Skip to main content

Full text of "USPTO Patents Application 09804625"

See other formats


WORLD INTELLEC 
In 



PCX 

INTERNATIONAL APPUCATION PUBUSHE 






NO 9602559X1 



(51) iDteniatioiial Patent Classlflcatkm ^ : 

C07H 21704, C12N 1/20, 15/09, 15/18, 
15/d3, 15/64, 15/66 



(43) Icternatioiial Publicatioii Date: 



February 1996(01.02.%) 



(21) International AppUcation Number: PCmJS95/08745 

(22) International Filing Date: 12 July 1995 (12.07.95) 



(30) Priority Date: 

08/274^15 
08O11370 



13 July 1994(13.07.94) US 
26 September 1994 (26.09.94) US 



(71) Applicant (for all designated States except US): THE JOHNS 
HOPKINS UNIVERSITY SCHOOL OF MEDICINE 
(US/US]; 720 Rutland Avenue. Baltimort. MD 21205 (US). 

(72) Inventors; and 

(75) Inventors/Applicants (for US only): LEE, Sc-Jin [USAJS]; 
6711 Chokebeny Road. Baltimore. MD 21209 (US). ES- 
QUELA. Aurora. F. [US/US); Apartment IB. 853 West Uni- 
versity Partway. Baltimore, MD 21210 (US). 

(74) Agents: HAILE, Lisa. A. ct al.; Fish & Richardson P.C.. Suite 
1400. 4225 Executive Square, U JoUa, CA 92037 (US). 



(81) Designated States: CA, JP, US, European patent (AT, BE. CH, 
DE. DK, ES, FR, GB, OR, IE. IT, LU, MC. NL, PT. SE). 



Published 

With international search report. 



(54) Title: GROWTH DIFFERENTIATION FACTOR- 12 
(57) Abstract 

Growth differentiation factor-12 (GDF-12) is disclosed along with its polynucleotide sequence and amino acid sequence. Also 
disclosed are diagnostic and therapeutic methods of using the GDF-12 polypeptide and polynucleoude sequences. 



FOR THE PURPOSES OF INFORMATION ONLY 



Codes used to identify States pany to the PCT on the from pages of pamphlets publishing international 
applications under the PCT. 



AT 


Austria 


GB 


United Kingdom 


MR 


Mauritania 


AU 


Ausnmlia 


GE 


Georgia 


MW 


Malawi 


BB 


Bart»ados 


GN 


Guinea 


NE 


Niger 


BE 


Belgium 


GR 


Greece 


NL 


Netherlands 


BF 


Burkina Fuo 


HU 


Hungary 


NO 


Norway 


BG 


Bulgara 


IE 


Ireland 


NZ 


New Zealand 


BJ 


Benin 


IT 


Italy 


PL 


Poland 


BR 


Bnzil 


JP 


iapan 


PT 


Portugal 


BY 


BeUnu 


K£ 


Kenya 


RO 


Romania 


CA 


Canada 


KG 


Kyrgyttan 


RU 


Russian Federation 


CF 


Central African Republic 


KP 


Democraiic People's Republic 


SD 


Sudan 


CG 


Congo 




of Korea 


SE 


Sweden 


CH 


Switzerland 


KR 


Republic of Korea 


SI 


Slovenia 


CI 


Cdte d'l voire 


KZ 


Kazakhstan 


SK 


Sk>vakia 


CM 


Cameroon 


U 


Liechtenstein 


SN 


Senegal 


CN 


China 


LK 


Sri Lanka 


TD 


Chad 


CS 


Czechoslovakia 


LU 


Luxembourg 


TG 


Togo 


CZ 


Cxech Republic 


LV 


Latvia 


TJ 


Tajikistan 


DE 


Gcfmany 


MC 


Monaco 


TT 


Trinidad and Tobago 


DK 


DcDinvt 


MD 


Republic of Moldova 


UA 


Ukraine 


ES 


Spain 


MG 


Madtgascar 


US 


United States of America 


n 


Finland 


ML 


Mali 


vz 


Uzbekistan 


PR 


France 


MN 


Mongolia 


VN 


Viet Nam 


CA 


Gabon 











wo 96/02559 



PCTAJS95/08745 



-1- 

GROWTH DIFFERENTIATION FACT0R>12 

This is a continuation-in-part application of U.S. Serial No. 08/274.215. filed 
on July 13. 1994. 

BACKGROUND OF THE INVENTION 

5 1. Field of the Invention 

The invention relates generally to growth factors and specifically to a new 
member of the transforming growth factor beta (TGF-P) superfamily. which is 
denoted, growth differentiation factor-1 2 <GDF-1 2). 

2. Description of Related Art 

10 The transforming growth factor P (TGF-P) superfamily encompasses a group 
of structurally-related proteins which affect a wide range of differentiation 
processes during embryonic development. The family includes. Mullerian 
inhibiting substance (MIS), which is required for normal male sex development 
(Behringer, etal., Nature, 345:167. 1990). Drosophila decapentaplegic (DPP) 

15 gene product, whic*i is required for dorsal-ventral axis formation and morpho- 
genesis of the imaginal disks (Padgett, et ai, Nature, 325:81-84, 1987), the 
Xenopus Vg-1 gene product, which localizes to the vegetal pole of eggs 
((Weeks, et ai, Cell, 51:861-867, 1987). the activins (Mason, et ai, Siochem, 
Biophys. Res, Commun., 135:957-964, 1986), whidi can induce the formation 

20 of mesoderm and anterior structures in Xenopus embryos (Thomsen, ef a/., 
Cell, 63:485. 1990). and the bone morphogenetic proteins (BMPs, osteogenin. 
OP-1) M/hich can induce cfe novo cartilage and bone formation (Sampath. et 
ai, 1 Biol, Chem,, 265:13198, 1990). The TGF-pscan influence a variety of 



wo 96/02559 



PCrAJS95/a8745 



-2- 

differentiation processes, including adipogenesis. myogenesis, chondrogene- 
sis. hematopoiesis, and epithelial cell differentiation (for review, see 
Massague. Ce// 49:437. 1987). 

The proteins of the TGF-p family are initially synthesized as a large precursor 
5 protein which subsequently undergoes proteolytic cleavage at a cluster of 
basic residues approximately 1 10-140 amino acids from the C-terminus. The 
C-terminal regions, or mature regions, of the proteins are all structurally 
related and the different family members can be classified into distinct 
subgroups based on the extent of their homology. Although the homologies 

10 within particular subgroups range from 70% to 90% amino acid sequence 
identity, the homologies between subgroups are significantly lower, generally 
ranging from only 20% to 50%. In each case, the active species appears to 
be a disulfide-linked dimer of C-terminal fragments. Studies have shown that 
when the pro-region of a member of the TGF-p family is coexpressed with a 

15 mature region of another member of the TGF-p family, intracellular 
dimerization and seaetion of biologically active homodimers occur {Gray. A., 
and Maston. A.. Science, 247:1328, 1990). Additional studies by Hammonds. 
et a/., {Molec, Endocrin, 5:149, 1991 ) showed that the use of the BMP-2 pro- 
region combined with the BMP-4 mature region led to dramatically improved 

20 expression of mature BMP-4. For most of the family members that have been 
studied, the homodimeric species has been found to be biologically active, but 
for other family members, like the inhibins (Ling, etai, Nature, 321:779, 1986) 
and the TGF-ps (Cheifetz, etaL Cell, 48:409, 1987). heterodimers have also 
been detected, and these appear to have different biological properties than 

25 the respective homodimers. 

Identification of new factors that are tissue-specific in their expression pattern 
will provide a greater understanding of that tissue's development and function. 



wo 96/02559 



PCTAJS95/08745 



-3- 

SUMMARY OF THE INVENTION 

The present invention provides a cell growth and differentiation factor. GDF- 
12, a polynucleotide sequence which encodes the factor, and antibodies v^ich 
are immunoreactive with the factor. This factor appears to relate to various 
5 cell proliferative disorders, especially those involving liver cells. 

Thus, in one embodiment, the invention provides a method for detecting a cell 
proliferative disorder of liver origin and which is associated with GDF-12. In 
another embodiment, the invention provides a method for treating a cell 
proliferative disorder by suppressing or enhancing GDF-12 activity. 



wo 96/02559 



PCT/US95/08745 



-4- 

BRIEF DESCRIPTION OF THE DRAWINGS 

FIGURE 1 shows a Northern blot of RNA prepared from adult tissues probed 
with a murine GDF-12 probe. 

FIGURE 2 shows the partial nucleotide and predicted amino acid sequence 
5 of human GDF-12. 

FIGURE 3 shows the full length nucleotide and predicted amino acid 
sequence of human GDF-12. 

FIGURE 4 shows amino acid sequence homologies between human GDF-12 
and different members of the TGF-P superfamily. Numbers represent amino 
10 acid sequence identities between GDF-12 and the indicated family member 
calculated from the first conserved cysteine to the C-temiinus. 



wo 96/02559 



PCrAJS95/a8745 



DETAILED DESCRIPTION OF THE INVENTION 

The present invention provides a growth and differentiation factor, GDF-12 
and a polynucleotide sequence encoding GDF-12. GDF-12 is expressed 
specifically in liver. In one embodiment, the invention provides a method for 
5 detection of a cell proliferative disorder of liver origin which is associated vAth 
GDF-12 expression. In another embodiment, the invention provides a method 
for treating a cell proliferative disorder by using an agent which suppresses or 
enhances GDF-12 activity. 

The TGF-P superfamily consists of multifunctional polypeptides that control 
10 proliferation, differentiation, and other functions in many celt types. Many of 
the peptides have regulatory, both positive and negative, effects on other 
peptide growth factors. The structural homology between the GDF-12 protein 
of this invention and the members of the TGF-|3 family, indicates that GDF-12 
is a new member of the family of growth and differentiation factors. Based on 
15 the known activities of many of the other members, it can be expected that 
GDF-12 will also possess biological activities that will make it useful as a 
diagnostic and therapeutic reagent. 

In particular, the expression pattern of GDF-12 suggests that GDF-12 
possesses activities that will make it useful for the treatment of various 

20 diseases involving the liver. For example, when GDF-12 functions to stimulate 
the growth or differentiation of liver cells. GDF-12 could be used for the 
treatment of disease states in which the function of the liver is compromised, 
such as in hepatitis or cirrhosis. Although liver tissue has the capacity to 
regenerate, GDF-12 could potentially accelerate the normal regenerative 

25 process or promote the process in <jisease states in which the regenerative 
process is suppressed. Similarly, GDF-12 could be useful for maintaining liver 
cells or tissue in culture prior to transplantation or for stimulating the growth 
of liver cells following transplantation; in this regard, because liver cells may 
be used as a vehicle for delivering genes to liver for gene therapy. GDF-12 



wo 96/02559 



PCT/US95/08745 



-6- 

could be useful for maintaining or expanding liver cells in culture during or 
after the introduction of particular genes or for stimulating the growth of these 
cells following transplantation. 

Alternatively, when GDF-1 2 functions as a growth inhibitor, GDF-12 could be 
5 used to create cell proliferative disorders involving liver cells, such as 
hepatocellular carcinoma. Indeed, one member of this superfamily, namely, 
inhibin alpha, has been shown to function as a tumor suppressor gene, and 
another member of this superfamily, namely, Mullerian inhibiting substance, 
has been shown to be capable of inhibiting the growth of tumor cells both in 
1 0 vitro and in vivo. 

This high specificity of GDF-12 expression also suggests potential applications 
of GDF-12 as a diagnostic toot. In particular, because GDF-12 encodes a 
secreted factor, levels of GDF-12 could be used to monitor liver function or to 
detect the presence of neoplasms involving liver cells. In this regard, another 
15 member of this family, namely, inhibin. has been shown to be useful as a 
marker for ovarian granulosa cell tumors. 

The term "substantially pure" as used herein refers to GDF-12 which is 
substantially free of other proteins, lipids, carbohydrates or other materials 
with which it is naturally associated. One skilled in the art can purify GDF-12 

20 using standard techniques for protein purification. The substantially pure 
polypeptide will yield a single major band on a non-reducing polyacrylamide 
gel. The purity of the GDF-12 polypeptide can also be determined by amino- 
terminal amino acid sequence analysis. GOF-12 polypeptide includes 
functional fragments of the polypeptide, as long as the activity of GDF-12 

25 remains. Smaller peptides containing the biological activity of <5DF-1 2 are 
included in the invention. 

The invention provkles polynucleotides encoding the GDF-12 protein. These 
polynucleotides include DNA, cDNA and RNA sequences which encode GDF- 



wo 96/02559 



PCTAJS95/08745 



12. It is understood that all polynucleotides encoding all or a portion of GDF- 
12 are also included herein, as long as they encode a polypeptide with GDF- 
12 activity. Such polynucleotides include naturally occurring, synthetic, and 
intentionally manipulated polynucleotides. For example. GDF-12 
5 polynucleotide may be subjected to site-directed mutagenesis. The 
polynucleotide sequence for GDF-12 also includes antisense sequences. The 
polynucleotides of the invention include sequences that are degenerate as a 
result of the genetic code. There are 20 natural amino acids, most of which 
are specified by more than one codon. Therefore, all degenerate nucleotide 
1 0 sequences are included in the invention as long as the amino acid sequence 
of GDF-12 polypeptide encoded by the nucleotide sequence is functionally 
unchanged. 

Specifically disclosed herein is a partial cDNA sequence containing the active 
portion of the human GDF-12 coding sequence. One of skill in the art could 

15 now use this partial sequence to isolate the full length clones. The cDNA 
clone from which this sequence was obtained is likely to contain the entire 
coding sequence for GDF-12. The disclosed sequence corresponds to the C- 
terminal region of the GDF-12 polypeptide. The sequence begins with a 
putative proteolytic cleavage site, RARRR. Cleavage of the polypeptide at this 

20 site would generate an active C-terminal fragment 114 amino acids in length 
with a predicted molecular weight of 12.500. 

The C-terminal region of GDF-12 following the putative proteolytic processing 
site shows significant homology to the known members of the TGF-p 
superfamily. The GDF-12 sequence contains most of the residues that are 
25 highly conserved in other family members (see FIGURE 1 ). Like the TGF-ps 
and inhibin Ps, GDF-12 contains an extra pair of cysteine residues in addition 
to the 7 cysteines found in virtually all other family members. Among the 
known family members, GDF-12 is most homologous to Inhibin PB (50% 
sequence identity) (see FIGURE 4). 



wo 96/02559 



PCTAJS95/08745 



-8- 

Minor modifications of the recombinant GDF-12 primary amino acid sequence 
may result in proteins which have substantially equivalent activity as 
compared to the GDF-12 polypeptide described herein. Such modifications 
may be deliberate, as by site-directed mutagenesis, or may be spontaneous. 
All of the polypeptides produced by these modifications are included herein 
as long as the biological activity of GDF-12 still exists. Further, deletion of one 
or more amino acids can also result in a modification of the structure of the 
resultant molecule without significantly altering its biological activity. This can 
lead to the development of a smaller active molecule which would have 
broader utility. For example, one can remove amino or carboxy terminal 
amino acids which are not required for GDF-12 biological activity. 

The nucleotide sequence encoding the GDF-12 polypeptide of the invention 
includes the disclosed sequence and conservative variations thereof. The 
temi "conservative variation" as used herein denotes the replacement of an 
15 amino acid residue by another, biologically similar residue. Examples of 
conservative variations include the substitution of one hydrophobic residue 
such as isoleucine, valine, leucine or methionine for another, or the 
substitution of one polar residue for another, such as the substitution of 
arginine for lysine, glutamic for aspartic acid, or glutamine for asparagine. and 
20 the like. The term "conservative variation" also includes the use of a 
substituted amino acid in place of an unsubstituted parent amino acid 
provided that antibodies raised to the substituted polypeptide also 
immunoreact with the unsubstituted polypeptide. 



5 



10 



wo 96/02559 ' PCr/US95/08745 

-9- 

The polynucleotide encoding GDF-12 includes the nucleotide sequence in 
FIGURES 2 and 3 (SEQ ID NO: 11 and N0:13, respectively), as well as 
nucleic acid sequences complementary to that sequence. A complementary 
sequence may include an antisense nucleotide. When the sequence is RNA, 
5 the deoxynucleotides A, G. C. and T of FIGURE 2 and 3 are replaced by 
ribonucleotides A. G, C, and U, respectively. Also included in the invention 
are fragments of the above-described nucleic acid sequences that are at least 
15 bases in length, which is sufficient to permit the fragment to selectively 
hybridize to DNA that encodes the protein of FIGURES 2 and 3 (SEQ ID 
10 NO: 12 and NO: 14, respectively) under physiological conditions. 

DNA sequences of the invention can be obtained by several methods. For 
example, the DNA can be isolated using hybridization techniques which are 
well known in the art. These include, but are not limited to: 1 ) hybridization of 
genomic or cDNA libraries with probes to detect homologous nucleotide 
15 sequences, 2) polymerase chain reaction (PGR) on genomic DNA or cDNA 
using primers capable of annealing to the DNA sequence of interest, and 3) 
antibody screening of expression libraries to detect cloned DNA fragments 
with shared structural features. 

Preferably the GDF-12 polynucleotide of the invention is derived from a 
20 mammalian organism, and most preferably from a mouse, rat, or human. 
Saeening procedures which rely on nucleic acid hybridization make it possible 
to isolate any gene sequence from any organism, provided the appropriate 
probe is available. Oligonucleotide probes, which correspond to a part of the 
sequence encoding the protein in question, can be synthesized chemically. 
25 This requires that short, oligopeptide stretches of amino acid sequence must 
be known. The DNA sequence encoding the protein can te deduced from the 
genetic code, however, the degeneracy of the code must be taken into 
account. It is possible to perform a mixed addition reaction when the 
sequence is degenerate. This includes a heterogeneous mixture of denatured 
30 double-stranded DNA. For such screening, hybridization is preferably 



wo 96/02559 



PCT/US95/08745 



-10- 

performed on either single-stranded DNA or denatured double-stranded DNA. 
Hybridization is particularly useful in the detection of cDNA clones derived 
from sources where an extremely low amount of mRNA sequences relating 
to the polypeptide of interest are present. In other words, by using stringent 
5 hybridization conditions directed to avoid non-specific binding, it is possible, 
for example, to allow the autoradiographic visualization of a specific cDNA 
clone by the hybridization of the target DNA to that single probe in the mixture 
which is its complete complement (Wallace, et ai, Nucl. Acid Res,, 9:879, 
1981). 

1 0 Therefore, given a partial DNA sequence of the gene of interest, one of skill 
in the art would be able to prepare probes for isolation of a full length cDNA 
clone, without undue experimentation (see for example, Ausubel. et ai, 
Current Protocols in Molecular Biology, Units 6.3-6.4, Greene Publ., 1994; 
Maniatis. ef a/.. Molecular Cloning, Cold Spring Harbor Laboratories, 1982). 

1 5 The development of specific DNA sequences encoding GDF-12 can also be 
obtained by: 1 ) isolation of double-stranded DNA sequences from the genomic 
DNA; 2) chemical manufacture of a DNA sequence to provide the necessary 
codons for the polypeptide of interest; and 3) in vitro synthesis of a double- 
stranded DNA sequence by reverse transcription of mRNA isolated from a 

20 eukaryotic donor cell. In the latter case, a double-stranded DNA complement 
of mRNA is eventually formed which is generally r-eferred to as cDNA. 

Of the three above-noted methods for developing specific DNA sequences for 
use in recombinant procedures, the isolation of genomic DNA isolates is the 
least common. This is especially true when it is desirable to obtain the 
25 microbial expression of mammalian polypeptides due to the presence of 
introns. 

The synthesis of DNA sequences is frequently the method of chorce when the 
entire sequence of amino acid residues of the desired polypeptide product is 



wo 96/02559 



PCTAJS95y08745 



-11- 

known. When the entire sequence of amino acid residues of the desired 
polypeptide is not known, the direct synthesis of DNA sequences is not 
possible and the method of choice is the synthesis of cDNA sequences. 
Among the standard procedures for isolating cDNA sequences of interest is 
5 the fomiation of plasmid- or phage-carrying cDNA libraries which are derived 
from reverse transcription of mRNA which is abundant in donor cells that have 
a high level of genetic expression. When used in combination with 
polymerase chain reaction technology, even rare expression products can be 
cloned, in those cases where significant portions of the amino acid sequence 

10 of the polypeptide are known, the production of labeled single or double- 
stranded DNA or RNA probe sequences duplicating a sequence putatively 
present in the target cDNA may be employed in DNA/DNA hybridization 
procedures which are carried out on cloned copies of the cDNA whk:h have 
been denatured into a single-stranded form (Jay, et a/., NucL Acid Res., 

15 11:2325, 1983). 

A cDNA expression library, such as lambda gt1 1 , can be screened indirectly 
for GDF-12 peptides having at least one epitope, using antibodies specific for 
GDF-12. Such antibodies can be either polyclonally or monodonally derived 
and used to detect expression product indicative of the presence of GDF-12 
20 cDNA. 

DNA sequences encoding GDF-12 can be expressed in vitro by DNA transfer 
into a suitable host cell. "Host cells" are cells in which a vector can be 
propagated and its DNA expressed. The term also includes any progeny of 
the subject host cell. It is understood that all progeny may not be identical to 
25 the parental cell since there may be mutations that occur during replication. 
However, such progeny are included when the term "host cell" is used. 
Methods of stable transfer, meaning that the foreign DNA is continuously 
maintained in the host, are known in the art. 



wo 96/02559 



PCT/US95/08745 



-12- 

In the present invention, the GDF-12 polynucleotide sequences may be 
inserted into a recombinant expression vector The term "recombinant 
expression vector"' refers to a plasmid, virus or other vehicle known in the art 
that has been manipulated by insertion or incorporation of the GDF-12 genetic 
5 sequences. Such expression vectors contain a promoter sequence which 
facilitates the efficient transcription of the inserted genetic sequence of the 
host. The expression vector typically contains an origin of replication, a 
promoter, as well as specific genes which allow phenotypic selection of the 
transformed cells. Vectors suitable for use in the present invention include, 

10 but are not limited to the T7-based expression vector for expression in 
bacteria (Rosenberg, ef a/., Gene, 56:125, 1987), the pMSXND expression 
vector for expression in mammalian cells (Lee and Nathans, J. BioL Chem,, 
263:3521 , 1988) and baculovinjs-derived vectors for e^cpression in insect cells. 
The DNA segment can be present in the vector operably linked to regulatory 

15 elements, for example, a promoter (e.g., T7, metallothionein I, or polyhedrin 
promoters). 

Polynucleotide sequences encoding GDF-12 can be expressed in either 
prokaryotes or eukaryotes. Hosts can include microbial, yeast, insect and 
mammalian organisms. Methods of expressing DNA sequences having 

20 eukaryotic or viral sequences in prokaryotes are well known in the art. 
Biologically functional viral and plasmid DNA vectors capable of expression 
and replication in a host are known in the art. Such vectors are used to 
incorporate DNA sequences of the invention. Preferably, the mature C- 
terminal region of GDF-12 is expressed from a cDNA clone containing the 

25 entire coding sequence of GDF-12. Alternatively, the C-terminal portion of 
GDF-12 can be expressed as a fusk^n protein with the pro- region of another 
member of the TGF-p family or co-expressed with another pro- region {see for 
example, Hammonds, et ai, Molec, Endocrin. 5:149, 1991; Gray, A., and 
Mason, A., Science, 247:1328, 1990). 



wo 96/02559 



PCTAJS95/08745 



.13- 

Transformation of a host cell with recombinant DNA may be carried out by 
conventional techniques as are well known to those skilled in the art. Where 
the host is prokaryotic, such as E. coli, competent cells which are capable of 
DNA uptake can be prepared from cells harvested after exponential growth 
5 phase and subsequently treated by the CaCIs method using procedures well 
known in the art. Alternatively, MgClj or RbCI can be used. Transformation 
can also be performed after forming a protoplast of the host cell if desired. 

When the host is a eukaryote, such methods of transfection of DNA as 
calcium phosphate co-precipitates, conventional mechanical procedures such 

10 as microinjection, electroporation, insertion of a plasmid encased in 
liposomes, or virus vectors may be used. Eukaryotic cells can also be 
cotransformed with DNA sequences encoding the GDF-12 of the invention, 
and a second foreign DNA molecule encoding a selectable phenotype, such 
as the herpes simplex thymidine kinase gene. Another method is to use a 

15 eukaryotic viral vector, such as simian virus 40 {SV40) or bovine papilloma 
virus, to transiently infect or transform eukaryotic cells and express the 
protein, (see for example. Eukaryotic Viral Vectors, Cold Spring Harbor 
Laboratory, Gluzmaned.. 1982). 

Isolation and purification of microbial expressed polypeptide, or fragments 
20 thereof, provided by the invention, may be earned out by conventional means 
including preparative chromatography and immunological separations 
involving monoclonal or polyclonal antibodies. 

The GDF-12 polypeptides of the invention can also be used to produce 
antibodies which are immunoreactive or bind to epitopes of the <3DF-12 
25 polypeptides. Antibody which consists essentially of pooled monoclonal 
antibodies with different epitopic specificities, as well as distinct monoclonal 
antibody preparations are provided. Monoclonal antibodies are made from 
antigen containing fragments of the protein by methods well known in the art 



wo 96/02559 



PCT/US95/08745 



.14- 

(Kohler, et al., Nature, 256:495, 1975; Current Protocols m Molecular Biology, 
Ausubel. et al., ed., 1989). 



The term "antibody" as used in this invention includes intact molecules as well 
as fragments thereof, such as Fab, F(ab*)2. and Fv \A^ich are capable of 
5 binding the epitopic determinant. These antibody fragments retain some 
ability to selectively bind v^ith its antigen or receptor and are defined as 
follows: 



(1) Fab, the fragment which contains a monovalent antigen-binding 
fragment of an antibody molecule can be produced by digestion of 
10 whole antibody with the enzyme papain to yield an intact light chain 

and a portion of one heavy chain; 



(2) Fab', the fragment of an antibody molecule can be obtained by treating 
whole antibody with pepsin, followed by reduction, to yield an intact 
light chain and a portion of the heavy chain; two Fab' fragments are 

1 5 obtained per antibody molecule; 

(3) (Fab')2, the fragment of the antibody that can be obtained by treating 
whole antibody with the enzyme pepsin without subsequent reduction; 
F(ab')2 is a dimer of two Fab* fragments held together by two disulfide 
bonds; 



20 (4) 



Fv, defined as a genetically engineered fragment containing the 
variable region of the light chain and the variable region-of the heavy 
chain expressed as two chains; and 



wo 96/02559 



PCT/US95y08745 



-15- 

(5) Single chain antibody ("SCA"), defined as a genetically engineered 
molecule containing the variable region of the light chain, the variable 
region of the heavy chain, linked by a suitable polypeptide linker as a 
genetically fused single chain molecule. 

5 Methods of making these fragments are known in the art. (See for example, 
Harlovy and Lane, Antibodies: A Laboratory Mar)ual, Cold Spring Harbor 
Laboratory. New York (1988), incorporated herein by reference). 

As used in this invention, the term "epitope" means any antigenic determinant 
on an antigen to v^ich the paratope of an antibody binds. Epitopic determi- 
1 0 nants usually consist of chemically active surface groupings of molecules such 
as amino acids or sugar side chains and usually have specific three 
dimensional structural characteristics, as well as specific charge 
characteristics. 

Antibodies which bind to the GDF-12 polypeptide of the invention can be 
1 5 prepared using an intact polypeptide or fragments containing small peptides 
of interest as the immunizing antigen. The polypeptide or a peptide used to 
immunize an animal can be derived from translated cDNA or chemical 
synthesis which can be conjugated to a carrier protein, if desired. Such 
commonly used carriers which are chemically coupled to the peptide include 
20 keyhole limpet hemocyanin (KLH), thyrogiobulin, bovine serum albumin (BSA), 
and tetanus toxoid. The coupled peptide is then used to immunize the animal 
(e.g.. a mouse, a rat, or a rabbit). 

If desired, polyclonal or monoclonal antibodies can be further purified, for 
example, by binding to and elution from a matrix to which the polypeptkJe or 
25 a peptide to which the antibodies were raised is bound. Those of skill in the 
art will know of various techniques common in the immunology arts for 
purification and/or concentration of polyclonal antibodies, as well as monocio- 



wo 96/02559 



PCTAJS95/0S745 



-16- 

nal antibodies (See for example. Coligan, et ai, Unit 9, Current Protocols in 
Immunology, Wiley Interscience, 1991 , incorporated by reference). 

It is also possible to use the anti-idiotype technology to produce monoclonal 
antibodies which mimic an epitope. For example, an anti-idiotypic monoclonal 
5 antibody made to a first monoclonal antibody will have a binding domain in the 
hypervariable region which is the "image" of the epitope bound by the first 
monoclonal antibody. 

The term "cell-proliferative disorder*' denotes malignant as well as non- 
malignant cell populations which often appear to differ from the surrounding 

10 tissue both morphologically and genotypically. Malignant cells (i.e. cancer) 
develop as a result of a multistep process. The GDF-12 polynucleotide that 
is an antisense molecule is useful in treating malignancies of the various 
organ systems, particularly, for example, cells in liver tissue. Essentially, any 
disorder which is etiologically linked to altered expression of GDF-12 could be 

1 5 considered susceptible to treatment with a GDF-12 suppressing reagent. One 
such disorder is a malignant cell proliferative disorder, for example. 

The invention provides a method for detecting a cell proliferative disorder of 
muscle or adipose tissue which comprises contacting an antj-GDF-12 
antibody with a cell suspected of having a GDF-12 associated disorder and 

20 detecting binding to the antibody. The antibody reactive with GOF-12 is 
labeled with a compound which allows detection of binding to GDF-12. For 
purposes of the invention, an antibody specific for GDF-12 polypeptide may 
be used to detect the level of GDF-12 in biological fluids and tissues. Any 
specimen containing a detectable amount of antigen can be used. A preferred 

25 sample of this invention is liver tissue. The level of GDF-12 in the suspect cell 
can be compared with the level in a normal cell to determine whether the 
subject has a GDF-12-associated cell proliferative disorder. Preferably the 
subject is human. 



wo 96/02559 



PCT/US95/08745 



-17- 

The antibodies of the invention can be used in any subject in which it is 
desirable to administer in vitro or in vivo immunodiagnosis or immunotherapy. 
The antibodies of the invention are suited for use. for example, in immuno- 
assays in which they can be utilized in liquid phase or bound to a solid phase 
carrier. In addition, the antibodies in these immunoassays can be detectably 
labeled in various ways. Examples of types of immunoassays which can 
utilize antibodies of the invention are competitive and non-competitive 
immunoassays in either a direct or indirect format. Examples of such 
immunoassays are the radioimmunoassay (RIA) and the sandwich 
(immunometric) assay. Detection of the antigens using the antibodies of the 
invention can be done utilizing immunoassays which are run in either the 
forward, reverse, or simultaneous modes, including immunohistochemical 
assays on physiological samples. Those of skill in the art will know, or can 
readily discern, other immunoassay formats without undue experimentation. 

1 5 The antibodies of the invention can be bound to many different carriers and 
used to detect the presence of an antigen comprising the polypeptide of the 
invention. Examples of well-known carriers include glass, polystyrene, 
polypropylene, polyethylene, dextran. nylon, amylases, natural and modified 
celluloses, polyacrylamides, agaroses and magnetite. The nature of the 

20 carrier can be either soluble or insoluble for purposes of the invention. Those 
skilled in the art will know of other suitable carriers for binding antibodies, or 
will be able to ascertain such, using routine experimentation. 

There are many different labels and methods of labeling known to those of 
ordinary skill in the art. Examples of the types of labels which can be used in 
25 the present invention include enzymes, radioisotopes, fluorescent compounds, 
colloidal metals, chemiluminescent compounds, phosphorescent compounds, 
and bioluminescent compounds. Those of ordinary skill in the art will know of 
other suitable labels for binding to the antit>ody, or will be able to ascertain 
such, using routine experimentation. 



5 



10 



wo 96/02559 ' PCTAJS95/08745 

-18- 

Another technique which may also result in greater sensitivity consists of 
coupling the antibodies to low molecular weight haptens. These haptens can 
then be specifically detected by means of a second reaction. For example, it 
is common to use such haptens as biotin. which reacts with avidin, or 
5 dinitrophenyl, puridoxal, and fluorescein, which can react with specific anti- 
hapten antibodies. 

In using the monoclonal antibodies of the invention for the in vivo detection of 
antigen, the detectably labeled antibody is given a dose which is diagnostically 
effective. The term "diagnostically effective" means that the amount of 
10 detectably labeled monoclonal antibody is administered in sufficient quantity 
to enable detection of the site having the antigen comprising a polypeptide of 
the invention for which the monoclonal antibodies are specific. 

The concentration of detectably labeled monoclonal antibody which is 
administered should be sufficient such that the binding to those cells having 
15 the polypeptide is detectable compared to the background. Further, it is 
desirable that the detectably labeled monoclonal antibody be rapidly cleared 
from the circulatory system in order to give the best target-to-background 
signal ratio. 

As a rule, the dosage of detectably labeled monoclonal antibody for in vivo 
20 diagnosis will vary depending on such factors as age, sex, and extent of 
disease of the individual. Such dosages may vary, for example, depending 
on whether multiple injections are given, antigenic burden, and other factors 
known to those of skill in the art. 

For /n vivo diagnostic imaging, the type of detection instrument available is a 
25 major factor in selecting a given radioisotope. The radioisotope chosen must 
have a type of decay which is detectable for a given type of instrument. Still 
another important factor in selecting a radk)isotope for in wVo diagnosis is that 
deleterious radiation with respect to the host is minimized. Ideally, a radio- 



wo 96/02559 



PCTAJS95/08745 



-19- 

isotope used for in vivo imaging will lack a particle emission, but produce a 
large number of photons in the 140-250 keV range, which may readily be 
detected by conventional gamma cameras. 

For in vivo diagnosis radioisotopes may be bound to immunoglobulin either 
5 directly or indirectly by using an intermediate functional group, intermediate 
functional groups which often are used to bind radioisotopes which exist as 
metallic ions to immunoglobulins are the bifunctional chelating agents such as 
diethylenetriaminepentacetic acid (DTPA) and ethylenediaminetetraacetic acid 
(EDTA) and similar molecules. Typical examples of metallic ions which can 
10 be bound to the monoclonal antibodies of the invention are ^^Mn. ®^Ru. ®^Ga, 
"Ga. '"As. "^Zr, and ^'Tl, 

The monoclonal antibodies of the invention can also be labeled with a 
paramagnetic isotope for purposes of in vivo diagnosis, as in magnetic 
resonance imaging (MRI) or electron spin resonance (ESR). In general, any 
15 conventional method for visualizing diagnostic imaging can be utilized. 
Usually gamma and positron emitting radioisotopes are used for camera 
imaging and paramagnetic isotopes for MRI. Elements which are particularly 
useful in such techniques include ^^^Gd, *^Mn, ^^Dy, ^Cr. and *Fe. 

The monoclonal antibodies of the invention can be used in vitro and in vivo to 
20 monitor the course of amelioration of a GDF-12-associated disease in a 

subject. Thus, for example, by measuring the increase or decrease in the 

number of cells expressing antigen comprising a polypeptide of the invention 

or changes in the concentration of such antigen present in various body fluids. 

it would be possible to determine whether a particular therapeutic regimen 
25 aimed at ameliorating the GDF-1 2-associated disease is effective. The term 

"ameliorate" denotes a lessening of the detrimental effect of the GDF-12- 

associated disease in the subject receiving therapy. 



wo 96/02559 PCTAJS95/0a745 

.20- 

The present invention identifies a nucleotide sequence ttiat can be expressed 
in an altered manner as compared to expression in a normal cell, therefore it 
is possible to design appropriate therapeutic or diagnostic techniques directed 
to this sequence. Thus, where a cell-proliferative disorder is associated with 
5 the expression of GDF-12, nucleic acid sequences that interfere with GDF-1 2 
expression at the translational level can be used. This approach utilizes, for 
example, antisense nucleic acid and ribozymes to block translation of a 
specific GDF-12 mRNA. either by masking that mRNA with an antisense 
nucleic acid or by cleaving it with a ribozyme. Such disorders include liver 
1 0 diseases, for example. 

Antisense nucleic acids are DNA or RNA molecules that are complementary 
to at least a portion of a specific mRNA molecule (Weintraub, Scientific 
American, 262:40. 1990). In the cell, the antisense nucleic acids hybridize to 
the corresponding mRNA, forming a double-stranded molecule. The 

15 antisense nucleic acids interfere with the translation of the mRNA, since the 
cell will not translate a mRNA that is double-stranded. Antisense oligomers 
of about 15 nucleotides are preferred, since they are easily synthesized and 
are less likely to cause problems than larger molecules when introduced into 
the target GDF-1 2-producing cell. The use of antisense methods to inhibit the 

20 in vitro translation of genes is well known in the art (Marcus-Sakura, 
Anal.Biochem. , 172:289. 1 988). 

Ribozymes are RNA molecules possessing the ability to specifically cleave 
other single-stranded RNA in a manner analogous to DNA restriction 
endonucleases. Through the modification of nucleotide sequences which 
25 encode these RNAs, it is possible to engineer molecules that recognize 
specific nucleotide sequences in an RNA molecule and cleave it (Cech, 
JAmerMed. Assn,, 260:3030, 1988). A major advantage of this approach is 
that, because they are sequence-specific, only mRNAs with particular 
sequences are inactivated. 



wo 96/02559 



PCTAJS95/08745 



-21- 

There are two basic types of ribozymes namely. tetrahymenaAype 
(Hasselhoff. Nature, 334:585. 1988) and "hammerhead' -type. Tetrahymena- 
type ribozymes recognize sequences which are four bases in length, while 
*'hammerhead"-type ribozymes recognize base sequences 11-18 bases in 
5 length. The longer the recognition sequence, the greater the likelihood that 
the sequence will occur exclusively in the target mRNA species. 
Consequently, hammerhead-type ribozymes are preferable to tetrahymena- 
type ribozymes for inactivating a specific mRNA species and 18-based 
recognition sequences are preferable to shorter recognition sequences. 

10 The present invention also provides gene therapy for the treatment of cell 
proliferative or immunologic disorders which are mediated by GDF-12 protein. 
Such therapy would achieve its therapeutic effect by introduction of the GDF- 
12 antisense polynucleotide into cells having the proliferative disorder. 
Delivery of antisense GDF-12 polynucleotide can be achieved using a 

15 recombinant expression vector such as a chimeric virus or a colloidal disper- 
sion system. Especially preferred for therapeutic delivery of antisense 
sequences is the use of targeted liposomes. 



wo 96/02559 



PCT/US95/08745 



-22- 

Various viral vectors which can be utilized for gene therapy as taught herein 
include adenovinjs. herpes virus, vaccinia, or, preferably, an RNA virus such 
as a retrovirus. Preferably, the retroviral vector is a derivative of a murine or 
avian retrovirus. Examples of retroviral vectors in which a single foreign gene 
5 can be inserted include, but are not limited to: Moloney murine leukemia virus 
(MoMuLV), Harvey murine sarcoma virus (HaMuSV), murine mammary tumor 
virus (MuMTV), and Rous Sarcoma Virus (RSV). A number of additional 
retroviral vectors can incorporate multiple genes. All of these vectors can 
transfer or incorporate a gene for a selectable marker so that transduced cells 

10 can be identified and generated. By inserting a GDF-12 sequence of interest 
into the viral vector, along with another gene which encodes the ligand for a 
receptor on a specific target cell, for example, the vector is now target specific. 
Retroviral vectors can be made target specific by inserting, for example, a 
polynucleotide encoding a sugar, a glycolipid, or a protein. Preferred targeting 

15 is accomplished by using an antibody to target the retroviral vector. Those of 
skill in the art will know of. or can readily ascertain without undue experimenta- 
tion, specific polynucleotide sequences which can be inserted into the 
retroviral genome to allow target specific delivery of the retroviral vector 
containing the GDF-12 antisense polynucleotide. 

20 Since recombinant retroviruses are defective, they require assistance in order 
to produce infectious vector particles. This assistance can be provided, for 
example, by using helper cell lines that contain plasmids encoding all of the 
stnjctural genes of the retrovirus under the control of regulatory sequences 
within the LTR. These plasmids are missing a nucleotide sequence which 

25 enables the packaging mechanism to recognize an RNA transcript for 
encapsidation. Helper cell lines which have deletions of the packaging signal 
include, but are not limited to ^^2, PA317 and PA12, for example. These cell 
lines produce empty virions, since no genome is packaged. If a retroviral 
vector is introduced into such cells in which the packaging signal is intact, but 

30 the structural genes are replaced by other genes of interest, the vector can be 
packaged and vector virion produced. 



wo 96/02559 



PCT/US95/08745 



-23- 

Altematively, NIH 3T3 or other tissue culture cells can be directly transfected 
with plasmids encoding the retroviral structural genes gag, pol and env, by 
conventional calcium phosphate transfection. These cells are then 
transfected >vith the vector plasmid containing the genes of interest. The 
5 resulting cells release the retroviral vector into the culture medium. 

Another targeted delivery system for GDF-12 antisense polynucleotides is a 
colloidal dispersion system. Colloidal dispersion systems include macromole- 
cule complexes, nanocapsules, miaospheres, beads, and lipid-based systems 
including oiWn-water emulsions, micelles, mixed micelles, and liposomes. The 

10 preferred colloidal system of this invention is a liposome. Liposomes are 
artificial membrane vesicles which are useful as delivery vehicles in vitro and 
in vivo. It has been shown that large unilamellar vesicles (LUV), which range 
in size from 0.2^.0 fzm can encapsulate a substantial percentage of an 
aqueous buffer containing large macromolecules. RNA, DNA and intact 

15 virions can be encapsulated within the aqueous interior and be delivered to 
cells in a biologically active form (Fraley. ef a/., Trends Biochem. Sc/., 6:77. 
1981 ). In addition to mammalian cells, liposomes have been used for delivery 
of polynucleotides in plant, yeast and bacterial cells. In order for a liposome 
to be an efficient gene transfer vehicle, the following characteristics should be 

20 present: (1 ) encapsulation of the genes of interest at high efficiency while not 
compromising their biological activity; (2) preferential and substantial binding 
to a target cell in comparison to non-target cells; (3) delivery of the aqueous 
contents of the vesicle to the target cell cytoplasm at high efficiency: and (4) 
accurate and effective expression of genetic information (Mannino, et aL, 

25 Biotechniques, 6:682, 1988). 

The composition of the liposome is usually a combination of phospholipids, 
particularly high-phase-transition-temperature phospholipids, usually in 
combination with steroids, especially cholesterol. Other phospholipids or other 
lipids may also be used. The physical characteristics of liposomes depend on 
30 pH, ionic strength, and the presence of divatent cations. 



wo 96/02559 ' PCT/US95/0r745 

-24- 

Examples of lipids useful in liposome production include phosphatidyl 
compounds, such as phosphatidylglyceroi. phosphatidylcholine, 
phosphatidylserine, phosphatidylethanolamine, sphingolipids, cerebrosides, 
and gangliosides. Particularly useful are diacylphosphatidylglycerols, where 
5 the lipid moiety contains from 14-18 cartwn atoms, particularly from 16-18 
carbon atoms, and is saturated. Illustrative phospholipids include egg 
phosphatidylcholine, dipalmitoylphosphatidylcholine and distearoylphos- 
phatidylchoiine. 

The targeting of liposomes can be classified based on anatomical and 
10 mechanistic factors. Anatomical classification is based on the level of 
selectivity, for example, organ-specific, cell-specific, and organelle-specific. 
Mechanistic targeting can be distinguished based upon whether it is passive 
or active. Passive targeting utilizes the natural tendency of liposomes to 
distribute to cells of the reticulo-endothelial system (RES) in organs which 
15 contain sinusoidal capillaries. Active targeting, on the other hand, involves 
alteration of the liposome by coupling the liposome to a specific ligand such 
as a monoclonal antibody, sugar, glycolipid, or protein, or by changing the 
composition or size of the liposome in order to achieve targeting to or^ns and 
cell types other than the naturally occurring sites of localization. 

20 The surface of the targeted delivery system may be modified in a variety of 
ways. In the case of a liposomal targeted delivery system, lipid groups can be 
incorporated into the lipid bilayer of the liposome in order to maintain the 
targeting ligand in stable association with the liposomal bilayer. Various 
linking groups can be used for joining the lipid chains to the targeting ligand. 

25 Due to the expression of GDF-12 in liver tissue, there are a variety of 
applications using the polypeptide, polynucleotide, and antibodies of the 
invention, related to these tissues. Such applications include treatment of cell 
proliferative disorders involving this tissue. In addition, GOF-12 maybe useful 
in various gene therapy procedures. 



wo 96/025S9 



PCTAJS95/08745 



-25- 

The following examples are intended to illustrate but not limit the invention. 
While they are typical of those that might be used, other procedures known to 
those skilled in the art may alternatively be used. 

EXAMPLE 1 

5 IDENTIFICATION AND ISOLATION OF A NOVEL 

TGF-p FAMILY MEMBER 

To identify novel nnembers of the TGF-p superfamily, degenerate 
oligonucleotides vy^ere designed which corresponded to two conserved 
regions among the known family members: one region spanning the two 

1 0 tryptophan residues conserved in most family members and the other region 
spanning the invariant cysteine residues near the C-terminus. These primers 
were used for polymerase chain reactions on cDNA synthesized from RNA 
prepared from whole mouse embryos isolated at day 18.5 of gestation. PGR 
products were subcloned using restriction sites placed at the 5' ends of the 

15 primers, and individual bacterial colonies carrying subcloned inserts were 
saeened by a combination of random sequencing and hybridization analysis 
to eliminate known members of the superfamily. 

GDF-12 was identified from a mixture of PGR products obtained with 
combinations of primer: 

20 SJL21 8: 5*- GCGGAATTGGGITGG(G/A)G(G/An"/C){G/G/A)ATGG 
{A/G)TI(A/G)TITA(T/C)CC (SEQ ID N0:1 ) 

with each of the following 9 primers: 

SJL188: 5'- GGGGAATTG(A/G)CAI(G/G)C(A/<3)CAIG(G/T) 
(G/Arr/G)(T/A)CIAGI(G/A)(T/G)CAT-3* (SEQ ID N0:2) 
25 SJL190: 5'- CGGGAATTC(A/G)GAI(G/G)G(A/G)GAIT(C/G) 
(G/Arr/GKG/T)GIAGI(G/A)(T/G)GAT-3' (SEQ ID N0:3) 



wo 96/02559 



PCT/US95/08745 



-26- 



10 



SJL191: 5'- CCGGAATTC(A/G)CAI(C/G)C(A/G)CAIT 

(C/G)(G/An-/C)(T/A)CIACI(G/A)(T/C)CAT-3' (SEQ ID N0:4) 
SJL192: 6'- CCGGAATTC(A/G)CAI(C/G)C(A/G)CAIT(C/G) 

(G/An-/C)(C/Gn")TIACI(G/A)(T/C)CAT-3' (SEQ ID N0:5) 
SJL193: 5'- CCGGAATTC(A/G)CAI(C/G)C(A/G)CAIG 

(A/C)(G/Arr/C)(C/T)GIACI(G/A)(T/C)CAT.3' (SEQ ID N0:6) 
SJL194: 5'- CCGGAATTC(A/G)CAI(C/G)C(A/G)CAIG 

(A/C)(G/An-/C)(T/A)CIACI(G/A)(T/C)CAT-3' (SEQ ID N0:7) 
SJL196: 5'- CCGGAATTC(A/G)CAI(C/G)C(A/G)CAI(A/C)G 

(G/An-/C)(Cn-)GIACI(G/A)(T/C)CAT-3' (SEQ ID N0:8) 
SJL197; 5'- CCGGAATTC(A/G)CAI(C/G)C(A/G)CAI 

(A/C)G(G/An"/C)(T/A)CIACI(G/A){T/C)CAT-3' (SEQ ID N0:9) 
SJL198: 5'- CCGGAATTC(A/G)CAI(C/G)C(A/G)CAI(A/C)G 

(G/A/T/C)(C/Gn-)TIACI(G/A)(T/C)CAT-3' (SEQ ID N0:10) 



15 PC R using each of these primer combinations was carried out with cDNA 
prepared from 0.4/zg poly A-selected RNA; reactions were carried out at 94°C 
for 1 minute, 50°C for 2 minutes, and 72"'C for 2 minutes for 40 cycles. 



PCR products of approximately 280 base pairs were gel purified, digested with 
EcoRI, gel purified again, and subcloned into the Bluescript vector 
20 (Stratagene, San Diego, CA). Bacterial colonies carrying individual subclones 
were picked into 96 well miaotiter plates, and multiple replicas were prepared 
by plating the cells onto nitrocellulose The replicate filters were hybridized to 
probes representing known members of the family, and DNA was prepared 
from non-hybridizing colonies for sequence analysis. 



25 Among the colonies analyzed in this manner was one that represented a novel 
sequence, which was designated GDF-12. This murine sequence was 
subsequently used to analyze expression patterns and to isolate a human 
cDNA clone (see below). 



wo 96/02559 



PCT/US95rt)8745 



-27- 

EXAMPUeg 
EXPRESSION OFGDF-12 

To determine the expression pattern of GDF-12, RNA samples prepared from 
a variety of adult tissues were saeened by Northern analysis. RNA isolation 

5 and Northern analysis were carried out as described previously (Lee, S.-J., 
Mol. Endocrinol., AAOZA, 1990) except that hybridization was carried out in 5X 
SSPE, 10% dextran sulfate, 50% fomiamide, 1% SDS, 200 tzg/m\ salmon 
DNA, and 0.1% each of bovine serum albumin, ficoll, and polyvinylpyrrolidone. 
Five micrograms of twice poly A-selected RNA prepared from each tissue 

1 0 were eledrophoresed on formaldehyde gels, blotted, and probed with GDF- 
12. As shown in FIGURE 1, the GDF-12 probe detected a single mRNA 
species approximately 2.8 and 1.9 kb in length, in adult liver. 



EXAMPLE 3 

ISOLATION OF cDNA CLONES ENCODING GDF-12 

15 In order to isolate cDNA clones encoding GDF-11, a cDNA library was 
prepared in the lambda ZAP 11 vector (Stratagene) using RNA prepared from 
human adult liver. From 5 uQ of twice poly A-selected RNA prepared from 
human spleen, a cDNA library consisting of 20 million recombinant phage was 
constructed according to the instructions provided by Stratagene. A portion 

20 of this library was screened without amplification using the murine GDF-12 
PGR product as a probe. Library screening and characterization of cDNA 
inserts were carried out as described previously (Lee, Mol. Endocrinol., 
4:1034, 1990), except that the final wash was earned out in 2xSSC. 



wo 96/02559 



PCrAJS95/08745 



-28- 

Partial sequence analysis of the first isolated clone showed that it contained 
the entire coding sequence of GDF-12. A portion of the nucleotide and 
predicted amino acid sequence of this clone is shown in FIGURE 2 and SEQ 
ID NOs: 1 1 and 12. The sequence begins with a putative proteolytic cleavage 
5 site which is followed by a C-terminal region of 1 14 amino acids. The active 
C-terminal fragment is predicted to have a molecular weight of approximately 
12,500. 

The entire nucleotide sequence of the longest human GDF-12 cDNA clone 
isolated is shown in FIGURE 3 and SEQ ID NO: 13. The 2419 base pair 

10 sequence contains a single long open reading frame beginning with a 
methionine codon at nucleotides 218-220 and extending for 350 codons. The 
sequence contains an in-frame stop codon upstream of the putative initiating 
methionine. The predicted amino acid sequence {SEQ ID NO: 14) contains a 
stretch of hydrophobic amino acids near the N-terminus suggestive of a signal 

15 sequence for secretion, one potential N-linked glycosylation site at amino 
acids 232-236 (box). The C-terminal region following the putative processing 
site (shaded box) contains all of the hallmarks present in other TGF-p family 
members (see above). 

The C-terminal region following the predicted <:leavage site contains all the 
20 hallmarks present in other TGF-p family members. GDF-12 contains most of 
the residues that are highly conserved in other family members, lrw:luding the 
seven cysteine residues with their characteristic spacing. Like the TGF-P's, 
and the inhibin P's, GDF-12 also contains two additional <:ysteine residues. 
In the case of TGF-32. these additional cysteine residues are known to form 
25 an intramolecular disulfide bond (Daopin, et al., Science, 257:369. 1992; 
Schlunegger and Grutter. A/a/are, 358:430, 1992). A tabulation of the amino 
acid sequence homologies between GDF-12 and the other TGF-P family 
members is shown in FIGURE 4. Numt>ers represent percent amino acid 
identities between each pair calculated from the first conrerved cysteine to the 
30 C-terminus. 



wo 96/02559 



PCT/US95/08745 



-29- 

Although the invention has been described with reference to the presently 
preferred embodiment, it should be understood that various modifications can 
be made without departing from the spirit of the invention. Accordingly, the 
invention is limited only by the following claims. 



wo 96/02559 



5 



10 



15 



20 



PCT/US95/08745 



-30- 



SEQUENCE LISTING 

(1) GENERAL INFORMATION 

(i) APPLICANT: THE JOHNS HOPKINS UNIVERSITY SCHOOL OF MEDICINE 

(ii) TITLE OF THE INVENTION: GROWTH DIFFERENTIATION FACTOR-12 

(iii) NUMBER OF SEQUENCES: 14 

(iv) CORRESPONDENCE ADDRESS: 

(A) ADDRESSEE: Fish & Richardson 

(B) STREET: 4225 Executive Square, Suite 1400 

(C) CITY: La Jolia 

(D) STATE: CA 

(E) COUNTRY: USA 

(F) ZIP: 92037 

(V) COMPUTER READABLE FORM: 

(A) MEDIUM TYPE: Diskette 

(B) COMPUTER: IBM Conqpatible 

(C) OPERATING SYSTEM: DOS 

(D) SOFTWARE: FastSEQ Version 1.5 

(vi) CURRENT APPLICATION DATA: 

(A) APPLICATION NUMBER: PCT/US95/ 
<B) FILING DATE: 12-JUL-1995 

(C) CLASSIFICATION: 

(viii) ATTORNEY /AGENT INFORMATION: 
<A) NAME: Haile, Ph.D., Lisa A 

(B) REGISTRATION NUMBER: 38,347 

(C) REFERENCE/DOCKET NUMBER: 07265/042WO1 (FD-3830) 

(ix) TELECOMMUNICATION INFORMATION: 

(A) TELEPHONE: 619-678-5070 

(B) TELEFAX: 619-678-5099 

(C) TELEX: 



30 



(2) INFORMATION FOR SEQ ID NO; 1 : 



wo 96/02559 



PCT/US95AW745 



-31- 



(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 34 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 
5 (D) TOPOLOGY: linear 



(ii) MOLECULE TYPE: cDNA 

(iii) HYPOTHETICAL: NO 

(iv) ANTISENSE: NO 
(V) FRAGMENT TYPE: 

10 (vi) ORIGINAL SOURCE: 

(ix) FEATURE: 



(A) NAME/KEY: Modified Base 

(B) LOCATION: 12... 12 

(D) OTHER INFORMATION: Inosine 

(A) NAME/KEY:Modified Base 

(B) LOCATION: 26... 26 
(D) OTHER INFORMATION: Inosine 



20 (A) NAME/KEY:Modified Base 

(B) LOCATION: 29... 29 

(D) OTHER INFORMATION: Inosine 



25 



(xi) SEQUENCE DESCRIPTION: SEQ ID N0:1: 
CCGGAATTCG GNTGQ4GNVA TGGRTNRTNT AYCC 34 



(2) INFORMATION FOR SEQ ID NO: 2: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 33 base pairs 

(B) TYPE: nucleic acid 
30 (C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 



(ii) MOLECULE TYPE: cDNA 

(iii) HYPOTHETICAL: NO 

(iv) ANTISENSE: NO 
35 (V) FRAGMENT TYPE: 

(vi) ORIGINAL SOURCE: 
(ix) FEATURE: 

(A) NAME/KEY: Modified Base 



wo 96/02559 



PCTAJS95/08745 



-32- 

(B) LOCATION: 13... 13 

(D) OTHER INFORMATION: Inoaine 



(A) NAME/K£Y:Modified Base 

(B) LOCATION: 19... 19 
(D) OTHER INFORMATION: Inosxne 



(A) NAME/KEYrModified Base 

(B) LOCATION: 25... 25 

10 (D) OTHER INFORMATION: Inosine; Inosine also at position 

28 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2: 
CCGGAATTCR CANSCRCANC YNWCNACNRY CAT 33 
(2) INFORMATION FOR SEQ ID NO: 3: 

15 (i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 33 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

20 (ii) MOLECULE TYPE: cDNA 

(iii) HYPOTHETICAL: NO 

(iv) ANTISENSE: NO 
(V) FRAGMENT TYPE: 
(vi) ORIGINAL SOURCE: 

25 (ix) FEATURE: 

(A) NAME/KEY: Modified Base 

(B) LOCATION: 13... 13 

(D) OTHER INFORMATION: Inosine 



30 (A) NAME/KEY:Modified Base 

(B) LOCATION: 19. . .19 

(D) OTHER INFORMATION: Inosine 



(A) NAME/KEY :Modified Base 
35 (B) LOCATION: 25... 25 

(D) OTHER INFORMATION: Inosine; Inosine also at position 
28 



wo 96/02559 



PCT/US95/08745 



-33- 

<xi) SEQUENCE DESCRIPTION: 5EQ ID NO: 3: 
CCGGAATTCR CANSCRCANT SNYGNACNRY CAT 33 
{2} INFORMATION FOR SEQ ID N0:4: 

(i) SEQUENCE CHARACTERISTICS: 
5 (A) LENGTH: 33 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: cDNA 
10 <iii) HYPOTHETICAL: NO 

<iv) ANTISENSE: NO 
(V) FRAGMENT TYPE: 
<vi) ORIGINAL SOURCE: 
(ix) FEATURE: 

15 (A) NAME/KEY: Modified Base 

(B) LOCATION: 13... 13 
(D) OTHER INFORMATION: Inosine 



(A) NAME/KEY:Modified Base 
20 (B) LOCATION: 19... 19 

(D) OTHER INFORMATION: Inosine 



(A) NAME/KEY:Modified Base 

(B) LOCATION: 25... 25 

25 (D) OTHER INFORMATION: Inosine; Inosine also at position 

28 



wo 96/02559 



PCT/US95/08745 



.34- 

Ui) SEQUENCE DESCRIPTION: SEQ ID NO: 4: 
CCGGAATTCR CANSCRCANT SNWCNACNRY CAT 33 
(2) INFORMATION FOR SEQ ID NO: 5: 

(i) SEQUENCE CHARACTERISTICS: 
5 (A) LENGTH: 33 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: cDNA 
10 (iii) HYPOTHETICAL: NO 

(iv) ANTISENSE: NO 
(V) FRAGMENT TYPE: 
(vi) ORIGINAL SOURCE: 
(ix) FEATURE: 

15 (A) NAME/KEY: Modified Base 

(B) LOCATION: 13... 13 
(D) OTHER INFORMATION: Inosine 



(A) NAME/KEY: Modified Base 
20 (B) LOCATION: 19... 19 

(D) OTHER INFORMATION: Inosine 



(A) NAME/KEY: Modified Base 

(B) LOCATION: 25... 25 

25 (D) OTHER INFORMATION: Inosine; Inosine also at position 

28 

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:5: 
CCGGAATTCR CANSCRCANT SNBTNACNRY CAT 33 
(2) INFORMATION FOR SEQ ID NO: 6: 

30 (i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 33 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 



35 



(ii) MOLECULE TYPE: cDNA 

(iii) HYPOTHETICAL: NO 



wo 96/02559 



PCT/US95A)8745 



-35- 

(iv) ANTI5ENSE: NO 
(V) FRAGMENT TYPE: 
(vi) ORIGINAL SOtTRCE: 
(ix) FEATURE: 

5 (A) NAME/KEY: Modified Base 

(B) LOCATION: 13... 13 
(D) OTHER INFORMATION: Inosine 



(A) NAME/KEYiModified Base 

(B) LOCATION: 19.,. 19 
(D) OTHER INFORMATION: Inosine 



(A) NAM£/KEY:Modified Base 

(B) LOCATION: 25... 25 

(D) OTHER INFORMATION: Inosine; Inosine also at position 
28 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6: 
CCGGAATTCR CANSCRCANG MNYGNACNRY CAT 

(2) INFORMATION FOR SEQ ID NO: 7: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 33 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS : single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: cDNA 

(iii) HYPOTHETICAL: NO 

(iv) ANTISENSE: NO 
(V) FRAGMENT TYPE: 
(vi) ORIGINAL SOURCE: 

(ix) FEATURE: 

(A) NAME/KEY: Modified Base 

(B) LOCATION: 13... 13 

(D) OTHER INFORMATION: Inosine 



(A) NAME/REY:Kodified Base 

(B) LOCATION: 19... 19 
(D) OTHER INFORMATION: Inosine 



wo 96/02559 



PCTAJS95/08745 



•36- 



(A) NAME/KEy:Modified Base 
<B) LOCATION: 25... 25 

(D) OTHER INFOBMATION: Inoaine; Inosine also at position 
2B 

5 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:*?: 

CCGGAATTCR CANSCRCANG MNWCNACNRY CAT 



(2) INFORMATION FOR SEQ ID NO: 8: 

(i) SEQUENCE CHARACTERISTICS: 
(A) LENGTH: 33 base pairs 
10 (B) TYPE: nucleic acid 

(C) STRANDEDNESS : single 

(D) TOPOLOGY: linear 



(ii) MOLECULE TYPE: cDNA 

(iii) HYPOTHETICAL: NO 
15 (iv) ANTISENSE: NO 

(V) FRAGMENT TYPE: 
<vi) ORIGINAL SOURCE: 
(ix) FEATURE: 



20 (A) NAME/KEY: Modified Base 

(B) LOCATION: 13... 13 
(D) OTHER INFORMATION: Inosine 



(A) NAME/KEY :Modi£ied Base 
25 <B) LOCATION: 19... 19 

(D) OTHER INFORMATION: Inosine 



(A) NAME/KEYiModified Base 

(B) LOCATION: 25... 25 

30 (D) OTHER INFORMATION: Inosine; Inosine also at position 

28 

{xi) SEQUENCE DESCRIPTION: SEQ ID N0:8: 
CCGGAATTCR CANSCRCANM GNYGNACNRY CAT 33 
(2) INFORMATION FOR SEQ ID NO: 9: 



35 



(i) SEQUENCE CHARACTERISTICS: 
<A) LENGTH: 33 base pairs 
(B) TYPE: nucleic acid 



wo 96/02559 



PCTAJS95/0«745 



.37. 



(C) STRAKDEDNESS: single 

(D) TOPOLCX^Y: linear 

(ii) MOLECXn^E TYPE: cDNA 

(iii) HYPOTHETICAL: NO 
5 (iv) ANTISEKSE: HO 

(V) FRAGMENT TYPE: 
(vi) ORIGINAL SOURCE: 
(ix) FEATtJRE: 

(A) NAME/KEY: Modified Base 
10 (B) LOCATION: 13.. .13 

(D) OTHER INFORMATION: Inosine 



(A) NAME/KEY iModified Base 

(B) LOCATION: 19... 19 
15 (D) OTHER INFORMATION: Inosine 



(A) KAME/K£Y:Modified Base 

(B) LOCATION: 25... 25 

(D) OTHER INFORMATION: Inosine; Inosine also at position 
20 28 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9: 

CCGGAATTCR CAnSCRCANM GNWCNACNMY CAT 33 

(2) INFORMATION FOR SEQ ID NO:10: 

(i) SEQUENCE CHARACTERISTICS: 
25 (A) LENGTH: 33 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS : single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: cDNA 
30 (iii) HYPOTHETICAL: NO 

(iv) ANTISENSE: NO 
(V) FRAGMENT TYPE: 
(vi) ORIGINAL SOURCE: 
- (ix) FEATURE: 



35 



(A) NAME/KEY: Modified Base 

(B) LOCATION: 13... 13 

(D) OTHER INFORMATION: Inosine 



wo 96/02559 



PCTAJS95/08745 



-38- 



(A) NAME/KEy:Modifaed Base 

(B) LOCATION: 19... 19 
(D) OTHER INFORMATION: Inosine 



5 (A) NAME/KEY :Modif led Base 

(B) LOCATION: 25... 25 

(D) OTHER INFORMATION: Inosine; Inoaine also at position 
28 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10: 
10 CCGGAATTCR CAnSCRCANM GNWCNACNMY CAT 33 

(2) INFORMATION FOR SEQ ID NO: 11: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 360 base pairs 

(B) TYPE: nucleic acid 
15 (C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: cDNA 

(iii) HYPOTHETICAL: NO 

(iv) ANTISENSE: NO 
20 <v) FRAGMENT TYPE: 

(vi) ORIGINAL SOURCE: 
(ix) FEATURE: 

(A) NAME/KEY: Coding Sequence 

(B) LOCATION: l..,357 
25 (D) OTHER INFORMATION: 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11: 

CGG GCC AGG AGG AGG ACC CCC ACC TGT GAG CCT GCG ACC CCC TTA TGT 48 
Arg Ala Arg Arg Arg Thr Pre Thr Cys Glu Pro Ala Thr Pro Leu Cys 
30 1 5 10 15 

TGC AGG CGA GAC CAT TAC GTA GAC TTC CAG GAA -CTG GGA TGG CGG GAC 96 
Cys Arg Arg Asp His Tyx Val Asp Phe Gin Clu Leu Gly Trp Arg Asp 
20 25 30 

TGG ATA CTG CAG CCC GAG GGG TAC CAG CTG AAT TAC TGC AGT QGO CAG 144 
35 Trp lie Leu Gin Pro Glu Gly Tyr Gin Leu Asn Tyr Cys Ser Gly Gin 

35 40 45 



wo 96/02559 



PCTAJS95/a8745 



.39- 



TGC CCT CCC CAC CTG GCT GGC AGC CCA GGC ATT GCT GCC TCT TTC CAT 192 
Cys Pro Pro His Leu Ala Gly Ser Pro Gly He Ala Ala Ser Phe His 
50 55 60 

TCT GCC GTC TTC AGC CTC CTC AAA GCC AAC AAT CCT TGG CCT GCC AGT 240 
5 Ser Ala Val Phe Ser Leu Leu Lys Ala Asn Asn Pro Trp Pro Ala Ser 

65 70 75 80 

ACC TCC TGT TGT GTC CCT ACT GCC CGA AGG CCC CTC TCT CTC CTC TAC 288 
Thr Ser Cys Cys Val Pro Thr Ala Arg Arg Pro Leu Ser Leu Leu Tyr 
85 90 95 

0 CTG GAT CAT AAT GGC AAT GTG GTC AAG ACG GAT GTG CCA GAT ATG GTG 336 

Leu Asp His Asn Gly Asn Val Val Lys Thr Asp Val Pro Asp Met Val 
100 105 110 

GTG GAG GCC TGT GGC TGC AGC TAG 360 
Val Glu Ala Cys Gly Cys Ser 
5 115 



(2) INFORMATION FOR SEQ ID NO: 12: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 119 amino acids 

(B) TYPE: amino acids 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(iii) HYPOTHETICAL: NO 

(iv) ANTISENSE: NO 

(V) FRAGMENT TYPE: internal 
(vi) ORIGINAL SOURCE: 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 12: 



Arg Ala Arg Arg Arg Thr Pro Thr 
1 5 

Cys Arg Arg Asp His Tyr Val Asp 
20 

Trp He Leu Gin Pro Glu Gly Tyr 
35 40 

Cys Pro Pro His Leu Ala Gly Ser 
50 55 



Cys Glu Pro Ala Thr Pro Leu Cys 
10 15 

Phe Gin Glu Leu Gly Trp Arg Asp 
25 30 

Gin Leu Asn Tyr Cys Ser <;iy Gin 
45 

Pro Gly He Ala Ala Ser Phe His 
60 



wo 96/02559 



PCT/US95y08745 



-40- 



Ser Ala Val Phe Ser Leu Leu Lys Ala Asn Asn Pro Trp Pro Ala Ser 
65 70 75 80 

Thz Ser Cys Cys Val Pro Thr Ala Arg Arg Pro Leu Ser Leu Leu Tyr 
85 90 95 



5 Leu Asp His Asn Gly Asn Val Val Lys Thr Asp Val Pro Asp Met Val 

100 105 110 

Val Glu Ala Cys Gly Cys Ser 

lis 



(2) INFORMATION FOR SEQ ID NO: 13: 

10 (i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 2419 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

15 (ii) MOLECULE TYPE: cDNA 

(iii) HYPOTHETICAL: NO 

(iv) ANTISENSE: NO 
(V) FRAGMENT TYPE: 
(vi) ORIGINAL SOURCE: 

20 (ix) FEATURE: 

(A) NAME/KEY: Coding Sequence 
<B) LOCATION: 218... 1267 
(D) OTHER INFORMATION: 



25 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 13: 

GAGCTGTGAG GGTCAAGCAC AGCTATCCAT CAGATGATCT ACTTTCAGCC TTCCTGAGTC 60 

CCAGACAATA GAAGACAGGT GGCTGTACCC TTGGCCAAGG GTAGGTGTGG CAGTGGTGTC 120 

TGCTGTCACT GTGCCCTCAT TGGCCCCCAG CAATCAGACT CAACAGACGG AGCAACTGCC 180 



ATCCGAGGCT CCTGAACCAG GGCCATTCAC CAGGAGC ATG CGG CTC CCT GAT GTC 235 
30 Arg Leu Pro Asp Val 

1 5 



CAG CTC TGG CTG GTG CTG CTG TGG GCA CTG GTG CGA GCA CAG GGG ACA 
Gin Leu Trp Leu Val Leu Leu Trp Ala Leu Val Arg Ala Gin Gly Thr 
10 15 20 



263 



wo 96/02559 



PCTAJS95/08745 



-41- 



GGG TCT GT6 TGT CCC TCC TG7 GGG GGC TCC AAA CTG OCA CCC CAA GCA 331 
Gly Scr Val Cys Pro Ser Cys Gly Gly Ser Lys Leu Ala Pro Gin Ala 
25 30 35 

GAA CGA GCT CTG GTG CTG GAG CTA GCC AAG GAG CAA ATC CTG GAT GGG 379 
5 Glu Arg Ala Leu Val Leu Glu Leu Ala Lys Gin Gin lie Leu Asp Gly 

40 45 50 

TTG CAC CTG ACC AGT CGT CCC AGA ATA ACT CAT CCT CCA CCC CAG GCA 427 
Leu Hi5 Leu Thr Ser Arg Pro Arg lie Thr His Pro Pro Pro Gin Ala 
55 60 65 70 

10 GCG CTG ACC AGA GCC CTC CGG AGA CTA CAG CCA GGG AGT GTG GCT CCA 475 

Ala Leu Thr Arg Ala Leu Arg Arg Leu Gin Pro Gly Ser Val Ala Pro 
75 80 85 

GGG AAT GGG GAG GAG GTC ATC AGC TTT GCT ACT GTC ACA GAC TCC ACT 523 
Gly Asn Gly Glu Glu Val lie Ser Phe Ala Thr Val Thr Asp Ser Thr 
15 90 95 100 

TCA GCC TAC AGC TCC CTG CTC ACT TTT CAC CTG TCC ACT CCT CGG TCC 571 
Ser Ala Tyr Ser Ser Leu Leu Thr Phe His Leu Ser Thr Pro Arg Ser 
105 110 115 

CAC CAC CTG TAC CAT GCC CGC CTG TGG CTG CAC GTG CTC CCC ACC CTT 619 
20 His His Leu Tyr His Ala Arg Leu Trp Leu His Val Leu Pro Thr Leu 

120 125 130 

CCT GGC ACT CTT TGC TTG AGG ATC TTC CGA TGG G6A CCA AGG AGG AGG 667 
Pro Gly Thr Leu Cys Leu Arg lie Phe Arg Trp Gly Pro Arg Arg Arg 
135 140 145 150 

25 CGC CAA GGG TCC CGC ACT CTC CTG GCT GAG CAC -CAC ATC ACC AAC CTG 715 

Arg Gin Gly Ser Arg Thr Leu Leu Ala Glu His His lie Thr Asn Leu 
155 160 165 

GGC TGG CAT ACC TTA ACT CTG CCC TCT AGT GGC TTG AGG GGT GAG AAG 763 
Gly Trp His Thr Leu Thr Leu Pro Ser Ser Gly Leu Arg Gly Glu Lys 
30 170 175 180 

TCT GGT GTC CTG AAA CTG CAA CTA GAC TGC AGA CCC CTA GAA GGC AAC 811 
Ser Gly Val Leu Lys Leu Gin Leu Asp Cys Arg Pro Leu Glu Gly Asn 
185 190 195 

AGC ACA GTT ACT GGA CAA CCG AGG CGG CTC TTG GAC ACA GCA GGA CAC 859 
35 Ser Thr Val Thr Gly Gin Pro Arg Arg Leu Leu Asp Thr Ala Gly His 

200 205 210 



wo 96/02559 



PCTAJS95/08745 



-42- 



CAG CAG CCC TTC CTA GAG CTT AAG ATC CGA GCC AAT GAG CCT GGA GCA 907 
Gin Gin Pro Phe Leu Glu Leu Lys lie Arg Ala Asn Glu Pro Gly Ala 
215 220 225 230 

GGC CGG GCC AGG AGG AGG ACC CCC ACC TGT GAG CCT GCG ACC CCC TTA 955 
5 Gly Arg Ala Arg Arg Arg Thr Pro Thr Cys Glu Pro Ala Thr Pro Leu 

235 240 245 

TGT TGC AGG CGA GAC CAT TAC GTA GAC TTC CAG GAA CTG GGA TGG CGG 1003 
Cys Cys Arg Axg Asp His Tyr Val Asp Phe Gin Glu Leu Gly Trp Arg 
250 255 260 

10 GAC TGG ATA CTG CAG CCC GAG GGG TAC CAG CTG AAT TAC TGC AGT GGG 1051 

Asp Trp He Leu Gin Pro Glu Gly Tyr Gin Leu Asn Tyr Cys Ser Gly 
265 270 275 

CAG TGC CCT CCC CAC CTG GCT GGC AGC CCA GGC ATT GCT GCC TCT TTC 1099 
Gin Cys Pro Pro His Leu Ala Gly Ser Pro Gly He Ala Ala Ser Phe 
15 280 285 290 

CAT TCT GCC GTC TTC AGC CTC CTC AAA GCC AAC AAT CCT TGG CCT GCC 1147 
His Ser Ala Val Phe Ser Leu Leu Lys Ala Asn Asn Pro Trp Pro Ala 
295 300 305 310 

AGT ACC TCC TGT TGT GTC CCT ACT GCC CGA AGG CCC CTC TCT CTC CTC 1195 
20 Ser Thr Ser Cys Cys Val Pro Thr Ala Arg Arg Pro Leu Ser Leu Leu 

315 320 325 

TAC CTG GAT CAT AAT GGC AAT GTG GTC AAG AC<; GAT GTG CCA GAT ATG 1243 
Tyr Leu Asp His Asn Gly Asn Val Val Lys Thr Asp Val Pro Asp Met 
330 335 340 

25 GTG GTG <3AG GCC TGT GGC TGC AGC TAGCAAGAGG ACCTGGGGCT TT<KiAGTGAA G 1298 

Val Val Glu Ala Cys Gly Cys Ser 
345 350 

AGACCAAGAT GAAGTTTCCC AGGCACAGGG CATCTGTGAC TGGAGGCATC AGATTCCTGA 1358 

TCCACACCCC AACCCAACAA CCACCTGGCA ATATGACTCA CTTGACCCCT ATGGGACCCA 1418 

30 AATGGGCACT TTCTTGTCTG AGACTCT<;GC TTATTCCAGG TTGGCTGATG TGTTGGGAGA 1478 

TGGGTAAAGC GTTTCTTCTA AAGGGGTCTA CCCAGAAAGC ATGATTTCCT GCCCTAAGTC 1538 

CTGTGAGAAG ATGTCAGGGA CTAGGGAGGG AGGGAGGGAA -GGCAGAGAAA AATTACTTAG 1598 

CCTCTCCCAA GATGAGAAAG TCCTCAAGTG AGGGGAGGAG GAAGCAGATA GATGGTCCAG 1658 



wo 96/02559 



PCTAJS95/08745 



-43- 

CAGGCTTGAA GCAGGGTAAG CAGGCTGGCC CAGGGTAAGG GCTGTTGAGG TACCTTAAGG 1718 

GAAGGTCAAG AGGGAGATGG GCAAGGCGCT GAGGGAGGAT GCTTAGGGGA CCCCCAGAAA 1778 

CAGGAGTCAG GAAAATGAGG CACTAAGCCT AAGAAGTTCC CTGGTTTTTC CCAGGGGACA 1838 

GGACCCACTG GGAGACAAGC ATTTATACTT TCTTTCTTCT TTTTTATTTT TTTGAGATCG 1898 

AGTCTCGCTC TGTCACCAGG CTGGAGTGCA GTGACACGAT CTTGGCTCAC TGCAACCTCC 1958 

GTCTCCTGGG TTCAAGTGAT TCTTCTGCCT CAGCCTCCCG AGCAGCTGGG ATTACAGGCG 2018 

CCCACTAATT TTTGTATTCT TAGTAGAAAC GAGGTTTCAA CATGTTGGCC AGGATGGTCT 2078 

CAATCTCTTG ACCTCTTGAT CCACCCGACT TGGCCTCCCG AAGTGATGAG ATTATAGGCG 2138 

TGAGCCACCG CGCCTGGCTT ATACTTTCTT AATAAAAAGG AGAAAGAAAA TCAACAAATG 2198 

TGAGTCATAA AGAAGGGTTA GGGTGATGGT CCAGAGCAAC AGTTCTTCAA GTGTACTCTG 2258 

TAGGCTTCTG GGAGGTCCCT TTTCAGGGGT GTCCACAAAG TCAAAGCTAT TTTCATAATA 2318 

ATACTAACAT GTTATTTGCC TTTTGAATTC TCATTATCTT AAAATTGTAT TGTGGAGTTT 2378 

TCCAGAGGCC GTGTGACATG TGATTACATC ATCTTTCTGA C 2419 
(2) INFORMATIOK FOR SEQ ID NO: 14: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 350 amino acids 

(B) TYPE: amino acids 

(C) STRANDEDNESS: single 
{D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(iii) HYPOTHETICAL: NO 

(iv) ANTISENSE: NO 

(V) FRAQiENT TYPE: internal 
(vi) ORIGINAL SOURCE: 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 14: 

Met Arg Leu Pro Asp Val Gin Leu Trp Leu Val Leu Leu Trp Ala Leu 
15 10 15 

Val Arg Ala Gin Gly Thr Gly Ser Val Cys Pro Ser Cys Gly Gly Ser 
20 25 30 



wo 96/02559 ' PCT/US95A)8745 



-44- 



Lys Leu Ala Pro Gin Ala Glu Arg Ala Leu Val Leu Glu Leu Ala Lys 
35 40 45 

Gin Gin lie Leu Aap Gly Leu His Leu Thr Ser Arg Pro Arg lie Thr 
50 55 60 

His Pro Pro Pro Gin Ala Ala Leu Thr Arg Ala Leu Arg Arg Leu Gin 
65 70 75 80 

Pro Gly Ser Val Ala Pro Gly Asn Gly Glu Glu Val lie Sex Phe Ala 
85 90 95 



10 



Thr Val Thr Asp Ser Thr Ser Ala Tyr Ser Ser Leu Leu Thr Phe His 
100 105 110 



Leu Ser Thr Pro Arg Ser His His Leu Tyr His Ala Arg Leu Trp Leu 
lis 120 125 

His Val Leu Pro Thr Leu Pro Gly Thr Leu Cys Leu Arg lie Phe Arg 
130 135 140 

15 Trp Gly Pro Arg Arg Arg Arg Gin Gly Ser Arg Thr Leu Leu Ala Glu 

145 150 155 160 

His His lie Thr Asn Leu Gly Trp His Thr Leu Thr Leu Pro Ser Ser 
165 . 170 175 



20 



Gly Leu Arg Gly Glu Lys Ser Gly Val Leu Lys Leu Gin Leu Asp Cys 
180 185 190 



Arg Pro Leu Glu Gly Asn Ser Thr Val Thr Gly Gin Pro Arg Arg Leu 
195 200 205 

Leu Asp Thr Ala Gly His Gin Gin Pro Phe Leu Glu Leu Lys lie Arg 
210 215 220 

25 Ala Asn Glu Pro Gly Ala Gly Arg Ala Arg Arg Arg Thr Pro Thr Cys 

225 230 235 240 

Glu Pro Ala Thr Pro Leu Cys Cys Arg Arg Asp His Tyr Val Asp Phe 
245 250 255 



30 



Gin Glu Leu Gly Trp Arg Asp Trp He Leu Gin Pro Glu Gly Tyr Gin 
260 265 270 



Leu Asn Tyr Cys Ser Gly Gin Cys Pro Pro His Leu Ala Gly Ser Pro 
275 280 285 



wo 96/02559 



PCT/US95/08745 



-45- 



Gly lie Ala Ala Ser Phe His Ser Ala Val Phe Ser Leu Leu Lys Ala 
290 295 300 

Asn Asn Pro Trp Pro Ala Ser Thr Ser Cys Cys Val Pro Thr Ala Arg 
305 310 315 320 

5 Arg Pro Leu Ser Leu Leu Tyr Leu Asp His Asn Gly Asn Val Val Lys 

325 330 335 



Thr Asp Val Pro Asp Met Val Val Glu Ala Cys Gly Cys Ser 
340 345 350 



wo 96/02559 



PCTAJS95/08745 



-46- 

CLAIMS 

1. Substantially pure groNvth differentiation factor-12 (GDF-12) and 
functional fragments thereof. 

2. An isolated polynucleotide sequence encoding the GDF-12 polypeptide 
of claim 1 . 

3. The polynucleotide of claim 2, wherein the GDF-12 is selected from the 
group consisting of: 

a. SEQ ID N0:13. wherein T can also be U; 

b. nucleic acid sequences complementary to SEQ ID NO: 13; and 

c. fragments of a. or b. that are at least 15 bases in length and that 
will selectively hybridize to DNA which encodes the GDF-12 
protein of SEQ ID NO: 14; and 

4. The polynucleotide of claim 2, wherein the polynucleotide is isolated 
from a mammalian cell. 

5. The polynucleotide of claim 4, wherein the mammalian ceil is selected 
from the group consisting of mouse, rat, and human cell. 

6. An expression vector including the polynucleotide of claim 2. 

7. The vector of claim 6, wherein the vector is a plasmid. 

8. The vector of claim 6. wherein the vector is a virus. 

9. A host cell stably transformed with the vector of claim 6. 

10. The host cell of claim 9, wherein the cell is prokaryotic. 



wo 96/02559 



PCTAJS95/08745 



-47- 

1 1 . The host cell of claim 9. wherein the cell is eukaryotic. 

12. Antibodies that bind to the polypeptide of claim 1 or fragments thereof. 

13. The antibodies of claim 12, wherein the antibodies are polyclonal. 

14. The antibodies of claim 12, wherein the antibodies are monoclonal. 

15. A method of detecting a cell proliferative disorder comprising 
contacting the antibody of claim 12 with a specimen of a subject 
suspected of having a GDF-12 associated disorder and detecting 
binding of the antibody. 

16. The method of claim 15, wherein the cell is a liver cell. 

17. The method of claim 15, wherein the detecting is in vivo, 

18. The method of claim 17, wherein the antibody is detectably labeled. 

19. The method of claim 18, wherein the detectable label is selected from 
the group consisting of a radioisotope, a fluorescent compound, a 
bioluminescent compound and a chemiluminescent compound. 

20. The method of claim 1 5, wherein the detection is in vitro. 

21 . The method of claim 20. wherein the antibody is detectably labeled. 

22. The method of claim 21 , wherein the label is selected from the group 

consisting of a radioisotope, a fluorescent compound, a biolumi- 
nescent compound, a chemoluminescent compound and an enzyme. 



wo 96/02559 ' PCrAJS95A)8745 

-48- 

23. A methcxi of treating a cell proliferative disorder associated with 
expression of GDF-12, comprising contacting the cells with a reagent 
which suppresses the GDF-12 activity. 

24. The method of claim 23, wherein the reagent is an anti-GDF-12 
antibody. 

25. The method of claim 23. wherein the reagent is a GDF-12 antisense 
sequence. 

26. The method of claim 23. wherein the cell is a liver cell. 

27. The method of claim 23, wherein the reagent which suppresses GDF- 
12 activity is introduced to a cell using a vector. 

28. The method of claim 27, wherein the vector is a colloidal dispersion 
system. 

29. The method of claim 28, wherein the colloidal dispersion system is a 
liposome. 

30. The method of claim 29, wherein the liposome is essentially target 
specific. 

31 . The method of claim 30, wherein the liposome is anatomically targeted. 

32. The method of claim 31, wherein the liposome is mechanistically 
targeted. 

33. The method of claim 32, wherein the mechanistic targeting is passive. 

34. The method of ciaim 32. wherein the mechanistic targeting is active. 



wo 96/02559 



PCT/US95/08745 



-49- 

35. The method of claim 34, wherein the liposome is actively targeted by 
coupling with a moiety selected from the group consisting of a sugar, 
a glycolipid. and a protein. 

36. The method of claim 35, wherein the protein moiety is an antibody. 

37. The method of claim 36, wherein the vector is a virus. 

38. The method of claim 37, wherein the virus is an RNA virus. 

39. The method of claim 38. wherein the RNA virus is a retrovirus. 

40. The method of claim 39, wherein the retrovirus is essentially target 
specific. 

41. The method of claim 40, wherein a moiety for target specificity is 
encoded by a polynucleotide inserted into the retroviral genome. 

42. The method of claim 40, wherein a moiety for target specificity is 
selected from the group consisting of a sugar, a glycolipid, and a 
protein. 

43. The method of claim 42. wherein the protein is an antibody. 



wo 96/02559 



1/3 



PCT/US95/08745 



m s 



FIG. 1 



ovary 

liver 

muscle 

testis 

spleen 

intestine 

pancreas 

seminal vesicle 

kidney 

brain 

thymus 

lung 

heart 



SUBSTITUTE SHEET (RULE 26) 



wo 96/02559 



2/3 



PCTAJS95/08745 



1 CC»;CCAGCACGAMACCCCCACCTCriX:AGCCTGCCAC^ fiO 

RARR RTPTCEPATPLCCRRD 
^1 CATTACGTAGACrrrcCAGGAACTCXX;AlXX;CCGGAC^^ 120 
HYVDFQELGWRDWILQ P ECY 

121 cacctcaattactk:actc»x:actcccctcccc^ lao 

Q Y CSGQCPPHLACSPCI A 

181 GCCTCTITCCATTCTarCGTCTTCACCC^ 240 

A S F H S AVFSLLKANNPWPAS 
241 ACCTCCTGTTGlX^'TCrCTACTKCCGAACGCCCC^^ 300 

T S C C VPTARRPLSLLYLD HM 
301 GGCAATCnWPCAAGACGGATtmxrOUSATATG^^ 360 

GNVVKTDVPDMVVEACGCS* 



FIG. 2 



Fgrnily fngmbsr % identity with finp.ii> 



GDF-1 


43 


GDF-3 


36 


GDF-S 


36 


GDF-6 


39 


GDF-T 


42 


GDF-9 


30 


BMP-3 


37 


BMP-2 


43 




42 


Vgr-1 


41 


0P.1 


40 


BMP-5 


38 


OP-2 


39 


MIS 


30 


Inhibin-a 


27 


Inhibin-BA 


47 


inhlbin-6B 


50 


Nodal 


38 


GDNF 


21 


TGF-81 


36 


TGF-e2 


36 


TGF-63 


41 



FIG. 4 



SUBSTITUTE SHEET (RULE 26) 



wo 96/02559 ' PCT/US95/08745 

3/3 

1 CACCTCnXSAgGCnOU^CACACCrATC^ SO 
5 1 CCACACJJlTACAACACACCTCCCTtn*ACCCTXCCCCAACCCTJ^ X2 0 

12 1 TCCTSTCACTCTCCCCrCATXt^CCCCACCAATCACACTCAACJ^ ISO 
181 ATCCGAGGCTCCTCAACCACCCCCATTCACOUKSACCATCCKCTCCCTCA'S^^ 260 

241 CTCGrTX^ ^ CTGC TCTC GCCACTCCTCCCACCACACKGA^^ 300 

MLVLLWALVRAQCTCSVCPS 
301 CTCTCCCCCCTCCAAACTCCCACCCCAACCACAACCACCT^^ 3 S 0 

CCCSKLAPQASRAI.VLS1-AR 
361 CCACCAAA?CCTCCATC5CTTCCACCTCACCACT^^ ^20 

QQXLOCLHLTSRPRITHPPP 
421 CCACGCACCCCTCACCACACCCCTCCCKy^CACTACACCCACGCA^ CQQ 

QAALTRALRRLQPCSVAPCW 
481 TCCCGACCytf;CTCATCACCrrTT^ 540 

CiEVISFATVTDSTSAYSSL 
541 CCIC ACTTTTC ACCTCTCC ACTCCrroCTCCCACCACCTCTACCATCCC^ 

LTF HLSTPRSHHLVHARLWL 
601 CCACCTCCTCCCCACCCTTCCTCGCACTCrrrCCTT^^ 

HVL PTLPCTLCLRIFRWGPR 
661 CACG AGGCCCCAACCCTCCCCCACTCTCCTCCCrCAC^^ 720 

RRRQCSRTLLAEHH2TNLCW 

721 CCA.^^^* Y^LPSSCLRCEKSCVLKL 

781 CCAACTACACTCCACACCCCTAGAACCCAAC|gCAa^ 940 

QLDCRPLEC In S T| VTCQPRRL 
941 CTTKACACACCACXSACACCACCACCCCTTCCTACAGC^ 500 

LDTACHQQPFl-EI'KJ RAWEP 
901 'TXTr.^r.c.sjsGrrnGGCC^sX^^ SSO 

GAG ai^^^^g^^i TP'?CEPA7PX-CC 
961 CAKCCACACXATTACCTACACTTCCACCAACTXXSGATKC^ 1020 
RROHYVDFQELCWRDWX L QP 
1021 CCACCCCTACCACCTCAATTACTCCACTCCCCACrSCCCCTC 1090 

ECyQLNYCSGQCPPHLACSP 
1081 ACCCATTCCTCCCTCTTTCCATTCTCCCCTCrrc^ 11^0 

GIAASFHSAVFSLLSCANNPW 
1141 CCCTSCCAGTAC a n-L'X l oT TGTC TCCCYACTgCCCGAACCCCCC^^ 1200 

PASTSCCVPTARR PLSLLYL 
1201 CGATCATAATCGCAA'TOTCGTCAACSACGGAOTrCCCACATAT^ 1260 

DHNCNVVKTDVPDMVVE A C C 
1261 crXICAGCTACCAACACCACCTCCCCCTT^^ 1320 



C S - 

1321 CCACAGGGCATCTCTCACTCGACGCATCAGATTC 1380 

1381 ACCTCCCAATATGACTCACTTOACCCCTATCGCACCCAA^ 1440 

1441 ACTTICCrn'ATrCCACCTTCCCTCATCnCTTGCCA^ 1500 

1501 CCGCTCTACCCACAAACCATCATTTCCTCCCCTAACTCCT^ 1560 

1561 ACGGACGGA5CCACCCAACCCACACAAAAATTACTTAGCCTCTCCCAACATC 1620 

1621 CTCAACrrcACCCCACCAGCAACCACATACATCCTCCACCA^ 1680 

1681 CGCTGGCCCAGGGTAACCCXrrCTTCACCTACCTTAACCCAACCTC^ 1740 



600 
660 



180C 
1860 



1861 TTATAC TlTJ ' m 'L ll 'L i U U i A TTTTr i TC ACATCCACTCTCGCTCT^ 1920 

1921 GGAC^CAGTCACACCATCTICGCTCACTGCAACCTCCGTC^ 1980 

1981 -rC-X:CCTCACCCICCCGACCACCTCCCATTACACCCCCC^^ 2040 

2041 GTAGAAACCAGCriTCAACATCTTCGCCACGATCGTCTC 2100 

2101 AC-^-GACTTCGCCTCCCCAACTCATCACATTATAGGCGTCACCCACCGCGC^^ 2160 

2161 AC-rrTTAATAAAAACGAGAAACAAAATCAACAJ^TCTCACTCATAAA^ 2220 

2221 GTCATCCTCCACACCAACACTTCTTCAA^ 2280 

228^ TCAGGGGTCTCCACAAACTCAAAGCTArrTTCATAATAATACTAACATC^^ 2340 

2341 TTGArtTTCTCATTATCTTAAAATTCTATTGTGGAGTTTTCCAC^ 2400 

24 C: ATTArATCA?CTTTCTCAC 2419 



INTERNATIONAL SEARCH REPORT 



Intemaiional application No, 
PCT/US95/08745 



A. CLASSIFICATION OF SUBJECT MATTER 
1PC(6) :C07H 21/04; C12N 1/20, J5/09, 15/18, 15/63. 15/64. 15/66 
US CL :530/350. 399; 536/23.1; 435/69.1 . 252.3. 320.1, 172.3 

According to International Patent Classification qPC) or to both naiional classification and IPC 



B. HELPS SEARCHED 



Minimum documentation searched (classification system followed by classification symbols) 
U.S. : 530/350. 399; 536^,1; 435/69.1. 252.3. 320.1. 172.3 



Documentation searched other than minimum documcnuiion to the extent that such documents arc included in the fields searched 



Electronic data base consulted during the international search (name of data base and. where practicable, search terms used) 
APS, CAS ONLINE, MEDLINE. BIOSIS. EMBASE. SCISEARCH 

search terms: growth differentiation factor, production or isolation, mammal, sequence, polynucleotide, cloning 



C. DOCUMENTS CONSIDERED TO BE RELEVANT 



Category* 



Citation of document, with indication, where appropriate, of the relevant 



passages 



Relevant to claim No. 



PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCE, 
U.S.A., Volume 90, issued July 1993, Sampath et al,' 
"Drosophila Transfofming Growth Factor Beta Superfamily 
Proteins Induce Endochondral Bone Formation in Mammals", 
pages 6004-6008, see page 6004, column 1, see abstract.' 

BIOCHEMICAL AND BIOPHYSICAL RESEARCH 
COMMUNICATIONS, Volume 204, Number 2, issued 28 
October 1994, Hotten et al, "Cloning and Expression of 
Recombinant Human Growth/Differentiation Factor 5", pages 
646-652, see page 646, see abstract. 

WO, A, 93/16099 INEIDHARDT ET AL) 19 August 1993 
page 3. lines 10-13. 



1-11 



1-11 



1-11 



f~l Funher dncumcnis arc lisicd in the continuation of Box C. 



See paiem family annex. 



r 



special coierorto of ciicd documcnti: 

documenl deftnini the fcnereJ Mole of Ihe M which n tMt comidered 
to be of panicular relevance 

curlier document publiKhcd on or after the mienuttMnal filinf date 

documenl which may throw doubu on nrK»rii>- cbtm(R} or which » 
cited to CAUbltsh the publicslion date of another ciiaiion or other 
•pectai rcMon (an upeciricd) 

doctuneni referring to an oral disclosure, uic. exhibition or other 



document published prior lo the iMemational fiUnr dote but later than 
the prior it> dale cbimcd 



later document publuihcd after the inlemaUonal Titinf date or prioriry 
dote and not tn conHici with the appUcation but cited lo undciMand the 
principle or theory undcrlyini Ihe invention 

documenl of parxicutar relevance; the cbbncd invention cannot be 
comidered novel or cannot be comidered lo involve an inventive atep 
when the documenl b taken akmc 

document of parxicutar relevance; the clatmed invention cannot be 
considered to involve an inventive uep when the document ii 
combined with one or more other such documento. tucb combination 
beinf obvious to a pereon skilled in the art 

document member of the same potent family 



Date of the actual compltuion of the intemaiional search 



03 OCTOBER 1995 



Date of mailing of the intemaiional jtearch report 

2 6 €CT 1995 



Name and mailing address of ihe ISA/US 
CommtMioner of Paicnis and Trademarks 
Box PCX 

Washinpmn. D.C. 20231 
Fai'similc Nn. (703) 3050:30 



Authnri7.ed officer 

PREMA MERTZ 
Telephone No. (703) 308-0196 



r f 



Form PCT/ISA/:iO iscetmd sheciXJuU 1992)* 



INTERNATIONAL SEARCH REPORT 



International application No. 
PCT/US95/08745 



Box I Obserratioiis where certain claims were found unsearchable (Continuation of item 1 of first shed) 

This inicmaltonaJ report has not been established in respect of certain claims under Article n(2)(a) for the following reasons: 

1. I I Claims Nos.: 

' — ' because ihcy relate to subject matter not required to be searched by this Authority, namely; 

2. I I Claims Nos.: 

' — ' because they relate to parts of the inlemalional application thai do not comply with the prescribed requirements to such 
an extent that no meaningful international search can be carried out, specifically: 

3. r~] Cla'uns Nos.: 

— because ihcy are dependent claims and are not drafted in accordance with the second and third sentences of Rule 6.4(a). 

Box II Observations where unity of invention is lacking (Continuation of item 2 of first sheet) 
fhis International Searching Authority found multiple inventions in this inlemalional application, as follows: 
Please See Extra Sheet. 



I I As all required additional search fees were timely paid by the applicanl, this inlemalional search report covers all searchable 



claims. 



2. Q As all searchable claims could be searched without effort justifying an additional fee, this Authority did not invite payment 

of any additional fee. 

3. n As only some of the required additional search fees were timely paid by the applicant, this international search report cov4 

onlv those claims for which fees were paid, specifically claims Nos.: 



4. Px] No required additional scarcli fees were timely paid by the applicant. Consequently, this imcmaiional search report is 
— rcsiricied to the invention first mcntinncd in the claims; it is covered by claims Nos.: 



in 



Rrmiirk on Protrsl [ | The aJdilional .search fees were accompanied by the applicant's protest. 

j I No protest accompanied the payment of additional search fees. 



Form PCT/lSA/210 (cominuation of first shccKl ))(July 1992)* 



INTERNATIONAL SEARCH REPORT 



Iniemational application No. 
PCT/US95/08745 



BOX n. OBSERVATIONS WHERE UNFTY OF INVENTION WAS LACKING 
This ISA found muliiple invcniions as follows: 

I. Claims l-U, drawn lo a growih diffcrenlialion facior-12 (GDF-12). a polynuclcolide sequence encoding the CDF- 
12, an expression vector and a host cell. 

II. Claims 12-22, drawn lo antibodies, and a method of detecting a cell proliferative disorder by contacting the 
antibody with a specimen. 

III. Claims 23-24. and 26-43, drawn to a method of treating a cell proliferative disorder by conuciing cells with Anli- 
GDF-12 antibody, 

IV. Claims 23, and 25-43. drawn lo a method of treating a cell proliferative disorder by contacting cells with GDF-12 
antisense sequence. 

The inventions listed as Groups I-IV do not relate lo a single inventive concept under PCT Rule 13 J because, under 
PCT Rule 13.2, they lack the same or corresponding special technical features for the following reasons: 

Groups Ml are drawn to separate, distinct inventions and arc distinguished from each other because the special 
technical features which define them by chemical and physical characteristics as well a.s biological functions arc 
different and these special technical features are not shared by each invention. Since these special technical features arc 
not shared by each product and since the common features do not establish an advance over the prior art. the inventions 
of Groups l-II do not form a single inventive concern within the meaning of Rule 13.2. 

Groups III -IV are drawn to methods having different mcihodstcps.andreagenis which do not share the same or a 
corresponding special technical feature which define the contribution of each invention. Since ihese special technical 
features is not shared by each process and since the common features do not establish an advance over the prior art, the 
inventions of Groups lll-IV do not form a single inventive concept wiihin the meaning of Rule 13.2. 
The invention of Group I is separate and distinct from the inventions of Groups III and IV because the invention of 
Group I is not used or produced by the inventions of Groups III and IV. 

The invention of Group II is separate and distinct from the invention of Group IV because the invention of Group II is 
not used or produced by the invention of Group IV. 

The invention of Group II is separate and distinct from the invention of Group III because the invention of Group II 
may be used in other methods other than the method of treating a cell proliferative disorder. The antibody of Group II 
can be used in immunodiagnosiics. 



F.»rm PCT/ISA/210 (cxir.i sluvDUuly 1992)* 



This Page is Inserted by IFW Indexing and Scanning 
Operations and is not part of the Official Record 

BEST AVAILABLE IMAGES 

Defective images within this document are accurate representations of the original 
documents submitted by the appHcant. 

Defects in the images include but are not limited to the items checked: 

□ BLACK BORDERS 

□ IMAGE CUT OFF AT TOP, BOTTOM OR SIDES 
□TfADED TEXT OR DRAWING 

Ef BLURRED OR ILLEGIBLE TEXT OR DRAWING 

□ SKEWED/SLANTED IMAGES 

□ COLOR OR BLACK AND WHITE PHOTOGRAPHS 

□ GRAY SCALE DOCUMENTS 

□ LINES OR MARKS ON ORIGINAL DOCUMENT 

□ REFERENCE(S) OR EXHIBIT(S) SUBMITTED ARE POOR QUALITY 

□ OTHER: ^ 

IMAGES ARE BEST AVAILABLE COPY. 
As rescanning these documents will not correct the image 
problems checked, please do not report these problems to 
the IFW Image Problem Mailbox.