Skip to main content

Full text of "USPTO Patents Application 09804625"

See other formats


WORLD INTELLECTUAL PROPERTY ORGANIZATION 
International Bureau 




PCT 

INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) 



(51) International Patent Classification 6 : 

C12N 15/12, C07K 14/51, A61K 38/18 



Al 



(11) International Publication Number: WO 95/33830 

(43) International Publication Date: 14 December 1995 (14.12.95) 



(21) International Application Number: PCT/US95/07084 

(22) International Filing Date: 5 June 1995 (05.06.95) 



(30) Priority Data: 

08/254,353 



6 June 1994(06.06.94) 



US 



(71) Applicant {for all designated States except US): GENET- 

ICS INSTITUTE, INC. [US/US]; Legal Affairs, 87 Cam- 
bridgePark Drive, Cambridge, MA 02140 (US). 

(72) Inventors; and 

(75) Inventors/Applicants (for US only): ROSEN, Vicki, A. 
[US/US]; 127 Kilsyth Road, Brookline, MA 02146 (US). 
WOZNEY, John, M. [US/US]; 59 Old Bolton Road, 
Hudson, MA 01749 (US). CELESTE, Anthony, J. [US/USJ; 
86 Packard Street, Hudson, MA 01749 (US). THIES, 
Scott, R. [US/US]; 10 McKenney Circle, Andover, MA 
01810 (US). SONG, Jeffrey, J. [US/US]; 10 Dwight Street, 
Brookline, MA 02146 (US). 

(74) Agent: KAPINOS, Ellen, J.; Genetics Institute, Inc., Legal 
Affairs, 87 CambridgePark Drive, Cambridge, MA 02140 
(US). 



(81) Designated States: AU t JP, KR, US, European patent (AT, BE, 
CH, DE, DK, ES, FR, GB, GR, IE, IT, LU, MC, NL, PT, 
SE). 



Published 

With international search report. 

Before the expiration of the time limit for amending the 
claims and to be republished in the event of the receipt of 
amendments. 



(54) Title: BMP-9 COMPOSITIONS 
(57) Abstract 



Purified BMP-9 proteins and processes for producing them are disclosed. The proteins may be used in the treatment of bone and 
cartilage defects and in wound healing and related tissue repair, and in hepatic growth and function. 



FOR THE PURPOSES OF INFORMATION ONLY 



Codes used to identify States party to the PCT on the front pages of pamphlets publishing international 
applications under the PCT. 



AT 


Austria 


GB 


United Kingdom 


MR 


Mauritania 


AU 


Australia 


GE 


Georgia 


MW 


Malawi 


BB 


Barbados 


GN 


Guinea 


NE 


Niger 


BE 


Belgium 


GR 


Greece 


NL 


Netherlands 


BF 


Burkina Faso 


HU 


Hungary 


NO 


Norway 


BG 


Bulgaria 


IE 


Ireland 


NZ 


New Zealand 


BJ 


Benin 


IT 


Italy 


PL 


Poland 


BR 


Brazil 


JP 


Japan 


FT 


Portugal 


BV 


Belarus 


KE 


Kenya 


RO 


Romania 


CA 


Canada 


KG 


Kyrgystan 


RU 


Russian Federation 


CF 


Central African Republic 


KP 


Democratic People's Republic 


SD 


Sudan 


CG 


Congo 




of Korea 


SE 


Sweden 


CH 


Switzerland 


KR 


Republic of Korea 


SI 


Slovenia 


CI 


Cote d'lvoire 


KZ 


Kazakhstan 


SK 


Slovakia 


CM 


Cameroon 


U 


Liechtenstein 


SN 


Senegal 


CN 


China 


LK 


Sri Lanka 


TO 


Chad 


cs 


Czechoslovakia 


LU 


Luxembourg 


TG 


Togo 


cz 


Czech Republic 


LV 


Latvia 


TJ 


Tajikistan 


DE 


Germany 


MC 


Monaco 


TT 


Trinidad and Tobago 


DK 


Denmark 


MD 


Republic of Moldova 


UA 


Ukraine 


ES 


Spain 


MG 


Madagascar 


US 


United States of America 


Fl 


Finland 


ML 


Mali 


UZ 


Uzbekistan 


FR 


France 


MN 


Mongolia 


VN 


Viet Nam 


GA 


Gabon 











WO 95/33830 



PCT/US95/07084 



BMP-9 COMPOSITIONS 

The present invention relates to a novel family of purified 
proteins designated BMP-9 proteins and processes for obtaining 
them. These proteins may be used to induce bone and/or cartilage 
5 formation, in wound healing and tissue repair, and in hepatic 
growth and function. 

The murine BMP-9 DNA sequence (SEQ ID NO:l) and amino acid 
sequence (SEQ ID NO: 2) are set forth in Figure 1. Human BMP-9 
sequence is set forth in Figure 3 (SEQ ID NO:8 and SEQ ID NO:9). 
10 It is contemplated that BMP-9 proteins are capable of inducing 
the formation of cartilage and/or bone. BMP-9 proteins may be 
further characterized by the ability to demonstrate cartilage 
and/or bone formation activity in the rat bone formation assay 
described below. 

15 Murine BMP-9 is characterized by comprising amino acid #319 

to #428 of Figure 1 (SEQ ID NO:2 amino acids #1-110). Murine 
BMP-9 may be produced by culturing a cell transformed with a DNA 
sequence comprising nucleotide #610 to nucleotide #1893 as shown 
in Figure 1 (SEQ ID N0:1) and recovering and purifying from the 

20 culture medium a protein characterized by the amino acid sequence 
comprising amino acid #319 to #428 as shown in Figure 1 (SEQ ID 
NO: 2) substantially free from other proteinaceous materials with 
which it is co-produced. 

Human BMP-9 is expected to be homologous to murine BMP-9 and 

25 is characterized by comprising amino acid #1 (Ser, Ala, Gly) to 
#110 of Figure 3 (SEQ ID NO:9) (Arg) . The invention includes 
methods for obtaining the DNA sequences encoding human BMP-9. 
This method entails utilizing the murine BMP-9 nucleotide 
sequence or portions thereof to design probes to screen libraries 

30 for the human gene or fragments thereof using standard 
techniques. Human BMP-9 may be produced by -culturing a cell 
transformed with the BMP-9 DNA sequence and recovering and 
purifying BMP-9 from the culture medium. The expressed protein 
is isolated, recovered, and purified from the culture medium. 



WO 95/33830 



PCI7US95/07084 



The purified expressed protein is substantially free from other 
proteinaceous materials with which it is co-produced, as well as 
from other contaminants. The recovered purified protein is 
contemplated to exhibit cartilage and/or bone formation activity. 
5 The proteins of the invention may be further characterized by the 
ability to demonstrate cartilage and/or bone formation activity 
in the rat bone formation assay described below. 

Human BMP-9 may be produced by culturing a cell transformed 
with a DNA sequence comprising nucleotide #124 to #453 as shown 

10 in SEQ ID NO: 8 and recovering and purifying from the culture 
medium a protein characterized by the amino acid sequence of SEQ 
ID NO: 9 from amino acid #1 to amino acid #110 substantially free 
from other proteinaceous materials with which it is co-produced. 
Another aspect of the invention provides pharmaceutical 

15 compositions containing a therapeutically effective amount of a 
BMP-9 protein in a pharmaceutical^ acceptable vehicle or 
carrier. BMP-9 compositions of the invention may be used in the 
formation of cartilage. These compositions may further be 
utilized for the formation of bone. BMP-9 compositions may also 

20 be used for wound healing and tissue repair. Compositions of the 
invention may further include at least one other therapeutically 
useful agent such as the BMP proteins BMP-1, BMP-2, BMP-3, BMP-4, 
BMP-5, BMP-6, and BMP-7 disclosed for instance in PCT Publication 
Nos. VJO88/00205, WO89/10409, and WO90/11366, and BMP-8, disclosed 

25 in U.S. Application Serial No. 07/641,204 filed January 15, 1991, 
Serial No. 07/525,357 filed May 16, 1990, and Serial No. 
07/800,364 filed November 20, 1991. 

The compositions of the invention may comprise, in addition 
to a BMP-9 protein, other therapeutically useful agents including 

30 growth factors such as epidermal growth factor (EGF) , fibroblast 
growth factor (FGF) , transforming growth factor (TGF-a and TGF- 
P) , and insulin-like growth factor (IGF) . The compositions may 
also include an appropriate matrix for instance, for supporting 
the composition and providing a surface for bone and/or cartilage 

35 growth. The matrix may provide slow release of the 
osteoinductive protein and/or the appropriate environment for 
presentation thereof. 



2 



WO 95/33830 



PCT/US95/07084 



The BMP-9 compositions may be employed in methods for 
treating a number of bone and/or cartilage defects, periodontal 
disease and various types of wounds. These methods, according 
to the invention, entail administering to a patient needing such 
5 bone and/or cartilage formation wound healing or tissue repair, 
an effective amount of a BMP-9 protein. These methods may also 
entail the administration of a protein of .the invention in 
conjunction with at least one of the novel BMP proteins disclosed 
in the co-owned applications described above. In addition, these 
10 methods may also include the administration of a BMP-9 protein 
with other growth factors including EGF, FGF, TGF-a, TGF-jS, and 
IGF. 

Still a further aspect of the invention are DNA sequences 
coding for expression of a BMP-9 protein. Such sequences include 

15 the sequence of nucleotides in a 5' to 3 ' direction illustrated 
in Figure 1 (SEQ ID N0:1) and Figure 3 (SEQ ID NO:8) or DNA 
sequences which hybridize under stringent conditions with the DNA 
sequences of Figure 1 or 3 and encode a protein having the 
ability to induce the formation of cartilage and/or bone. 

20 Finally, allelic or other variations of the sequences of Figure 
1 or 3, whether such nucleotide changes result in changes in the 
peptide sequence or not, are also included in the present 
invention. 

A further aspect of the invention includes vectors 
25 comprising a DNA sequence as described above in operative 
association with an expression control sequence therefor. These 
vectors may be employed in a novel process for producing a BMP-9 
protein of the invention in which a cell line transformed with 
a DNA sequence encoding a BMP-9 protein in operative association 
30 1 with an expression control sequence therefor, is cultured in a 
suitable culture medium and a BMP-9 protein is recovered and 
purified therefrom. This process may employ a number of known 
cells both prokaryotic and eukaryotic as host cells for 
expression of the polypeptide. 
35 Other aspects and advantages of the present invention will 

be apparent upon consideration of the following detailed 
description and preferred embodiments thereof. 



3 



WO 95/33830 



PCT/US95/07084 



BRIEF DESCRIPTION OF THE DRAWINGS 
FIG. 1 comprises DNA sequence and derived amino acid sequence of 
murine BMP-9 from clone ML14a further described below, 
FIG. 2 comprises DNA sequence and derived amino acid sequence of 
5 human BMP-4 from lambda U20S-3 ATCC #40342. 

FIG. 3 comprises DNA sequence and derived amino acid sequence of 
human BMP-9 from X FIX/H6111 ATCC #75252. 

FIG. 4 sets forth articular cartilage assay sulfate incorporation 
results. 

10 FIG. 5 sets forth results of specific BMP-9 binding to HepG2 
cells. 

FIG. 6 sets forth results of stimulation of HepG2 cell 
proliferation by BMP-9. 

FIG, 7 sets forth the results of stimulation of primary rat 
15 hepatocytes by BMP-9. 

DETAILED DESCRIPTION OF THE INVENTION 
The murine BMP-9 nucleotide sequence (SEQ ID NO:l) and 
encoded amino acid sequence (SEQ ID N0:2) are depicted in Figure 
1. Purified murine BMP-9 proteins of the present invention are 

20 produced by culturing a host cell transformed with a DNA sequence 
comprising the DNA coding sequence of Figure 1 (SEQ ID NO:l) from 
nucleotide #610 to nucleotide #1893 and recovering and purifying 
from the culture medium a protein which contains the amino acid 
sequence or a substantially homologous sequence as represented 

25 by amino acid #319 to #428 of Figure 1 (SEQ ID NO:2). The BMP-9 
proteins recovered from the culture medium are purified by 
isolating them from other proteinaceous materials from which they 
are co-produced and from other contaminants present. 

Human BMP-9 nucleotide and amino acid sequence is depicted 

30 in SEQ ID No: 8 and 9. Mature human BMP-9 is expected to 
comprise amino acid #1 (Ser, Ala, Gly) to #110 (Arg) . 

Human BMP-9 may be produced by culturing a cell transformed 
with a DNA sequence comprising nucleotide #124 to #453 as shown 
in SEQ ID NO: 8 and recovering and purifying from the culture 

35 medium a protein characterized by the amino acid sequence -of SEQ 
ID NO: 9 from amino acid #1 to amino acid #110 substantially free 



4 



WO 95/33830 



PCTAJS95/07084 



from other proteinaceous materials with which it is co-produced. 

BMP-9 proteins may be characterized by the ability to induce 
the formation of cartilage. BMP-9 proteins may be further 
characterized by the ability to induce the formation of bone. 
5 BMP-9 proteins may be further characterized by the ability to 
demonstrate cartilage and/or bone formation activity in the rat 
bone formation assay described below. 

The BMP-9 proteins provided herein also include factors 
encoded by the sequences similar to those of Figure 1 and 3 (SEQ 

10 ID NOS:l and 8), but into which modifications are naturally 
provided (e.g., allelic variations in the nucleotide sequence 
which may result in amino acid changes in the polypeptide) or 
deliberately engineered. For example, synthetic polypeptides may 
wholly or partially duplicate continuous sequences of the amino 

15 acid residues of Figure 1 of Figure 3 (SEQ ID NOS:2 and 9). 
These sequences, by virtue of sharing primary, secondary, or 
tertiary structural and conformational characteristics with bone 
growth factor polypeptides of Figure 1 and Figure 3 may possess 
bone growth factor biological properties in common therewith. 

20 Thus, they may be employed as biologically active substitutes for 
naturally-occurring BMP-9 and other BMP-9 polypeptides in 
therapeutic processes. 

Other specific mutations of the sequences of BMP-9 proteins 
described herein involve modifications of glycosylation sites. 

25 These modifications may involve O-linked or N-linked 
glycosylation sites. For instance, the absence of glycosylation 
or only partial glycosylation results from amino acid 
substitution or deletion at asparagine-linked glycosylation 
recognition sites. The asparagine-linked glycosylation 

3 0 recognition sites comprise tripeptide sequences which are 
specifically recognized by appropriate cellular glycosylation 
enzymes. These tripeptide sequences are either asparagine-X- 
threonine or asparagine-X-serine, where X is usually any amino 
acid. A variety of amino acid substitutions or deletions at one 

35 or both of the first or third amino acid positions of a 
glycosylation recognition site (and/or amino acid deletion at the 
second position) results in non-glycosylation at the modified 



5 



WO 95/33830 



PCT/US95/07084 



tripeptide sequence. 

The present invention also encompasses the novel DNA 
sequences, free of association with DNA sequences encoding other 
proteinaceous materials, and coding on expression for BMP-9 
5 proteins. These DNA sequences include those depicted in Figure 
1 or Figure 3 (SEQ ID NOS:l and 8) in a 5' to 3' direction and 
those sequences which hybridize thereto . under stringent 
hybridization conditions [see, T. Maniatis et al., Molecular 
Cloning (A Laboratory Manual) . Cold Spring Harbor Laboratory 

10 (1982) , pages 387 to 389] and encode a protein having cartilage 
and/or bone inducing activity. 

Similarly, DNA sequences which code for BMP-9 proteins coded 
for by the sequences of Figure 1 or Figure 3, but which differ 
in codon sequence due to the degeneracies of the genetic code or 

15 allelic variations (naturally-occurring base changes in the 
species population which may or may not result in an amino acid 
change) also encode the novel factors described herein. 
Variations in the DNA sequences of Figure 1 or Figure 3 (SEQ ID 
NOS:l and 8) which are caused by point mutations or by induced 

20 modifications (including insertion, deletion, and substitution) 
to enhance the activity, half-life or production of the 
polypeptides encoded are also encompassed in the invention. 

Another aspect of the present invention provides a novel 
method for producing BMP-9 proteins. The method of the present 

25 invention involves culturing a suitable cell line, which has been 
transformed with a DNA sequence encoding a BMP-9 protein of the 
invention, under the control of known regulatory sequences. The 
transformed host cells are cultured and the BMP-9 proteins 
recovered and purified from the culture medium. The purified 

30 proteins are substantially free from other proteins with whioh 
they are co-prpduced as well as from other contaminants. 

Suitable cells or cell lines may be mammalian cells, such 
as Chinese hamster ovary cells (CHO) . The selection of suitable 
mammalian host cells and methods for transformation, culture, 

35 amplification, screening, product production and purification are 
known in the art. See e.g., Gething and Sambrook, Nature 
293 :620-625 (1981), or alternatively, Kaufman et al., Mol. Cell. 



6 



WO 95/33830 



PCT/US95/07084 



Biol. 5(7) H750-1759 (1985) or Howley et al., U.S. Patent No. 
4,419,446. Another suitable mammalian cell line, which is 
described in the accompanying examples, is the monkey COS-1 cell 
line. The mammalian cell CV-1 may also be suitable. 
5 Bacterial cells may also be suitable hosts. For example, 

the various strains of E . coli (e.g., HB101, MC1061) are 
well-known as host cells in the field of biotechnology. Various 
strains of B. subtilis , Pseudomonas, other bacilli and the like 
may also be employed in this method. 

10 Many strains of yeast cells known to those skilled in the 

art may also be available as host cells for expression of the 
polypeptides of the present invention. Additionally, where 
desired, insect cells may be utilized as host cells in the method 
of the present invention. See e.g., Miller et al., Genetic 

15 Engineering 8:277-298 (Plenum Press 1986) and references cited 
therein. 

Another aspect of the present invention provides vectors for 
use in the method of expression of these novel BMP-9 
polypeptides. Preferably the vectors contain the full novel DNA 

20 sequences described above which encode the novel factors of the 
invention. Additionally the vectors also contain appropriate 
expression control sequences permitting expression of the BMP-9 
protein sequences. Alternatively, vectors incorporating modified 
sequences as described above are also embodiments of the present 

25 invention. The vectors may be employed in the method of 
transforming cell lines and contain selected regulatory sequences 
in operative association with the DNA coding sequences of the 
invention which are capable of directing the replication and 
expression thereof in selected host cells. Regulatory sequences 

30 for such vectors are known to those skilled in the art and may 
be selected depending upon the host cells. Such selection is 
routine and does not form part of the present invention. 

A protein of the present invention, which induces cartilage 
and/or bone formation in circumstances where bone is not normally 

35 formed, has application in the healing of bone fractures and 
cartilage defects in humans and other animals. Such a 
preparation employing a BMP-9 protein may have prophylactic use 



7 



WO 95/33830 



PCT/US95/07084 



in closed as well as open fracture reduction and also in the 
improved fixation of artificial joints. De novo bone formation 
induced by an osteogenic agent contributes to the repair of 
congenital, trauma induced, or oncologic resection induced 
5 craniofacial defects, and also is useful in cosmetic plastic 
surgery. A BMP-9 protein may be used in the treatment of 
periodontal disease, and in other tooth repair processes. Such 
agents may provide an environment to attract bone-forming cells, 
stimulate growth of bone-forming cells or induce differentiation 

10 of progenitors of bone-forming cells. BMP-9 polypeptides of the 
invention may also be useful in the treatment of osteoporosis. 
BMP-9 may be used in cartilage defect repair and prevention/ 
reversal of osteoarthritis. A variety of osteogenic, 

cartilage-inducing and bone inducing factors have been 

15 described. See e.g., European Patent Application Nos. 148,155 
and 169,016 for discussions thereof. 

The proteins of the invention may also be used in wound 
healing and related tissue repair. The types of wounds include, 
but are not limited to burns, incisions and ulcers. (See e.g., 

20 PCT Publication No. WO84/01106 for discussion of wound healing 
and related tissue repair). 

It is further contemplated that proteins of the invention 
may increase neuronal survival and therefore be useful in 
transplantation and treatment of conditions exhibiting a decrease 

25 in neuronal survival. 

BMP-9 proteins of the invention may also be useful in 
hepatic growth and function including repair and regeneration of 
liver cells. BMP-9 may therefore be used for instance in 
treatment of conditions exhibiting degeneration of the liver. 

3 0 A further aspect of the invention is a therapeutic method 

and composition for repairing fractures and other conditions 
related to cartilage and/or bone defects or periodontal dis- 
eases. The invention further comprises therapeutic methods and 
compositions for wound healing and tissue repair. Such 

35 compositions comprise a therapeutically effective amount of at 
least one of the BMP-9 proteins of the invention in admixture 
with a pharmaceutical^ acceptable vehicle, carrier or matrix. 



8 



WO 95/33830 



PCT/US95/07084 



It is expected that the proteins of the invention may act in 
concert with or perhaps synergistically with other related 
proteins and growth factors. Further therapeutic methods and 
compositions of the invention therefore comprise a therapeutic 
5 amount of at least one BMP-9 protein of the invention with a 
therapeutic amount of at least one of the other BMP proteins 
disclosed in co-owned applications described above. Such 
combinations may comprise separate molecules of the BMP proteins 
or heteromolecules comprised of different BMP moieties. For 

10 example, a method and composition of the invention may comprise 
a disulfide linked dimer comprising a BMP-9 protein subunit and 
a subunit from one of the "BMP" proteins described above. A 
further embodiment may comprise a heterodimer of BMP-9 moieties. 
Further, BMP-9 proteins may be combined with other agents 
. 15 beneficial to the treatment of the bone and/or cartilage defect, 
wound, or tissue in question. These agents include various 
growth factors such as epidermal growth factor (EGF) , platelet 
derived growth factor (PDGF) , transforming growth factors (TGF-cr 
and TGF-(8) , and insulin-like growth factor (IGF) . 

20 The preparation and formulation of such physiologically 

acceptable protein compositions, having due regard to pH, 
isotonicity, stability and the like, is within the skill of the 
art. The therapeutic compositions are also presently valuable 
for veterinary applications due to the lack of species 

25 specificity in BMP proteins. Particularly domestic animals and 
thoroughbred horses in addition to humans are desired patients 
for such treatment with BMP-9 of the present invention. 

The therapeutic method includes administering the 
composition topically, systemically , or locally as an implant or 

3 0 device. When administered, the therapeutic composition for use 
in this invention is, of course, in a pyrogen-f ree, 
physiologically acceptable form. Further, the composition may 
desirably be encapsulated or injected in a viscous form for 
delivery to the site of bone, cartilage or tissue damage. 

35 Topical administration may be suitable for wound healing and 
tissue repair. Therapeutically useful agents other than the BMP- 
9 proteins which may also optionally be included in the 



9 



WO 95/33830 



PCTAJS95/07084 



composition as described above, may alternatively or 
additionally, be administered simultaneously or sequentially with 
the BMP composition in the methods of the invention. Preferably 
for bone and/or cartilage formation, the composition would 
5 include a matrix capable of delivering BMP-9 or other BMP 
proteins to the site of bone and/or cartilage damage, providing 
a structure for the developing bone and cartilage and optimally 
capable of being resorbed into the body. The matrix may provide 
slow release of BMP-9 and/or the appropriate environment for 

10 presentation thereof. Such matrices may be formed of materials 
presently in use for other implanted medical applications. 

The choice of matrix material is based on biocompatibility , 
biodegradability , mechanical properties, cosmetic appearance and 
interface properties. The particular application of the BMP-9 

15 compositions will define the appropriate formulation. Potential 
matrices for the compositions may be biodegradable and chemically 
defined calcium sulfate, tricalciumphosphate, hydroxyapatite, 
polylactic acid and polyanhydrides. Other potential materials 
are biodegradable and biologically well defined, such as bone or 

20 dermal collagen. Further matrices are comprised of pure proteins 
or extracellular matrix components. Other potential matrices are 
nonbiodegradable and chemically defined, such as sintered 
hydroxyapatite, bioglass, aluminates, or other ceramics. 
Matrices may be comprised of combinations of any of the above 

25 mentioned types of material, such as polylactic acid and 
hydroxyapatite or collagen and tricalciumphosphate. The 
bioceramics may be altered in composition, such as in calcium- 
aluminate-phosphate and processing to alter pore size, particle 
size, particle shape, and biodegradability. 

30 The dosage regimen will be determined by the attending 

physician considering various factors which modify the action of 
the BMP-9 protein, e.g., amount of bone weight desired to be 
formed, the site of bone damage, the condition of the damaged 
bone, the size of a wound, type of damaged tissue, the patient's 

35 age, sex, and diet, the severity of any infection, time of 
administration and other clinical factors. The dosage may vary 
with the type of matrix used in the reconstitution and the types 



10 



WO 95/33830 



PCT/US95/07084 



of BMP proteins in the composition. The addition of other known 
growth factors, such as IGF I (insulin like growth factor I) , to 
the final composition, may also effect the dosage. Progress can 
be monitored by periodic assessment of bone growth and/or repair, 
5 for example, x-rays, histomorphometric determinations and 
tetracycline labeling. 

The following examples illustrate practice of the present 
invention in recovering and characterizing murine BMP-9 protein 
and employing it to recover the human and other BMP-9 proteins, 
10 obtaining the human proteins and expressing the proteins via 
recombinant techniques. 

EXAMPLE I 

MURINE BMP-9 

750,000 recombinants of a mouse liver cDNA library made in 

15 the vector lambdaZAP (Stratagene/Catalog #935302) are plated and 
duplicate nitrocellulose replicas made. A fragment of human BMP- 
4 DNA corresponding to nucleotides 1330-1627 of Figure 2 (SEQ ID 
NO: 3) (the human BMP-4 sequence) is 32 P-labeled by the random 
priming procedure of Feinberg et al., Anal. Biochem. 132:6-13 

20 (1983) and hybridized to both sets of filters in SHB at 60°C for 
2 to 3 days. Both sets of filters are washed under reduced 
stringency conditions (4X SSC, 0.1% SDS at 60°C) . Many duplicate 
hybridizing recombinants of various intensities (approximately 
92) are noted. 50 of the strongest hybridizing recombinant 

25 bacteriophage are plaque purified and their inserts are 
transferred to the plasmid Bluescript SK (+/-) according to the 
in vivo excision protocol described by the manufacturer 
(Stratagene) . DNA sequence analysis of several recombinants 
indicate that they encode a protein homologous to other BMP 

30 proteins and other proteins in the TGF-0 family. The DNA 
sequence and derived amino acid sequence of one recombinant, 
designated ML14a, is set forth in Figure 1. (SEQ ID NO:l) 

The nucleotide sequence of clone ML14a contains an open 
reading frame of 1284 bp, encoding a BMP-9 protein of 428 amino 

35 acids. The encoded 428 amino acid BMP-9 protein is contemplated 
to be the primary translation product as the coding sequence is 



11 



WO 95/33830 



PCT/US95/07084 



preceded by 609 bp of 5' untranslated sequence with stop codons 
in all three reading frames. The 4 28 amino acid sequence 
predicts a BMP-9 protein with a molecular weight of 48,000 
daltons. 

5 Based on knowledge of other BMP proteins and other proteins 

within the TGF-/J family, it is predicted that the precursor 
polypeptide would be cleaved at the multibasic sequence ARG-ARG- 
LYS-ARG in agreement with a proposed consensus proteolytic 
processing sequence of ARG-X-X-ARG. Cleavage of the BMP-9 

10 precursor polypeptide at this location would generate a 110 amino 
acid mature peptide beginning with the amino acid SER at position 
#319. The processing of BMP-9 into the mature form is expected 
to involve dimerization and removal of the N-terminal region in 
a manner analogous to the processing of the related protein TGF-jS 

15 [L. E. Gentry et al., Mol. & Cell. Biol. 8:4162 (1988); R. 
Derynck et al., Nature 316:701 (1985)]. 

It is contemplated therefore that the mature active species 
of murine BMP-9 comprises a homodimer of 2 polypeptide subunits, 
each subunit comprising amino acids #319-#428 with a predicted 

20 molecular weight of approximately 12,000 daltons. Further active 
species are contemplated comprising amino acids #326 - #428 
thereby including the first conserved cysteine residue. As with 
other members of the BMP and TGF-0 family of proteins, the 
carboxy-terminal region of the BMP-9 protein exhibits greater 

25 sequence conservation than the more amino-terminal portion. The 
percent amino acid identity of the murine BMP-9 protein in the 
cysteine-rich C-terminal domain (amino acids #326 - #428) to the 
corresponding region of other human BMP proteins and other 
proteins within the TGF-0 family is as follows: BMP-2, 53%; BMP- 

30 3, 43%; BMP-4, 53%; BMP-5, 55%; BMP-6, 55%; BMP-7 , 53%; Vgl, 50%; 
GDF-1, 43%; TGF-01, 32%; TGF-02 , 34%; TGF-03 , 34%; inhibin 0(B), 
34%; and inhibin j3(A), 42%. 



EXAMPLE II 

HUMAN BMP-9 

35 Murine and human osteoinductive factor genes are presumed 

to be significantly homologous, therefore the murine coding 



12 



WO 95/33830 



PCT/US95/07084 



sequence or a portion thereof is used as a probe to screen a 
human genomic library or as a probe to identify a human cell line 
or tissue which synthesizes the analogous human cartilage and/or 
bone protein. A human genomic library (Toole et al., supra) may 
5 be screened with such a probe, and presumptive positives isolated 
and DNA sequence obtained. Evidence that this recombinant 
encodes a portion of the human BMP-9 relies of the murine/human 
protein and gene structure homologies. 

Once a recombinant bacteriophage containing DNA encoding 

10 portion of the human cartilage and/or bone inductive factor 
molecule is obtained, the human coding sequence can be used as 
a probe to identify a human cell line or tissue which synthesizes 
BMP-9. Alternatively, the murine coding sequence can be used as 
a probe to identify such human cell line or tissue. Briefly 

15 described, RNA is extracted from a selected cell or tissue source 
and either electrophoresed on a formaldehyde agarose gel and 
transferred to nitrocellulose, or reacted with formaldehyde and 
spotted on nitrocellulose directly. The nitrocellulose is then 
hybridized to a probe derived from a coding sequence of the 

20 murine or human BMP-9. mRNA is selected by oligo (dT) cellulose 
chromatography and cDNA is synthesized and cloned in lambda gtlO 
or lambda ZAP by established techniques (Toole et al., supra). 

Additional methods known to those skilled in the art may be 
used to isolate the human and other species' BMP-9 proteins of 

25 the invention. 

A. ISOLATION OF HUMAN BMP— 9 DNA 

One million recombinants of a human genomic library 
constructed in the vector XFIX (Stratagene catalog # 944201) are 
plated and duplicate nitrocellulose replicas made. Two 

30 oligonucleotides probes designed on the basis of nucleotides 
#1665-#1704 and #1837-#1876 of the sequence set forth in Figure 
1 (SEQ ID N0:1) are synthesized on an automated DNA synthesizer. 
The sequence of these two oligonucleotides is indicated below: 
#1: CTATGAGTGTAAAGGGGGTTGCTTCTTCCCATTGGCTGAT 

35 #2: GTGCCAACCCTCAAGTACCACTATGAGGGGATGAGTGTGG 

These two oligonucleotide probes are radioactively labeled with 



13 



WO 95/33830 



PCT/US95/07084 



Y 32 P-ATP and each is hybridized to one set of the duplicate 
nitrocellulose replicas in SHB at 65°C and washed with IX SSC, 
0.1% SDS at 65°C. Three recombinants which hybridize to both 
oligonucleotide probes are noted. All three positively 
5 hybridizing recombinants are plaque purified, bacteriophage plate 
stocks are prepared and bacteriophage DNA is isolated from each. 
The oligonucleotide hybridizing regions of one of these 
recombinants, designated HG111, is localized to a 1.2 kb Pst 
I/Xba I fragment. This fragment is subcloned into a plasmid 

10 vector (pGEM-3) and DNA sequence analysis is performed. HG111 
was deposited with the American Type Culture Collection ATCC, 
12301 Parklawn Drive, Rockville, Maryland USA (hereinafter the 
"ATCC") on June 16, 1992 under the requirements of the Budapest 
Treaty and designated as ATCC #75252. This subclone is 

15 designated pGEM-111. A portion of the DNA sequence of clone 
pGEM-111 is set forth in Figure 3 (SEQ ID NO:8/HUMAN BMP-9 
SEQUENCE) . This sequence encodes the entire mature region of 
human BMP-9 and a portion of the propeptide. It should be noted 
that this sequence consists of preliminary data. Particularly, 

20 the propeptide region is subject to further analysis and 
characterization. For example, nucleotides #1 through #3 (TGA) 
encode a translational stop which may be incorrect due to the 
preliminary nature of the sequence. It is predicted that 
additional sequences present in both pGEM-111 (the 1.2 kb 

25 Pstl/Xbal fragment of HG111 subcloned into pGEM) and HG111 encode 
additional amino acids of the human BMP-9 propeptide region. 
Based on knowledge of other BMPs and other proteins within the 
TGF-/3 family, it is predicted that the precursor polypeptide 
would be cleaved at the multibasic sequence ARG-ARG-LYS-ARG 

30 (amino acids # -4 through # -1 of SEQ ID NO:9) in agreement with 
a proposed consensus proteolytic processing sequence ARG-X-X-ARG. 
Cleavage of the human BMP-9 precursor polypeptide at this 
location would generate a 110 amino acid mature peptide beginning 
with the amino acid SER at position #1 of SEQ ID NO: 9 (encoded 

35 by nucleotides #124 through #126 of SEQ ID NO:£) . The processing 
of human BMP-9 into the mature form is expected to involve 
dimerization and removal of the N-terminal region in a manner 



14 



WO 95/33830 



PCT/US95/07084 



analogous to the processing of the related protein TGF-0 [L.E. 
Gentry et al., Mol. & Cell. Biol. 8:4162 (1988); R. Derynck et 
al., Nature 316:701 (1985)]. 

It is contemplated therefore that the mature active species 
5 of human BMP-9 comprises a homodimer of two polypeptide subunits, 
each subunit comprising amino acids #1 through #110 of SEQ ID 
NO: 9, with a predicted molecular weight of 12,000 daltons. 
Further active species are contemplated comprising amino acids 
#8 through #110 thereby including the first conserved cysteine 

10 residue. As with other members of the BMP and TGF-jS family of 
proteins, the carboxy-terminal portion of the human BMP-9 
sequence exhibits greater sequence conservation than the amino- 
terminal portion. The percent amino acid identity of the human 
BMP-9 protein in the cysteine-rich C-terminal domain (amino acids 

15 #8 through #110) to the corresponding region of other human BMP 
proteins and other proteins within the TGF-/J family is as 
follows: BMP-2, 52%; BMP-3, 40%; BMP-4 , 52%; BMP-5, 55%; BMP-6, 
55%; BMP-7, 53%; murine BMP-9, 97%; Vgl, 50%; GDF-1 , 44%; TGF-01, 
32%; TGF-02, 32%; TGF-03, 32%; inhibin jS (B) , 35%; and inhibin 

20 ft (A), 41%. BMP-9 exhibits 80% homology to chick Dorsalin-1, a 
BMP-like protein cloned from embryonic chick. 

EXAMPLE III 
ROSEN MODIFIED SAMPATH-REDDI ASSAY 

A modified version of the rat bone formation assay described 

25 in Sampath and Reddi, Proc. Natl. Acad. Sci. USA 80:6591-6595 
(1983) is used to evaluate bone and/or cartilage activity of the 
BMP proteins. This modified assay is herein called the Rosen- 
modified Sampath-Reddi assay. The ethanol precipitation step of 
the Sampath-Reddi procedure is replaced by dialyzing (if the 

30 composition is. a solution) or diafiltering (if the composition 
is a suspension) the fraction to be assayed against water. The 
solution or suspension is then redissolved in 0.1 % TFA, and the 
resulting solution added to 20mg of rat matrix. A mock rat 
matrix sample not treated with the protein serves as a control. 

35 This material is frozen and lyophilized and the resulting powder 
enclosed in #5 gelatin capsules. The capsules are implanted 



15 



WO 95/33830 PCT/US95/07084 

subcutaneous ly in the abdominal thoracic area of 21 - 4-9 day old 
male Long Evans rats. The implants are removed after 7-14 
days. Half of each implant is used for alkaline phosphatase 
analysis [See, A. H. Reddi et al., Proc. Natl Acad Sci. 69:1601 
5 (1972)]. 

The other half of each implant is fixed and processed for 
histological analysis. 11m glycolmethacrylate sections are 
stained with Von Kossa and acid fuschin to score the amount of 
induced bone and cartilage formation present in each implant. 

10 The terms +1 through +5 represent the area of each histological 
section of an implant occupied by new bone and/ or cartilage cells 
and matrix. A score of +5 indicates that greater than 50% of 
the implant is new bone and/or" cartilage produced as a direct 
result of protein in the implant. A score of +4, +3, +2 and 

15 +1 would indicate that greater than 40%, 30%, 20% and 10% 
respectively of the implant contains new cartilage and/or bone. 
In a modified scoring method, three non-adjacent sections are 
evaluated from each implant and averaged. "+/-" indicates 
tentative identification of cartilage or bone; "+1" indicates 

20 >10% of each section being new cartilage or bone; "+2", >25%; 
"+3" , >50%; "+4", -75%; "+5", >80%. A indicates that the 

implant is not recovered. 

It is contemplated that the dose response nature of the BMP- 
9 containing samples of the matrix samples will demonstrate that 

25 the amount of bone and/ or cartilage formed increases with the 
amount of BMP-9 in the sample. It is contemplated that the 
control samples will not result in any bone and/or cartilage 
formation. 

As with other cartilage and/or bone inductive proteins such 
30 as the above-mentioned "BMP" proteins, the bone and/or cartilage 
formed is expected to be physically confined to the space 
occupied by the matrix. Samples are also analyzed by SDS gel 
electrophoresis and isoelectric focusing followed by 
autoradiography. The activity is correlated with the protein 
35 bands and pi. To estimate the purity of the protein in a 
particular fraction an extinction coefficient of 1 OD/mg-cm is 
used as an estimate for protein and the protein is run on SDS 



16 



WO 95/33830 



PCT/US95/07084 



PAGE followed by silver staining or radioiodination and 
autoradiography . 

EXAMPLE IV 

EXPRESSION OF BMP -9 
5 In order to produce murine, human or other mammalian BMP-9 

proteins, the DNA encoding it is transferred- into an 
appropriate expression vector and introduced into mammalian cells 
or other preferred eukaryotic or prokaryotic hosts by 
conventional genetic engineering techniques. The preferred 

10 expression system for biologically active recombinant human BMP-9 
is contemplated to be stably transformed mammalian cells. 

One skilled in the art can construct mammalian expression 
vectors by employing the sequence of Figure 1 (SEQ ID NO:l) or 
Figure 3 (SEQ ID NO: 8), or other DNA sequences encoding BMP-9 

15 proteins or other modified sequences and known vectors, such as 
pCD [Okayama et al., Mol. Cell Biol. 2:161-170 (1982)], pJL3, 
pJL4 [Gough et al., EMBO J. 4:645-653 (1985)] and pMT2 CXM. 

The mammalian expression vector pMT2 CXM is a derivative of 
p91023 (b) (Wong et al., Science 228:810-815 (1985)) differing 

20 from the latter in that it contains the ampicillin resistance 
gene in place of the tetracycline resistance gene and further 
contains a Xhol site for insertion of cDNA clones. The 
functional elements of pMT2 CXM have been described (Kaufman, 
R.J., Proc. Natl. Acad. Sci. USA 82:689-693 (1985)) and include 

25 the adenovirus VA genes, the SV40 origin of replication including 
the 72 bp enhancer, the adenovirus major late promoter including 
a 5' splice site and the majority of the adenovirus tripartite 
leader sequence present on adenovirus late mRNAs, a 3' splice 
acceptor site, a DHFR insert, the SV40 early polyadenylation site 

30 (SV40) , and pBR322 sequences needed for propagation in E. coli . 

Plasmid pMT2 CXM is obtained by EcoRI digestion of pMT2-VWF, 
which has been deposited with the American Type Culture 
Collection (ATCC) , Rockville, MD (USA) under accession number 
ATCC #67122. EcoRI digestion excises the cDNA insert present in 

35 pMT2-VWF, yielding pMT2 in linear form which can be ligated and 
used to transform E. coli HB 101 or DH-5 to ampicillin 



17 



WO 95/33830 



PCI7US95/07084 



resistance. Plasmid pMT2 DNA can be prepared by conventional 
methods. pMT2 CXM is then constructed using loopout/in 
mutagenesis [Morinaga et al. , Biotechnology 84:636 (1984)]. This 
removes bases 1075 to 114 5 relative to the Hind III site near the 
SV40 origin of replication and enhancer sequences of pMT2. In 
addition it inserts the following sequence: 

5' PO-CATGGGCAGCTCGAG-3' (SEQ ID NO: 5) 
at nucleotide 1145. This sequence contains the recognition site 
for the restriction endonuclease Xho I. A derivative of pMT2CXM, 
termed pMT23, contains recognition sites for the restriction 
endonucleases PstI, Eco RI, Sail and Xhol. Plasmid pMT2 CXM and 
pMT23 DNA may be prepared by conventional methods. 

pEMC2bl derived from pMT21 may also be suitable in practice 
of the invention. pMT21 is derived from pMT2 which is derived 
from pMT2-VWF. As described above EcoRI digestion excises the 
cDNA insert present in pMT-VWF, yielding pMT2 in linear form 
which can be ligated and used to transform E. coli HB 101 or DH-5 
to ampicillin resistance. Plasmid pMT2 DNA can be prepared by 
conventional methods. 

pMT21 is derived from pMT2 through the following two 

modifications. First, 76 bp of the 5' untranslated region of the 

DHFR cDNA including a stretch of 19 G residues from G/C tailing 

for cDNA cloning is deleted. In this process, a Xhol site is 

inserted to obtain the following sequence immediately 

upstream from DHFR : 5 ' - CTGCAG GCGAGCCT GAATTCCTCGAG CCATCATG-3 ' 

PstI Eco RI Xhol 

(SEQ ID NO: 6) 

Second, a unique Clal site is introduced by digestion with EcoRV 
and Xbal, treatment with Klenow fragment of DNA polymerase I, and 
ligation to a Clal linker (CATCGATG) . This deletes a 250 bp 
segment from the adenovirus associated RNA (VAI) region but does 
not interfere with VAI RNA gene expression or function. pMT21 
is digested with EcoRI and Xhol, and used to derive the vector 
PEMC2B1. 

A portion of the EMCV leader is obtained from pMT2-ECATl 
[S.K. Jung et al., J. Virol 63:1651-1660 (1989)] by digestion 
with Eco RI and PstI, resulting in a 2752 bp fragment. This 
fragment is digested with TaqI yielding an Eco RI-TaqI fragment 



18 



WO 95/33830 



PCT/US95/07084 



of 508 bp which is purified by electrophoresis on low melting 

agarose gel. A 68 bp adapter and its complementary strand are 

synthesized with a 5' TaqI protruding end and a 3' Xhol 

protruding end which has the following sequence: 

5 5 ' -CGAGGTTAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTT 
TaqI 

GAAAAACACG ATT GO 3 ' 

Xhol (SEQ ID NO: 7) 

10 This sequence matches the EMC virus leader sequence from 
nucleotide 763 to 827. It also changes the ATG at position 10 
within the EMC virus leader to an ATT and is followed by a Xhol 
site. A three way ligation of the pMT21 Eco Rl-Xhol fragment, 
the EMC virus EcoRI-TaqI fragment, and the 68 bp oligonucleotide 

15 adapter Taql-Xhol adapter resulting in the vector pEMC2j8l. 

This vector contains the SV40 origin of replication and 
enhancer, the adenovirus major late promoter, a cDNA copy of the 
majority of the adenovirus tripartite leader sequence, a small 
hybrid intervening sequence, an SV40 polyadenylation signal and 

20 the adenovirus VA I gene, DHFR and (8- lactamase markers and an EMC 
sequence, in appropriate relationships to direct the high level 
expression of the desired cDNA in mammalian cells. 

The construction of vectors may involve modification of the 
BMP-9 DNA sequences. For instance, BMP-9 cDNA can be modified 

25 by removing the non-coding nucleotides on the 5' and 3' ends of 
the coding region. The deleted non-coding nucleotides may or may 
not be replaced by other sequences known to be beneficial for 
expression. These vectors are transformed into appropriate. host 
cells for expression of BMP-9 proteins. One skilled in the art 

30 can manipulate the sequences of Figure 1 or Figure 3 (SEQ H) 
NOS:l and 8) by eliminating or replacing the mammalian regulatory 
sequences flanking the coding sequence with bacterial sequences 
to create bacterial vectors for intracellular or extracellular 
expression by bacterial cells. For example, the coding sequences 

35 could be further manipulated (e.g., ligated to other known 
linkers or modified by deleting non-coding sequences therefrom 
or altering nucleotides therein by other known techniques) . The 
modified BMP-9 coding sequence could then be inserted into a 



19 



WO 95733830 



PCT/US95/07084 



known bacterial vector using procedures such as described in T. 
Taniguchi et al., Proc. Natl Acad. Sci. USA 77:5230-5233 (1980). 
This exemplary bacterial vector could then be transformed into 
bacterial host cells and a BMP-9 protein expressed thereby. For 
5 a strategy for producing extracellular expression of BMP-9 
proteins in bacterial cells, see e.g., European Patent 
Application No. EPA 177,343. 

Similar manipulations can be performed for the construction 
of an insect vector [See e.g., procedures described in published 

10 European Patent Application No. 155,476] for expression in insect 
cells. A yeast vector could also be constructed employing yeast 
regulatory sequences for intracellular or extracellular 
expression of the factors of the present invention by yeast 
cells. [See e.g., procedures described in published PCT 

15 Publication No. WO86/00639 and European Patent Application No. 
EPA 123,289] . 

A method for producing high levels of a BMP-9 protein of the 
invention in mammalian cells may involve the construction of 
cells containing multiple copies of the heterologous BMP-9 gene. 

20 The heterologous gene is linked to an amplifiable marker, e.g., 
the dihydrof olate reductase (DHFR) gene for which cells 
containing increased gene copies can be selected for propagation 
in increasing concentrations of methotrexate (MTX) according to 
the procedures of Kaufman and Sharp, J. Mol. Biol. 159 : 601-629 

25 (1982) . This approach can be employed with a number of different 
cell types. 

For example, a plasmid containing a DNA sequence for a BMP-r9 
of the invention in operative association with other plasmid 
sequences enabling expression thereof and the DHFR expression 

30 plasmid pAdA26SV(A)3 [Kaufman and Sharp, Mol. Cell. Biol. 2:1304 
(1982)] can be co-introduced into DHFR-def icient CHO cells, DUKX- 
BII, by various methods including calcium phosphate 
coprecipitation and transf ection, electroporation or protoplast 
fusion. DHFR expressing transf ormants are selected for growth 

35 in alpha media with dialyzed fetal calf serum, and subsequently 
selected for amplification by growth in increasing concentrations 
of MTX (e.g., sequential steps in 0.02, 0.2, 1.0 and 5uM MTX) as 



20 



WO 95/33830 



PCT/US95/07084 



described in Kaufman et al., Mol Cell Biol. 5:1750 (1983). 
Transformants are cloned, and biologically active BMP-9 
expression is monitored by the Rosen-modified Sampath - Reddi rat 
bone formation assay described above in Example III. BMP-9 
5 expression should increase with increasing levels of MTX 
resistance. BMP-9 polypeptides are characterized using standard 
techniques known in the art such as pulse labeling with [35S] 
methionine or cysteine and polyacrylamide gel electrophoresis. 
Similar procedures can be followed to produce other related BMP-9 
10 proteins. 

A. BMP-9 VECTOR CONSTRUCTION 

In order to produce human BMP-9 proteins of the invention 
DNA sequences encoding the mature region of the human BMP-9 
protein may be joined to DNA sequences encoding the propeptide 

15 region of the murine BMP-9 protein. This murine/human hybrid DNA 
sequence is inserted into an appropriate expression vector and 
introduced into mammalian cells or other preferred eukaryotic or 
prokaryotic hosts by conventional genetic engineering techniques. 
The construction of this murine/human BMP-9 containing expression 

20 plasmid is described below. 

A derivative of the human BMP-9 sequence (SEQ ID NO: 8) 
comprising the nucleotide sequence from nucleotide #105 to #470 
is specifically amplified. The following oligonucleotides are 
utilized as primers to allow the amplification of nucleotides 

25 #105 to #470 of the human BMP-9 sequence (SEQ ID NO:8) from clone 
pGEM-111 described above. 

#3 ATCGGGCCCCTTTTAGCCAGGCGGAAAAGGAG 
#4 AGCGAATTCCCCGCAGGCAGATACTACCTG 
This procedure generates the insertion of the nucleotide sequence 

30 ATCGGGCCCCT immediately preceding nucleotide #105 and the 
insertion of the nucleotide sequence X3AATTCGCT immediately 
following nucleotide #470. The addition of these sequences 
results in the creation of an Apa I and EcoR I restriction 
endonuclease site at the respective ends of the specifically 

35 amplified DNA fragment. The resulting 374 bp Apa I/EcoR I 
fragment is subcloned into the plasmid vector pGEM-7Zf(+) 



21 



WO 95/33830 



PCT/US95/07084 



(Promega catalog# p2251) which has been digested with Apa I and 
EcoR I. The resulting clone is designated phBMP9mex-l. 

The following oligonucleotides are designed on the basis of 
murine BMP-9 sequences (SEQ ID NO:l) and are modified to 
5 facilitate the construction of the murine/human expression 
plasmid referred to above: 

#5 

GATTCCGTCGACCACCATGTCCCCTGGGGCCTGGTCTAGATGGATACACAGCTGTGGGGCC 

# 6 CCACAGCTGTGTATCCATCTAGACCAGGCCCCAGGGGACATGGTGGTCGACG 

10 These oligonucleotides contain complimentary sequences which upon 

addition to each other facilitate the annealing (base pairing) 

of the two individual sequences, resulting in the formation of 

a double stranded synthetic DNA linker (designated LINK-1) in a 

manner indicated below: 

15 1 5 10 20 30 40 50 60 

iii i i i i i 

tii i i i i i 

#5GATTCCGTCGACCACCATGTCCCCTGGGGCCTGGTCTAGATGGATACACAGCTGTGGGGCC 
GCAGCTGGTGGTACAGGGGACCCCGGACCAGATCTACCTATGTGTCGACACC #6 

This DNA linker (LINK-1) contains recognition sequences of 

20 restriction endonucleases needed to facilitate subsequent 
manipulations required to construct the murine/human expression 
plasmid, as well as sequences required for maximal expression of 
heterologous sequences in mammalian cell expression systems. 
More specifically (referring to the sequence numbering of 

25 oligonucleotide #5/LINK-l) : nucleotides #1-#11 comprise 
recognition sequences for the restriction endonucleases BamH I 
and Sal I, nucleotides #11-#15 allow for maximal expression of 
heterologous sequences in mammalian cell expression systems, 
nucleotides #16-#31 correspond to nucleotides #610-#625 of the 

30 murine BMP-9 sequence (SEQ ID NO:l), nucleotides #32-#33 are 
inserted to facilitate efficient restriction digestion of two 
adjacent restriction endonuclease sites (Eco0109 I and Xba I) , 
nucleotides #34-#60 correspond to nucleotides #1515-#1541 of the 
murine BMP-9 sequence (SEQ ID NO:l) except that nucleotide #58 

35 of synthetic oligonucleotide #5 is a G rather than the A which 
appears at position #1539 of SEQ ID NO:l (This nucleotide 
conversion results in the creation of an Apa I restriction 
endonuclease recognition sequence, without altering the amino 



22 



WO 95/33830 



PCTYUS95/07084 



acid sequence it is intended to encode, to facilitate further 
manipulations of the murine/human hybrid expression plasmid. 
LINK-1 (the double stranded product of the annealing of 
oligonucleotides #5 and #6) is subcloned into the plasmid vector 
5 pGEM-7Zf(+) which has been digested with the restriction 
endonucleases Apa I and BamH I. This results in a plasmid in 
which the sequences normally present between- the Apa I and BamH 
I sites of the pGEM-7Zf(+) plasmid polylinker are replaced with 
the sequences of LINK-1 described above. The resulting plasmid 

10 clone is designated pBMP-9link. 

pBMP-91ink is digested with the restriction endonucleases 
BamH I and Xba I resulting in the removal nucleotides #l-#34 of 
LINK-1 (refer to the numbering of oligo #5). Clone ML14a, which 
contains an insert comprising the sequence set forth in SEQ ID 

15 NO:l, is also digested with the restriction endonucleases BamH 
I and Xba I resulting in the removal of sequences comprising 
nucleotides #1-#1515 of SEQ ID NO:l (murine BMP-9). This BamH 
I /Xba I fragment of mouse BMP-9 is isolated from the remainder 
of the ML14a plasmid clone and subcloned into the BamH I/Xba I 

20 sites generated by the removal of the synthetic linker sequences 
described above. The resulting clone is designated p3 02. 

The p302 clone is digested with the restriction endonuclease 
EcoO109 I resulting in the excision of nucleotides corresponding 
to nucleotides #621-#1515 of the murine BMP-9 sequence (SEQ ID 

25 NO:l) and nucleotides #35-#59 of LINK-1 (refer to numbering of 
oligonucleotide #5) . It should be noted that the Apa I 
restriction site created in LINK-1 by the A to G conversion 
described above is a subset of the recognition sequence of 
Eco0109 I, therefore digestion of p302 with EcoO109 I cleaves at 

30 the Apa I site as well as the naturally occurring murine Eco0109 
I (location #619-#625 of SEQ ID NO:l) resulting in the excision 
of a 920 bp EcoO109 I/EcoO109 I (Apa I) fragment comprising the 
sequences described above. This 920 Eco0109 I/Eco0109 I (Apa I) 
fragment is isolated from the remainder of the p302 plasmid clone 

35 and subcloned into clone pBMP-91ink which has been similarly 
digested with EcoO109 I. It should be noted that the nucleotides 
GG (#32-#33 of oligonucleotide #5) originally designed to 



23 



WO 95/33830 PCT/US95/07084 

facilitate a more complete digestion of the two adjacent 
restriction sites Eco0109 I and Xba I of LINK-1, which is now a 
part of pBMP-9link (described above) , results in the creation of 
Dcm methylation recognition sequence. The restriction nuclease 
5 Eco0109 I is sensitive to Dcm methylation and therefore cleavage 
of this sequence (nucleotides #25-#31 of oligonucleotide #5/LINK- 
1) by the restriction endonuclease EcoO109 I is prevented at this 
site. Therefore the plasmid clone pBMP-9link is cleaved at the 
Apa I site but not at the EcoO109 I site upon digestion with the 

10 restriction endonuclease Eco0109 I as described above, preventing 
the intended removal of the sequences between the Eco0109 I and 
Xba I site of LINK-1 (#32-#55 defined by the numbering, of 
oligonucleotide #5), This results in the insertion of the 92 0 
bp Eco0109 I/Apa I fragment at the EcoO109 I (Apa I) site of 

15 pBMP-9link. The resulting clone is designated p318. 

Clone p318 is digested with the restriction endonucleases 
Sal I and Apa I, resulting in the excision of sequences 
comprising nucleotides #6-#56 of LINK-1 (refer to oligo #5 for 
location), nucleotides #621-#1515 of murine BMP-9 (SEQ ID NO:l), 

20 and nucleotides #35-#60 of LINK-1 (refer to oligo #5 for 
location) . The resulting 972 bp Sal I/Apa I fragment described 
above is isolated from the remainder of the p318 plasmid clone 
and will be utilized in subsequent manipulations. 

The clone phBMP9mex-l (described above) , which contains DNA 

25 sequences which encode the entire mature region and portions of 
the propeptide of the human BMP-9 protein, is digested with the 
restriction endonucleases Apa I and EcoR I. This results in the 
excision of a 374 bp fragment comprising nucleotides #105-#470 
of the human BMP-9 sequence (SEQ ID NO: 8) and the additional 

30 nucleotides of oligonucleotide primers #3 and #4 which contain 
the recognition sequences for the restriction endonucleases Apa 
I and EcoR I. This 374 bp Apa I/EcoR I fragment is combined with 
the 972 bp Sal I/Apa I fragment from pl38 (isolation described 
above) and ligated to the mammalian cell expression plasmid pED6 

35 (a derivative of pEMC2j3l) which has been digested with Sal I and 
EcoR I. The resulting clone is designated p324. 

The clone ML14a (murine BMP-9) is digested with EcoO!09 I 



24 



WO 95/33830 



PCT/US95/07084 



and Xba I to generate a fragment comprising nucleotides #621- 
#1515 of SEQ ID NO:l. 

The following oligonucleotides are synthesized on an 
automated DNA synthesizer and combined such that their 
5 complimentary sequences can base pair (anneal) with each other 
to generate a double stranded synthetic DNA linker designated 
LINK- 2: 

#7 TCGACCACCATGTCCCCTGG 

#8 GCCCCAGGGGACATGGTGG 

10 This double stranded synthetic DNA linker (LINK-2) anneals in 

such a way that it generates single stranded ends which are 

compatible to DNA fragments digested with Sal I (one end) or 

Eco0109 I (the other end) as indicated below: 

#7 TCGACCACCATGTCCCCTGG 
15 GGTGGTACAGGGGACCCCG #8 

This LINK-2 synthetic DNA linker is ligated to the 895 bp 

EcoO109 I/Xba I fragment comprising nucleotides #621-#1515 of 

murine BMP-9 (SEQ ID NO:l) described above. This results in a 

915 bp Sal I/Xba I fragment. 

20 The clone p324 is digested with Sal I/Xba I to remove 

sequences comprising nucleotides #6*#56 of LINK-1 (refer to oligo 
#5 for location) and nucleotides #621-#1515 of murine BMP-9 (SEQ 
ID NO:l) . The sequences comprising nucleotides #35-#60 of LINK-1 
(refer to oligo #5 for location) and the sequences comprising the 

25 374 bp Apa I/EcoR I fragment (human BMP-9 sequences) derived from 
phBMP9mex-l remain attached to the pED6 backbone. The 915 bp Sal 
I/Xba I fragment comprising LINK-2 sequences and nucleotides 
#621-#1515 of murine BMP-9 (SEQ ID N0:1) is ligated into the p324 
clone from which the Sal I to Xba I sequences described above 

30 have been removed. 

The resulting plasmid is designated BMP-9 fusion and 
comprises LINK-2, nucleotides #621-#1515 of murine BMP-9 (SEQ ID 
NO:l), nucleotides #35-#59 of LINK-1 (refer to the numbering of 
oligonucleotide #5) , and the 374 bp Apa I/EcoR I fragment (human 

35 BMP-9) derived from clone pBMP9mex-l (described above) inserted 
between the Sal I and EcoR I sites of the mammalian cell 
expression vector pED6. 



25 



WO 95/33830 



PCT/US95/07084 



B. EXPRESSION 

BMP-9 fusion is transfected into CHO cells using standard 
techniques known to those having ordinary skill in the art to 
create stable cell lines capable of expressing human BMP-9 
5 protein. The cell lines are cultured under suitable culture 
conditions and the BMP-9 protein is isolated and purified from 
the culture medium. 

In one embodiment, cells are grown in Rl medium based on a 
50:50 mix of F12 and DME plus extra non-essential amino acids 

10 plus extra biotin and B12 and 10% fetal bovine serum (FBS) and 
0.2 ?M methotrexate (MTX) . Cells are grown up and expanded into 
roller bottles in this medium using confluent roller bottles. 
The serum containing growth medium is discarded, the rollers are 
rinsed with PBS-CMF, and a serum free production medium is added 

15 containing additional amino acids plus insulin (5 cg/ml) , 
putrescine (12.9 £M) , hydrocortisone (0.2 CM), selenium (29 nM) , 
and PVA (0.6 g/L) . Dextran sulfate is used in this CM (at 100 
gg/ml) . Conditioned medium (CM) is collected at 24 hours and the 
rollers are refed with fresh serum free medium. Four sequential 

20 24 hour harvest can be collected. Conditioned medium is 
clarified (floating cells in the CM are removed) for purification 
by passing the CM through a 5 g (pass Profile) pore size filter 
and a 0.22 c (millipore Duropore) pore size filter. 

EXAMPLE V 

25 BIOLOGICAL ACTIVITY OF EXPRESSED BMP-9 

To measure the biological activity of the expressed BMP-9 

proteins obtained in Example IV above, the proteins are recovered 

from the cell culture and purified by isolating the BMP-9 

proteins from other proteinaceous materials with which they are 
30 co-produced as well as from other contaminants. The purified 

protein may be assayed in accordance with the rat bone formation 

assay described in Example III. 

Purification is carried out using standard techniques known 

to those skilled in the art. It is contemplated, as with other 
35 BMP proteins, that purification may include the use of Heparin 

sepharose. 



26 



WO 95/33830 



PCT/US95/07084 



In one embodiment, 4 0 liters of the conditioned media from 
Example IV-B is titrated to pH 6.9 with concentrated sodium 
phosphate pH 6.0, and loaded onto Cellufine Sulfate, previously 
equilibrated with 50 mM sodium phosphate, pH 6.9. The resin is 
5 washed with 50 mM sodium phosphate, 0.5 M NaCl, followed by 50 
mM sodium phosphate, 0.5 M NaCl, 0.5 M Arg, pH 6.9. BMP-9 is 
found in the wash as well as the elution, with a lesser amount 
of contaminants in the elution pool. Cellufine sulfate pools are 
concentrated and directly loaded onto RP-HPLC for final 

10 purification. Each concentrated pool is titrated to pH 3.8 with 
dilute TFA and loaded onto a 0.46 X 25 cm C 4 reverse phase column 
running a linear gradient from 30% A (0.1% TFA/H 2 0) to 55% B 
(0.1% TFA/90% Acetonitrile) over 100 minutes. BMP-9 monomer is 
separated by baseline resolution from BMP-9 dimer. The identity 

15 of monomer and dimer pools are confirmed by N-terminal 
sequencing. Although heterogeneity in the N-terminus is expected 
sequencing reveals a predominant species Ser-Ala-Gly-Ala 
beginning with amino acid #1 of SEQ ID NO: 9. 

Protein analysis is conducted using standard techniques such 

20 as SDS-PAGE acrylamide [U.K. Laemmli, Nature 227 ;680 (1970)] 
stained with silver [R.R. Oakley et al., Anal. Biochem. .105:361 
(1980)] and by immunoblot [H. Towbin et al., Proc. Natl. Acad. 
Sci. USA 76:4350 (1979)]. BMP-9 is efficiently expressed in CHO 
cells as a 14kDa nonglycosylated protein when analyzed under 

25 reducing conditions. BMP-9 is efficiently secreted within 4 
hours of its synthesis. 

EXAMPLE VI 

A. W-2 0 BIOASSAY 

Use of the W-2 0 bone marrow stromal cells as an indicator 

30 cell line is based upon the conversion of these cells to 
osteoblast-like cells after treatment with BMP-2 [R. S. Thies et 
al., "Bone Morphogenetic Protein alters W-20 stromal cell 
differentiation in vitro ". Journal of Bone and Mineral Research 
5(2) :305 (1990); and R. S. Thies et al,, "Recombinant Human Bone 

35 Morphogenetic Protein 2 Induces Osteoblastic Differentiation in 
W-20-17 Stromal Cells", Endocrinology , in press (1992)]. 



27 



WO 95/33830 



PCTAJS95/07084 



Specifically, W-20 cells are a clonal bone marrow stromal cell 
line derived from adult mice by researchers in the laboratory of 
Dr. D. Nathan, Children's Hospital, Boston, MA. BMP-2 treatment 
of W-20 cells results in (1) increased alkaline phosphatase 
production, (2) induction of PTH stimulated cAMP, and (3) 
induction of osteocalcin synthesis by the cells. While (1) and 
(2) represent characteristics associated with the osteoblast 
phenotype, the ability to synthesize osteocalcin is a phenotypic 
property only displayed by mature osteoblasts. Furthermore, to 
date we have observed conversion of W-20 stromal cells to 
osteoblast-like cells only upon treatment with BMPs. In this 
manner, the in vitro activities displayed by BMP treated W-20 
cells correlate with the in vivo bone forming activity known for 
BMPs . 

Below two in vitro assays useful in comparison of BMP 
activities of novel osteoinductive molecules are described. 

B. W-2 0 ALKALINE PHOSPHATASE ASSAY PROTOCOL 

W-20 cells are plated into 96 well tissue culture plates at 
a density of 10,000 cells per well in 200 /ul of media (DME with 
10% heat inactivated fetal calf serum, 2 mM glutamine and 100 
U/ml + 100 fig/ml streptomycin. The cells are allowed to attach 
overnight in a 95% air, 5% C0 2 incubator at 37 °C. 

The 200 Ml of media is removed from each well with a 
multichannel pipettor and replaced with an equal volume of test 
sample delivered in DME with 10% heat inactivated fetal calf 
serum, 2 mM glutamine and 1% penicillin-streptomycin. Test 
substances are assayed in triplicate. 

The test samples and standards are allowed a 24 hour 
incubation period with the W-20 indicator cells. After the 24 
hours, plates are removed from the 37 °C incubator and the test 
media are removed from the cells. 

The W-20 cell layers are washed 3 times with 200 fil per well 
of calcium/magnesium free phosphate buffered saline and these 
washes are discarded. 

50 Ail of glass distilled water is added to each well and the 
assay plates are then placed on a dry ice/ethanol bath for quick 



28 



WO 95/33830 



PCT/US95/07084 



freezing. Once frozen, the assay plates are removed from the dry 
ice/ethanol bath and thawed at 37 °C. This step is repeated 2 
more times for a total of 3 freeze-thaw procedures* Once 
complete, the membrane bound alkaline phosphatase is available 
5 for measurement. 

50 /zl -of assay mix (50 mM glycine, 0.05% Triton X-100, 4 mM 
MgCl 2 , 5 mM p-nitrophenol phosphate, pH = 10.3) is added to each 
assay well and the assay plates are then incubated for 30 minutes 
at 37 °C in a shaking waterbath at 60 oscillations per minute. 

10 At the end of the 30 minute incubation, the reaction is 

stopped by adding 100 jul of 0.2 N NaOH to each well and placing 
the assay plates on ice. 

The spectrophotometric absorbance for each well is read at 
a wavelength of 4 05 nanometers. These values are then compared 

15 to known standards to give an estimate of the alkaline 
phosphatase activity in each sample. For example, using known 
amounts of p-nitrophenol phosphate, absorbance values are 
generated. This is shown in Table I. 



20 Table I 

Absorbance Values for Known Standards 
of P-Nitrophenol Phosphate 

P-nitrophenol phosphate umoles Mean absorbance (405 nm) 

0.000 0 

25 0.006 0.261 +/- .024 

0.012 0.521 +/- .031 

0.018 0.797 +/- .063 

0.024 1.074 +/- .061 

0.030 1.305 +/- .083 



30 



Absorbance values for known amounts of BMP-2 can be 
determined and converted to /moles of p-nitrophenol phosphate 
cleaved per unit time as shown in Table II. 



29 



WO95/33830 



PCT/US95/07084 



Table II 

Alkaline Phosphatase Values for W-20 Cells 
Treating with BMP-2 

5 BMP-2 concentration Absorbance Reading umoles substrate 
na/ml 4 05 nmeters per hour 

0 0.645 0.024 

1.56 0.696 . 0.026 

3.12 0.765 0.029 

10 6.25 0.923 0.036 

12.50 1.121 0.044 

25.0 1.457 0.058 

50.0 1.662 0.067 

100.0 1.977 0.080 



15 



These values are then used to compare the activities of 
known amounts of BMP-9 to BMP-2 . 

C. OSTEOCALCIN RIA PROTOCOL 

W-20 cells are plated at 10 6 cells per well in 24 well 
20 multiwell tissue culture dishes in 2 mis of DME containing 10% 
heat inactivated fetal calf serum, 2 mM glutamine. The cells are 
allowed to attach overnight in an atmosphere of 95% air 5% C0 2 at 
37°C. 

The next day the medium is changed to DME containing 10% 
25 fetal calf serum, 2 mM glutamine and the test substance in a 
total volume of 2 ml. Each test substance is administered to 
triplicate wells. The test substances are incubated with the W- 
20 cells for a total of 96 hours with replacement at 48 hours by 
the same test medias. 
30 At the end of 96 hours, 50 /xl of the test media is removed 

from each well and assayed for osteocalcin production using a 
radioimmunoassay for mouse osteocalcin. The details of the assay 
are described in the kit manufactured by Biomedical Technologies 
Inc., 378 Page Street, Stoughton, MA 02072. Reagents for the 
35 assay are found as product numbers BT-431 (mouse osteocalcin 
standard) , BT-432 (Goat anti-mouse Osteocalcin) , BT-431R 
(iodinated mouse osteocalcin), BT-415 (normal goat serum) and BT- 
414 (donkey anti goat IgG) . The RIA for osteocalcin synthesized 
by W-20 cells in response to BMP treatment is carried out as 



30 



WO 95/33830 



PCT/US95/07084 



described in the protocol provided by the manufacturer. 

The values obtained for the test samples are compared to 
values for known standards of mouse osteocalcin and to the amount 
of osteocalcin produced by W-2 0 cells in response to challenge 
5 with known amounts of BMP-2. 



Table III 
Osteocalcin Synthesis by W-20 Cells 

BMP-2 Concentration na/ml Osteocalcin Synthesis na/well 



10 



0 


0.8 


2 


0.9 


4 


0.8 


8 


2.2 


16 


2.7 


31 


3.2 


62 


5.1 


125 


6.5 


250 


8.2 


500 


9.4 


1000 


10.0 



EXAMPLE VII 

ARTICULAR CARTILAGE ASSAY 

The effect of BMP-9 on articular cartilage proteoglycan and 
25 DNA synthesis is assayed to determine if BMP-9 is involved in the 

regulation of metabolism of differentiated articular cartilage. 
Articular cartilage explants from calf carpal joints are 

maintained in DM EM with 50 Mg/ml ascorbate, 4 mM glutamine and 

antibiotics for 3 days. Cytokines (rhBMP-2, rhBMP-4 , rhBMP-6 and 
30 rhBMP-9, IGF-1, bFGF (1-1000 ng/ml) , and TGFjS (1-100 ng/ml)) are 

added to the medium and culture is continued for 3 more days. 

Medium is changed daily. Twenty-four hours prior to harvest, 

explants are pulsed with 50 /iCi/ml 35 S0 4 or 25 ^Ci/ml 3 H-thymidine. 

Explants are solubilized and separation of free isotope is 
35 performed by gel chromatography- Total DNA of ^ach ^xplant is 

measured by a spectrophotometry assay. BMP-9 stimulates 

proteoglycan synthesis above control levels at a dose of 10 ng/ml 

(p<0.05) . 

BMP-4, BMP-6, BMP-9 and TGF)8 are significantly more active 
40 in stimulating proteoglycan synthesis • at 100 ng/ml. At the 



WO 95/33830 



PCT/US95/07084 



highest doses of cytokine tested (1 M9/ml) , proteoglycan 
synthesis by explants exposed to all cytokines are significantly 
greater (p<0.05) than that by control explants. Sulfate 
incorporation results are set forth in Figure 4. 
5 Recombinant human BMP-9 stimulates alkaline phosphatase 

activity in the osteoprogenitor cell line, W-20-17, in a dose 
responsive manner with an ED 50 of 4 ng/ml. In vivo , high doses 
are rhBMP-9 induce ectopic bone formation, with 25 jig/implant of 
rhBMP-9 inducing cartilage and bone tissue after 10 days of 
10 implantation. 

EXAMPLE VIII 
STIMULATION OF LIVER CELLS 

It is contemplated that BMP-9 may be used in liver repair 
or regeneration. Through the use of whole embryo sections or 

15 whole mount techniques, expression of mRNA in multiple tissue is 
screened simultaneously. In the 11.5 dpc mouse embryo, BMP-9 
mRNA localizes exclusively to the developing liver. It is 
contemplated that BMP-9 , like all other BMPs studied to date, 
acts as a local regulator of cell growth and differentiation, 

20 therefore this very specific expression pattern suggests liver 
as a BMP-9 target tissue. 

BMP-9 responsiveness in parenchymal liver cells is tested 
by screening four liver cell lines for their ability to bind 
iodinated, CHO-derived BMP-9 . The four liver cell lines, HepG2 

25 (ATCC HB8065), NMuli (ATCC CRL1638), Chang and NCTC1469 (ATCC 
CCL9.1), all specifically bind l2 *I-BMP-9 to some extent, with 
HepG2 and NCTC14 69 cell lines exhibiting the highest degree of 
binding. Specific binding of BMP-9 to HepG2 cells is carried out 
by incubating HepG2 cells grown to confluence in Dulbecco's 

30 Modified Eagle's Medium (DME) containing 10% heat-inactivated 
fetal calf serum (FCS) on gelatinize* 6 well plates with 2 ng/ml 
I25 I-BMP-9 and increasing concentrations of unlabelled BMP-9 in 
binding buffeir (136.9 mM NaCl, 5.37 mM KC1, 1.26 mM CaCl 2 , 0.64 
mM MgS0 4 , 0.34 mM Na 2 HP0 4 / 0 . 44 mM KH 2 P0 4 , 0 . 49 mM MgCl 2 , 25 mM 

35 HEPES and 0.5% BSA, pH 7.4) for 20 hours at 4°C to achieve 
binding equilibrium. This incubation follows a one hour 



32 



WO 95/33830 



PCT/US95/07084 



preincubation at 37°c in binding buffer alone. For crosslinking 
experiments, the cells were incubated with 500 mM disuccinimidyl 
suberate for 20 minutes at 40c following binding. Cell extracts 
were analyzed on SDS-PAGE. As shown in Figure 5, HepG2 cells 
5 expressed abundant high affinity receptors for BMP-9. Scatchard 
analysis of these binding data resulted in a curvilinear plot, 
with approximately 10,000 high affinity receptors per cell. 
These receptors exhibited a K d of 0.3 nM. The curvilinear nature 
of the Scatchard plot indicates negative cooperativity among BMP- 

10 9 receptors or that HepG2 cells express at least two populations 
of BMP-9 receptors with different affinities. Crosslinking 
analysis on HepG2 cells with l2 *I-BMP-9 yields two binding 
proteins of apparent molecular weights of 54 and 80 kD. 
Crosslinked ligand/receptor complexes were observed at 78 and 100 

15 kD under nonreducing conditions, and 67 and 94 kD under reducing 
conditions. Subtracting the molecular weight of the BMP-9 dimer 
and monomer, respectively, it is estimated that these BMP-9 
receptor proteins have molecular weights of approximately 54 and 
80 kD. The K d of the high affinity binding sites for BMP-9 is 

20 estimated to be approximately 270 pM for HepG2 cells. To test 
the binding specificity of the receptors for BMP-9, HepG2 cells 
were incubated with IZ,i I-BMP-9 and a 250-fold excess of different 
unlabeled ligands. The BMP-9 receptors expressed on HepG2 cells 
show only limited crossreactivity with BMPs 2 and 4, and no 

25 crossreactivity with BMPs 3, 5, 6, 7, 12 and 2/6, or with TGF-B1 
or TGF-B2. 

As a first indication of BMP-9 effects on confluent, serum 
starved HepG2 cells, cell proliferation is examined as determined 
by 3 H-thymidine incorporation and cell counting. HepG2 cells are 

30 plated at 10 6 cells/well in 96 well plates and cultured for 48 
hours in DME/0. 1% FCS to synchronize the cell cycle are treated 
for 24 hours with or without BMP-9 in the presence of 0.1% FCS. 
In 3 H-thymidine incorporation assays, 3 H-thymidine was included 
during the last 4 hours of treatment and cellular DNA was 

35 collected with a 96 well plate cell harvester. Proliferation was 
assayed by quantifying ethanol-precipitable 3 H-thymidine 
incorporation by liquid scintillation counting. For cell 



33 



WO 95/33830 



PCT/US95/07084 



counting assays, cells were trypsinized and counted with a 
hemacytometer. Primary rat hepatocytes isolated from male 
Fischer 344 rats (Charles River, Wilmington, MA) by collagenase 
digestion as perviously described [Michalopoulos et al., Cancer 
5 Res. £2:4673-4682 (1982)] are plated on collagen-coated plates 
at subconf luence (5,000-10,000 cells/cm 2 ) in serum-free media as 
described in Michalopoulos et al., Cancer- Res. 42:4673-4682 
(1982) and treated with or without rhBMP-9 for 3 6 hours. 3 H- 
thymidine was included throughout the treatment period and 

10 incorporated 3 H-thymidine was quantified as described by Anscher 
et al., New England J. Med. 328 : 1592-1598 (1993). BMP-9 
stimulates 3 H-thymidine incorporation in HepG2 cells 
approximately five fold. This effect is confirmed by a 
stimulatory effect of BMP-9 in cell counting experiments. As 

15 shown in Figure 6, BMP-9 stimulated 3 H-thymidine incorporation in 
HepG2 cells in a dose-responsive manner. The ED 50 for this effect 
was estimated at 10 ng/ml BMP-9. This ED 50 value is consistent 
with the estimated binding affinity (K d = 0.3 nM = 8 ng/ml), 
suggesting that this biological effect is mediated by the 

20 described BMP-9 receptors. 

To determine if this proliferative effect of BMP-9 was 
unique to the HepG2 liver tumor cell line, primary rat 
hepatocytes were tested for effects of BMP-9 on 3 H-thymidine 
incorporated as shown in Figure 7. BMP-9 stimulated 3 h-thymidine 

25 incorporation in primary hepatocytes, although not as markedly 
as EGF. This stimulatory effect is cell density-dependent in 
primary rat hepatocytes. While subconfluent cells exhibited a 
stimulation in response to BMP-9, confluent primary hepatocytes 
did not. As indicatedin Figure 7, in contrast to rhBMP-9, TGF-01 

30 was inhibitory, not stimulatory on primary rat hepatocytes. 

The foregoing descriptions detail presently preferred 
embodiments of the present invention. Numerous modifications and 
variations in practice thereof are expected to occur to those 
skilled in the art upon consideration of these descriptions. 

35 Those modifications and variations are believed to be encompassed 
within the claims appended hereto. 



34 



WO 95/33830 



PCT/US95/07084 



SEQUENCE LISTING 



(1) GENERAL INFORMATION: 



(i) APPLICANT: Rosen, Vicki A. 

Wozney, John M. 
5 Celeste, Anthony J . 

(ii) TITLE OF INVENTION: BMP-9 COMPOSITIONS 

(iii) NUMBER OF SEQUENCES: 9 

(iv) CORRESPONDENCE ADDRESS: 
10 (A) ADDRESSEE: Genetics Institute, Inc. 

(B) STREET: Legal Affairs - 87 CambridgePark Drive 

(C) CITY: Cambridge 

(D) STATE: MA 

(E) COUNTRY: US 
15 <F) ZIP: 02140 

(v) COMPUTER READABLE FORM: 

(A) MEDIUM TYPE: Floppy disk 

(B) COMPUTER: IBM PC compatible 

(C) OPERATING SYSTEM: PC-DOS/MS-DOS 

20 (D ) SOFTWARE: Patentln Release #1.0, Version #1.25 

(vi) CURRENT APPLICATION DATA: 

(A) APPLICATION NUMBER: US 

(B) FILING DATE: 

(C) CLASSIFICATION: 

25 (viii) ATTORNEY /AGENT INFORMATION: 

(A) NAME: Kapinos, Ellen J. 

(B) REGISTRATION NUMBER: 32,245 

(C) REFERENCE/DOCKET NUMBER: GI 5186C-PCT 

(ix) TELECOMMUNICATION INFORMATION: 
30 (A) TELEPHONE: (617) 876-1210 

(B) TELEFAX: (617) 876-5851 



(2) INFORMATION FOR SEQ ID NO:l: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 2447 base pairs 
35 (B) TYPE: nucleic acid 

(C) STRAND ED NESS : double 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: cDNA to mRNA 
(iii) HYPOTHETICAL: NO 
40 (iv) ANTI-SENSE: NO 

(vi) ORIGINAL SOURCE : 

(A) ORGANISM: Mus musculus 

(B) STRAIN: C57B46xCBA 
(F) TISSUE TYPE: liver 

45 (vii) IMMEDIATE SOURCE: 

(A) LIBRARY: Mouse liver cDNA 

(B) CLONE: ML14A 

(viii) POSITION IN GENOME: 

(C) UNITS: bp 



35 



WO 95/33830 



PCT/US95/07084 



(ix) FEATURE: 

(A) NAME /KEY : mat_peptide 

(B) LOCATION: 1564, ,1893 

(ix) FEATURE: 
5 (A) NAME/KEY: CDS 

(B) LOCATION: 610.. 1896 

(ix) FEATURE: 

(A) NAME /KEY: mRNA 

(B) LOCATION: 1..2447 

10 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:l: 

CATTAATAAA TATTAAGTAT TGGAATTAGT GAAATTGGAG TTCCTTGTGG AAGGAAGTGG 60 

GCAAGTGAGC TTTTTAGTTT GTGTCGGAAG CCTGTAATTA CGGCTCCAGC TCATAGTGGA 120 

ATGGCTATAC TTAGATTTAT GGATAGTTGG GTAGTAGGTG TAAATGTATG TGGTAAAAGG 180 

CCTAGGAGAT TTGTTGATCC AATAAATATG ATTAGGGAAA CAATTATTAG GGTTCATGTT 240 

15 CGTCCTTTTG GTGTGTGGAT TAGCATTATT TGTTTGATAA TAAGTTTAAC TAGTCAGTGT 300 

TGGAAAGAAT GGAGACGGTT GTTGATTAGG CGTTTTGAGG ATGGGAATAG GATTGAAGGA 360 

AATATAATGA TGGCTACAAC GATTGGGAAT CCTATTATTG TTGGGGTAAT GAATGAGGCA 420 

AATAGATTTT CGTTCATTTT AATTCTCAAG GGGTTTTTAC TTTTATGTTT GTTAGTGATA 480 

TTGGTGAGTA GGCCAAGGGT TAATAGTGTA ATTGAATTAT AGTGAAATCA TATTACTAGA 540 

20 CCTGATGTTA GAAGGAGGGC TGAAAAGGCT CCTTCCCTCC CAGGACAAAA CCGGAGCAGG 600 

GCCACCCGG ATG TCC CCT GGG GCC TTC CGG GTG GCC CTG CTC CCG CTG 648 
Met Ser Pro Gly Ala Phe Arg Val Ala Leu Leu Pro Leu 
-318 -315 -310 

TTC CTG CTG GTC TGT GTC ACA CAG CAG AAG CCG CTG CAG AAC TGG GAA 696 
25 Phe Leu Leu Val Cys Val Thr Gin Gin Lys Pro Leu Gin Asn Trp Glu 

-305 -300 -295 -290 





CAA 
Gin 


GCA 
Ala 


TCC 
Ser 


CCT 
Pro 


GGG GAA 
Gly Glu 
-285 


AAT 
Asn 


GCC 
Ala 


CAC 
His 


AGC TCC 
Ser Ser 
-280 


CTG 
Leu 


GGA 
Gly 


TTG 
Leu 


TCT GGA 
Ser Gly 
-275 


744 


30 


GCT 
Ala 


GGA 
Gly 


GAG 
Glu 


GAG GGT 
Glu Gly 
-270 


GTC 
Val 


TTT 
Phe 


GAC 
Asp 


CTG CAG 
Leu Gin 
-265 


ATG 
Met 


TTC 
Phe 


CTG 
Leu 


GAG AAC 
Glu Asn 
-260 


ATG 
Met 


792 


35 


AAG 
Lys 


GTG 
Val 


GAT TTC 
Asp Phe 
-255 


CTA 
Leu 


CGC 
Arg 


AGC 
Ser 


CTT AAC 
Leu Asn 
-250 


CTC 
Leu 


AGC 
Ser 


GGC 
Gly 


ATT CCC 
lie Pro 
-245 


TCC 
Ser 


CAG 
Gin 


840 




GAC 
Asp 


AAA ACC 
Lys Thr 
-240 


AGA 
Arg 


GCG 
Ala 


GAG 
Glu 


CCA CCC 
Pro Pro 
-235 


CAG 
Gin 


TAC 
Tyr 


ATG 
Met 


ATC GAC 
He Asp 
-230 


TTG 
Leu 


TAC 
Tyr 


AAC 
Asn 


888 


40 


AGA TAC 
Arg Tyr 
-225 


ACA 
Thr 


ACG 
Thr 


GAC 
Asp 


AAA TCG 
Lys Ser 
-220 


TCT 
Ser 


ACG 
Thr 


CCT 
Pro 


GCC TCC 
Ala Ser 
-215 


AAC 
Asn 


ATC 
He 


GTG 
Val 


CGG 
Arg 
-210 


936 




AGC 
Ser 


TTC 
Phe 


AGC 
Ser 


GTG 
Val 


GAA GAT 
Glu Asp 
-205 


GCT 
Ala 


ATA 
He 


TCG 
Ser 


ACA GCT 
Thr Ala 
-200 


GCC 
Ala 


ACG 
Thr 


GAG 
Glu 


GAC 
Asp 
-195 


TTC 
Phe 


984 



36 



WO 95/33830 



PCT/US95/07084 



CCC TTT CAG AAG CAC ATC CTG ATC TTC AAC ATC TCC ATC CCG AGG CAC 1032 
Pro Phe Gin Lys His He Leu He Phe Asn He Ser He Pro Arg His 
-190 -185 -180 

GAG CAG ATC ACC AGG GCT GAG CTC CGA CTC TAT GTC TCC TGC CAA AAT 1080 
5 Glu Gin He Thr Arg Ala Glu Leu Arg Leu Tyr Val Ser Cys Gin Asn 
-175 -170 -165 

GAT GTG GAC TCC ACT CAT GGG CTG GAA GGA AGC ATG GTC GTT TAT GAT 1128 
Asp Val Asp Ser Thr His Gly Leu Glu Gly Ser Met Val Val Tyr Asp 
-160 -155 -150 

10 GTT CTG GAG GAC AGT GAG ACT TGG GAC CAG GCC ACG GGG ACC AAG ACC 1176 

Val Leu Glu Asp Ser Glu Thr Trp Asp Gin Ala Thr Gly Thr Lys Thr 
-145 -140 -135 -130 

TTC TTG GTA TCC CAG GAC ATT CGG GAC GAA GGA TGG GAG ACT TTA GAA 1224 
Phe Leu Val Ser Gin Asp He Arg Asp Glu Gly Trp Glu Thr Leu Glu 
15 -125 -120 -115 

GTA TCG AGT GCC GTG AAG CGG TGG GTC AGG GCA GAC TCC ACA ACA AAC 1272 
Val Ser Ser Ala Val Lys -Arg Trp Val Arg Ala Asp Ser Thr Thr Asn 
-110 -105 -100 

AAA AAT AAG CTC GAG GTG ACA GTG CAG AGC CAC AGG GAG AGC TGT GAC 1320 
20 Lys Asn Lys Leu Glu Val Thr Val Gin Ser His Arg Glu Ser Cys Asp 

-95 -90 -85 

ACA CTG GAC ATC AGT GTC CCT CCA GGT TCC AAA AAC CTG CCC TTC TTT 1368 
Thr Leu Asp He Ser Val Pro Pro Gly Ser Lys Asn Leu Pro Phe Phe 
-80 -75 -70 

25 GTT GTC TTC TCC AAT GAC CGC AGC AAT GGG ACC AAG GAG ACC AG A CTG 1416 

Val Val Phe Ser Asn Asp Arg Ser Asn Gly Thr Lys Glu Thr Arg Leu 
-65 -60 -55 -50 

GAG CTG AAG GAG ATG ATC GGC CAT GAG CAG GAG ACC ATG CTT GTG AAG 1464 
Glu Leu Lys Glu Met He Gly His Glu Gin Glu Thr Met Leu Val Lys 
30 -45 -40 -35 

ACA GCC AAA AAT GCT TAC CAG GTG GCA GGT GAG AGC CAA GAG GAG GAG 1512 
Thr Ala Lys Asn Ala Tyr Gin Val Ala Gly Glu Ser Gin Glu Glu Glu 
-30 -25 -20 

GGT CTA GAT GGA TAC ACA GCT GTG GGA CCA CTT TTA GCT. AGA AGG AAG 1560 
3 5 Gly Leu Asp Gly Tyr Thr Ala Val Gly Pro Leu Leu Ala Arg Arg Lys 

-15 -10 -5 

AGG AGC ACC GGA GCC AGC AGC CAC TGC CAG AAG ACT TCT CTC AGG GTG 1608 
Arg Ser Thr Gly Ala Ser Ser His Cys Gin Lys Thr Ser Leu Arg Val 
15 10 15 

40 AAC TTT GAG GAC ATC GGC TGG GAC AGC TGG ATC ATT GCA CCC AAG GAA 1656 

Asn Phe Glu Asp He Gly Trp Asp Ser Trp He He Ala Pro Lys Glu 
20 25 30 

TAT GAC GCC TAT GAG TGT AAA GGG GGT TGC TTC TTC CCA TTG GCT GAT 1704 
Tyr Asp Ala Tyr Glu Cys Lys Gly Gly Cys Phe Phe Pro Leu Ala Asp 
45 35 40 45 

GAC GTG ACA CCC ACC AAA CAT GCC ATC GTG CAG ACC CTG GTG CAT CTC 17 52 

Asp Val Thr Pro Thr Lys His Ala He Val Gin Thr Leu Val His Leu 
50 55 "60 

GAG TTC CCC ACA AAG GTG GGC AAA GCC TGC TGC GTT CCC ACC AAA CTG 1800 
50 Glu Phe Pro Thr Lys Val Gly Lys Ala Cys Cys Val Pro Thr Lys Leu 
65 70 75 



37 



WO 95/33830 



PCT/US95/07084 



AGT CCC ATC TCC ATC CTC TAC AAG GAT GAC ATG GGG GTG CCA ACC CTC 
Ser Pro lie Ser lie Leu Tyr Lys Asp Asp Met Gly Val Pro Thr Leu 
80 85 90 95 



1848 



AAG TAC CAC TAT GAG GGG ATG AGT GTG GCT GAG TGT GGG TGT AGG TAGTCCCTGC 
Lys Tyr His Tyr Glu Gly Met Ser Val Ala Glu Cys Gly Cys Arg 
100 105 110 



1903 



10 



15 



AGCCACCCAG 


GGTGGGGATA 


CAGGACATGG 


AAGAGGTTCT 


GGTACGGTCC 


TGCATCCTCC 


1963 


TGCGCATGGT 


ATGCCTAAGT 


TGATCAGAAA 


CCATCCTTGA 


GAAGAAAAG& 


AGTTAGTTGC 


2023 


CCTTCTTGTG 


TCTGGTGGGT 


CCCTCTGCTG 


AAGTGACAAT 


GACTGGGGTA 


TGCGGGCCTG 


2083 


TGGGCAGAGC 


AGGAGACCCT 


GGAAGGGTTA 


GTGGGTAGAA 


AGATGTCAAA 


AAGGAAGCTG 


2143 


TGGGTAGATG 


ACCTGCACTC 


CAGTGATTAG 


AAGTCCAGCC 


TTACCTGTGA 


GAGAGCTCCT 


2203 


GGCATCTAAG 


AGAACTCTGC 


TTCCTCATCA 


TCCCCACCGA 


CTTGTTCTTC 


CTTGGGAGTG 


2263 


TGTCCTCAGG 


GAGAACAGCA 


TTGCTGTTCC 


TGTGCCTCAA 


GCTCCCAGCT 


GACTCTCCTG 


2323 


TGGCTCATAG 


GACTGAATGG 


GGTGAGGAAG 


AGCCTGATGC 


CCTCTGGCAA 


TCAGAGCCCG 


2383 


AAGGACTTCA 


AAACATCTGG 


ACAACTCTCA 


TTGACTGATG 


CTCCAACATA 


ATTTTTAAAA 


2443 


AGAG 












2447 



(2) INFORMATION FOR SEQ ID NO: 2: 

(i) SEQUENCE CHARACTERISTICS: 
20 (A) LENGTH: 428 amino acids 

( B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: 

25 Met Ser Pro Gly Ala Phe Arg Val Ala Leu Leu Pro Leu Phe Leu Leu 
-318 -315 -310 -305 

Val Cys Val Thr Gin Gin Lys Pro Leu Gin Asn Trp Glu Gin Ala Ser 
-300 -295 -290 

Pro Gly Glu Asn Ala His Ser Ser Leu Gly Leu Ser Gly Ala Gly Glu 
30 -285 -280 -275 

Glu Gly Val Phe Asp Leu Gin Met Phe Leu Glu Asn Met Lys Val Asp 
-270 -265 -260 -255 

Phe Leu Arg Ser Leu Asn Leu Ser Gly lie Pro Ser Gin Asp Lys Thr 
-250 -245 -240 



35 Arg Ala Glu Pro Pro Gin Tyr Met lie Asp Leu Tyr Asn Arg Tyr Thr 
-235 -230 -225 

Thr Asp Lys Ser Ser Thr Pro Ala Ser Asn lie Val Arg Ser Phe Ser 
-220 -215 -210 

Val Glu Asp Ala lie Ser Thr Ala Ala Thr Glu Asp Phe Pro Phe Cln 
40 -205 -200 -195 

Lys His lie Leu lie Phe Asn lie Ser He Pro Arg His Glu Gin He 
-190 -185 -1B0 -175 



38 



WO 95/33830 



PCT/US95/07084 



Thr Arg Ala Glu Leu Arg Leu Tyr Val Ser Cys Gin Asn Asp Val Asp 
-170 -165 -160 

Ser Thr His Gly Leu Glu Gly Ser Met Val Val Tyr Asp Val Leu Glu 
-155 -150 -145 

5 Asp Ser Glu Thr Trp Asp Gin Ala Thr Gly Thr Lys Thr Phe Leu Val 
-140 -135 -130 

Ser Gin Asp He Arg Asp Glu Gly Trp Glu Thr Leu Glu Val Ser Ser 
-125 -120 -115 

Ala Val Lys Arg Trp Val Arg Ala Asp Ser Thr Thr Asn Lys Asn Lys 
10 -110 -105 -100 -95 

Leu Glu Val Thr Val Gin Ser His Arg Glu Ser Cys Asp Thr Leu Asp 
-90 . -85 -80 

He Ser Val Pro Pro Gly Ser Lys Asn Leu Pro Phe Phe Val Val Phe 
-75 -70 -65 

15 Ser Asn Asp Arg Ser Asn. Gly Thr Lys Glu Thr Arg Leu Glu Leu Lys 

-60 -55 -50 

Glu Met He Gly His Glu Gin Glu Thr Met Leu Val Lys Thr Ala Lys 
-45 -40 -35 

Asn Ala Tyr Gin Val Ala Gly Glu Ser Gin Glu Glu Glu Gly Leu Asp 
20 -30 -25 -20 ' -15 

Gly Tyr Thr Ala Val Gly Pro Leu Leu Ala Arg Arg Lys Arg Ser Thr 
-10 -5 1 

Gly Ala Ser Ser His Cys Gin Lys Thr Ser Leu Arg Val Asn Phe Glu 
5 10 15 

25 Asp He Gly Trp Asp Ser Trp He He Ala Pro Lys Glu Tyr Asp Ala 
20 25 30 

Tyr Glu Cys Lys Gly Gly Cys Phe Phe Pro Leu Ala Asp Asp Val Thr 
35 40 45 50 

Pro Thr Lys His Ala He Val Gin Thr Leu Val His Leu Glu Phe Pro 
30 55 60 65 

Thr Lys Val Gly Lys Ala Cys Cys Val Pro Thr Lys Leu Ser Pro He 
70 75 80 

Ser He Leu Tyr Lys Asp Asp Met Gly Val Pro Thr Leu Lys Tyr His 
85 90 95 

35 Tyr Glu Gly Met Ser Val Ala Glu Cys Gly Cys Arg 
100 105 110 

(2) INFORMATION FOR SEQ ID NO: 3: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 1954 base pairs 
40 (B) TYPE: nucleic acid 

(C) STRANDEDNESS: double 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: cDNA to mRNA 
(iii) HYPOTHETICAL: NO 



39 



WO 95/33830 



PCT/US95/07084 



(iv) ANTI-SENSE: NO 

(vi) ORIGINAL SOURCE: 

(A) ORGANISM: Homo sapiens 
(G) CELL TYPE: Osteosarcoma Cell Line 
5 (H) CELL LINE: U-20S 

(vii) IMMEDIATE SOURCE: 

(A) LIBRARY: U20S cDNA in Lambda gtlO 

(B) CLONE: Lambda U20S-3 

(viii) POSITION IN GENOME: 
10 <C) UNITS: bp 

(ix) FEATURE: 

(A) NAME /KEY: CDS 

(B) LOCATION: 403. ,1629 

(ix) FEATURE: 
15 (A) NAME /KEY : mat_peptide 

(B) LOCATION: 1279. . 1626 

(ix) FEATURE: 

(A) NAME /KEY : mRNA 

(B) LOCATION: 9.. 1934 

20 <xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: 

CTCTAGAGGG CAGAGGAGGA GGGAGGGAGG GAAGGAGCGC GGAGCCCGGC CCGGAAGCTA 60 

GGTGAGTGTG GCATCCGAGC TGAGGGACGC GAGCCTGAGA CGCCGCTGCT GCTCCGGCTG 120 

AGTATCTAGC TTGTCTCCCC GATGGGATTC CCGTCCAAGC TATCTCGAGC CTGCAGCGCC 180 

ACAGTCCCCG GCCCTCGCCC AGGTTCACTG CAACCGTTCA GAGGTCCCCA GGAGCTGCTG 240 

25 CTGGCGAGCC CGCTACTGCA GGGACCTATG GAGCCATTCC GTAGTGCCAT CCCGAGCAAC 300 

GCACTGCTGC AGCTTCCCTG AGCCTTTCCA GCAAGTTTGT TCAAGATTGG CTGTCAAGAA 360 

TCATGGACTG TTATTATATG CCTTGTTTTC TGTCAAGACA CC ATG ATT CCT GGT 414 

Met lie Pro Gly 
-292 -290 

30 AAC CGA ATG CTG ATG GTC GTT TTA TTA TGC CAA GTC CTG CTA GGA GGC 462 

Asn Arg Met Leu Met Val Val Leu Leu Cys Gin Val Leu Leu Gly Gly 
-285 -280 -275 

GCG AGC CAT GCT AGT TTG ATA CCT GAG ACG GGG AAG AAA AAA GTC GCC 510 
Ala Ser His Ala Ser Leu lie Pro Glu Thr Gly Lys Lys Lys Val Ala 
35 -270 -265 ' -260 

GAG ATT CAG GGC CAC GCG GGA GGA CGC CGC TCA GGG CAG AGC CAT GAG 558 
Glu lie Gin Gly His Ala Gly Gly Arg Arg Ser Gly Gin Ser His Glu 
-255 -250 -245 

CTC CTG CGG GAC TTC GAG GCG ACA CTT CTG CAG ATG TTT GGG CTG CGC 606 
4 0 Leu Leu Arg Asp Phe Glu Ala Thr Leu Leu Gin Met Phe Gly Leu Arg 

-240 -235 -230 -225 

CGC CGC CCG CAG CCT AGC AAG AGT GCC GTC ATT CCG GAC TAC ATG CGG 654 
Arg Arg Pro Gin Pro Ser Lys Ser Ala Val He Pro Asp Tyr Met Arg 
-220 -215 -210 



40 



WO 95/33830 



PCT/US95/07084 



GAT CTT TAC CGG CTT CAG TCT GGG GAG GAG GAG GAA GAG CAG ATC CAC 702 
Asp Leu Tyr Arg Leu Gin Ser Gly Glu Glu Glu Glu Glu Gin lie His 
-205 -200 -195 

AGC ACT GGT CTT GAG TAT CCT GAG CGC CCG GCC AGC CGG GCC AAC ACC 750 
5 Ser Thr Gly Leu Glu Tyr Pro Glu Arg Pro Ala Ser Arg Ala Asn Thr 
-190 -185 -180 

GTG AGG AGC TTC CAC CAC GAA GAA CAT CTG GAG AAC ATC CCA GGG ACC 798 
Val Arg Ser Phe His His Glu Glu His Leu Glu Asn lie Pro Gly Thr 
-175 -170 -165 

10 AGT GAA AAC TCT GCT TTT CGT TTC CTC TTT AAC CTC AGC AGC ATC CCT 846 

Ser Glu Asn Ser Ala Phe Arg Phe Leu Phe Asn Leu Ser Ser He Pro 
-160 -155 -150 -145 

GAG AAC GAG GTG ATC TCC TCT GCA GAG CTT CGG CTC TTC CGG GAG CAG 894 
Glu Asn Glu Val He Ser Ser Ala Glu Leu Arg Leu Phe Arg Glu Gin 
15 -140 -135 -130 

GTG GAC CAG GGC CCT GAT TGG GAA AGG GGC TTC CAC CGT ATA AAC ATT - 942 
Val Asp Gin Gly Pro Asp- Trp Glu Arg Gly Phe His Arg He Asn lie 
-125 -120 -115 

TAT GAG GTT ATG AAG CCC CCA GCA GAA GTG GTG CCT GGG CAC CTC ATC 990 
20 Tyr Glu Val Met Lys Pro Pro Ala Glu Val Val Pro Gly His Leu He 

-110 -105 -100 

ACA CGA CTA CTG GAC ACG AGA CTG GTC CAC CAC AAT GTG ACA CGG TGG 1038 
Thr Arg Leu Leu Asp Thr Arg Leu Val His His Asn Val Thr Arg Trp 
-95 -90 -85 

25 GAA ACT TTT GAT GTG AGC CCT GCG GTC CTT CGC TGG ACC CGG GAG AAG 1086 

Glu Thr Phe Asp Val Ser Pro Ala Val Leu Arg Trp Thr Arg Glu Lys 
-80 -75 -70 -65 

CAG CCA AAC TAT GGG CTA GCC ATT GAG GTG ACT CAC CTC CAT CAG ACT 1134 
Gin Pro Asn Tyr Gly Leu Ala He Glu Val Thr His Leu His Gin Thr 
30 -60 -55 -50 

CGG ACC CAC CAG GGC CAG CAT GTC AGG ATT AGC CGA TCG TTA CCT CAA 1182 
Arg Thr His Gin Gly Gin His Val Arg He Ser Arg Ser Leu Pro Gin 
-45 -40 -35 

GGG AGT GGG AAT TGG GCC CAG CTC CGG CCC CTC CTG GTC ACC TTT GGC 1230 
35 Gly Ser Gly Asn Trp Ala Gin Leu Arg Pro Leu Leu Val Thr Phe Gly 

-30 -25 -20 

CAT GAT GGC CGG GGC CAT GCC TTG ACC CGA CGC CGG AGG GCC AAG CGT 1278 
His Asp Gly Arg Gly His Ala Leu Thr Arg Arg Arg Arg Aia Lys Arg 
-15 -10 -5 

40 AGC CCT AAG CAT CAC TCA CAG CGG GCC AGG AAG AAG AAT AAG AAC TGC 1326 

Ser Pro Lys His His Ser Gin Arg Ala Arg Lys Lys Asn Lys Asn Cys 
1 5 10 15 

CGG CGC CAC TCG CTC TAT GTG GAC TTC AGC GAT GTG GGC TGG AAT GAC 1374 
Arg Arg His Ser Leu Tyr Val Asp Phe Ser Asp Val Gly Trp Asn Asp 
45 20 25 30 

TGG ATT GTG GCC CCA CCA GGC TAC CAG GCC TTC TAC TGC CAT GGG GAC 1422 
Trp lie Val Ala Pro Pro Gly Tyr Gin Ala Phe Tyr Cys His Gly Asp 
35 40 45 

TGC CCC TTT CCA CTG GCT GAC CAC CTC AAC TCA ACC AAC CAT GCC ATT 1470 
50 Cys Pro Phe Pro Leu Ala Asp His Leu Asn Ser Thr Asn His Ala He 

50 55 60 



41 



WO 95/33830 



PCT/US95/07084 



GTG CAG ACC CTG GTC AAT TCT GTC AAT TCC AGT ATC CCC AAA GCC TGT 1518 
Val Gin Thr Leu Val Asn Ser Val Asn Ser Ser lie Pro Lys Ala Cys 
65 70 75 80 

TGT GTG CCC ACT GAA CTG AGT GCC ATC TCC ATG CTG TAG CTG GAT GAG 1566 
5 Cys Val Pro Thr Glu Leu Ser Ala lie Ser Met Leu Tyr Leu Asp Glu 

85 90 95 

TAT GAT AAG GTG GTA CTG AAA AAT TAT CAG GAG ATG GTA GTA GAG GGA 1614 
Tyr Asp Lys Val Val Leu Lys Asn Tyr Gin Glu Met Val Val Glu Gly 
100 105 110 

10 TGT GGG TGC CGC TGAGATCAGG CAGTCCTTGA GGATAGACAG ATATACACAC 1666 

Cys Gly Cys Arg 
115 

CACACACACA CACCACATAC ACCACACACA CACGTTCCCA TCCACTCACC CACACACTAC 1726 

ACAGACTGCT TCCTTATAGC TGGACTTTTA TTTAAAAAAA AAAAAAAAAA AATGGAAAAA 1786 

15 ATCCCTAAAC ATTCACCTTG ACCTTATTTA TGACTTTACG TGCAAATGTT TTGACCATAT 1846 

TG ATC AT AT A TTTTGACAAA ATATATTTAT AACTACGTAT TAAAAGAAAA AAATAAAATG 1906 

AGTCATTATT TTAAAAAAAA AAAAAAAACT CTAGAGTCGA CGGAATTC 1954 

(2) INFORMATION FOR SEQ ID NO: 4: 

(i) SEQUENCE CHARACTERISTICS: 
20 (A) LENGTH: 408 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4: 

25 Met He Pro Gly Asn Arg Met Leu Met Val Val Leu Leu Cys Gin Val 
-292 -290 -285 -280 

Leu Leu Gly Gly Ala Ser His Ala Ser Leu He Pro Glu Thr Gly Lys 
-275 -270 -265 

Lys Lys Val Ala Glu He Gin Gly His Ala Gly Gly Arg Arg Ser Gly 
30 -260 -255 -250 -245 

Gin Ser His Glu Leu Leu Arg Asp Phe Glu Ala Thr Leu Leu Gin Met 
-240 -235 -230 

Phe Gly Leu Arg Arg Arg Pro Gin Pro Ser Lys Ser Ala Val He Pro 
-225 -220 -215 

35 Asp Tyr Met Arg Asp Leu Tyr Arg Leu Gin Ser Gly Glu Glu Glu Glu 

-210 -205 -200 

Glu Gin He His Ser Thr Gly Leu Glu Tyr Pro Glu Arg Pro Ala Ser 
-195 -190 -185 

Arg Ala Asn Thr Val Arg Ser Phe His His Glu Glu His Leu Glu Asn 
40 -180 -175 -170 -165 

He Pro Gly Thr Ser Glu Asn Ser Ala Phe Arg Phe Leu Phe Asn Leu 
-160 -155 -150 

Ser Ser He Pro Glu Asn Glu Val He Ser Ser Ala Glu Leu Arg Leu 
-145 -140 -135 

42 



WO 95/33830 



PCTAJS95/07084 



Phe Arg Glu Gin Val Asp Gin Gly Pro Asp Trp Glu Arg Gly Phe His 
-130 -125 -120 

Arg lie Asn lie Tyr Glu Val Met Lys Pro Pro Ala Glu Val Val Pro 
-115 -110 -105 

5 Gly His Leu He Thr Arg Leu Leu Asp Thr Arg Leu Val His His Asn 
-100 -95 -90 -85 

Val Thr Arg Trp Glu Thr Phe Asp Val Ser Pro Ala Val Leu Arg Trp 
-80 -75 - -70 

Thr Arg Glu Lys Gin Pro Asn Tyr Gly Leu Ala He Glu Val Thr His 
10 -65 -60 -55 

Leu His Gin Thr Arg Thr His Gin Gly Gin His Val Arg lie Ser Arg 
-50 -45 -40 

Ser Leu Pro Gin Gly Ser Gly Asn Trp Ala Gin Leu Arg Pro Leu Leu 
-35 -30 -25 

15 Val Thr Phe Gly His Asp. Gly Arg Gly His Ala Leu Thr Arg Arg Arg 
-20 -15 -10 -5 

Arg Ala Lys Arg Ser Pro Lys His His Ser Gin Arg Ala Arg Lys Lys 
15 10 

Asn Lys Asn Cys Arg Arg His Ser Leu Tyr Val Asp Phe Ser Asp Val 
20 15 20 25 

Gly Trp Asn Asp Trp He Val Ala Pro Pro Gly Tyr Gin Ala Phe Tyr 
30 35 40 

Cys His Gly Asp Cys Pro Phe Pro Leu Ala Asp His Leu Asn Ser Thr 
45 50 55 60 

25 Asn His Ala He Val Gin Thr Leu Val Asn Ser Val Asn Ser Ser He 

65 70 75 

Pro Lys Ala Cys Cys Val Pro Thr Glu Leu Ser Ala He Ser Met Leu 
80 85 90 

Tyr Leu Asp Glu Tyr Asp Lys Val Val Leu Lys Asn Tyr Gin Glu Met 
30 95 100 105 

Val Val Glu Gly Cys Gly Cys Arg 
110 115 

(2) INFORMATION FOR SEQ ID NO: 5: 

(i) SEQUENCE CHARACTERISTICS: 
35 (A) LENGTH: 15 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: double 

(D) TOPbLOGY: linear 

(ii) MOLECULE TYPE: cDNA to mRNA 

40 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5: 

CATGGGCAGC TCGAG 15 

(2) INFORMATION FOR SEQ ID NO: 6: 

(i) SEQUENCE CHARACTERISTICS: 
(A) LENGTH: 34 base pairs 

43 



WO 95/33830 



PCT/US95/07084 



(B) TYPE: nucleic acid 

(C) STRANDEDNESS: double 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: cDNA to mRNA 

5 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6: 

CTGCAGGCGA GCCTGAATTC CTCGAGCCAT CATG 34 

(2) INFORMATION FOR SEQ ID NO: 7: 

(i) SEQUENCE CHARACTERISTICS: 
(A) LENGTH: 68 base pairs 
10 (B) TYPE: nucleic acid 

(C) STRANDEDNESS : double 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: cDNA to mRNA 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7: 

15 CGAGGTTAAA AAACGTCTAG GCCCCCCGAA CCACGGGGAC GTGGTTTTCC TTTGAAAAAC 60 

ACGATTGC 68 

(2) INFORMATION FOR SEQ ID NO: 8: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 470 base pairs 
20 (B) TYPE: nucleic acid 

(C) STRANDEDNESS: double 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 
(iii) HYPOTHETICAL: NO 
25 (v) FRAGMENT TYPE: C-terminal 

(vi) ORIGINAL SOURCE: 

(A) ORGANISM: Homo sapiens 

(H) CELL LINE: W138 (genomic DNA) 

(vii) IMMEDIATE SOURCE: 
30 (A) LIBRARY: human genomic library 

(B) CLONE: lambda 111-1 

(viii) POSITION IN GENOME: 

(C) UNITS: bp 

(ix) FEATURE: 
35 (A) NAME/KEY: exon 

(B) LOCATION: 1. .470 

(ix) FEATURE: 

(A) NAME/KEY: CDS 

(B) LOCATION: 1..456 

4 0 (ix) FEATURE: 

(A) NAME/KEY: mat_peptide 

(B) LOCATION: 124.. 453 

(ix) FEATURE: 

(A) NAME/KEY: mRNA 
45 (B) LOCATION: 1..470 



44 



WO 95/33830 



PCT/US95/07084 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8: 

TGA ACA AGA GAG TGC TCA AGA AGC TGT CCA AGG ACG GCT CCA CAG AGG 48 

Thr Arg Glu Cys Ser Arg Ser Cys Pro Arg Thr Ala Pro Gin Arg 
-41 -40 -35 -30 

5 CAG GTG AGA GCA GTC ACG AGG AGG ACA CGG ATG GCG CAC GTG GCT GCG 96 

Gin Val Arg Ala Val Thr Arg Arg Thr Arg Met Ala His Val Ala Ala 
-25 -20 -15 -10 

GGG TCG ACT TTA GCC AGG CGG AAA AGG AGC GCC GGG GCT GGC AGC CAC 144 
Gly Ser Thr Leu Ala Arg Arg Lys Arg Ser Ala Gly Ala GLy Ser His 
10 -5 15 

TGT CAA AAG ACC TCC CTG CGG GTA AAC TTC GAG GAC ATC GGC TGG GAC 192 
Cys Gin Lys Thr Ser Leu Arg Val Asn Phe Glu Asp lie Gly Trp Asp 
10 15 20 

AGC TGG ATC ATT GCA CCC AAG GAG TAT GAA GCC TAG GAG TGT AAG GGC 240 
15 Ser Trp lie lie Ala Pro Lys Glu Tyr Glu Ala Tyr Glu Cys Lys Gly 

25 30 35 

GGC TGC TTC TTC CCC TTG GCT GAC GAT GTG ACG CCG ACG AAA CAC GCT 288 
Gly Cys Phe Phe Pro Leu Ala Asp Asp Val Thr Pro Thr Lys His Ala 
40 45 50 55 

20 ATC GTG CAG ACC CTG GTG CAT CTC AAG TTC CCC ACA AAG GTG GGC AAG 336 

lie Val Gin Thr Leu Val His Leu Lys Phe Pro Thr Lys Val Gly Lys 
60 65 70 

GCC TGC TGT GTG CCC ACC AAA CTG AGC CCC ATC TCC GTC CTC TAC AAG 384 
Ala Cys Cys Val Pro Thr Lys Leu Ser Pro He Ser Val Leu Tyr Lys 
25 75 80 85 

GAT GAC ATG GGG GTG CCC ACC CTC AAG TAC CAT TAC GAG GGC ATG AGC 432 
Asp Asp Met Gly Val Pro Thr Leu Lys Tyr His Tyr Glu Gly Met Ser 
90 95 100 

GTG GCA GAG TGT GGG TGC AGG TAGTATCTGC CTGCGGG 470 
30 Val Ala Glu Cys Gly Cys Arg 
105 110 

(2) INFORMATION FOR SEQ ID NO: 9: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 150 amino acids 
35 (B) TYPE: amino acid 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9: 

Thr Arg Glu Cys Ser Arg Ser Cys Pro Arg Thr Ala Pro Gin Arg 
40 -41 -40 -35 -30 

Gin Val Arg Ala Val Thr Arg Arg Thr Arg Met Ala His Val Ala Ala 
-25 -20 -15 -10 

Gly Ser Thr Leu Ala Arg Arg Lys Arg Ser Ala Gly Ala Gly Ser His 
-5 1 5 

4 5 Cys Gin Lys Thr Ser Leu Arg Val Asn Phe Glu Asp He Gly Trp Asp 

10 15 20 



45 



WO 95/33830 PCT/US95707084 



Ser Trp lie He Ala Pro Lys Glu Tyr Glu Ala Tyr Glu Cys Lys Gly 

25 30 35 

Gly Cys Phe Phe Pro Leu Ala Asp Asp Val Thr Pro Thr Lys His Ala 

40 45 50 55 

He Val Gin Thr Leu Val His Leu Lys Phe Pro Thr Lys Val Gly Lys 

60 65 70 

Ala Cys Cys Val Pro Thr Lys Leu Ser Pro He Ser Val Leu Tyr Lys 

75 80 85 

Asp Asp Met Gly Val Pro Thr Leu Lys Tyr His Tyr Glu Gly Met Ser 

90 95 100 

Val Ala Glu Cys Gly Cys Arg 

105 110 



46 



WO 95/33830 



PCT/US95/07084 



What is claimed is: 

1. A BMP-9 polypeptide comprising the amino acid sequence from 
amino acid #8 - 110 as set forth in FIG. 3 (SEQ ID NO: 9) . 

2. A BMP-9 polypeptide comprising the amino acid sequence from 
5 amino acid #1 - 110 as set forth in FIG. 3 (SEQ ID NO: 9). 

3. A BMP-9 polypeptide of claim 1 wherein said polypeptide is 
a dimer wherein each subunit comprises at least the amino acid 
sequence from amino acid #8 - 110 of FIG. 3 (SEQ ID NO: 9). 

4. A BMP-9 polypeptide of claim 2 wherein said polypeptide is 
10 a dimer wherein each subunit comprises at least the amino acid 

sequence from amino acid #1-110 of FIG. 3. (SEQ ID NO: 9). 

5. A purified BMP-9 protein produced by the steps of 

(a) culturing a cell transformed with a cDNA comprising the 
nucleotide sequence from nucleotide #124 to #4 53 as shown in FIG. 

15 3 (SEQ ID NO: 8); and 

(b) recovering and purifying from said culture medium a 
protein comprising the amino acid sequence from amino acid #1 "to 
amino acid #110 as shown in FIG. 3 (SEQ ID NO: 9) . 

6. A purified BMP-9 protein produced by the steps of 

20 (a) culturing a cell transformed with a cDNA comprising the 

nucleotide sequence from nucleotide #124 to #453 as shown in FIG. 
3 (SEQ ID NO: 8) ; and 

(b) recovering form said culture medium a protein 
comprising an amino acid sequence from amino acid #8 to amino 

25 acid #110 as shown in Figure 3 (SEQ ID NO: 9). 

7. A BMP-9 protein characterized by the ability to induce the 
formation of cartilage and/or bone. 

8. A DNA sequence encoding a BMP-9 protein. 



47 



WO 95/33830 



PCTAJS95/07084 



9. The DNA sequence of claim 8 wherein said DNA comprises 

(a) nucleotide 124 to 453 (SEQ ID NO: 8); and 

(b) sequences which hybridize thereto under stringent 
hybridization conditions and exhibit the ability to form 
cartilage and/ or bone* 

10- The DNA sequence of claim 8 wherein said DNA comprises 

(a) nucleotide 145 to 453 (SEQ ID NO: 8); and 

(b) sequences which hybridize thereto under stringent 
hybridization conditions and exhibit the ability to form 
cartilage and/or bone. 

11. A host cell transformed with a DNA sequence encoding BMP-8. 

12. A method for producing a purified BMP-9 protein said method 
comprising the steps of 

(a) culturing a cell transformed with a cDNA comprising the 
nucleotide sequence encoding a BMP-9 protein; and 

(b) recovering and purifying said BMP-9 protein from the 
culture medium. 

13. A pharmaceutical composition comprising an effective amount 
of a BMP-9 protein in admixture with a pharmaceutical^ 
acceptable vehicle . 

14. A composition of claim 13 further comprising a matrix for 
supporting said composition and providing a surface for bone 
and/or cartilage growth. 

15. The composition of claim 14 wherein said matrix comprises 
a material selected from the group consisting of hydroxyapatite, 
collagen, polylactic acid and tricalcium phosphate. 

16. A method for inducing bone and/or cartilage formation in a 
patient in need of same comprising administering to said patient 
an effective amount of the composition of claim 13. 



48 



WO 95/33830 



PCT/US9S/07084 



17. A pharmaceutical composition for wound healing and tissue 
repair said composition comprising an effective amount of a BMP-9 
protein in a pharmaceutically acceptable vehicle. 

18. A method for treating wounds and/or tissue repair in a 
5 patient in need of same comprising administering to said patient 

an effective amount of the composition of claim 17. 

19. A purified mammalian BMP-9 protein produced by the steps of 

(a) culturing a cell transformed with (i) a DNA comprising 
the nucleotide sequence from nucleotide #610 to #1893 of SEQ ID 

10 NO:l and (ii) sequences which hybridize thereto under stringant 
hybridization conditions and induces the formation of cartilage 
or bone; and 

(b) recovering and purifying from said culture medium a 
protein comprising amino acid #1 to #110 of SEQ ID NO: 9. 

15 20. A pharmaceutical composition for hepatocyte growth said 
composition comprising an effective amount of a BMP-9 protein in 
a pharmaceutically acceptable vehicle. 

21. A method for inducing hepatocyte growth in a patient in need 
of same comprising administering to said patient an effective 

20 amount of the composition of claim 20. 

22. A pharmaceutical composition for cartilage repair said 
composition comprising an effective amount of a BMP-9 protein in 
a pharmaceutically acceptable vehicle. 



49 



WO 95/33830 



PCT/US95/070R4 



u 

0) 



U 

O CD 

cd 

1 

cd 

o CD 
u> CD 
H 



o 
in 



I 

CD 

1 



g 

U 
U 
H 
H 

o CD 



o H 
ro CD 



o 

CM 



i 
i 

U 
CD 



o < 
H 

o U 
H 9 

U 
H 
U 
CD 
CD 

u 

o < 
o H 

"I 

B 

U 
U 

I 

cd 

CD 
U 
H 
CD 
H 
CD 

o H* 

00 Eh 

H 

8 



o 



o 


CD 


o 


% 


o 




o 


,—1 




00 






& 


CM 


CM 


s 


CM 


5 


CO 












s 




S 










§ 




3 














K 




















5 














S 








£_, 














5 




o 


u 


O 


H 


O 


CD 


O 


o 


u 


r- 








rH 


CM 




CM 


g 


ro 


§ 














CD 






cd 








H 






H 




s 




H 














H 






6 


























& 












o 




o 




o 


CD 


O 




1 


vo 


1 


m 




O 


rH 




CM 




m 


l 




















CD 


















g 




i 
























CD 




H 






u 








H 






u 




& 




CD 





o 

CO 



o 



o 

VO 



O 
CM 



H 
H 
U 
U 

CD 
U 

H o 
O ro 

H 

H 
CD 
CD 



CD o 

H ro 

CD CM 
CD 



1 
S 



o 
o 
ro 



o 
in 




o 
ro 



o 
oo 
ro 



o 
ro 



o 
vo 
ro 



< o 
CD ^ 



o 

00 



o 



o 



U O 
< in 



< o 
CD 

H ^ 

! 

< o 
CD ro 
CD ^ 



CD in 



o 
in 
in 



U 
CD 

1 

CD 

1 

CD 



o 
in 



o 
ro 

LO 



O 
CM 

in 



in 



EH o 

H o 

H in 

i 





o 






o\ 




TT 


in 


1 
























i 










o 


U 




00 


u 




in 


H 












U 






U 


1 




H 






H 












U 


H 


o 




CD 


r- 


B 


CD 


in 




i 




1 


CCZ 






CD 




CD 


CD 




H 





00 


H 






rH 


o 


a, 




V£> 


u 
















u 




1 




a 


CO 


CD 








H 








U 




i 




U 


A 






















I 


O 








VO 


8 








U 








U 








a 








s 
















u 








CD 






O 


CD 






O 








VO 










U 
























CD 








8 





















1/20 



SUBSTITUTE SHEET (RULE 26) 



WO 95/33830 



PCTAJS95/07084 



(D 
U 
O 
Cn 



VD 



ro 

VD 



VD 



VD 

ro 

VD 



VD 



u a 
u a 



< 

U 
E-« 
O 

H 
O 
H 

U 
H 
O 

o 

U 



U 



H 

U 
H 

a 

H 

U iJ 



in I a 

^ u 

vd I U Du 

I o 



u 
u 

o 

u > 

a 
u 



u 

H 
H 

U 
U 
O 



VD 



H 



oo 
o 



VD 



o 

VD 



CO 
VD 



CO 



CO 



U 
U 
H 

U 

u 

u 

u 
u 
o 



2 

o 
o 

H 

u 

u a* 



u 
u 



co 



u 

a < 

$ 

u a 

o 
o 

u 



o 

u a 

o 
u 

U 0< 



o 

CO 



(N 
VD 

r- 



in 



in 



H 
U 

U 
H 
H 

O 



u a 
o 

H 

u 
< 

O P 



H 
H 



U 
H 

O > 
H 

o o 

H 
U 

a < 



a 



CO 



8 

H 

a 

H 

o 

H 
H 



o 



ro 

CO 



in 

CM 

CO 



VD 
CO 



o 

CO 



GO 



CO 



U 
U 

H co 

U 
U 

U P4 

H 
H 

< w 

U 
O 

o o 



u 
< 
u 

U 

u 

H 
H 
U 

U 



CO 



CO 



[1. 



U 

a 



u 

H 
H 

a 
a 

H 

o 

1 

o 
u 

2 



2/20 



SUBSTITUTE SHEET <RULE 26) 



WO 95/33830 



PCT/US95/07084 



0) 
•H 



00 
CD 
CD 



CO 



O 
CO 



CO 



CM 
LD 
CO 



CO 



m 

CO 



CM 

CTi 



in 

i-t 



o 



CTl 

oo 



CO 



&4 



CO 



g 

u 

H 
H 

U 

o 
o 
u 

e 

u 
u 

u 
u 

H 

u 
u 

CD 



U 

u a* 



CO 



CO 



CO 



00 



CO 



cr. 



o 



in 

CPi 



< 
U 

O 

% 

s 

H 
H 
H 

U 
U 
U 

U 

H 

g 

s 



O 

u 
< 

u 
o 
o 

H 

a 
o 

< 

8 

H 
U 
O 

H 

2 



o 

H 







1 O 
















t o 






o 


1 H 








u 






o 


1 o 






H 










1 o 












a 




1 < 
























1 < 


H 




H 


u 






^f* 






CM 


O 


1 < 


M 




H 


















< 




fx. 




1 8 


o 


















P 




1 3 


w 




CM 


I ^ 






ro 






CO 


o 


I u 






rH 










1 © 








o 








1 < 








8 
















1 o 


a* 




cn 


I r i 






CM 








O 


s 
















i r ) 
















H 


CO 






a 












CO 




s 


M 












s 


3 




M 






53 




rH 










U 








H 




< 






Du 






U 












Q 




< 


M 




If) 


O 






O 


H 






O 


U 


►3 




rH 










U 








H 




> 




< 


M 



3/20 



SUBSTITUTE SHEET (RULE 26) 



WO 95/33830 



PCT/US95/07084 



u 





GAA 




O 




H 


rH 


U 


rH 






s 

o 








ft 




CJ 


LD 




OA 


U 


O 


< 


rH 






r * 
(J 




U 




H 




r i 
(J 




s 




u 


VO 


rM 

U 


00 


H 


o 


U 


rH 






r . 








r . 




«. 




% 


o 


8 








u 








8 




U 




U 




H 


00 


U 


V£> 


& 


O 




rH 










1 








u 




H 




U 


OA 




in 


g 


o 




H . 






cj 




H 




U 







r t 






ro 






U 






8 


W 




o 


< 




a 




00 












in 


2 




rH 


o 


. T 

M 


rH 


1 w 


<J* 


{>! 






■ 














f J 




















u 




O 


a 




o 


















O 








s 




1 H 






1 o 




OA 


H 




ro 


vJ 






U 


■ 


O 


Js 


H 


rH 


< 


H 


03 


o 




rH 






rH 














u 






1 S 








CO 




8 


W 




a 












H 














Q 




< 


CO 




< 




O 


u 






U 






< 




o\ 




> 


H 




Q 


rH 


O 




H 






rH 














O 














Q 




3 


W 




u 






c 






u 






H 






a 






a 
















in 


< 






H 




GO 


H 


O 


rH 


a 


> 


rH 


O 




rH 






rH 














CD 














U 










H 












U 












H 


CO 










H 




C\ 








U 




(N 






r- 




> 


rH 


6 


> 


rH 






rH 






rH 








U 


















1 






(3 


> 
















U 














l-H* 














ro 






r- 


8 




rH 






KD 






rH 


S 


CO 


H 


a 




rH 






rH 














8 






1 








•J 






o 




< 















8 








< 


H 




\D 








U) 


s 




i* 


(\ 








I 










rj 








U 




a 




H 


CO 






CJ 
















O 


p 




[-*■ 








m 


(J 




Q 


(N 


1 o 


< 




rH 










o 












OS 












u 












M 






> 




00 


o 








o 




O 










rH 










o 








o 




o 






Pi 






% 




CO 




2 






OA 


o 






ro 






> 


CO 


o 


> 




rH 










CJ 








QJ 




•J 




O 








E-« 


















CO 




o 


8 






ro 






Eh 


OJ 


■H 


CO 




H 










■is 
















a 


> 


H 




3 






rH 








<N 






a 


(N 


H 






rH 










H 








CJ 




H 






H 



A/20 



SUBSTITUTE SHEET (RULE 26) 



WO 95/33830 PCT/US95/07084 



in 



0) 

u 
o 

-H 

tl4 





< 








o 
















rj 














ro 


ro 


O 


ro 








H 




H 








O 










Cj 






a 
















< 
**** 












LTI 












v./ 












rH 




o 








o 










U-t 






u 






















CN 






VD 


O 






LD 


ro 




CO 


m 


tH 






rH 




















3 


a 






o 








H 








u 


> 




ro 






i* 








^t 4 


(N 






ro 








H 




o 








H 








O 


> 






















o 


W 






a 




GO 


00 


H 




ro 


<N 


u 




ro 


H 






H 












i 








s 






in 






CTi 


rv 






<N 


oq 






ro 


rH 






rH 



CO 



CO 



CO 
CM 



H 



O 



03 

o\ 
ro 
H 



ro 

00 

ro 



U 

2 



a 

H 

u 



o 

H 
U 

< 

a 

u 
u 
< 

a 



3 

u 
u 
< 

o 
a 



.3 

u 

a 

u 
o 



3 



a 
u 

H 







O 








< 




s 




a 


o 






u 






CO 






Da 










rH 










1 h 








u 








a 








AA1 






ro 








J-* 






w 




















u 








u 
























r \ 




i-M 


















vo 






r . 










1 










o 








H 








a 


►> 






















U 


t—i 




LO 


a 






LD 






r, 
I™ 1 




< 
















u 








u 










H 
























•w 




VD 








^* 


a 




CO 






O 




H 






















a: 






DO 














S 




Q 






EC 




I> 


u 






ro 


o 








o 


U 




rH 










o 












CO 




< 





5/20 



SUBSTITUTE SHEET (RULE 26) 



WO 95/33830 



PCT/US95/07084 



U 
t7) 





1 3 




u 




1 o 


VD 


1 o 


ro 




in 


1 o 


H 






H 




r t 




O 




1 < 








< 




1 CJ 


IN 




LO 




rH 






1 < 




o 




o 




1 H 










00 


g 


iH 


r -1 


LD 


VJ 


r~ 1 






H 




O 




VU 


■ 
















Q 




LO 


3 


rH 






o 




3 








a 




u 






in 




rH 














o 




H 




O 




o 


rH 












rH 






8 











CO 





O 






1 *< 














u 














1 o 


< 




o 


o 






1 




00 




f* 










CTi 


in 


u 


a 


vo 


1 < 


M 


VD 


rH 






H 






rH 




u 






u 










VO 












Eh 


U CM 




3 


M 








ro 












u 


— 




1 ^ 








< 














u 






1 H 






r-i 


o 




in 


U 




CO 


CO 


o 




ro 


o 




CO 


in 


< 


CO 


VD 


< 


CO 


VD 


rH 






rH 






rH 
































s 


CO 




$ 


p 






u 






a 








u 














I*} 












(N 












o 




8 




C\) 


ri 




CO 


in 


s 




VO 


g 


ro 


VD 














rH 




u 






u 








u 














id! 








rH 












u 
























CO rH 






Q 








ro 












O 






o 




rH 




ro 




, 1 








in 




Ctl 


VD 


s 


W 


VD 








rH 






rH 


































fed 




t 








o 














a 














< 


















CO 


o 




rsj 


in 






O 






vo 


m 


< 




VD 


o 


> 


VD 


rH 






rH 






rH 




H 






o 








U 














O 


< 


















o 








£ 






Eh 














u 






in 






Ch 


Eh 




ro 








o% 


a 




LO 


in 




J 


LO 


Eh 


CO 


VD 


rH 






rH 






rH 




< 






£h 








u 






a 








u 






< 


H 





6/20 



SUBSTITUTE SHEET (RULE 26) 



WO 95/33830 



PCTAJS95/07084 



u 





















C5 


CO 






r i 
w 




\D 


ID 


r. 

fl 






P*- 


vJ 




00 


rH 






rH 












u 








o 








H 








O 


> 




ro 


o 




r** 








a\ 


r* 


U 




\> 


H 






rH 




o 
















< 


H 






en 
















3 


a 






a 




CO 


ro 






00 




o 


> 


r- 


rH 






rH 




a 
















< 








a 






















in 






























rH 












a 








u 








< 






ve- 


u 




O 


in 


u 






r- 


u 


cu 




rH 






H 




6 

< 
















H 








o 


> 




r- 


u 




rH 


o 








r- 




Q 




rH 






rH 












§ 










P 





CO 



u 
u 

u a* 



u 



u 
a 

o o 
a 

H ^ 
O > 



s 



a 
u 

u a< 
u 



o 

00 



in 
oo 



00 
rH 



ro 

00 



(N 
00 



in 



oo 

rH 



(5 

e 
1 

u 

H 
U 

U 
< 



H 

o 
o 



I 

u 

u 

o 
u 



ro 
cn 







© 








ro 










rH 


ft 








C^i 










rH 


u 






>* 




u 










s 






X 






















ro 


u 








o 










<n 


H 








H 


U 










a 






H 




a 






























< 










H 








A 






. 






a 




CO 


> 


































o 






o 






u 






r* 


a 








00 


o 






s 


CO 


o 


a 






H 












H 










a 






a 




H 


o 
























a 






















? 


B 








00 


O 








H 












O 






















> 






























CO 






cn 










vo 








rH 


CO 










H 








to 




o 







7/20 



SUBSTITUTE SHEET {RULE 26} 



WO 95/33830 



PCT/US95/07084 



oo 



0) 
u 



CO 




ro 


g 


0\ 




VD 




0\ 




w 




rH 


rh 


In 


s 




f$ 








w 




s 




p" 1 








£t 




5 








•2 




p" 1 






ro 


H 


ro 


8 


CO 




in 




o\ 


o 


LJ 


rH 




CM 


rfv 

CJ 








H 




U 




U 




u 








o 












cj 




< 




cj 


ro 


Ph 


ro 


H 










cn 


cd 


o 


cd 


H 


H 


CM 


cd 




< 




H 




U 




CD 




cd 




CD 




u 




H 




cd 




U 




H 




H 


ro 


CJ 


ro 


CD 


vd 


U 


ro 


H 


c* 


H 


o 


CD 


H 


U 


CM 


H 




U 




H 




H 




U 




rfl 




H 




CJ 




H 




cd 












U 


ro 


cj 


ro 


u 


in 


o 


CM 


CD 


o\ 


H 


o 


H 


rH 


cd 


CM 


H 




a 








u 








< 




H 












CD 








CD 






ro 




ro 


CD 




U 


rH 


CD 




H 


o 




H 


H 


CM 






CD 
















S 












i 




1 




CD 



ro CD 
ro CD 
cn H 
H < 
U 

3 



g 

H 
H 
U 
U 

g 

U 



ro 




ro 


Eh 


ro 


CD 


ro 


CD 


ro 


ro 


<! 


o 


CJ 


r> 


CD 




CD 


rH 






CM 


CJ 


CM 


< 


ro 


H 


<3« 


CM 




CM 


H 


CM 


u 


CM 


< 


CM 








CJ 




f— i 




< 






CD 




CD 




CJ 








H 




< 




CJ 










s 




8 




Eh 




u 






s 




1 




CD 


















Eh 




5 




ro 




ro 




ro 


CD 


ro 


S 


ro 


CM 




CTi 


ei 


vo 




ro 


a 


o 




§ 


rH 




CM 


o 


ro 






/VI 


s 


CM 


rh 

s 






CM 




CM 










s 




g 






5 

V-/ 

ro 








ri 












r ) 




ri 




r > 
^-^ 






c? 




£ 




f 




ro 














P H 




rn 

s 






rh 

CD 




r . 

r - * 












ro 




ro 


U 


ro 


u 


ro 


CD 


ro 


H 


H 


CO 


CJ 


i/> 


r . 

fc-* 


CM 


r j 


o\ 


H 


H 


H 




CM 




ro 


CJ 


ro 


CM 


CD 


CM 




CM 


CJ 


CM 


CJ 


CM 




CD 




u 




H 




H 






CD 




u 




H 




CJ 










H 




CD 




H 














H 




CJ 






CD 






E-« 




< 






CD 




< 




CJ 




CD 




ro 


H 


ro 




ro 


fS 


ro 


H 


ro 


o 


CJ 


r> 






CD 


rH 


CJ 


CO 


H 


U 


i-i 


H 


CM 


CJ 


ro 


CD 


ro 


CM 


CJ 


CM 




CM 


CJ 


CM 


< 


CM 




< 




<! 




6 




CJ 










CD 








CJ 






fS 




H 




CJ 




CJ 






CD 








CJ 




H 






CD 




$ 




CJ 




CJ 






< 




CJ 




H 




CD 




ro 


U 


ro 


CJ 


ro 


< 


ro 




ro 




rh 

w 


vo 


p* 


ro 


u 






i 






rH 


r \ 


CM 




ro 


r \ 


ro 


CM 


rh 


CM 




CM 


s 


CM 




CM 








O 




u 










T \ 

\J 




rh 




H 




r ) 






CD 








CJ 




rh 






rh 








CJ 










2 




r \ 
\J 








rh 






p** 




«« 




& 




p 1 




ro 




ro 




ro 


CJ 


ro 


u 


ro 


CO 


B 


in 


g 


CM 


CD 


o\ 


u 




o 


U 


rH 




CM 




CM 




ro 


CM 


CJ 


CM 




CM 


B 


CM 




CM 




CD 




I 




ct 




& 






CD 










H 










CD 








U 






8 




CD 














CD 




CD 




1 










H 




H 








H 




ro 


< 


ro 


CD 


ro 




ro 




ro 


r> 


H 


^* 




rH 


I 


CO 




in 


o 


CD 


H 


U 


CM 




CM 




ro 


CM 


O 


CM 


1 


CM 




CM 




CM 




a 










i 






























8 










1 






















I 




CD 










CD 








O 




CD 





ft ro 

u ^ 
CD cm 



CD 




H 


H 




H 


U 




H 


H 




H 


a 






u 






u 


ro 






ro 




1 








CM 




S2 










g 


u 






u 




U 






H 






CJ 




ro 


a 




CM 












CM 








H 


I 




U 






3 








8 




H 






H 



8/20 



SUBSTITUTE SHEET (RULE 26) 



WO 95/33830 



PCT/US95/07084 



ON 

0) 

u 



•H 



o U 

rH U 
U 

H 
U 
H 
O 
H 
H 

O U 
ro O 

H < 
H 

u 



o 

03 



O 

o 



U 

o 
u 
u 
a 

B 

O 

B 



O 

u 
u 
o 
u 

I 

rH < 

B 

u 
a 

3 

O 

O U 

I 

H 

O U 

oo e> 

3 

u 
u 

3 

U 

o 



o O 
u 

H 
H 
O 

o U 
O U 
<N U 

o 
u 

H 

U 
U 
U 

o 

o O 
C\ U 

H U 

u 
u 

H 

I 



o 

00 



o 



U 
U 

8 
I 



a 

8 

H 
U 

o U 

V£> O 

U 
H 
O 
U 
U 

a 

H 
H 
< 
O 
O 
O 



o 
in 



o U 
co U 
cm H 

% 

U 

u 



o 



H 

a 
u 
< 
o 
o 
a 



o < 

\D u 

CM O 

H 

u 

8 

o U 
in u 
cm a 

3 

u 
o 
u 

U 



o 



B 



a 

H 
U 

u 

o < 

ro U 

OJ U 

a 
a 

H 

a 
a 

o < 

cm a 

CNJ H 

H 

a 
a 
a 



o 
o 



o 

ro 



o 
ro 



O 



a) 



u 
o w 

3 s 

u 
u 

H 

u 

H 

U 
H 
H 
H 
H 
O 
H 
H 

a 
a 



o o 

oo H 
ro < 



B 

O 
H 
< 
U 
H 



S 2 

ro O 



3 

a 



H 
O 
H 
U 



O as 

U rH 

a <c 

CM U >i 

VO O rH 

^ a o 

< >1 

O rH 

O O 

< 3 

H a) 

U J 

O 3 

H Q) 

U J 

U rH 

H as 

O > 



2 5 



^ u o 



u 
o 

H 

IS 

H 



CO 
O 

Q) 
Q) 

•a 



H rH 

H as 

O > 

CN U rH 

ro H 0J 

^ O > 



rH 



B 

U 

o 

5 

U 

u 



H 

a) 

E-« 
S 
Cn 



C rH 

a o 



9/20 



SUBSTITUTE SHEET (RUL€ 26) 



WO 95/33830 PCT/DS95/07084 



CM 



0) 

u 

•H 



o 



< 






U 


a> 




rh 


UJ 










r i 


ID 


rH 




H 




CM 


§ 


>1 






rH 




u 


rH 


u 


O 




H 


a* 


VD 








C5 


© 




o 


< 


r . 

rr* 


u) 




U 


a 




VJ 


H 




rh 

8 




CM 


rh 

VJ 


r\ 

s 




rH 






CO 




O 


CD 






rH 


m 


U 




< 


M 




3 


< 






CO 




o 


O 


r- 


u 




rh 






o 






H 


o 




r . 

tr* 


t , 

H 




VJ 


CD 




rH 


vo 


a 


u 




u 






U 


<u 




O 




8 


a 


in 


u 


< 




u 


cu 




H 


CO 




u 




u 


CO 




o 






o 


G 


CM 




c 








u 


i— 1 




H 


0) 




< 


i— 1 




s 


rH 




< 


rH 


o 


< 




u 






u 


o 




U 


o 






O 


u 


i— i 




u 








- 

o 










H 


0 




as 








8 


u 




H 


a) 




u 




o 


> 








u 


0u 




a 






U 


04 




CO 








CM 


u 


01 












u 












rH 


V) 






8 






< 




s 






8 


o 


VO 


a 


< 




8 


< 






H 




CO 






CD 




u 


Cn 




u 


u 


























id! 
















S 


a: 




U 


< 








r- 


O 


o 




CO 


CM 


u 






U 


tn 


















in 








o 












H 


(J) 


a 




in 


a 


CO 




a 


< 




u 






U 




o 








c 




o 




r- 










>i 








1 


rH - 






a) 


in 




CD 








o 


o 






o 




c 




VD 


8 






o 


a 


o 






8 












o 


CJ1 






rl 


(J 


JC 






rH 










rn 






rj 




< 


H 




O 


U 




o 


O 




u 


< 






B 














H 


a) 




o 


H 




a 




< 


rH 






o 












W 




CD 


CD 


o 


o 




H 


CO 


in 










s 






CO 




0 




U 


Cn 




O 


H 




u 




CM 


u 


CQ 


^) 






O 








W 








o 




*H 


o 






o 






S 












u 


sc 




a) 


r- 


u 














a 




u 


(D 




rH 


CO 


o 


U 






rH 






CQ 




s 


rH 




M 


in 


u 


< 




u 


O 






< 






M 


o 






< 






o 




CM 


O 


0 






c 


H 


<u 






rH 




H 






u 


u 




8 


rH 


H 






o 


u 




u 






u 








o 




M 




< 






H 






H 


a) 








O 


a> 






rH 




H 


0) 




H 


rH 




< 


rH 


< 


w 




o 


u 




O 


►J 




< 


M 




CP 


o 


H 


m 




o 


as 


CM 




rl 




U 


rH 








U 


rH 




o 


iH 


GO 








H 


m 






rH 


a 


< 




o 


< 


in 


< 


H 




O 


> 






U 




CQ 




u 


CQ 




o 


ro 




U 


(0 


r- 








-H 




< 


-H 




o 


rH 




u 


rH 


CO 




rH 








u 






a 


< 




o 




VD 




O 




r< 


CM 


u 


>i 










H 


U 






ri 




a> 


CM 


o 


rH 




§ 


rH 






(D 




? 


rH 




CO 


in 


a 


O 






o 






CO 




o 


O 



10/20 



SUBSTITUTE SHEET (RUL€ 26) 



WO 95/33830 



PCT/US95/07084 



m 

CM 

<D 
U 

p 

CJ. 

•H 



u 


CD 




U 


d) 




ID 


rH 




r . 


rH 








H 


1— 1 




H 


rH 




H 


ffi 




H 






< 


CO 


< 


rH 




< 


M 


CO 


O 


> 




O 


> 




a 


<: 


CJ 






CJ 


M 




S3 


c 








CM 


CJ 






CQ 




o 


a> 






rH 






rH 


O 


H 


CD 


2 


< 




< 


CO 






a 




O 


O 


O 
i~H 


CJ 


r3 


o 


p 




CJ 


w 










r . 


M 






P 


< 




m 


a 


CD 






rH 




< 


>i 




H 


CD 


o 


o 


CO 


< 


CO 




CD 


O 




H 






a 


HH 


o 






u 






o 


CJ) 


CM 


H 


CD 






CJ) 




CD 




H 


a) 




c 








rH 




o 


U 


U 






U 






u 


< 




< 


M 




u 


< 




CO 




U 


c 




u 






CJ 


C 










*H 






CO 




rH 








CO 








0 








<C 




P 






a 


< 




< 


H 


js 






H 


CD 


CM 


u 








CD 




u 


CD 




rH 




tr 1 


r* 
•*-» 
















Fh 


rH 


3 


o 




H 




CO 


u 








M 






M 








CJ 


P 






CJ) 




Eh 


CJ) 


r- 


u 


P 


% 








fl) 




8 










CO 




CD 


3 


o 




u 






CJ 


< 




8 


< 


cn 


a 


J 


a 


CO 


CM 


u 


CD 




H 








CO 






CO 




•ri 


IN 








Fh 














*H 


u 


ac 


CO 


H 






CJ 






0 


a; 




s 


w 


u 


CO 




H 


0) 




o 




r- 


u 


CD 




o 


















rH 


CM 


L_i 


r*. 






rH 


u 


ac 




U 


< 




o 


o 


cn 


H 






o 


o 


u 






H 


CD 




<: 


m 




U 


>. 






o 


F-i 






Fh 






cj 






CO 


rH 




tj 




H 






H 






o 


< 




8 


o 




U 


a. 


U 






H 


m 






u 




o 


CJ> 




o 


rH 


V) 


CD 




Cj 






CJ 


CD 




o 


u 








s 


CO 




U 


< 


CO 


H 


CO 




< 


< 




O 


> 


o 


tJI 




H 


Jh 




CJ 


u 








CM 


o 


rH 








(j 


CD 




CJ 


0) 














s 


< 




H 


CO 




H 


CO 




§ 


a 


cn 


o 


> 


U 


rH 


r* 


CJ 


c 




U 


CD 




o 








P 


H 




o 




CO 




H 


rH 




o 








rH 


O 


> 


CO 


3 


< 




< 


H 




H 






a 


a 


U 


rl 






P 




O 


rH 


CM 








6 


03 










rH 




H 


m 


rH 


1 








rH 














U 


> 


cn 








O 


< 


u 


C 






r4 




O 






H 


0 




rt! 


0 




CO 






0) 




< 


rH 




U 


rl 




U 




% 


< 




S 


CO 










U 






U 


04 


cj 






U 




CN) 


a 


C 




CJ 


>1 




CJ 


o 


u 


rH 




U 


■C 


in 




CO 




O 


rH 




u 


u 


o 


< 




< 


H 


CO 




< 




O 


a 




u 


a* 


o 


Cn 




a 














c 






CO 


o 






o 


rH 




< 


rH 






rH 


IT) 


! 


>N 


cj 






a 


a 




o 


a 




u 


O 


cn 






u 


iH 


CN 


< 


0 




H 


o 




CJ 


a 




a 


H 




Q> 


cn 


u 


Jh 




u 


}H 




< 


CO 




H 


W 




CO 




u 






u 






o 


< 




< 





11/20 



SUBSTITUTE SHEET (RULE 26) 



WO 95/33830 



PCTAJS95/07084 



CM 
0) 

u 

V) 
-H 





iH 


o 




u 


u 




a 


CU 




CJ 


H 




CD 


0) 






CO 




cd 


rH 




H 






CD 


> 




H 






< 


CQ 




CD 


< 




H 


CD 






X3 


o 


H 


a 


rH 










)h 




B 






< 


H 
















3 


cd 




a 


a 




CD 






H 


H 






tn 




CD 






CJ 


< 


CN 




M 


ro 






O 




h 


r-l 








cd 


rH 




H 


m 




CD 


> 




r . 


c 






ID 




s 


< 




U 






g 


-H 












CQ 




8 


•H 






K 




u 




H 


H 




o 


CD 


> 


i— i 








CD 






H 


a) 




U 






< 


CD 
















o 






u 


X3 




< 





CD 3 

cd o 

H 0) 

< M 

U (0 

O U rH 

H CD < 
H 

H <D 

U J 

a >i 

S o 

H h 

< 5n 
H H 

y c 

CN < O 

cr» a rH 

O O Ou 
rH 

g c 

a o 

CD ro 

cd cd 

CD 01 

CD iH 

o < 

1> u u 

r> o x! 

o < H 



rH 



r- U U 
U) O (U 

H < CO 



0) 



8 



a cn 
a jh 
u < 



H 
H 
CJ 

U 
H 
CD 

CN 

<D o 

O U 
H CJT 



3 



> 



H rH 

< M 

cd D> 

O rH 

< < 

U rH 

H m 

cd > 

H 00 

< -H 

u a 

(n a c 

in < rH 

rH U O 
rH 

u >, 

0 rH 

a cd 

o c 

< rH 

a cd 

CJ CD 

< -H 

o aa 

u u 

cj x: 

< H 
r- O O 

n O rH 

h U < 

H 

H Jh 

cj x: 

o c 

<C rH 

a cd 



u 
u 

H 
U 



CO 



3 



OJ U CD 
C3 < -H 
H U ffi 



U 
< 

O 

O 



x; 

H 

rH 
> 





u 


iH 






m 




o 


Dl 












>i 






U 




O 


> 










u 


< 




o 






u 


as 




u 


m 




H 


<D 


r> 


u 


rH 




u 


>i 




U 


r-3 




rri 






lH 


r j 








iH 














u 








tr» 




u 


a 




H 


a) 




O 


iH 




< 


CO 




rj 






< 


< 




< 








o 




o 








CO 


H 


u 


u 




o 


rH 




§ 


>• 


f>3 


u 






u 










rH 






















in 




(J 








c: 






U 








rH 


§ 


CO 




U 


< 




u 


< 


ro 




< 














rH 








r i 








CD 




CD 


CQ 




f-l 


0) 




O 


u 










r ) 


. T 
►—I 




r » 












ri 




i 








CD 


CQ 




P 


rH 


in 








s 






a 


O 






H 




< 
























r i 


rrt 




CO 


^* 




CD 






U 


rH 




H 


CP 






rH 




a 


< 




H 


•J 












Q, 






as 




u 






o 








rH 




u 


rH 
















CD 


< 
















CD 


tn 












00 


CN 




s 


CO 




g 


-H 


O 


CD 


>H 




<: 






O 




ro 
H 


u 






o 
o 






U 


>. 




a 


c 




rH 




o 


rH 




< 


rH 




o 


O 




o 


U 




u 


CD 








CN 


o 


cn 






Sh 






<U 










u 


<U 




< 


CO 


CN 


u 


<; 






CO 








rH 














o 


>1 




o 






u 


CO 




o 


rH 




o 


rH 




< 


•H 




o 


U 




o 


KD 




u 




CN 










a 






CO 


00 


g 


rH 










s 


-H 


H 




u 














rH 




0 






CO 






CQ 




U 






s 


•H 


00 




>t 




u 






u 




CN 




rH 












rH 








< 






u 






H 


0 




H 


Q) 




o 


rH 




U 


Jh 




H 






o 


O 




U 






O 


rH 


t> 




CU 






u 




U 


a) 


CN 


H 


x: 




CD 






H 


w 


CN 


H 






< 


CO 








H 
















tj) 




U 


rH 




H 


01 






u 




U 


x: 




O 


rH 




U 


< 




< 






CJ 





.12/20 



SUBSTITUTE SHEET (fUJLE 26) 



WO 95/33830 



PCT/US95/07084 



in 

Q) 
U 

01 

-H 





ro 


rH 


1 


rl 
w 








M 




r i 


Al 
W 




ro 






H 




ro 


H 






U 


<u 




H 


rH 






rH 




O 


> 


i 


U 






H 


0) 




< 


M 






a 




r . 
M 


U> 






u 






C 


CN 


r i 


ro 




ro 


c 




H 


rH 






u 






CO 




U 


rH 






rH 




< 


M 




u 






< 


< 


U1 


O 


< 




u 


o 






£u 




r . 
M 


cu 




r i 


rH 


rH 


r, 


H 




r . 


il 


r- 


a 






H 






H 






o 


CD 




< 


> 


ro 


H 


H 






a. 




a 


> 




<: 


CQ 








H 




Qj 




CJ 


o 




rh 






KD 








c 




< 


CO 




a 


n 


00 


H 






H 


a> 




< 


to 






< 




u 






U 






U 


►h- 




a 


< 






C 




u 


CO 


tH 


u 


u 










[3 


CO 






CD 




o 


>1 




u 








rH 


00 




>1 




§ 


< 




H 


O 




< 






3 


O 


in 


a 


rJ 




CD 


a 


rg 


U 














}h 


H 


o 






ro 








CO 






rH 




rj 


f! 




FH 


w 




H 


H 




a 


< 




5 


u 






H 




u 






U 




rH 


o 








rH 


r- 


u 


0 






rH 




CD 


rH 




ro 


rH 










rj 












a 


o 




O 


o 




a 


> 


in 


U 






o 




oc 


o 


rH 






CO 








tH 


8 


rH 






rH 


VD 








g 


*H 






r — 1 




c 1 










ro 
H 


o 






0 


X 




< 


M 




O 


> 






> 




H 






u 


to 


r- 


u 


m 




H 


CO 




< 


to 






CD 




ro 






rj 


rH 




ro 










o 


< 




H 


u 


H 


o 


< 




H 


U 










u 


JH 




U 


u 






CO 




H 


CO 










o 


oj 




< 


>i 




6 


•H 




O 


>s 


r- 


< 


CO 




< 


w 




H 














U 


in 




< 




u 


<u 


r- 


U 


a> 




u 


c 




U 


m 


tH 


H 


u 




H 


x: 


o 


Eh 






< 


to 




U 


rH 










H 












a 


< 




O 








H 




U 


a 


rH 


U 


as 




u 


u 


CM 




CO 










id! 


cg 




r j 






rj 


c 




^ 






s 


rH 




O 


< 




o 


< 






H 


tn 




5" 






a 




o 








c 






M 


rH 


U 


o 






a 




H 






a 


iH 






0) 




u 


u 






CO 


ro 

H 


O 








o 




H 


CO 




u 


cu 






< 






u 






iH 




U 


c 




u 


a 




O 
















in 


% 


to 






rH 




H 


<D 






H 








H 




< 




s 


M 




O 






a 






u 






u 








Jh 


r- 










a> 






rH 




H 


0) 








in 








u 






8 


u 




U 


•J 






w 


in 








o 


u 


(N 


6 


o 




U 


to 




u 




tH 


8 






u 


0) 


o\ - 










-H 




u 


CD 






a) 




H 


w 


ro 


U 


cu 






ffi 






W 








H 






H 








u 
















H 


U 


to 






o 






r- 










H 


ro 


< 


•H 




u 








CO 






CO 




1 


W 




U 






u 


a* 






< 


^* 




< 






2 


CM 


















tH 












ro 


u 


tn 




u 


rc 




H 






a 


rH 




u 


r4 


ro 


o 






u 


rH 




U 


rH 










u 


d) 


H 


u 


< 




o 


< 




o 


< 




a 


> 




H 


03 



13/20 



SUBSTITUTE SHEET (RULE 26) 



WO 95/33830 PCTAJS95/07084 



eg 

•H 

fa 



V£> 


5 






in 
















H 


















< 




i— 1 




Eh 




r* 




< 




rH 




















< 






















H 


Eh 








r i 




VO 




U 




O 












O 




rH 




<c 








u 








o 






ro 








vo 








H 


u 








Eh 




VX> 




< 




(T» 








V£> 








H 


















CO 








o 


u 






e> 








u 


< 






u 




VO 




o 




i 00 




H 




VD 








i-l 




o 




i 




o 


rH 






o 


o 






H 


w 




rH 


O 




t 






6 




rH 






ID 




< 


>i 






o 


rH 






o 


o 


rH 














rH 






o 


o 





O 



O 

o 



rM < 



s 



8 

H 
U 
< 

u 
u 

H 

< 

U 

u 
u 

u 

U 

6 



< 
U 

6 



< 



< 
u 
u 

6 



< 

ts 

6 
6 

VD U 

I 



vr> U 

Co < 



co U 



CO 



V£> 



rH 
rH 



H 

H 
H 

u 

.a 



O Eh 





Eh 
















H 
















Eh 


















M> 


8 


VD 








in 




(N 




<Ti 








r- 


H 


CO 




CO 








rH 




rH 




rH 










Eh 
















U 




H 
















u 












3 




< 












U 




o 
















Eh 










V£> 


U 


V£> 


< 


VO 












rH 


H 


CO 








r- 




CO 


H 


CO 


H 




a 


rH 




rH 




rH 


O 












S 




O 








H 




H 












H 




H 












u 




U 








o 




U 




U 








o 




H 




< 




s 




u 


VX) 


H 


V£> 


o 








< 


ro 


U 


O 


H 


r* 






8 


r- 


CD 


CO 


H 


CO 








H 


H 


H 


U 


rH 




rH 






U 




U 
























a 












I 




a 




1 




H 
























H 
















U 



14/20 



SUBSTITUTE SHEET (RULE 26) 



WO 95/33830 



PCT/US9S/07084 



0) 

u 
tn 



00 




iH 


CD tn 

CD U 
< < 


CD «C o 

CJ H H 

CD < i 


CJ to 

< -rl 

CJ ffi 


CD C 
**** " 
CJ CD 


w rn 

CD <C 


CJ M 
CD (U 
< CO 


< o 

r * 1 1 

U 04 


CD rH 
fcH <U 

CD > 


U Sin 

W r— 1 

CD O 


H m 

O < 


cj to 

fl, mH 
CJ ffi 


H rc 

w r~ i 

CD < 


CD M o 
CJ »C ro 
<H > 


CD m 

C rH 

CD < 


CD >* 

\y l—t 

CD CD 


CD tn 
CD i-i 
< < 


CD i-> in 

H fl) H 

< £ • 


CJ «J 

(J fH 

CD < 


< O 

u u 
CJ cu 


CD tn 

CD l"i 

u 4 


CJ Jh H 
CD O 
< CO 


E-t tO 
CD >i 
H U 


< M 

cj *c 


CD tn 

CD ^ 
< 4 


CJ H 
CD (!) 
< CO 


O tn 
CD in 
< < 


CQ 

< (4 


< C>in 
CD ^ m 

< 4 ' 


CD tn 
CD u 
< < 


CD cn 

CD U 
U < 


< U 

CJ d> 
H. CO 


CD M o 

U & CN 
< H I 


CD Cn 
CD U 
< < 


CJ CO 
CD >i 
H U 


CJ rH 

H m 

CD > 


cj m in 

U rH 1 

CD 4 


CD 3 

<rH 

CD CD 


< tc 

CJ rH 

CD < 


< 2 

Eh Q) 

h a 


< tn 

CD U 

< < 


< tn 
CD U 

< < 


a x: 

< H 


< u o 

U rjt 

< H i 


CD rH 
H fTJ 
CD > 


CD V4 
U CD 
Eh CO 


< <H 

CD * ^ 
Eh « 


CD G m 

4 rH CN 

CJ CD i 


CD >, 

CD rH 

CD CD 



CN 



u a 

< to 
CD < 

8& 

H Eh 
CJ >i 

CD rH 

CD CD 
U (D o 

H »H (N 

u a 

< to 
CD < 

CD 3 

< rH 

CD CD 
CJ 0) 

h x; 

U C 

< rH in 
H (TJ iH 

CD > 

CD tn 

CD U- 

u < 
a s 

Eh 0) 
CJ tJ 

CJ u 
CJ Q) 
H CO 

CJ U 
V £ 

< H 

CD CQ o 

2S H 



o 

CN 



CD 



H CO 



CJ >, 
CD CD 



CD CO 

Eh CO 
CD 

H CJ 
CD 0 

< rH 

CD CD 

CJ Jh in 
< 

Eh H 

U (U 

U rH 

CD < 

2^ 

CD CD 
Eh U 
Eh H 
CD 3 

< rH 

CD CD 
CD to o 

CJ o 
CJ M 

cj a* 

< f0 

U rH 

CD < 

H o 

H rH 

< w 

CJ 0) 

H rH 

< M 

CD D*in 
CD U cm 

u n 

CD O 

< CO 



CO 
CN 



H m in 
cj rH in 



m 
m 



CD CO 

*S 

CJ >iO 

O >-h r> 
CD CD 

O rH 
H CO 

CD > 
CD to 

< Eh 

CJ o 
CJ u 

CJ 04 

CJ <l) in 
H £ vr> 
H O, 

CD co 

35 

a ? 

£h Q) 
CJ iJ 

E-* to 

< -h 
U X 



a) 
m 



O 
H 
CD 

CD 
H 
U 



rd 
> 

ZJ o 

O V£> 



U k 

< Eh 

o c 

< rH 

CJ tD 

CD rH 

H m 
o > 

cj a> 

H rH 

< M 



CN 

m 



U Jh 
CD 0) 

< CO 

CD JJ 
H CJJ 

< 2 

CJ >• 
CD rH 

CD CD 
CD 3 o 
O CD H 

U H 

< >^ 
H Eh 

H co 
CJ tc 

CJ iH 

< >^ 

H Eh 
O CQ 

25 



o 



CJ 



O m 

CD C\ 



XJ u 
CJ x 

< Eh 



CD rH 
H ffj 

a > 

CD 

CD rH 

CD CD 

CD 4-> O 



< 

CD 



to 

< 

to 



CD < 



CD 
CD 
CD 
CJ 
CD 

H 

CJ 

CJ 
CD 
H 

a 

£h 
Eh 

CD tno 

CD JH iH 

< < rH 

U CQ 

CD >t 
H CJ 

<D 

CD rH 
CD CD 

H to 

a 

*H cj 
O 3 

< rH 

CD CD 

< <0 in 

CJ rH O 
CD < rH 

O rH 

H cd 

CD > 



15/20 



SUBSTITUTE SHEET {RULE 56) 



WO 95/33830 



PCT/US95/07084 



Figure 4 



2.5 



1.5 - 



1 - 



SULFATE INCORPORATION 
Bovine Explants 




n=5 BMP* 

n=3 IGF-t.bFGF 

n=1 TGFB 

'=0it1oronl lhan conird (p<0.05) 



1 fl§OnJ 



10 a^/ml 
log doM 



100 o^mJ 



BMP-2 B 

BMP-6 **— 
(QF-I 

TGR3 



flMP-4 — B- 

bmp-s — o- 

tR3F — ^E- 



16/20 

SUBSTITUTE SHEET (RULE 26) 



WO 95/33830 



PCT/US95/07084 




SUBSTITUTE SHEET (RULE 26) 



WO 95/33830 



PCTAJS95/07084 



Figure 6/1 



c 
o 

CD 
O 

o 9> 
- £ 

CD CL 
C O 

is % 

E - 



I 

CO 



200 



150 



100 



t, 50 - 




_L 



0.1 10 
BMP-9 (ng/ml) 



1000 



18/20 



SUBSTITUTE SHEET (RULE 26) 



WO 95/33830 



PCT/US95/07084 



Figure 6/2 




BMP-9 (ng/ml) 



19/20 

SUBSTITUTE SHEET (RULE 26) 



WO 95/33830 



PCT/US95/07084 




EGF 
BMP- 9 
TGF-B 



20/20 



SUBSTITUTE SHEET (ftULE 26) 



INTERNATIONAL SEARCH REPORT 


f_-i_ j xfiju l>I AtmlicAtif O 

uternauonai /*ppi'** w * 

PCT/US 95/07084 


tp?T ,n cf2 O NlIHr CT C0 A 7Tl R 4/51 A61K38/18 

According to International Patent Classification (IPC) or tt) both national classification and IPC 


B. FIELDS SEARCHED — 


Minimum documentation searched (classification system followed by classification symbols) 

IPC 6 C07K C12N A61K 


Documentation searched other than minimum documentation to the extent that such documents are included in the fields searched 


' Electronic data base consulted during the mternauonal search (name of data base and, where practical, search terms used) 


C. DOCUMENTS CONSIDERED TO BE RELEVANT _. * 




Category" 


Otation of document, with indication, where appropriate, ofihe relevant passages 


Relevant to claim No. 


X 
Y 
Y 


WO, A, 93 00432 (GENETICS INST) 7 January 
1993 

see the whole document 

WO, A, 94 06449 (CREATIVE BIOMOLECULES INC) 

31 March 1994 

see the whole document 

-/-- 


7,8, 

11-18,22 
20,21 

20,21 




her ctocuments arc listed in the continuation of box C. [x] Patent members are listed m annex 


• Special categories of cited documents : -r- lfttCT document published after the international filing date 

or priority date and not in conflict with the application but 
'A* document defining the general state of the art which is not cited to understand the principle or theory underlying the 

considered to be of particular relevance invention 
•E' earlier document but published on or after the international *X* document of particular relevance; the daimed invention 

fi^£date cannot be considered novel or cannot be considered to 
•L- document which may throw doubts on priority daimfs) or involve an inventive step when the oocument is taken alone 

which is cited to establish (he publication date of another *y document of particular relevance; the daimed invention 

citation or other special reason (as specified) cannot be considered to involve an mventiye step whenthe 
•O- document Nfentai «o «, era. di.do.ur,. use, exhibition or tS^SSSS^Z^^^Sm 

other means in the art. 


D«tc of the actual completion of (be international Karen 

18 October 1995 


16.11 .95 


Name and mailing address of the ISA 

European Patent Office, P.B. 581 8 Patentlaan 2 
NL - 2280 HV RJjswijk 
Td.(-r 31.70) 340-2040, Tx. 31 651 eponl, 
Fax (+31-70) 340-3016 


Authorized officer 

Andres, S 



Form PCT/ISA/310 (second ihcat) (July 1992) 



page 1 of 2 



INTERNATIONAL SEARCH REPORT 

PCT/US 95/07084 


^Continuation) DOCUMENTS CONSIDERED TO BE RELEVANT 




Category* 


Gtation of document, with indication, where appropriate, of the relevant passages 




0,P, 
X 


MOLECULAR BIOLOGY OF THE CELL, 
vol. 5, October 1994 
page 384a 

SONG, J. ET AL. 'Bone morphogenetic 
protein-9 (BMP-9) binds to HEPG2 cells and 
stimulates proliferation 1 
see abstract 

& 34th Ann. Meet, of the American Soc. for 
Cell Biol.; december 10-14, 1994; 
San Francisco, California 


20,21 



Form PCTASA/MO (continuttion of ucontf thotlMJuly 19H> 



page 2 of 2 



INTERNATIONAL SEARCH REPORT 



International application No. 

PCT/US 95/ 07084 



Box I Observations where certain claims were found unsearchable (Continuation of item 1 of first sheet) 



Thii international search report has not been established in respect of certain claims under Article 17(2X») for the following reasons: 
1. [X] Claims Nos.: 

because they relate to subject matter not required to be searched by this Authority, namely: 

Remark: Although claims 16,18,21 are directed to a method of treatment of 

the human/animal body, the search has been carried out and based on the 
aaleged effects of the compound/composition. 

X | X | Claims Nbs^ 

because they relate to parts of the international application that do not comply with the prescribed requirements to such 
an extent that no meaningful international search can be carried out, specifically: 

Claim 11 referlng to a DNA sequence encoding BMP-8, has been Interpreted 
as being meant to refer to BMP-9! 

. | | Claims Nos.: 

because they arc dependent claims and are not drafted in accordance with the second and third sentences of Rule 6.4(a). 



Box II Observations where unity of invention is lacking (Continuation of item 2 of first sheet) 



This International Searching Authority found multiple inventions in this international application, as follows: 



| | As all required additional search fees were timely paid by the applicant, this international search report covers all 
searchable claims. 

| 1 As all searchable claims could be searches without effort justifying an additional fee, this Authority did not invite payment 
of any additional fee. 



| | As only some of the required additional search fees were timely paid by the applicant, this international search report 
covers only those claims for which fees were paid, specifically claims Nosj 



| | No required additional search fees were timely paid by the applicant Consequently, this international search report is 
restricted to the invention first mentioned in the claims; it is covered by claims Nos- 



Remark on Protest | | The additional search fees were accompanied by the applicant's protest. 

| | No protest accompanied the payment of additional search fees. 



Form PCT/ISA/2J0 {continuation of first sheet (1)) (July 1992) 



INTERNATIONAL SEARCH REPORT 



Internationa] Appticatir "o 

PCT/US 95/07084 



Patent document 
cited in search report 



Publication 
date 



Patent family 
member(s) 



Publication 
date 



WO-A-9300432 



07-01-93 



W0-A-9406449 



31-03-94 



AU-B- 


652472 


25-08-94 


AU-A- 


2269992 


25-01-93 


EP-A- 


0592562 


20-04-94 


JP-T- 


6508990 


13-10-94 


AU-B- 


4795193 


03-03-94 


AU-B- 


4797193 


03-03-94 


AU-B- 


4995593 


03-03-94 


AU-B- 


5129293 


12-04-94 


AU-B- 


5129393 


12-04-94 


AU-B- 


5162393 


12-04-94 


AU-B- 


5290893 


12-04-94 


AU-B- 


5590094 


24-05-94 


CA-A- 


2141554 


17-02-94 


CA-A- 


2141555 


17-02-94 


CA-A- 


2141556 


17-02-94 


CA-A- 


2147598 


11-05-94 


EP-A- 


0652953 


17-05-95 


EP-A- 


0653942 


24-05-95 


EP-A- 


0661933 


12-07-95 


EP-A- 


0665739 


09-08-95 


EP-A- 


0661987 


12-07-95 


EP-A- 


0672064 


20-09-95 


W0-A- 


9403600 


17-02-94 


W0-A- 


9403075 


17-02-94 


W0-A- 


9403200 . 


17-02-94 


WO-A- 


9406447 


31-03-94 


WO-A- 


9406399 


31-03-94 


WO-A- 


9406420 


31-03-94 


WO-A- 


9410203 


11-05-94 



Form PCT/ISA/210 (psunt Orally tnnw) (July 1992) 



This Page is Inserted by IFW Indexing and Scanning 
Operations and is not part of the Official Record 

BEST AVAILABLE IMAGES 

Defective images within this document are accurate representations of the original 
documents submitted by the applicant. 

Defects in the images include but are not limited to the items checked: 

□ BLACK BORDERS 

□ IMAGE CUT OFF AT TOP, BOTTOM OR SIDES 
□f FADED TEXT OR DRAWING 

Gif BLURRED OR ILLEGIBLE TEXT OR DRAWING 

□ SKEWED/SLANTED IMAGES 

□ COLOR OR BLACK AND WHITE PHOTOGRAPHS 

□ GRAY SCALE DOCUMENTS 

□ LINES OR MARKS ON ORIGINAL DOCUMENT 

□ REFERENCE(S) OR EXHIBIT(S) SUBMITTED ARE POOR QUALITY 

□ OTHER: 

IMAGES ARE BEST AVAILABLE COPY. 
As rescanning these documents will not correct the image 
problems checked, please do not report these problems to 
the IFW Image Problem Mailbox.