 
implanted medical applications. 

The choice of matrix material is based on biocompatibility, 

20 biodegradability, mechanical properties, cosmetic appearance and interface 
properties. The particular application of the BMP-15-related compositions will 
define the appropriate formulation. Potential matrices for the compositions may 
be biodegradable and chemically defined calcium sulfate, tricalciumphosphate, 
hydroxyapatite, polylactic acid and polyanhydrides. Other potential materials are 

25 biodegradable and biologically well defined, such as bone or dermal collagen. 
Further matrices are comprised of pure proteins or exu^cellular matrix 
components. Other potential matrices are nonbiodegradable and chemically 
defined, such as sintered hydroxyapatite, bioglass, aluminates, or other <;eramics. 
Matrices may be comprised of combinations of any of the above mentioned types 

30 of material, such as polylactic acid and hydroxyapatite or collagen and 
tricalciumphosphate. The bioceramics may be altered in composition, such as in 



16 



wo 96A36710 



PCTAJS96/06540 



calci\im-aluminate-phosphate and processing to alter pore size, particle size, 
panicle shape, and biodegradability. 

The dosage regimen will be determined by the attending physician 
considering various factors which modify the action of the BMP-15-reIated protein, 
5 e.g. amount of bone weight desired to be formed, the site of bone damage, the 
condition of the damaged bone, the size of a wound, type of damaged tissue, the 
patient's age, sex, and diet, the severity of any infection, time of administration 
and other clinical factors. The dosage may vary with the type of matrix used in 
the reconstitution and the types of BMP proteins in the composition. The addition 
10 of other known growth factors, such as IGF I (insulin like growth factor I), to the 
final composition, may also effect the dosage. 

Progress can be monitored by periodic assessment of bone growth and/or 
repair. The progress can be monitored, for example, x-rays, histomorphometric 
determinations and tetracycline labeling. 
15 The following examples illusu^te practice of the present invention in 

recovering and characterizing murine PC-3 protein and employing the DNA it to 
recover human BMP-15 and other BMP-15-related proteins, obtaining the human 
proteins and expressing the proteins via recombinant techniques. 

EXAMPLES 

20 EXAMPLE 1 

Isolation of DNA 

DNA sequences encoding BMP-15 and BMP-15 related proteins, such as 
the murine PC-3 protein may be isolated by various techniques known to those 
skilled in the art. As described below, oligonucleotide primers may be designed 

25 on the basis of amino acid sequences present in other BMP proteins, Vg-1 related 
proteins and other proteins of the TGF-jS superfamily. Regions containing amino 
acid sequences which are highly conserved within the BMP family of proteins and 
within other members of the TGF-jS superfamily of proteins can be identified and 
consensus amino acid sequences of these highly conserved regions can be 

30 constructed based on the similarity of the corresponding regions of individual 
BMP/TGF-/3/Vg-l proteins. An example of such a consensus amino acid sequence 
is indicated below. 



17 



wo 96/36710 



PCTAJS96/06540 



Consensus amino acid sequence (1): 

Trp-Gln/Asn/Asp-Asp/Glu/Asn-Trp-Ile-Val/Ile-Ala (SEQ ID NO: #5) 
Where X/Y indicates that either amino acid residue may appear at that position. 

The following oligonucleotide is designed on the basis of the above 
S identified consensus amino acid sequence (1): 

#1: GCGGATCCTGGVANGABTGGATHRTNGC (SEQ ID N0:#6) 

This oligonucleotide sequence is synthesized on an automated DNA 
synthesizer. The standard nucleotide symbols in the above identified 
oligonucleotide primer are as follows: A,adenosine; C,cytosine; G,guanine; 
10 T,thymine; N,adenosine or cytosine or guanine or thymine; R,adenosine or 
cytosine; Y,cytosine or thymine; H,adenosine or cytosine or thymine; V,adenosine 
or cytosine or guanine; D,adenosine or guanine or thymine. 

The first eight nucleotides of oligonucleotide #1 (underlined) contain the 
recognition sequence for the restriction endonuclease BamHI in order to facilitate 
15 the manipulation of a specifically amplified DNA sequence encoding the PC-3 
protein and are thus not derived from the consensus amino acid sequence (1) 
presented above. 

A second consensus amino acid sequence is derived from another highly 
conserved region of BMP/TGF-)3 /Vg-1 proteins as described below: 
20 Asn-His-Ala-Ile-Val/Leu-Gln-Thr (SEQ ID NO:#7) 

The following oligonucleotide is designed on the basis of the above 
identified consensus amino acid sequence (2): 

#2: GCTCTAGAGTYTGNAYNATNGCRTGRTT (SEQ ID N0:8) 
This oligonucleotide sequence is synthesized on an automated DNA 
25 synthesizer. The same nucleotide symbols are used as described above. 

The first eight nucleotides of oligonucleotide #2 (underlined) contain the 
recognition sequence for the restriction endonuclease Xbal in order to facilitate the 
manipulation of a specifically amplified DNA sequence encoding the PC-3 protein 
and are thus not derived from the consensus amino acid sequence (2) presented 
30 above. 

It is contemplated that the PC-3 protein of the invention and other 
BMP/TGF-/3/Vg-l related proteins may contain amino acid sequences similar to 



18 



wo 96/36710 



PCTAJS96/06540 



the consensus amino acid sequences described above and that the location of those 
sequences within a BMP- 15 or PC-3 protem or other novel related proteins would 
correspond to the relative locations in the proteins from which they were derived. 
It is further contemplated that this positional information derived from the structure 
5 of other BMP/TGF-iS/Vg-l proteins and the oligonucleotide sequences #1 and #2 
which have been derived from consensus amino acid sequences (1) and (2), 
respectively, could be utilized to specifically amplify DNA sequences encoding the 
corresponding amino acids of a BMP-15 protein or other BMP/TGF-)3/Vg-l related 
proteins. 

10 Based on the knowledge of the gene structures of BMP/TGF-/3/Vg-l 

protems, it is further contemplated that human or murine genomic DNA can be 
useid as a template to perform specific amplification reactions which would result 
in the identification of BMP-15 BMP/TGF-)3/Vg-l (BMP-15 related protein) 
encoding sequences. Such specific amplification reactions of a human or murine 

15 genomic DNA template could be initialed with die use of oligonucleotide primers 
#1 and #2 described earlier. Oligonucleotides #1 and #2 identified above are 
utilized as primers to allow the specific amplification of a specific nucleotide 
sequence from murine genomic DNA. The amplification reaction is performed as 
follows: 

20 Murine genomic DNA is sheared by repeated passage through a 25 gauge 

needle, denamred at 100**C for 5 minutes and then chilled on ice before adding to 
a reaction mixture containing 200 /xM each deoxynucleotide triphosphates (dATP, 
dGTP, dCTP and dTTP), 10 mM Tris-HCl pH 8.3, 50 mM KCI, 1 .5 mM MgCIj, 
0.001% gelatin, 1.25 units Taq DNA polymerase, 50 pM oligonucleotide #1 and 

25 50 pM oligonucleotide #2, in a total reaction volume of 50 /xl. This reaction 
mixmre is subjected to thermal cycling in the following manner: 1 minute at 94°C, 
1 minute at 37°C, 2 minutes at 72°C for thirty cycles; followed by a 7 minute 
incubation at 72^C. 

The DNA which is specifically amplified by this reaction is ethanol 

30 precipitated, digested with the restriction endonucleases BamHI and Xbal and 
subjected to agarose gel electrophoresis. A region of the gel, corresponding to the 
predicted size of the BMP-15 or other BMP/TGF-i3/Vg-l encoding DNA fragment, 



19 



wo 96/36710 



PCTAJS96/06540 



is excised and the specifically amplified DNA fragments contained therein are 
electroeluted and subcloned into the plasmid vector pGEM-3 between the Xbal and 
BamHI sites of the polylinker. DNA sequence analysis of one of the resulting 
BMP- 15 related subclones indicates the specifically amplified DNA sequence 
5 product contained therein encodes a ponion of the BMP-15-related protein, mPC- 
3, of the invention. 

The DNA sequence (SEQ ID N0:9) and derived amino acid sequence (SEQ 
ID NO: 10) of this specifically amplified DNA fragment of mPC-3 are shown in 
the SEQUENCE Listings. 

10 Nucleotides #l-#26 of SEQ ID N0:9 comprise a ponion of oligonucleotide 

#1 and nucleotides #100-#119 comprise a portion of the reverse compliment of 
oligonucleotide #2 utilized to perform the specific amplification reaction. Due to 
the function of oligonucleotides #1 and #2 in initiating the amplification reaction, 
they may not correspond exactly to the acmal sequence encoding a PC-3 protein 

15 and are therefore not translated in the corresponding amino acid derivation (SEQ 
ID NO: 10). 

The following oligonucleotide probes are designed on the basis of the 
specifically amplified PC-3 murine DNA sequence set forth above (SEQ ID NO:9) 
and synthesized on an automated DNA synthesizer: 

20 #3 : TCCTCGTCTCTATACCCC AAATTACTGTAAAGGAATCTGT(SEQID 
NO: 11) and 

#4: ATCTGTACTCGGGTATTACCCTATGGTCTCAATTCACCC (SEQ ID 
N0:#12) 

25 

Oligonucleotide probes #3 and #4 are designed on the basis of nucleotides 
#27 - #66 and #61 - #99 of the murine PC-3 sequence set forth in SEQ ID NO: 
9. 

These oligonucleotide probes are radioactively labeled with ^^P and 
30 employed to screen a murine genomic library constructed in the vector XFIX II 
(Stratagene catalog #946309). 500,000 recombinants of the human genomic 
library are plated at a density of approximately 10,000 recombinants per plate on 



20 



wo 96/36710 



PCT/US96/06540 



50 plates. Duplicate nitrocellulose replicas of the recombinant bacteriophage 
plaques are made one set of nitrocellulose filters is hybridized to oligonucleotide 
probe #3 and the duplicate set of nitrocellulose filters is hybridized to 
oligonucleotide #4, both in a hybridization buffer consisting of 5X SSC, 1 % SDS, 
5 10% dextran sulfate, 2X Denhardt's, 100 /zg/ml herring sperm DNA) at 60T 
overnight. The following day the radioactively labelled oligonucleotide containing 
hybridization solution is removed an the filters are washed with 5X SSC, 0.1% 
SDS at 60°C. Two recombinants which hybridize to both oligonucleotide probes 
are identified and one is plaque purified. This plaque purified recombinant 

10 bacteriophage clone which hybridizes to the murine PC-3 oligonucleotide probes 
#3 and #4 is designated 060. A bacteriophage plate stock is made and 
bacteriophage DNA is isolated from the 060 murine genomic clone. The complete 
insen of the 060 murine genomic recombinant is excised with the restriction 
endonuclease Notl. subcloned into a plasmid vector (pBluescript) and DNA 

15 sequence analysis is performed. This plasmid subclone is designated mPC-3/NotI- 
18 and has been deposited with the American Type Culture Collection, 12301 
Parklawn Drive, Rockville, MD "ATCC" under the accession # 69777 on March 
30, 1995. This deposit meets the requirements of the Budapest Treaty of the 
International Recognition of the Deposit of Microorganisms for the Purpose of 

20 Patent Procedure and Regulations thereunder. 

The partial DNA sequence (SEQ ID N0:1) and derived amino acid 
sequence (SEQ ID N0:2) of the approximately 18 kb DNA insert of the plasmid 
subclone mPC-3/NotI-18, derived from clone 060, are shown in the Sequence 
Listings. 

25 It should be noted that nucleotides #765 -#837 of SEQ ID NO: 1 correspond 

to nucleotides #28-#99 of the specifically amplified murine PC-3 encoding DNA 
fragment set forth in SEQ ID NO: 9 thus confirming that the murine genomic 
bacteriophage clone 060 and derivative subclone mPC-3/NotI-18 encode at least 
a portion of the PC-3 protein of the invention. The nucleotide sequence of a 

30 portion of the 18 kb Notl insert of the plasmid mPC-3/NotI-18 contains an open 
reading frame of 885 base pairs, as defined by nucleotides #124-#1008 of SEQ 
IDN0:1. 



21 



wo 96/36710 



PCT/US96/06540 



The 5' limit of this open reading frame is defined by a stop codon at 
nucleotide positions #121 -#123. As this sequence is derived from a genomic clone 
it is difficult to determine the boundary between the 5' extent of coding sequence 
and the 3' limit of intervening sequence (intron/non-coding sequence), however, 
5 nucleotides #127-#154 are predicted to represent sequences characteristic of a 
splice acceptor site, including the invariant dinucleotide AG found at positions 
#153-#154, which delineate the 3' limit of an intron in genomic sequences. This 
predicts the 5' boundary of a single exon which encodes the entire mature peptide 
and a substantial ponion of the propeptide of the murine PC-3 protein of the 

10 invention. The 852 base pair open reading frame of this predicted exon 
(nucleotides #157-#1008 of SEQ ID N0:1) encodes at least 284 amino acids of the 
murine PC-3 protein of the invention. The encoded 284 amino acid murine PC-3 
protein includes the fiill mature murine PC-3 peptide (amino acids #1-#125 of SEQ 
ID NO:2), as well as the C-terminal portion of the propeptide region of the 

15 primary translation product (amino acid #-159 to #-1 of SEQ ID N0:2). 

Based on the knowledge of other BMP proteins and other proteins within 
the TGF-jS family, it is predicted that the precursor polypeptide would be cleaved 
at the multibasic sequence Arg-Ser-Val-Arg in agreement with a proposed 
consensus proteolytic processing sequence of Arg-X-X-Arg. Cleavage of the 

20 murine PC-3 precursor polypeptide is expected to generate a 125 amino acid 
mature peptide beginning with the amino acid Gin at position #1 of SEQ ID N0:2. 
The processing of murine PC-3 into the mature form is expected to involve 
dimerization and removal of the N-ierminal region in a maimer analogous to the 
processing of the related protein TGF-^ [Gentry et al., Molec & Cell. Biol. , 

25 8:4162 (1988); Derynck et al. Nature. 316:701 (1985)]. 

It is contemplated therefore that the mature active species of murine PC-3 
comprises a homodimer of two polypeptide subunits, each subunit comprising 
amino acids #1 to #125 of SEQ ID N0:1 with a predicted molecular weight of 
approximately 14,(XK) daltons. Further active species are contemplated comprising 

30 at least amino acids #24 to #125 of SEQ ID N0:2, thereby including the first 
conserved cysteine residue. 



wo 96/36710 PCT/US96/06540 

As with other members of the TGF-j8/BMP family of proteins, the 
carboxy-terminal portion of the murine PC-3 protein exhibits greater sequence 
conservation than the more amino-tenninal portion. The percent amino acid 
identity of the murine PC-3 protein in the cysteine-rich C-terminal domain (amino 
5 acids #24-#125) to the corresponding region of human BMP proteins and other 
proteins within the TGF-/3 family is as follows: BMP-2, 42%; BMP-3, 39%; 
BMP-4, 41 %; BMP-5. 39%; BMP-6, 40%; BMP-7, 38%; BMP-8, 35%; BMP-9, 
38%; BMP-10, 40%; BMP-11, 33%; Vgl, 39%; GDF-1, 32%; 26%; 
TGF-^2. 30%; TGF-i83, 29%; inhibina(B), 30%; inhibin a(A), 34%. 

10 The murine PC-3 DNA sequence (SEQ ID NO: 1), or a ponion thereof, can 

be used as a probe to identify a human cell line or tissue which synthesizes PC-3 
or PC-3-related mRNA. Briefly described, RNA is extracted from a selected cell 
or tissue source and either electrophoresed on a formaldehyde agarose gel and 
transferred to nitrocellulose, or reacted with formaldehyde and spotted on 

15 nitrocellulose directly. The nitrocellulose is then hybridized to a probe derived 
from the coding sequence of murine PC-3. 

Alternatively, the murine PC-3 sequence is used to design oligonucleotide 
primers which will specifically amplify a portion of the PC-3 or PC-3-related 
encoding sequence located in the region between the primers utilized to perform 

20 the specific amplification reaction. It is contemplated that these murine PC-3 
derived primers would allow one to specifically amplify corresponding human PC- 
3 or PC-3-related encoding sequences from mRNA, cDNA or genomic DNA 
templates. Once a positive source has been identified by one of the above 
described methods, mRNA is selected by oligo (dT) cellulose chromatography and 

25 cDNA is synthesized and cloned in XgtlO or other X bacteriophage vectors known 
to those skilled in the art, for example, XZAP by established techniques (Toole et 
al., supra) . It is also possible to perform the oligonucleotide primer directed 
amplification reaction, described above, directly on a pre-established human cDNA 
or genomic library which has been cloned into a X bacteriophage vector. In such 

3d cases, a library which yields a specifically amplified DNA product encoding a 
portion of the human PC-3 or PC-3-related protein could be screened directly, 



23 



wo 96/36710 



PCTAJS96/06540 



Utilizing the fragment of amplified human PC-3 or PC-3-related protein encoding 
DNA as a probe. 

Oligonucleotide primers designed on the basis of the DNA sequence of the 
murine PC-3 genomic clone 060 are predicted to allow the specific amplification 
5 of human PC-3 or PC-3-related encoding DNA sequences from pre-established 
human cDNA libraries which are commercially available (i.e., Stratagene, La 
JoUa, CA or Clonetech Laboratories, Inc., Palo Alto, CA). The following 
oligonucleotide primer is designed on the basis of nucleotides #728 to #747 of the 
DNA sequence set forth in SEQ ID N0:1 and synthesized on an automated DNA 
10 synthesizer: 

#5 : GCTTCCACCAACTAGGCTGG (SEQ ID NO: 13) 

The following oligonucleotide primer is designed on the basis of the reverse 
15 compliment of nucleotides #1007-#988 of the DNA sequence set forth in SEQ ID 
NO:l and synthesized on an automated DNA synthesizer: 

#6: CTACATGTACAGGACTGGGC (SEQ ID NO: 14) 

The standard nucleotide symbols in the above identified primers are as 
follows: A, adenine; C, cytosine; G, guanine; T, thymine. 

Primers #5 and #6 identified above are utilized as primers to allow the 
amplification of a specific PC-3 or PC-3-related encoding nucleotide sequence 
from pre-established cDNA libraries. 

Approximately 1 x 10^ pfu (plaque forming units) of Xbacteriophage 
libraries containing human cDNA inserts such as those detailed above are 
denatured at 95°C for five minutes prior to addition to a reaction mixture 
containing 200 each deoxy nucleotide triphosphates (dATP, dGTP, dCTP and 
dTTP) 10 mM Tris-HCl pH 8.3, 50 mM KCl, 1.5 mM MgClj, 0.001% gelatin, 
1.25 units Taq DNA polymerase, 100 pM oligonucleotide primer #4 and 100 pM 
oligonucleotide primer #5. The reaction mixture is then subjected to thermal 

24 



20 



25 



30 



wo 96/36710 



PCT/US96/06540 



cycling in the following manner: 1 minute at 94°C, 1 minute at 50°C, 1 minute at 
72°C for thirty-nine cycles followed by 10 minutes at IT'C. 

The DNA which is specifically amplified by this reaction would be 
expected to generate a PC-3 or PC-3-related protein-encoding product of 
5 approximately 280 base pairs. The resulting 280 bp DNA product is visualized 
following electrophoresis of the reaction products through a 2% agarose gel. 

Once a positive cDNA source has been identified in this manner, the 
corresponding cDNA library from which a PC-3 specific or PC-3-related sequence 
was amplified could be screened directly with the 280 bp insert or other PC-3 

10 specific probes in order to identify and isolate cDNA clones encoding the 
full-length PC-3 or PC-3-related protein of the invention. 

Additional methods known to those skilled in the art may be used to isolate 
other full-length cDNAs encoding human PC-3 related proteins, or full length 
cDNA clones encoding PC-3 related proteins of the invention from species other 

15 than humans, particularly other mammalian species. 

Alternatively, oligonucleotides #5 and #6 described above (SEQ ID N0:13 
and SEQ ID NO: 14) are utilized as primers to allow the specific amplification of 
murine PC-3 specific nucleotide sequences from murine PC-3 encoding plasmid 
niPC-3/NotI-18. The amplification reaction is performed as follows: 

20 Approximately 25 ng of mPC-3/NotI-18 plasmid DNA is added to a reaction 
mixture containing 200 /xM each deoxynucleotide triphosphates (dATP, dGTP, 
dCTP and dTTP) 10 mM Tris-HCl pH 8.3, 50 mM KCl, 1 .5 mM MgClj, 0.001 % 
gelatin, 1.25 units Taq DNA polymerase, 100 pM oligonucleotide primer #5 and 
100 pM oligonucleotide primer #6. The reaction mixture is then subjected to 

25 thermal cycling in the following manner: 1 minute at 94**C. 1 minute at 53°C, 1 
minute at 72**C for thirty cycles. 

The DNA which is specifically amplified by this reaction would be 
expected to generate a PC-3 or PC-3-related encoding product of approximately 
280 base pairs. The resulting 280 bp DNA product is visualized following 

30 electrophoresis of the reaction products through a 2% agarose gel. The region of 
the gel containing the 280 base pair murine PC-3 DNA fragment is excised and 
the specifically amplified DNA fragments contained therein are extracted (by 



25 



wo 96/36710 



PCTAJS96/06S40 



electroelution or by other methods known to those skilled in the art). The gel- 
extracted 280 base pair DNA amplification product was radioactively labelled with 
^^P and employed to screen a human genomic library constructed in the vector X 
DASH II (Stratagene catalog #945203). 

5 

Human BMP-15 

One million recombinants of the human genomic library are plated at a 
density of approximately 20,000 recombinants per plate on 50 plates. Duplicate 
nitrocellulose replicas of the recombinant bacteriophage plaques are hybridized, 

10 under reduced stringency conditions, to the specifically amplified 280 bp probe in 
standard hybridization buffer (SHB = 5X SSC, 0.1% SDS, 5X Denhardt's, 100 
fig/m\ sabnon sperm DNA) at 60T overnight. The following day the radioactively 
labelled oligonucleotide containing hybridization solution is removed an the filters 
are washed, under reduced stringency conditions, with 2X SSC, 0.1% SDS at 

15 60**C. Multiple positively hybridizing recombinants are identified and plaque 
purified. One of the recombinant bacteriophage clones which hybridizes to the 
280 base pair mPC-3 probe is designated XJLDcl9. This recombinant 
bacteriophage clone is plaque purified, a bacteriophage plate stock is made and 
bacteriophage DNA is isolated from the XJLX)cl9 human genomic clone. The 

20 bacteriophage >JLDcl9 has been deposited with the American Type Culture 
Collection, 12301 Parklawn Drive, Rockville, MD "ATCC" under the accession 
#97106 on March 30, 1995. This deposit meets the requirements of the Budapest 
Treaty of the International Recognition of the Deposit of Microorganisms for the 
Purpose of Patent Procedure and Regulations thereunder. 

25 The hybridizing region of this recombinant, XJLDcl9, is localized to a 3 

kb Eco RI fragment. This fragment is subcloned into a plasmid vector (pGEM-3) 
and DNA sequence analysis is performed. Iliis plasmid subclone is designated 
pGEMJLDc 19/3.0 and has been deposited with the American Type Culture 
Collection, 12301 Parklawn Drive, Rockville, MD "ATCC" under the accession 

30 #69779 on March 30, 1995. This deposit meets the requirements of the Budapest 
Treaty of the International Recognition of the Deposit of Microorganisms for the 
Purpose of Patent Procedure and Regulations thereunder. 



wo 96/36710 PCTAJS96/06540 

The partial DNA sequence (SEQ ID N0:3) and derived amino acid 
sequence (SEQ ID N0:4) of a portion of the 3.0 kb DNA insert of the plasmid 
subclone pGEMJLDcl9/3.0, derived from clone >JLDcl9, are shown in the 
Sequence Listings 

5 The DNA sequence of a portion of the 3.0 kb EcoRI insert of the plasmid 

pGEMJLDcl9/3.0 is set forth in SEQ ID N0:3. contains an contains an open - 
reading frame of 888 base pairs, as defined by nucleotides #489-#1376 of SEQ 
ID N0:4. 

The 5' limit of this open reading frame is defined by a stop codon at 

10 nucleotide positions #486-#488. As this sequence is derived from a genomic clone 
it is difficult to determine the boundary between the 5' extent of coding sequence 
and the 3* limit of intervening sequence (intron/non-coding sequence), however, 
nucleotides #498-#528 are predicted to represent sequences characteristic of a 
splice acceptor site, including the invariant dinucleotide AG found at positions 

15 #527-#528, which delineate the 3* limit of an intron in genomic sequences. This 
predicts the 5' boundary of a single exon which encodes the entire mature peptide 
and a substantial portion of the propeptide of the human PC-3 -related protein of 
the invention, designated BMP- 15. The 846 base pair open reading frame of this 
predicted exon (nucleotides #531hS'1376 of SEQ ID N0:3) encodes at least 282 

20 amino acids of the human BMP- 1 5 protein of the invention. The encoded 282 
amino acid human BMP-15 protein includes the fall mature human BMP-15 
peptide (amino acids #1-#125 of SEQ ID N0:4), as well as the C-terminal portion 
of the propeptide region of the primary translation product (amino acid #-157 to 
#-1 of SEQ ID N0:4). 

25 Based on the knowledge of other BMP proteins and other proteins within 

the TGF-i3 family, it is predicted that the precursor polypeptide would be cleaved 
at the multibasic sequence Arg-Arg-Thr-Arg in agreement with a proposed 
consensus proteolytic processing sequence of Arg-X-X-Arg. Cleavage of the 
human BMP-15 precursor polypeptide is expected to generate a 125 amino acid 

30 mamre peptide beginning with the amino acid Gin at position #1 of SEQ ID NO:4. 
The processing of human BMP-15 into the mature form is expected to involve 
dimerization and removal of the N-terminal region in a manner analogous to the 



27 



wo 96/36710 PCTAJS96/06540 

processing of the related protein TGF-jS [Gentry et al., Molec & CelL Biol. . 
8:4162 (1988); Deiynck et al. Nature , 316:701 (1985)]. 

It is contemplated therefore that the mature active species of human BMP- 
15 comprises a homodimer of two polypeptide subunits, each subunit comprising 
5 amino acids #1 to #125 of SEQ ID N0:4 with a predicted molecular weight of 
approximately 14,000 daltons. Further active species are contemplated comprising 
at least amino acids #24 to #125 of SEQ ID N0:4, thereby includmg the first 
conserved cysteine residue. As with other members of the TGF-)3/BMP family of 
proteins, the carboxy-terminal portion of the human BMP-15 protein exhibits 

10 greater sequence conservation than the more amino-terminal portion. The percent 
amino acid identity of the human BMP- 15 protein in the cysteine-rich C-terminal 
domain (amino acids #24 -#125) to the corresponding region of human BMP 
proteins and other proteins withm the TGF-j3 family is as follows: BMP-2, 43%; 
BMP.3. 35%; BMP-4, 42%; BMP-5, 41%; BMP.6, 41%; BMP-7, 39%; BMP-8, 

15 34%; BMP-9, 40%; BMP- 10, 43%; BMP-11, 32%; Vgl, 39%; GDF-1, 35%; 
TGF-j31, 28%; TGF-02, 30%; TGF-^3. 31%; inhibin a(B), 31%; inhibin a(A), 
33%, 

EXAMPLE 2 
W-20 BIOASSAYS 

20 A. Description of W-20 cells 

Use of the W-20 bone marrow stromal cells as an indicator cell line is 
based upon the conversion of these cells to osteoblast-like cells after treatment with 
a BMP protein [Thies et al. Journal of Bone and Mineral Research . 5:305 (1990); 
and Thies et al, Endocrinology , 130:1318 (1992)]. Specifically, W-20 cells are 

25 a clonal bone marrow stromal cell line derived from adult mice by researchers in 
the laboratory of Dr. D. Nathan, Children's Hospital, Boston, MA. Treatment of 
W-20 cells with certain BMP proteins results in (1) increased alkaline phosphatase 
production, (2) induction of PTH stimulated cAMP, and (3) induction of 
osteocalcin synthesis by the cells. While (1) and (2) represent characteristics 

30 associated with the osteoblast phenotype, the ability to synthesize osteocalcin is a 
phenotypic property only displayed by mature osteoblasts. Furthermore, to date 
we have observed conversion of W-20 stromal cells to osteoblast-like cells only 

28 



wo 96/36710 



PCT/US96/06540 



upon treatment with BMPs. In this manner, the in vitro activities displayed by 
BMP treated W-20 cells correlate with the in vivo bone forming activity known 
for BMPs. 

Below two in vitro assays useful in comparison of BMP activities of novel 
5 osteoinductive molecules are described. 

B. W-20 Alkaline Phosphatase Assav Protocol 
W-20 cells are plated into 96 well tissue culture plates at a density of 
10,000 cells per well in 200 ^1 of media (DME with 10% heat inactivated fetal 
calf serum, 2 mM glutamine and 100 Units/ml penicillin H- 100 /ig/ml 
10 streptomycin. The cells are allowed to attach overnight in a 95% air, 5% CO2 
incubator at 37°C. 

The 200 pi of media is removed from each well with a multichannel 
pipettor and replaced with an equal volume of test sample delivered in DME with 
10% heat inactivated fetal calf serum, 2 mM glutamine and 1% penicillin- 
15 streptomycin. Test substances are assayed in triplicate. 

The test samples and standards are allowed a 24 hour incubation period 
with the W-20 indicator cells. After the 24 hours, plates are removed from the 
37**C incubator and the test media are removed from the cells. 

The W-20 cell layers are washed 3 times with 200 ^1 per well of 
20 calcium/magnesium free phosphate buffered saline and these washes are discarded. 

50 /il of glass distilled water is added to each well and the assay plates are 
then placed on a dry ice/ethanol bath for quick freezing. Once frozen, the assay 
plates are removed from the dry ice/ethanol bath and thawed at 37'*C. This step 
is repeated 2 more times for a total of 3 freeze-thaw procedures. Once complete, 
25 the membrane bound alkaline phosphatase is available for measurement. 

50 /xl of assay mix (50 mM glycine, 0.05% Triton X-100, 4 mM MgClj, 
5 mM p-nitrophenol phosphate, pH = 10.3) is added to each assay well and the 
assay plates are then incubated for 30 minutes at 37 ^'C in a shaking waterbath at 
60 oscillations per minute. 
30 At the end of the 30 minute incubation, the reaction is stopped by adding 

100 /il of 0.2 N NaOH to each well and placing the assay plates on ice. 



29 



wo 96/36710 



PCTAJS96/06540 



The specirophotometric absorbance for each well is read at a wavelength 
of 405 nanometers. These values are then compared to known standards to give 
an estimate of the alkaline phosphatase activity in each sample. For example, 
using known amounts of p-nitrophenol phosphate, absorbance values are generated. 
5 This is shown in Table I. 



30 



wo 96/36710 



PCTAJS96/06540 



Table I 



Absorbance Values for Known Standards 
of P-Nitrophenol Phosphate 

P-nitrophenol phosphate umoles Mean absorbance (405 nm'> 



0.000 0 

0.006 0.261 +/- .024 

0.012 0.521 +/- .031 

0.018 0.797 +/- .063 

0.024 1.074 +/- .061 

0.030 1.305 +/- .083 



5 



Absorbance values for known amounts of BMPs can be determined and 
converted to pinoles of p-nitrophenol phosphate cleaved per unit time as shown in 
Table II. 



wo 96/36710 



PCTAJS96/06540 



Table U 



Alkaline Phosphatase Values for W-20 Cells 




Treating with BMP-2 




BMP-2 concentration 


Absorbance Reading 


umoles substrate 


ne/ml 


405 nmeters 


per hour 


0 


0.645 


0.024 


1.56 


0.696 


0.026 


3.12 


0.765 


0.029 


6.25 


0.923 


0.036 


12.50 


1.121 


0.044 


25.0 


1.457 


0.058 


50.0 


1.662 


0.067 


100.0 


1.977 


0.080 



These values are then used to compare the activities of known amounts of 
BMP-15 to BMP-2. 

C. Osteocalcin RIA Protocol 

W-20 cells are plated at 10^ cells per well in 24 well multiwell tissue 
culture dishes in 2 mis of DME containing 10% heat inactivated fetal calf serum, 
2 mM glutamine. The cells are allowed to attach overnight in an atmosphere of 
95% air5% COj at 37**C. 

The next day the medium is changed to DME containing 10% fetal calf 
serum, 2 mM glutamine and the test substance in a total volume of 2 ml. Each 
test substance is administered to triplicate wells. The test substances are incubated 
with the W-20 cells for a total of 96 hours with replacement at 48 hours by the 
same test medias. 

At the end of 96 hours, 50 /xl of the test media is removed from-each well 
and assayed for osteocalcin production using a radioinmiunoassay for mouse 
osteocalcin. The details of the assay are described in the kit manufactured by 
Biomedical Technologies Inc., 378 Page Su-eet, Stoughton, MA 02072. Reagents 
for the assay are found as product numbers BT-431 (mouse osteocalcin standard). 



32 



wo 96/36710 



PCTAJS96/06540 



BT-432 (Goat anti-mouse Osteocalcin), BT-431R (iodinated mouse osteocalcin), 
BT-415 (normal goat serum) and BT-414 (donkey ami goat IgG). The RIA for 
osteocalcin synthesized by W-20 cells in response to BMP treatment is carried out 
as described in the protocol provided by the manufacturer. 
5 The values obtained for the test samples are compared to values for known 

standards of mouse osteocalcin and to the amount of osteocalcin produced by W-20 
cells in response to challenge with known amounts of BMP-2. The values for 
BMP-2 induced osteocalcin synthesis by W-20 cells is shown in Table III. 

10 Table ID 

Osteocalcin Synthesis by W-20 Cells 
BMP-2 Concentration ng/ml Osteocalcin Svnthesis ng/we11 



0 


0.8 


2 


0.9 


4 


0.8 


8 


2.2 


16 


2.7 


31 


3.2 


62 


5.1 


125 


6.5 


250 


8.2 


500 


9.4 


1000 


10.0 



EXAMPLE 3 

ROSEN MODIFIED SAMPATH-REDDI ASSAY 

A modified version of the rat bone formation assay described m Sampath 
15 and Reddi, Proc. Natl. Acad. Sci. USA . 80:6591-6595 (1983) is used to evaluate 

bone and/or cartilage and/or other connective tissue activity of BMP proteins. 

This modified assay is herein called the Rosen-modified Sampath-Reddi assay. 

The ethanol precipitation step of the Sampath-Reddi procedure is replace by 

dialyzing (if the composition is a solution) or diafiliering (if the composition is a 
20 suspension) the fraction to be assayed against water. The solution or suspension 

is then equilibrated to 0. 1 % TFA. The resulting solution is added to 20 mg of rat 



wo 96736710 PCrAJS96/06540 

matrix, A mock rat matrix sample not treated with the protein serves as a control. 
This material is frozen and lyophilized and the resulting powder enclosed in #5 
gelatin capsules. The capsules are implanted subcutaneously in the abdominal 
thoracic area of 21-49 day old male Long Evans rats. The implants are removed 
5 after 7-14 days. Half of each implant is used for alkaline phosphatase analysis 
[see, Reddi et al, Proc. Natl. Acad. Sci. . 69:1601 (1972)]. 

The other half of each implant is fixed and processed for histological 
analysis. 1 ^m glycolmethacrylate sections are stained with Von Kossa and acid 
ftischin to score the amount of induced bone and cartilage and other connective 

10 tissue formation present in each implant. The terms + 1 through +5 represent the 
area of each histological section of an implant occupied by new bone and/or 
cartilage cells and matrix. A score of +5 indicates that greater than 50% of the 
implant is new bone and/or cartilage produced as a direct result of proteiii in the 
implant. A score of +4, +3, +2, and +1 would indicate that greater than 40%. 

15 30%, 20% and 10% respectively of the implant contains new cartilage and/or 
bone. 

Alternatively, the implants are inspected for the appearance of tissue 
resembling embryonic tendon, which is easily recognized by the presence of dense 
bundles of fibroblasts oriented in the same plane and packed tightly together. 

20 [Tendon/ligament-like tissue is described, for example, in Ham and Cormack, 
Histology (JB Lippincott Co. (1979), pp. 367-369, the disclosure of which is 
hereby incorporated by reference]. These findings may be reproduced in 
additional assays in which tendon/ligament-like tissues are observed in the BMP- 
15-related protein containing implants. 

25 The BMP-15-related proteins of this invention may be assessed for activity 

on this assay. 

EXAMPLE 4 

Expression of BMP- 15 
30 In order to produce murine, human or other mammalian BMP-15-related 

proteins, the DNA encoding it is transferred into an appropriate expression vector 
and introduced into manunalian cells or other preferred eukaryotic or prokaryotic 



34 



wo 96/36710 



PCT/US96/06540 



hosts by conventional genetic engineering techniques. The preferred expression 
system for biologically active recombinant human BMP- 15 is contemplated to be 
stably transformed mammalian cells. 

One skilled in the art can construct mammalian expression vectors by 
5 employing the sequence of SEQ ID NO: 1 or SEQ ID NO: 3, or other DNA 
sequences encoding BMP- 15 -related proteins or other modified sequences and 
known vectors, such as pCD [Okayama et al. , Mol. Cell BioL , 2: 161-170 (1982)], 
pJL3, pJlA [Gough et al., EMBO 4:645-653 (1985)] and pMT2 CXM. 

The mammalian expression vector pMT2 CXM is a derivative of p91023(b) 

10 (Wong et al.. Science 228:810-815, 1985) differing from the latter in that it 
contains the ampicillin resistance gene in place of the tetracycline resistance gene 
and further contains a Xhol site for insertion of cDNA clones. The functional 
elements of pMT2 CXM have been described (Kaufman, R.J., 1985, Proc. Natl. 
Acad. Sci. USA 82:689-693) and include the adenovirus VA genes, the SV40 

15 origin of replication including the 72 bp enhancer, the adenovirus major late 
promoter including a 5' splice site and the majority of the adenovirus tripartite 
leader sequence present on adenovirus late mRNAs, a 3' splice acceptor site, a 
DHFR insert, the SV40 early polyadenylation site (SV40), and pBR322 sequences 
needed for propagation in R coli. 

20 Plasmid pMT2 CXM is obtained by EcoRI digestion of pMT2-VWF, which 

has been deposited with the American Type Culnire Collection (ATCC), Rockvijle, 
MD (USA) under accession number ATCC 67122. EcoRI digestion excises the 
cDNA insert present in pMT2-VWF, yielding pMT2 in linear form which can be 
ligated and used to transform E. coli HB 101 or DH-5 to ampicillin resistance. 

25 Plasmid pMT2 DNA can be prepared by conventional methods. pMT2 CXM is 
then constructed using loopout/in mutagenesis [Morinaga, et al. , Biotechnolopv 84: 
636 (1984). This removes bases 1075 to 1 145 relative to the Hind III site near the 
SV40 origin of replication and enhancer sequences of pMT2. In addition it insens 
the following sequence: 

30 5' PO-CATGGGCAGCTCGAG-3' 

at nucleotide 1145. This sequence contains the recognition site for the restriction 
endonuclease Xho I. A derivative of pMT2CXM, termed pMT23, contains 



35 



wo 96/36710 



PCTAJS96/06540 



recognition sites for the restriction endonucleases PstI, Eco RI, Sail and Xhol. 
Plasmid pMT2 CXM and pMT23 DNA may be prepared by conventional methods. 

pEMC2)Sl derived from pMT21 may also be suitable in practice of the 
invention. pMT21 is derived from pMT2 which is derived from pMT2-VWF. As 
5 described above EcoRI digestion excises the cDNA insert present in pMT-VWF, 
yielding pMT2 in linear form which can be ligated and used to transform R Coli 
HB 101 or DH-5 to ampicillin resistance. Plasmid pMT2 DNA can be prepared 
by conventional methods. 

pMT21 is derived from pMT2 through the following two modifications. 
10 First, 76 bp of the 5' untranslated region of the DHFR cDNA including a stretch 
of 19 G residues from G/C tailing for cDNA cloning is deleted. In this process, 
a Xhol site is inserted to obtain the following sequence immediately upstream from 
DHFR: 5' -CTGCAGGCGAGCC TGAATTCCTCGAGC CATCATG-3' 



15 



PstI Eco RI Xhol 



Second, a unique Clal site is introduced by digestion with EcoRV and Xbal, 
treatment with Klenow fragment of DNA polymerase I, and ligation to a Clal 
linker (CATCGATG). This deletes a 250 bp segment from the adenovirus 
associated RNA (VAI) region but does not interfere with VAI RNA gene 

20 expression or function. pMT21 is digested with EcoRI and Xhol, and used to 
derive the vector pEMC2Bl. 

A portion of the EMCV leader is obtained from pMT2-ECATl [S.K. Jung, 
et al, LVirol 63:1651-1660 (1989)] by digestion with Eco RI and Psd, resulting 
in a 2752 bp fragment. This fragment is digested with TaqI yielding an Eco RI- 

25 TaqI fragment of 508 bp which is purified by electrophoresis on low nielting 
agarose gel. A 68 bp adapter and its complementary strand are synthesized with 
a 5' TaqI protruding end and a 3' Xhol protruding end which has the following 
sequence: 



30 5 *-CGAGGTTAAAAAACGTCTAGGCCCCCCGAACCACGGGG ACGTGGTTTTCCTTT 
TaqI 

G AAAAACACGATTGC-S ' 
Xhol 

35 



36 



wo 96/36710 



PCTAJS96/06S40 



This sequence matches the EMC virus leader sequence from nucleotide 763 to 827. 
It also changes the ATG at position 10 within the EMC virus leader to an ATT 
and is followed by a Xhol site. A three way ligation of the pMT21 Eco Rl-Xhol 
fragment, the EMC virus EcoRI-TaqI fragment, and the 68 bp 
5 oligonucleotide adapter Taql-Xhol adapter resulting in the vector pEMC2i31. 

This vector contains the SV40 origin of replication and enhancer, the 
adenovirus major late promoter, a cDNA copy of the majority of the adenovirus 
tripartite leader sequence, a small hybrid intervening sequence, an SV40 
polyadenylation signal and the adenovirus VA I gene, DHFR and /3-lactamase 

10 markers and an EMC sequence, in appropriate relationships to direct the high level 
expression of the desired cDNA in mammalian cells. 

The construction of vectors may involve modification of the BMP- 15- 
related DNA sequences. For instance, BMP-15 cDNA can be modified by 
removing the non-coding nucleotides on the 5' and 3' ends of the coding region. 

15 The deleted non-coding nucleotides may or may not be replaced by other 
sequences known to be beneficial for expression. These vectors are transformed 
into appropriate host cells for expression of BMP- 15 -related proteins. 
Additionally, the sequence of SEQ ID NO:l or SEQ ID NO: 3 or other sequences 
encoding BMP-15-related proteins can be manipulated to express a mature BMP- 

20 15-related protein by deleting BMP-15 encoding propeptide sequences and 
replacing them with sequences encoding the complete propeptides of other BMP 
proteins. 

One skilled in the art can manipulate the sequences of SEQ ID NO: 1 or 
SEQ ID NO: 3 by eliminating or replacing the mammalian regulatory sequences 

25 flanking the coding sequence with bacterial sequences to create bacterial vectors 
for intracellular or extracellular expression by bacterial cells. For example, the 
coding sequences could be further manipulated (e.g. ligated to other known linkers 
or modified by deleting non-coding sequences therefrom or altering nucleotides 
therein by other known techniques). The modified BMP- 15-related coding 

30 sequence could then be inserted into a known bacterial vector using procedures 
such as described in T. Taniguchi et al,, Proc. Natl Acad. Sci. USA . 77:5230- 
5233 (1980). This exemplary bacterial vector could then be transformed into 



37 



wo 96/36710 PCT/US96/06540 

bacterial host cells and a BMP-15-related protein expressed thereby. For a 
strategy for producing extracellular expression of BMP-15-related proteins in 
bacterial cells, see, e.g. European patent application EPA 177,343. 

Similar manipulations can be performed for the construction of an insect 
5 vector [See, e.g. procedures described in published European patent application 
155,476] for expression in insect cells. A yeast vector could also be constructed 
employing yeast regulatory sequences for intracellular or extracellular expression 
of the factors of the present invention by yeast cells. [See, e.g., procedures 
described in published PCT application WO86/00639 and European patent 

10 application EPA 123,289]. 

A method for producing high levels of a BMP-15-related protein of the 
invention in manunalian cells may involve the construction of cells containing 
multiple copies of the heterologous BMP-15-related gene. The heterologous gene 
is linked to an amplifiable marker, e.g. the dihydrofolate reductase (DHFR) gene 

15 for which cells containing increased gene copies can be selected for propagation 
in increasing concentrations of methotrexate (MTX) according to the procedures 
of Kaufman and Sharp. J. Mol. Biol. . 159:601-629 (1982). This approach can be 
employed with a number of different cell types. 

For example, a plasmid containing a DNA sequence for a BMP-15-related 

20 protein of the invention in operative asisociation with other plasmid sequences 
enabling expression thereof and the DHFR expression plasmid pAdA26SV(A)3 
[Kaufman and Shaip, MoL Cell. BioL , 2:1304 (1982)] can be co-introduced into 
DHFR-deficient GHO cells, DUKX-BII, by various methods including calcium 
phosphate coprecipitation and transfection, electroporation or protoplast fusion. 

25 DHFR expressing transformants are selected for growth in alpha media with 
dialyzed fetal calf serum, and subsequently selected for amplification by growth 
in increasing concentrations of MTX (e.g. sequential steps in 0.02, 0.2, 1.0 and 
5uM MTX) as described in Kaufman et al., Mol Cell BioL . 5:1750 (1983). 
Transformants are cloned, and biologically active BMP-15 expression is monitored 

30 by the Rosen-modified Sampath-Reddi rat bone formation assay described above 
in Example 3. BMP-15 protein expression should increase with increasing levels 
of MTX resistance. BMP-15 polypeptides are characterized using standard 



38 



wo 96/36710 



PCT/US96/06540 



techniques known in the art such as pulse labeling with [35S] methionine or 
cysteine and polyacrylamide gel electrophoresis. Similar procedures can be 
followed to produce other related BMP-15-related proteins. 
EXAMPLES 
5 Biological Activity of Expressed BMP-15 

To measure the biological activity of the expressed BMP-15-related proteins 
obtained in Example 4 above, the proteins are recovered from the cell culture and 
purified by isolating the BMP-15-related proteins from other proteinaceous 
materials with which they are co-produced as well as from other contaminants. 
10 The purified protein may be assayed in accordance with the rat bone formation 
assay described in Example 3. 

Purification is carried out using standard techniques known to those skilled 
in the art. 

Protein analysis is conducted using standard techniques such as SDS-PAGE 
15 acrylamide [Laemmli, Nature 227:680 (1970)] stained with silver [Oakley, et al. 
Anal. Biochem. 105:361 (1980)] and by immunoblot [Towbin, et al. Proc. Natl. 
Acad. Sci. USA 76:4350 (1979)] 
EXAMPLE 6 

Using Northern analysis, BMP-15 and BMP-15-related proteins can be 
20 tested for their effects on various cell lines. Suitable cell lines include cell lines 
derived from E13 mouse limb buds. After 10 days of treatment with BMP-15 or 
BMP-15-related protein, the cell phenotype is examined histologically for 
indications of tissue differentiation. In addition, Northern analysis of mRNA from 
BMP-15 or BMP-15-related protein treated cells can be performed for various 
25 markers including one or more of the following markers for bone, cartilage and/or 
tendon/ligament, as described in Table IV: 



39 



wo 96/36710 



PCTAJS96/06540 



Marker Bone 

Osteocalcin + 

Alkaline Phosphatase + 
Proteoglycan Core Protein 

Collagen Type I + 
Collagen Type n 

Decorin + 

Elastin +/.^ 



Table IV 

Cartilage 



+ 

7 



Tendon/Ligament 



+2 



10 1- Marker seen early, marker not seen as mature bone tissue forms 

2- Marker depends upon site of tendon; strongest at bone interface 

3- Marker seen at low levels 



The foregoing descriptions detail presently preferred embodiments of the 
15 present invention. Numerous modifications and variations in practice thereof are 
expected to occur to those skilled in the art upon consideration of these descrip- 
tions. Those modifications and variations are believed to be encompassed within 
the claims appended hereto. 



40 



wo 96/36710 



PCT/US96/06540 



SEQUENCE LISTING 



(1) GENERAL INFORMATION: 



(i) APPLICANT: Celeste, Anthony J 
Dube, Jennifer L 
Lyons , Karen 
Hogan, Brigid 

(ii) TITLE OF INVENTION: BMP- 15 COMPOSITIONS 

(iii) NUMBER OF SEQUENCES: 14 



(iv) CORRESPONDENCE ADDRESS: 

(A) ADDRESSEE: Genetics Institute, Inc. 

(B) STREET: 87 CambridgePark Drive 

(C) CITY: Cambridge 

(D) STATE: Massachusetts 

(E) COUNTRY: US 

(F) ZIP: 02140 

(v) COMPUTER READABLE FORM: 

(A) MEDIUM TYPE: Floppy disk 

(B) COMPUTER: IBM PC compatible 

(C) OPERATING SYSTEM: PC-DOS/MS-DOS 

(D) SOFTWARE: Patentin Release #1.0, Version #1.25 

(vi) CURRENT APPLICATION DATA: 

(A) APPLICATION NUMBER: 

(B) FILING DATE: 

( C ) CLASSIFICATION : 

(viii) ATTORNEY/AGENT INFORMATION: 
(A) NAME: Lazar, Steven R. 
^B) REGISTRATION NUMBER: 32,618 
(C) REFERENCE /DOCKET NUMBER: GI 5256 

(ix) TELECOMMUNICATION INFORMATION: 

(A) TELEPHONE: (617) 498-8260 

(B) TELEFAX: (617) 876-5851 



(2) INFORMATION FOR SEQ ID N0:1: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 1541 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: doilble 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 

(vi) ORIGINAL SOURCE: 
(B) STRAIN: PC- 3 

(ix) FEATURE: 

(A) NAME/KEY: CDS 

(B) LOCATION: 157.. 1008 

(ix) FEATURE: 

(A) NAME/KEY: sig_peptide 

(B) LOCATION: 157.. 633 

(ix) FEATURE: 

(A) NAME/KEY: matjpeptide 

(B) LOCATION: 634.. 1008 



41 



wo 96/36710 



PCT/US96/06540 



(xi) SEQUENCE DESCRIPTION: SEQ ID N0:1: 

ACATTAGTAA AGTGCTCAAT AAAATGATAA AATGCATTAA TATCATGAGC TAATTTTAGG 60 

GCTAATTGCA ACTCTCAGTT TACATTCAGA GGTTTTCTAA GGGATGTTCA 6TTAAGACAC 120 

TAATGGTCTG CCCTGTTCTT TCACATTTGT GCAGGT TCC TGG CAT GTA CAG ACC 174 

Ser Trp His Val Gin Thr 
-159 -155 

CTG GAC TTT CCT CTA GCA TCA AAC CAG GTA GCA TAC GAA CTA ATC AGA 222 
Leu Asp Phe Pro Leu Ala Ser Asn Gin Val Ala Tyr Glu Leu lie Arg 
-150 -145 -140 

GCC ACT GTG GTT TAC CGC CAT CAA CTT CAT CTA GTT AAT TAC CAT CTC 270 
Ala Thr Val Val Tyr Arg His Gin Leu His Leu Val Asn Tyr His Leu 
-135 -130 -125 

TCC TGC CAT GTG GAA ACT TGG GTT CCT AAA TGC CGG ACC AAG CAC TTA 318 
Ser Cys His Val Glu Thr Trp Val Pro Lys Cys Arg Thr Lys His Leu 
-120 -115 -110 

CCT TCT TCT AAA TCG GGT TCC TCA AAG CCT TCT CCC ATG TCT AAA GCC 366 
Pro Ser Ser Lys Ser Gly Ser Ser Lys Pro Ser Pro Met Ser Lys Ala 
-105 -100 -95 -90 

TGG ACA GAG ATA GAT ATT ACA CAT TGT ATT CAG CAG AAG CTC TGG AAT 414 
Trp Thr Glu lie Asp He Thr His Cys He Gin Gin Lys Leu Trp Asn 
-85 -80 -75 

CGC AAG GGA CGG AGT GTT CTT CGC CTC CGC TTC ATG TGT CAG CAG CAA 462 
Arg Lys Gly Arg Ser Val Leu Arg Leu Arg Phe Met Cys Gin Gin Gin 
-70 -65 -60 

AAA GGC AAT GAG ACT CGT GAG TTC CGG TGG CAT GGC ATG ACA TCC TTG 510 
Lys Gly Asn Glu Thr Arg Glu Phe Arg Trp His Gly Met Thr Ser Leu 
-55 -SO -45 

GAT GTT GCC TTC TTG CTA CTC TAT TTC AAT <3AC ACC GAT GAC AGA GTT 558 
Asp Val Ala Phe Leu Leu Leu Tyr Phe Asn Asp Thr Asp Asp Arg Val 
-40 -35 -30 

CAG GGT AAA CTT CTT GCA AGA GGC CAA <3AG GAG TTA ACT GAT AGG GAA 606 
Gin Gly Lys Leu Leu Ala Tlrg Gly Gin Glu Glu Leu Thr Asp Arg Glu 
-25 -20 -15 -10 

TCT TCT TTT CTC ATG C<3G AGT GTC CGC CAA <3CA TGC AGC ATT GAA TCT 654 
Ser Ser Phe Leu Met Arg Ser Val Arg Gin Ala Cys Ser lie -Glu Ser 
-5 15 

GAT GCC TCT TGT CCT TCT CAG GAA CAT GAT GGG TCT GTA AAT AAC CAG 702 
Asp Ala Ser Cys Pro Ser Gin Glu His Asp Gly Ser Val Asn Asn Gin 
10 15 20 

TGT TCC CTC CAT CCT TAC AAG GTC AGC TTC CAC CAA CTA GGC TGG <3AT 750 
Cys Ser Leu His Pro Tyr Lys Val Ser Phe His Gin Leu Gly Trp Asp 
25 30 35 

CAC TGG ATC ATT GCT CCT GGT CTC TAT ACC CCA AAT TAC T<3T AAA GGA 798 
His Trp He He Ala Pro Arg Leu Tyr Thr Pro Asn Tyr Cys Lys Gly 
40 45 50 55 

ATC TGT ACT CGG GTA TTA CCC TAT GGT CTC AAT TCA CCC AAC CAT GCC 846 
He Cys Thr Arg Val Leu Pro Tyr Gly Leu Asn Ser Pro Asn His Ala 
60 65 70 



42 



wo 96/36710 



PCTAJS96/06540 



ATC ATT CAG AGC CTT GTC AAT GAA CTA GTG AAT CAC AGT GTA CCT CAG 894 
He He Gin Ser Leu Val Asn Glu Leu Val Asn His Ser Val Pro Gin 
75 80 85 

CCT TCC TGT GTC CCT TAT AAT TTT CTT CCT ATG AGC ATC . CTC CTG ATT 942 
Pro Ser Cys Val Pro Tyr Asn Phe Leu Pro Met Ser He Leu Leu He 
90 95 100 

GAG ACC AAC GGG AGT ATC TTG TAC AAG GAG TAT GAG GGT ATG ATT GCC 990 
Glu Thr Asn Gly Ser He Leu Tyr Lys Glu Tyr Glu Gly Met He Ala 
105 110 115 

CAG TCC TGT ACA TGT AG A TAATAGTGAA GTTGTTGCTA TCTCAGGTTT 1038 
Gin Ser Cys Thr Cys Arg 
120 125 



CCCAAGAAGC 


TATAGATGTT 


TAAAGAAAAC 


TGTGTTAAAG 


CTGGCAGTGA 


TCGAGTCGAC 


1098 


GCCCTATAGT 


GAGTCGTATT 


AGAGCTCGCG 


GCCGCCAOCG 


CGGTGGAGCT 


CCAATTCGCC 


1158 


CTATAGTGAG 


TCGTATTACG 


CGCGCTCACT 


GGCCGTCGTT 


TTACAACGTC 


GTGACTGGGA 


1218 


AAACCCTGGC 


GTTACCCAAC 


TTAATCGCCT 


TGCAGCACAT 


CCCCCTTTCG 


CCAGCTGGCG 


1278 


TAATAGCGAA 


GAGGGCCGCA 


CCGATCGCCC 


TTCCCAACAG 


TTGCGCAGCC 


TGAATGGCGA 


1338 


ATGGAAATTG 


TAAGCGTTAA 


TATTTTGTTA 


AT^TTCGCGT 


TAAATTTTTG 


GTAAATCAGC 


1398 


TCATTTTTTA 


ACCAATAGGC 


CGAAATCGGC 


AAAATCCCTT 


ATAAATCAAA 


AGAATAGACC 


1458 


AGATAGGGTT 


GGAGTGTTTG 


TTCCAGTTTG 


GGGACAAGAG 


TCCACTATTA 


AAGAACGTGG 


1518 


GACTCCAACG 


TCAAAGGGCG 


AAA 








1541 



(2) INFORMATION FOR SEQ ID NO: 2: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 284 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:2: 

Ser Trp His Val Gin Thr Leu Asp Phe Pro Leu Ala Ser Asn Gin Val 
-159 -155 -150 -145 

Ala Tyr Glu Leu He Arg Ala Thr Val Val Tyr Arg His Gin Leu His 
-140 -135 -130 

Leu Val Asn Tyr His Leu Ser Cys His Val Glu Thr Trp Val Pro Lys 
-125 -120 -115 

Cys Arg Thr Lys His Leu Pro Ser Ser Lys Ser Gly Ser Ser Lys Pro 
"110 -105 -100 

Ser Pro Met Ser Lys Ala Trp Thr Glu He Asp He Thr His Cys He 
-95 -90 -85 -80 

Gin Gin Lys Leu Trp Asn Arg Lys Gly Arg Ser Val Leu Arg Leu Arg 
-75 -70 -65 

Phe Met Cys Gin Gin Gin Lys Gly Asn Glu Thr Arg Glu Phe Arg Trp 
-60 -55 -50 



43 



wo 96/36710 



PCTAJS96/06540 



His Gly Met Thr Ser Leu Asp Val Ala Phe Leu Leu Leu Tyr Phe Asn 
-45 -40 -35 

Asp Thr Asp Asp Arg Val Gin Gly Lys Leu Leu Ala Arg Gly Gin Glu 
-30 -25 -20 

Glu Leu Thr Asp Arg Glu Ser Ser Phe Leu Met Arg Ser Val Arg Gin 
-15 -10 -5 1 

Ala Cys Ser lie Glu Ser Asp Ala Ser Cys Pro Ser Gin Glu His Asp 
B 10 15 

Gly Ser Val Asn Asn Gin Cys Ser Leu His Pro Tyr Lys Val Ser Phe 
20 25 30 

His Gin Leu Gly Trp Asp His Trp lie lie Ala Pro Arg Leu Tyr Thr 
35 40 45 

Pro Asn Tyr Cys Lys Gly lie Cys Thr Arg Val Leu Pro Tyr Gly Leu 
50 55 60 65 

Asn Ser Pro Asn His Ala lie lie Gin Ser Leu Val Asn Glu Leu Val 
70 75 BO 

Asn His Ser Val Pro Gin Pro Ser Cys Val Pro Tyr Asn Phe Leu Pro 
85 90 95 

Met Ser lie Leu Leu lie Glu Thr Asn Gly Ser lie Leu Tyr Lys Glu 
100 105 110 

Tyr Glu Gly Met lie Ala Gin Ser Cys Thr Cys Arg 
115 120 125 

(2) INFORMATION FOR SEQ ID NO: 3: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 1609 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS : double 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 

(vi) ORIGINAL SOURCE: 

(B) STRAIN: hBMP-15 

(ix) FEATURE: 

(A) NAME/KEY: CDS 

(B) LOCATION: 531.. 1376 

(ix) FEATURE: 

(A) NAME/KEY: sig_j)eptide 

(B) LOCATION: 531.. 1001 

(ix) FEATURE: 

(A) NAME/KEY: matjpeptide 

(B) LOCATION: 1002.. 1376 

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3: 

AAGCTGCATC TGTATAGTGA TATGACATGA GACTCTTCTT AATCCATGTA TGTTCCAACA 60 

ATTCTAAATG GACACATTAA TGGTCAACTA AT;\ATAATAT TGATCTTCTC CCCTACATAC 120 

AGTATGCACA CAAGATAATT CTATATTTGA GTTTTTTCCC CCGAGCCCAG CACTGTAAGT 180 



44 



wo 96/36710 



PCTAJS96/06540 



AATCTAACAG TGAGACAGTT TCTCTTAAGA AAAACAGACT TGGGTTCAAA TCTTAACTCT 24 0 

ACCACATACC AGCTGTGTGT CCTTTGTCAT AGCTTCTCTG AGCCTCAATT TCCTTATCTG 300 

CAAAATGGGG ATAATAACTA TCTCATAAGA CTATTAAGAA TTAAAGAGCT AATACATGTA 360 

AAGCATCTAG TGTATTAGTA AGTGCTCAGT AT^TGATAGT ATCATTATCT TGAGTTAATT 420 

TTAGGGCTGA TTATAGCTAT CAGTCTATAT CAAGACAGTT TATGAGGAAT ATTCATGTTA 480 

AGAGGTAAGA AGCTAAACCT CTGCTCTTGT TCCCTCTTAC TTCTGCAGGT ACC TGG 536 

Thr Trp 
-157 

CAT ATA CAG ATC CTG GGC TTT CCT CTC AGA CCA AAC CGA GGA CTA TAC 584 
His lie Gin lie Leu Gly Phe Pro Leu Arg Pro Asn Arg Gly Leu Tyr 
-155 .150 .145 .140 

CAA CTA GTT AGA GCC ACT GTG GTT TAC CGC CAT CAT CTC CAA CTA ACT 632 
Gin Leu Val Arg Ala Thr Val Val Tyr Arg His His Leu Gin Leu Thr 
-135 -130 -125 

CGC TTC AAT CTC TCC TGC CAT GTG GAG CCC TGG GTG CAG AAA AAC CCA 680 
Arg Phe Asn Leu Ser Cys His Val Glu Pro Trp Val Gin Lys Asn Pro 
-120 -115 -110 

ACC AAC CAC TTC CCT TCC TCA GAA GGA GAT TCC TCA AAA CCT TCC CTG 728 
Thr Asn His Phe Pro Ser Ser Glu Gly Asp Ser Ser Lys Pro Ser Leu 
-105 -100 -95 

ATG TCT AAC GCT TGG AAA GAG ATG GAT ATC ACA CAA CTT GTT CAG CAA 776 
Met ser Asn Ala Trp Lys Glu Met Asp He Thr Gin Leu Val Gin Gin 
-90 -85 -80 

AGG TTC TGG AAT AAC AAG <3GA CAC AGG ATC CTA CGA CTC CGT TTT ATG 824 
Arg Phe Trp Asn Asn Lys Gly His Arg He Leu Arg Leu Arg Phe Met 
-75 -70 -65 -60 

TGT CAG CAG CAA AAA GAT AGT GGT GGT CTT GAG CTC TGG CAT GGC ACT 872 
Cys Gin Gin Gin Lys Asp Ser Gly Cly Leu <31u Leu Trp His Cly Thr 
-55 -50 -45 

TCA TCC TTG GAC ATT GCC TTC TTG TTA CTC TAT TTC AAT GAT ACT CAT 920 
Ser Ser Leu Asp He Ala Phe Leu Leu Leu Tyr Phe Asn Asp Thr His 
-40 -35 -30 

AAA AGC ATT CGG AAG GCT AAA TTT CTT CCC AGG <3GC ATG GAG GAG TTC 968 
Lys Ser He Arg Lys Ala Lys Phe Leu Pro Arg Gly Met Glu Glu Phe 
-25 -20 -15 

ATG GAA AGG GAA TCT CTT CTC CGG AGA ACC CGA CAA GCA <3AT CGT ATC 1016 
Met Glu Arg Glu Ser Leu Leu Arg Arg Thr Arg Gin Ala Asp Gly He 
-10 -5 15 

TCA GCT GAG GTT ACT CCC TCT TCC TCA AAA CAT AGC GGG CCT GAA AAT 1064 
Ser Ala Glu Val Thr Ala Ser Ser Ser Lys His Ser Gly Pro Glu Asn 
10 15 20 

AAC CAG TGT TCC CTC CAC CCT TTC CAA ATC AGC TTC CGC CAG CTG GGT 1112 
Asn Gin Cys Ser Leu His Pro Phe Gin He Ser Phe Arg Gin Leu Gly 
25 30 35 

TGG CAT CAC TGG ATC ATT GCT CCC CCT TTC TAC ACC CCA AAC TAC TGT 1160 
Trp Asp His Trp He He Ala Pro Pro Phe Tyr Thr Pro Asn Tyr Cys 
40 45 50 

AAA GGA ACT TGT CTC CGA CTA CTA CGC GAT GGT CTC AAT TCC CCC AAT 1208 



45 



wo 96/36710 



PCTAJS96/0654O 



Lys Gly Thr Cys Leu Arg Val Leu Arg Asp Gly Leu Asn Ser Pro Asn 
55 60 65 

CAC GCC ATT ATT CAG AAC CTT ATC AAT CAG TTG GTG GAC CAG AGT GTC 1256 
His Ala lie lie Gin Asn Leu lie Asn Gin Leu Val Asp Gin Ser Val 
70 75 80 85 

CCC CGG CCC TCC TGT GTC CCG TAT AAG TAT GTT CCA ATT AGT GTC CTT 1304 
Pro Arg Pro Ser Cys Val Pro Tyr Lys Tyr Val Pro lie Ser Val Leu 
90 95 100 

ATG ATT GAG GCA AAT GGG AGT ATT TTG TAC AAG GAG TAT GAG GGT ATG 1352 
Met lie Glu Ala Asn Gly Ser lie Leu Tyr Lys Glu Tyr Glu Gly Met 
105 110 115 

ATT GCT GAG TCT TGT ACA TGC AGA TGACAGCAAC AGTACGGCTA GATCAGGTTT 1406 
lie Ala Glu Ser Cys Thr Cys Arg 
120 125 

CCCAGGAAAC TGGAGGAGAG TTTAAAATAT CAGTGTTAAA GCTGCAAGTA ATCCTGTACC 1466 

AATCTGTAGG TTATATTTCT TGCCTTAAGT GTTACTTAAG TCTCTTCCCC CACTTGTGAG 1526 

CTAGTCAGTT TATAGAAACA GTTCTGATAC CAGTCCCCTA GCATGAATCA GTACAGAGTT 1586 

GACACTAATC AGAGCCCTTA ATG 1609 

(2) INFORMATION FOR SEQ ID N0:4: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 282 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:4: 

Thr Trp His lie Gin lie Leu Gly Phe Pro Leu Arg Pro Asn Arg Gly 
-157 -155 -150 -145 

Leu Tyr Gin Leu Val Arg Ala Thr Val Val Tyr Arg His His Leu Gin 
-140 -135 -130 

Leu Thr Arg Phe Asn Leu Ser Cys His Val Glu Pro Trp Val Gin Lys 
-125 -120 -115 -110 

Asn Pro Thr Asn His Phe Pro Ser Ser Glu Gly Asp Ser Ser Lys Pro 
-105 -100 -95 

Ser Leu Met Ser Asn Ala Trp Lys Glu Met Asp He Thr Gin Leu Val 
-90 -85 -80 

Gin Gin Arg Phe Trp Asn Asn Lys Gly His Arg He Leu Arg Leu Arg 
-75 -70 -65 

Phe Met Cys Gin Gin Gin Lys Asp Ser Gly Gly Leu Glu Leu Trp His 
-60 -55 -50 

Gly Thr Ser Ser Leu Asp He Ala Phe Leu Leu Leu Tyr Phe Asn Asp 
-45 -40 -35 -30 

Thr His Lys Ser He Arg Lys Ala Lys Phe Leu Pro Arg Gly Met Glu 
-25 -20 -15 

Glu Phe Met Glu Arg Glu Ser Leu Leu Arg Arg Thr Arg Gin Ala Asp 



wo 96/36710 



PCT/US96/06540 



-10 -5 1 

Gly lie Ser Ala Glu Val Thr Ala Ser Ser Ser Lys His Ser Gly Pro 
5 10 15 

Glu Asn Asn Gin Cys Ser Leu His Pro Phe Gin He Ser Phe Arg Gin 
20 25 30 35 

Leu Gly Trp Asp His Trp He He Ala Pro Pro Phe Tyr Thr Pro Asn 
40 45 50 

Tyr Cys Lys Gly Thr Cys Leu Arg Val Leu Arg Asp Gly Leu Asn Ser 
55 60 65 

Pro Asn His Ala He He Gin Asn Leu He Asn Gin Leu Val Asp Gin 
70 75 80 

Ser Val Pro Arg Pro Ser Cys Val Pro Tyr Lys Tyr Val Pro He Ser 
85 90 95 

Val Leu Met He Glu Ala Asn Gly Ser He Leu Tyr Lys Glu Tyr Glu 
100 105 110 115 

Gly Met He Ala Glu Ser Cys Thr Cys Arg 
120 125 

(2) INFORMATION FOR SEQ ID NO: 5: 

(i) SEQtJENCE CHARACTERISTICS: 

(A) LENGTH: 21 amino acids 

(B) TYPE: amino acid 

(C) STRANDEDNESS : double 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5: 

Thr Arg Pro Xaa Ala Ala Xaa Ala Ala Thr Arg Pro He Leu Glu Xaa 
1 5 10 15 

Ala Ala Ala Leu Ala 
20 

(2) INFORMATION FOR SEQ ID NO: 6: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 28 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: double 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6: 
GCGGATCCTG GVANGABTGG ATHRTNGC 28 
(2) INFORMATION FOR SEQ ID NO: 7: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 21 amino acids 

(B) TYPE: amino acid 



47 



wo 96/36710 



PCTAJS96y06540 



(C) STRANDEDNESS : double 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 



(xi) SEQUENCE DESCRIPTION: SEQ ID N0:7: 

Ala Ser Asn His He Ser Ala Leu Ala He Leu Glu Xaa Ala Ala Gly 
15 10 15 

Leu Asn Thr His Arg 
20 

(2) INFORMATION FOR SEQ ID NO: 8: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 28 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8: 
GCTCTAGAGT YTGNAYNATN GCRTGRTT 
(2) INFORMATION FOR SEQ ID NO: 9: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 119 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 



(ix) FEATURE: 

(A) NAME/KEY: CDS 

(B) LOCATION: 28.. 99 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9: 

GGATCCTGGG AGGATTGGAT TGTGGCT CCT CGT CTC TAT ACC CCA AAT TAC 51 

Pro Arg Leu Tyr Thr Pro Asn Tyr 
1 5 

TGT AAA GGA ATC TGT ACT CGG OTA TTA CCC TAT GGT CTC AAT TCA CCC 99 
Cys Lys Gly He Cys Thr Arg Val Leu Pro Tyr Gly Leu Asn Ser Pro 
10 15 20 

AACCACGCTA TAGTCCAAAC 119 

(2) INFORMATION FOR SEQ ID NO: 10: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 24 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 



48 



wo 96/36710 



PCT/US96/06S40 



(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10: 

Pro Arg Leu Tyr Thr Pro Asn Tyr Cys Lys Gly lie Cys Thr Arg Val 
1 5 10 15 

Leu Pro Tyr Gly Leu Asn Ser Pro 
20 

(2) INFORMATION FOR SEQ ID NO: 11: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 40 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS : single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 



(xi) SEQUENCE DESCRIPTION: SEQ ID N0:11: 
TCCTCGTCTC TATACCCCAA ATTACTGTAA AGGAATCTGT 40 
(2) INFORMATION FOR SEQ ID NO: 12: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 39 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 12: 
ATCTGTACTC GGGTATTACC CTATGGTCTC AATTCACCC 3 9 

(2) INFORMATION FOR SEQ ID NO: 13: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 20 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECUI4E TYPE: DNA 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 13: 
GCTTCCACCA ACTAGGCTGG 20 
(2) INFORMATION FOR SEQ ID NO: 14: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 20 base pairs 

(B) TYPE; nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA 



49 



wo 96/36710 



PCTAJS96/06540 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 14: 
CTACATGTAC AGGACTGGGC 



wo 96/36710 



PCTAJS96/06540 



What is claimed is: 

1. An isolated DNA sequence encoding a BMP-15-related protein 
comprising a DNA sequence selected from the group consisting of: 

(a) nucleotides #490 or #634 to #1011 of SEQ ID NO: 1; 

(b) nucleotides #813 or #1002 to #1376 of SEQ ID NO: 3; and 

(c) sequences which hybridize to (a) or (b) under stringent hybridization 
conditions and encode a protein which exhibits the ability to form cartilage 
and/or bone and/or other connective tissue. 

2. An isolated DNA sequence encoding BMP- 15 protein comprising a 
DNA sequence selected from the group consisting of: 

(a) nucleotides encoding amino acids #-48 or # 1 to #125 of SEQ ID 

NO; 2; 

(b) nucleotides encoding amino acids #-63 or #1 to #125 of SEQ ID 
N0:4; and 

(c) sequences which hybridize to (a) or (b) under stringent 
hybridization conditions and encode a protein which exhibits the ability to form 
cartilage and/or bone and/or other connective tissue. 

3. A vector comprising a DNA molecule of claim 1 in operative 
association with an expression control sequence therefor. 

4. A vector comprising a DNA molecule of claim 2 in operative 
association with an expression control sequence therefor. 

5. A host cell transformed with the vector of claim 3. 

6. A host cell transformed with the vector of claim 4. 

7. An isolated DNA molecule having a sequence encoding a protein 
which is characterized by the ability to induce the formation of cartilage and/or 
bone and/or other connective tissue, said DNA molecule comprising a DNA 
sequence selected from the group consisting of: 

(a) nucleotide #634 to #1008 of SEQ ID NO: 1; and 

(b) nucleotide #1002 to #1376 of SEQ ID NO: 3; and 

(c) namrally occurring allelic sequences and equivalent degenerative 
codon sequences of (a) or (b). 



51 



wo 96/36710 



PCT/US96/06540 



8. A vector comprising a DNA molecule of claim 7 in operative 
association with an expression control sequence therefor. 

9. A host cell transformed with the vector of claim 8. 

10. An isolated DNA molecule encoding BMP-15 protein, said DNA 
molecule comprising nucleotide #1002 to #1376 of SEQ ID NO; 3, 

11. An isolated DNA molecule according to claim 10, further 
comprising a nucleotide sequence encoding a suitable propeptide 5' to and 
linked in frame to the DNA coding sequence. 

12. A vector comprising a DNA molecule of claim 11 in operative 
association with an expression control sequence therefor. 

13. A host cell transformed with the vector of claim 12. 

14. A method for producing purified BMP-15-reiated protein said 
method comprising the steps of: 

(a) culturing a host cell transformed with a DNA sequence according to 
claun 1, comprising a nucleotide sequence encoding BMP-15-related protein; 
and 

(b) recovering and purifying said BMP-15-related protein from the 
culture medium. 

15. A method for producing purified BMP-15-related protein said 
method comprising the steps of: 

(a) culturing a host cell transformed with a DNA sequence according to 
claim 2, comprising a nucleotide sequence encoding BMP-15-related protein; 
and 

(b) recovering and purifying said BMP-15-related protein from the 
culture medium. 

16. A method for producing purified BMP-15-related protein said 
method comprising the steps of: 

(a) culturing a host cell transformed with a DNA sequence according to 
claun 7, comprising a nucleotide sequence encoding BMP-15-related protein; 
and 

(b) recovering and purifying said BMP-15-related protein from the 
culture medium. 

52 



wo 96/36710 



PCT/US96/06540 



17. A purified BMP-15-related polypeptide comprising an amino acid 
sequence selected from the group consisting of amino acids encoded by the 
DNA sequence of SEQ ID N0:1 and amino acids encoded by the DNA 
sequence of SEQ ID N0:3. 

18. A purified BMP- 15 polypeptide of claim 17 wherein said 
polypeptide is a dimer wherein each subunit comprises an amino acid sequence 
selected from the amino acid sequence from amino acid #1 to 125 of SEQ ID 
N0:2 and the amino acid sequence from amino acid #1 to 125 of SEQ ID 
N0:4. 

19. A purified BMP-15 polypeptide of claim 17, wherein said 
polypeptide is a dimer wherein one subunit comprises an amino acid sequence 
selected from the group comprising amino acid #1 to #125 of SEQ ID N0:2 
and ammo acid #1 to #125 of SEQ ID N0:4, and one subunit comprises an 
amino acid sequence for a bone morphogenetic protein selected from the group 
consisting BMP-1, BMP-2, BMPO, BMP-4, BMP-5, BMP.6, BMP-7, BMP-8, 
BMP-9. BMP-10, BMP-11, BMP-12 and BMP-13. 

20. A purified BMP-15 protein produced by the steps of 

(a) culturing a cell transformed with a DNA comprising the nucleotide 
sequence from nucleotide #1014 to #1388 as shown in SEQ ID N0:3; and 

(b) recovering and purifying from said culture medium a protein 
comprising the amino acid sequence fi-om amino acid #1 to amino acid #125 as 
shown in SEQ ID N0:4. 

21. A composition comprising a therapeutic amount of at least one 
BMP-15-related protein according to claim 17. 

22. A composition of claim 21 further comprising a matrix for 
supporting said composition and providing a surface for bone and/or cartilage 
and/or other connective tissue growth. 

23. The composition of claim 22 wherein said matrix comprises a 
material selected from the group consisting of hydroxyapatite, collagen, 
poly lactic acid and tricalcium phosphate. 



53 



wo 96/36710 



PCTAJS96/06540 



24. A method for inducing bone and/or cartilage and/or other conMCtive 
tissue formation in a patient in need of same comprising administering to said 
patient an effective amount of the composition of claim 21. 

25. A chimeric DNA molecule comprising a DNA sequence encoding a 
propeptide from a member of the TGF-)3 superfamily of proteins linked in 

correct reading frame to a DNA sequence encoding a BMP-15-related ^ 
polypeptide. 

26. A purified BMP- 15 protein comprising the amino acid sequence 
from amino acid #1 to #125 of SEQ ID N0:4. 

27. A purified BMP- 15 related protein comprising the amino acid 
sequence from amino acid #1 to #125 of SEQ ID N0:2. 

28. A purified BMP-15-related protein having a molecular weight of 
about 10-17 kd in monomeric form, said protein comprising the amino acid 
sequence of SEQ ID NO: 10 and having the ability to induce the formation of 
cartilage and/or bone and/or other connective tissue in the Rosen-modified 
Sampath Reddi assay. 

29. Antibodies to a purified BMP-15-related protein according to claim 

17. 



INTERNATIONAL SEARCH REPORT 



inv onal AppUcatton No 

PCT/US 96/06540 



A. CLASSinCATION OF SUBJECT MATTER 

IPC 6 C12N15/12 C12N15/79 C12N5/1G C07K14/51 C07K19/00 
C07K16/22 A61K38/18 C07K17/02 

Accordipg to International Patent Qasrification (IPC) or to both pational dasrification and IPC 



B. HELDS SEARCHED 



Minimum documentatton searched (classification system followed by classification symbols) 

IPC 6 C07K C12N A61K 



Documentation searched other than minimum documentabon to the extent that such documents are inchided in the fields searched 



Electronic data base consulted during the international search (name of data base and. where practical, search tenns used) 



C. DOCUMENTS CONSIDERED TO BE RELEVANT 



Category* 


Otation of dociOTtent, with indication, where appropriate, of the relevant passages 


Relevant to claim No. 


A 


W0.A,94 15966 (JOHN HOPKINS UNIVERSITY 
SCHOOL OF MEDICINE) 21 July 1994 
see the whole document 


1-21,24. 
26-29 


A 


W0,A,93 09229 (GENETICS INSTITUTE) 13 May 
1993 

see the whole document 


1-29 


A 


W0,A,91 18047 (GENENTECH INC.) 28 November 
1991 

cited in the application 
see the whole document 
& US.A.5 168 050 


1-29 



□ 



Further documents are listed in (he continuation of box C. 



m 



Patent family members are listed in annex 



' Spcdal categories of dud docuntents : 

'A' document defining the general state of the an which is not 
considered to be of particular relevance 

'E' earlier document but published on or after the international 
filing date 

*L* document which may throw doubts on priority daim(s) or 
widcii is dted to establish the publication date of another 
otation or other spedal reason (as specified) 

'O' document referring to an oral disdosure, use, exhibition or 
other means 

*P' document pubhshed prior to the international filing date but 
later than the priority date claimed 



T* later document published after the international filing date 
or priority date and not in conflict with the ^iptication but 
dted lo understand the phnciple or theory underlying the 
invention 

'X' document of particular relevance; the daimed invention 
cannot be considered novd or caniuit be considered to 
involve an inventive step when the document is taken alone 

'Y' document of particular relevance; the daimed invention 
cannot be considered to mvolve an inventive step when the 
document is combined with one or more other such docu- 
ments, such combination bdng obvious to a person skilled 
in the art. 

document member of the same patent family 



pate of the actual completion of the international search 

28 June 1996 


Date of mailing of the international search report 

25.07.96 


Name and mailing address of the ISA 

European Patent Office, P.B. 5818 Patentlaan 2 
NL - 2280 HV Rijswijk 
Td. ( + 31-70) 340-2040, Tx. 31 651 epo nl. 
Fax (-^ 31-70) 340-3016 


Authorized officer 

Gac, G 



Fomi PCT/lSA/210 (tecond sticci) (July 1993) 



INTERNATIONAL SEARCH REPORT 



In* •national application No. 

PCT/ US 96/ 06540 



Box I Observations where certain claims were found unsearchable (Continuation of item I of first sheet) 



This internaUonal search report has not been esiabUshed in respect of certain claims under Article l7(2Xa) for the following reasons: 
1. Claims Nos.: 

because ihey relate to subject matter not required to be searched by this Authority, nameiy. 



2, X_ Claims Nos.: 

because they relate to parts of the international application that do not comply with the prescribed requirements to such 
an extent that no meaningful international search can be carried out, specifically: 

Remark: Although claim 24 is directed to a method of treatment of (diagnostic 
method practised on) the human/animla body the search has been carried out 
and based on the alleged effects of the compound/composition (Art. 17.2(a) 
(1) and Rule 39,2(iv) PCT). 

3. I I Claims Nos.: 

because they are dependent claims and arc not drafted in accordance with the second and third sentences of Rule 6.4(a). 

Box II Observations where unity of invention is lacking (Continuation of item 2 of first sheet) 
This International Searching Authority found multiple inventions in this international application, as follows: 



^' I I required additional search fees were timely paid by the applicant, this international search report covers all 



searchable claims. 



2- As all searchable claims could be searches without effort justifying an additional fee. this Authority did not invite payment 
of any additional fee. 



3- I I As only some of the required additional search fees were timely paid by the applicant, this international search report 
covers only those claims for which fees were paid, specifically claims Nos.: 



^* I I required additional search fees were timely paid by the applicant Consequently, this international search report is 
restricted to the invention fu-st mentioned in the claims; it is covered by claims Nos.: 



Remark on Protest [ [ The additional search fees were accompanied by the applicant's protest 

[ I No protest accompanied the payment of additional search fees. 



Form PCr/ISA.aiO ^continuation of first sheet <1)) (July 1992) 



INTERNATIONAL SEARCH REPORT 

jiformation on patent Camily monbcn 



Inv onal ApplicatioQ No 

PCT/US 96/06540 



Patent doctxment 
cited in search report 


Publication 
date 


Patent Tamtly 
member(s) 


Publication 
date 


WO-A-9415956 


21-07-94 


EP-A- 0678101 


25-10-95 


WO-A-9309229 


13-05-93 


AU-B- 3062292 
EP-A- 0612348 
JP-T- 7500968 


07-06-93 
31-08-94 
02-02-95 


WO-A-9118047 


28-11-91 


US-A- 5168050 
AT-T- 114163 
CA-A- 2082052 
DE-0- 69105205 
DE-T- 69105205 
EP-A- 0531448 
ES-T- 2067238 


01-12-92 

15- 12-94 
25-11-91 
22-12-94 
18-05-95 
17-03-93 

16- 03-95 



Fofin PCT,1SA/310 (patent funily anneii) (iuty 1992) 



This Page is Inserted by IFW Indexing and Scanning 
Operations and is not part of the Official Record 

BEST AVAILABLE IMAGES 

Defective images within this document are accurate representations of the original 
documents submitted by the applicant. 

Defects in the images include but are not limited to the items checked: 

□ BLACK BORDERS 

□ IMAGE CUT OFF AT TOP, BOTTOM OR SIDES 
C3f FADED TEXT OR DRAWING 

BLURRED OR ILLEGIBLE TEXT OR DRAWING 

□ SKEWED/SLANTED IMAGES 

□ COLOR OR BLACK AND WHITE PHOTOGRAPHS 

□ GRAY SCALE DOCUMENTS 

□ LINES OR MARKS ON ORIGINAL DOCUMENT 

□ REFERENCE(S) OR EXHIBIT(S) SUBMITTED ARE POOR QUALITY 

□ OTHER: . 

IMAGES ARE BEST AVAILABLE COPY. 
As rescanning these documents will not correct the image 
problems checked, please do not report these problems to 
the IFW Image Problem Mailbox.