Skip to main content

Full text of "USPTO Patents Application 09804625"

See other formats


WORLD INTELLECTUAL PROPERTY ORGANIZATION 
Internationa) Bureau 




PCT 

INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) 



(51) International Patent Classification 6 : 

C12N 15/12, 15/70, 15/62, 1/21, C07K 
14/51 



A2 



(11) International Publication Number: WO 95/16035 

(43) Internationa] Publication Date: 15 June 1995 (15.06.95) 



(21) International Application Number: PCT/US94/I4030 

(22) International Filing Date: 6 December 1994 (06.12.94) 



(30) Priority Data: 

08/164,103 
08/217,780 
08/333,576 



7 December 1993 (07.12.93) US 
25 March 1994 (25.03.94) US 
2 November 1994 (02.1 1.94) US 



(71) AppUcants: GENETICS INSTITUTE, INC. [US/US]; 87 

CambridgePark Drive, Cambridge, MA 02140 (US). 
PRESIDENT AND FELLOWS OF HARVARD COLLEGE 
[US/US]; 17 Quincy Street, Cambridge, MA 02139 (US). 

(72) Inventors: CELESTE, Anthony, J.; 86 Packard Street, Hudson, 

MA 01749 (US). WOZNEY, John, M.; 59 Old Bolton Road, 
Hudson, MA 01749 (US). ROSEN, Vicki, A.; 127 Kilsyth 
Road #7, Brookline, MA 02146 (US). WOLFMAN, Neil, 
M.; 30 Rolling Lane, Dover, MA 02030 (US). THOMSEN, 
Gerald, H.; 201 Bayview Terrace, Port Jefferson, NY 11777 
(US). MELTON, Douglas, A.; 22 Slocum Road, Lexington, 
MA 02173 (US). 



(74) Agent- LAZAR, Steven, R.; Genetics Institute, Inc., 
CambridgePark Drive, Cambridge, MA 02140 (US). 



87 



(81) Designated States: AU, CA, CN, FI, HU, JP, KP, KR, NO, 
RU, European patent (AT, BE, CH, DE, DK, ES, FR, GB, 
GR, IE IT, LU, MC, NL, PT, SE), OAPI patent (BF, BJ, 
CF, CG, CI CM, GA, GN, ML, MR, NE, SN, TD, TG). 



Published 

Without international search report and to be republished 
upon receipt of that report 



(54) Title: BMP-12, BMP-13 AND TENDON-INDUCING COMPOSITIONS THEREOF 
(57) Abstract 



Bone morohogenetic proteins BMP-12 and BMP-13 have been cloned. Compositions of these proteins with tendon/ligament-like 
tissue inducing activity are disclosed. The compositions are useful in the treatment of tendinitis and tendon or ligament defects and in 
related tissue repair. 



FOR THE PURPOSES OF INFORMATION ONLY 



Codes used to identify States party to the PCT on the front pages of pamphlets publishing international 
applications under the PCT. 



AT 


Austria 


GB 


United Kingdom 


MR 


Mauritatia 


AU 


Australia 


GE 


Georgia 


MW 


Malawi 


BB 


Barbados 


GN 


Guinea 


NE 


Niger 


BE 


Belgian 


GR 


Greece 


NL 


Netherlands 


BF 


Burkina Fuo 


HU 


Hungary 


NO 


Norway 


BG 


Bulgaria 


IE 


Ireland 


NZ 


New Zealand 


BJ 


Benin 


rr 


Italy 


PL 


Poland 


BR 


Brazil 


JP 


Japan 


PT 


Portugal 


BV 


Belarus 


KE 


Kenya 


RO 


Romania 


CA 




KG 


Kyrgystan 


RU 


Russian Federation 


CF 


Central African Republic 


KP 


Democratic People's Republic 


SD 


Sudan 


CG 


Congo 




of Korea 


SE 


Sweden 


CH 


Switzerland 


KR 


Republic of Korea 


SI 


Slovenia 


a 


Cote d'lvohx 


KZ 


Kazakhstan 


SK 


Slovakia 


CM 


Cameroon 


U 


Liechtenstein 


SN 


Senegal 


CN 


China 


LK 


Sri Lanka 


TD 


Chad 


CS 


Czechoslovakia 


. LU 


Luxembourg 


TG 


Togo 


CZ 


Czech Republic 


LV 


Latvia 


TJ 


Tajikistan 


DE 


Gennany 


MC 


Monaco 


TT 


Trinidad and Tobago 


DK 


Denmark 


MD 


Republic of Moldova 


UA 


Ukraine 


ES 


Spain 


MG 


Madagascar 


US 


United States of Amc 


n 




ML 


Mali 


UZ 


Uzbekistan 


FR 


Ranee . 


MN 


Mongolia 


VN 


Viet Nam 


GA 


Gabon 











WO 95/16035 



PCT/US94/14030 



TITLE OF THE INVENTION 

BMP- 12, BMP-13 AND TENDON-INDUCING COMPOSITIONS THEREOF 

5 RELATED APPLICATIONS 

The present invention is a continuation-in-part of application serial number 
08/217,780, filed March 25, 1994, 08/164,103, filed on December 7, 1993 and 
08\333,576, filed on November 2, 1994. 

FIELD OF THE INVENTION 

10 The present invention relates to a novel family of purified proteins, and 

compositions containing such proteins, which compositions are useful for the 
induction of tendon/ligament-like tissue formation, wound healing and ligament and 
other tissue repair. These proteins may also be used in compositions for augmenting 
the activity of bone morphogenetic proteins. 

15 BACKGROUND OF THE INVENTION 

The search for the molecule or molecules responsible for formation of bone, 
cartilage, tendon and other tissues present in bone and other tissue extracts has led 
to the discovery of a novel set of molecules called the Bone Morphogenetic Proteins 
(BMPs). The structures of several proteins, designated BMP-1 through BMP-11, 

20 have previously been elucidated. The unique inductive activities of these proteins, 
along with their presence in bone, suggests that they are important regulators of bone 
repair processes, and may be involved in the normal maintenance of bone tissue. 
There is a need to identify additional proteins which play a role in forming other 
vital tissues. The present invention relates to the identification of a family of 

25 proteins, which have tendon/ligament-like tissue inducing activity, and which are 
useful in compositions for the induction of tendon/ligament-like tissue formation and 
repair. 

SUMMARY OF THE INVENTION 

In one embodiment, the present invention comprises t)NA molecules 
30 encoding a tendon/ligament-like inducing protein which the inventors have named 
Vl-1. This novel protein is now called BMP-12. The present invention also 
includes DNA molecules encoding BMP-12 related proteins. 



WO 95/16035 



PCT/US94/14030 



BMP-12 related proteins are a subset of the BMP/TGF-/S/Vg-1 family of 
proteins, including BMP-12 and VL-1, which are defined as tendon/ligament-like 
tissue inducing proteins encoded by DNA sequences which are cloned and identified, 
e.g., using PCR, using BMP-12 specific primers, such as primers #6 and #7 
5 described below, with reduced stringency conditions. It is preferred that the DNA 
sequences encoding BMP-12 related proteins share at least about 80% homology at 
the amino acid level from amino acids with amino acids #3 to #103 of SEQ ID 
NO:l. 

The DNA molecules preferably have a DNA sequence encoding the BMP-12 

10 protein, the sequence of which is provided in SEQ ID NO:l, or a BMP-12 related 
protein as further described herein. Both the BMP-12 protein and BMP-12 related 
proteins are characterized by the ability to induce the formation of tendon/ligament- 
like tissue in the assay described in the examples. 

The DNA molecules of the invention preferably comprise a DNA sequence, 

15 as described in SEQUENCE ID NO:l; more preferably nucleotides #496 to #882, 
#571 to #882 or #577 to #882 of SEQ ID NO: 1 ; or DNA sequences which hybridize 
to the above under stringent hybridization conditions and encode a protein which 
exhibits the ability to form tendon/ligament-like tissue. The DNA molecules of the 
invention may also comprise a DNA sequence as described in SEQ ID NO: 25; more 

20 preferably nucleotides #604 or #658 to #964 of SEQ ID NO:25. 

The DNA molecules of the invention also include DNA molecules comprising 
a DNA sequence encoding a BMP-12 related protein with the amino acid sequence 
shown in SEQ ID NO:2 or SEQ ID NO:26, as well as naturally occurring allelic 
sequences and equivalent degenerative codon sequences of SEQ ID NO:2 or SEQ 

25 ID NO:26. Preferably, the DNA sequence of the present invention encodes amino 
acids #-25 to # 104, #1 to # 104 or #3 to #103 of SEQ ID NO:2; or amino acids #1 
to #120 or #19 to #120 of SEQ ID NO:26. The DNA sequence may comprise, in 
a 5* to 3' direction, nucleotides encoding a propeptide, and nucleotides encoding for 
amino acids #-25 to #104, #1 to #104 or #3 to #103 of SEQ ID NO:2; or amino 

30 acids #1 to #120 or #19 to #120 of SEQ ID NO:26. The propeptide useful in the 
above embodiment is preferably selected from the group consisting of native BMP-12 
propeptide and a protein propeptide from a different member of the TGF-B 



WO 95/16035 



PCT/US94/14030 



superfamily or BMP family. The invention further comprises DNA sequences which 
hybridize to the above DNA sequences under stringent hybridization conditions and 
encode a BMP-12 related protein which exhibits the ability to induce formation of 
tendon/ligament-like tissue. 

5 In other embodiments, the present invention comprises host cells and vectors 

which comprise a DNA molecule encoding the BMP-12 protein, or a BMP-12 related 
protein. The host cells and vectors may further comprise the coding sequence in 
operative association with an expression control sequence therefor. 

In another embodiment, the present invention comprises a method for 

10 producing a purified BMP-12 related protein, said method comprising the steps of 
culturing a host cell transformed with the above DNA molecule or vector comprising 
a nucleotide sequence encoding a BMP-12 related protein; and (b) recovering and 
purifying said BMP-12 related protein from the culture medium. In a preferred 
embodiment, the method comprises (a) culturing a cell transformed with a DNA 

15 molecule comprising the nucleotide sequence from nucleotide #496, #571 or #577 
to #879 or #882 as shown in SEQ ID NO: 1; or the nucleotide sequence from #604 
or #658 to #963 of SEQ ID NO:25; and 

(b) recovering and purifying from said culture medium a protein comprising 
the amino acid sequence from amino acid #-25, #1 or #3 to amino acid #103 or #104 

20 as shown in SEQ ID NO:2; or from amino acid #1 or #19 to amino acid #120 as 
shown in SEQ ID NO:26. The present invention also includes a purified protein 
produced by the above methods. 

The present invention further comprises purified BMP-12 related protein 
characterized by the ability to induce the formation of tendon/ligament-like tissue. 

25 The BMP-12 related polypeptides preferably comprise an amino acid sequence as 
shown in SEQ ID NO:2. The polypeptide more preferably comprise amino acids 
#-25, #1 or #3 to #103 or #104 as set forth in SEQ ID NO:2; or amino acids #1 or 
#19 to #120 as set forth in SEQ ID NO:26. In a preferred embodiment, the purified 
polypeptide may be in the form of a dimer comprised of two subunits, «ach with the 

30 amino acid sequence of SEQ ID NO:2. 

In another embodiment, the present invention comprises compositions 
comprising an effective amount of the above-described BMP-12 related proteins. 



WO 95/16035 



PCT/US94/14030 



In the compositions, the protein may be admixed with a pharmaceutical^ acceptable 
vehicle. 

The invention also includes methods for tendon/ligament-like tissue healing 
and tissue repair, for treating tendinitis, or other tendon or ligament defects, and for 
5 inducing tendon/ligament-like tissue formation in a patient in need of same, 
comprising administering to said patient an effective amount of the above 
composition. 

Other embodiments include chimeric DNA molecules comprising a DNA 
sequence encoding a propeptide from a member of the TGF-0 superfamily of 

10 proteins linked in correct reading frame to a DNA sequence encoding a BMP- 12 
related polypeptide. One suitable propeptide is the propeptide from BMP-2. The 
invention also includes heterodimeric protein molecules comprising one monomer 
having the amino acid sequence shown in SEQ ID NO:2, and one monomer having 
the amino acid sequence of another protein of the TGF-j3 subfamily. 

15 Finally, the present invention comprises methods for inducing 

tendon/ligament-like tissue formation in a patient in need of same comprising 
administering to said patient an effective amount of a composition comprising a 
protein which exhibits the ability to induce formation of tendon/ligament-like tissue, 
said protein having an amino acid sequence shown in SEQ ID NO:2 or SEQ ID 

20 NO:4 or SEQ ID NO:26. The amino acid sequences are more preferably one of the 
following: (a) amino acids #-25, #1 or #3 to #103 or #104 of SEQ ID NO:2; (b) 
amino acids #1 or #19 to #1 19 or #120 of SEQ ID NO:4; (c) amino acids #1 or #19 
to #119 or #120 of SEQ ID NO:26; (d) mutants and/or variants of (a), (b) or (c) 
which exhibit the ability to form tendon and/or ligament. In other embodiments of 

25 the above method, the protein is encoded by a DNA sequence of SEQ ID NO:l, 
SEQ ID NO:3 or SEQ ID NO:25, more preferably one of the following: (a) 
nucleotides #496, #571 or #577 to #879 or #882 of SEQ ID NO:l; (b) nucleotides 
#845 or #899 to #1201 or #1204 of SEQ ID NO:3; (c) nucleotides #605 or #659 to 
#961 or #964 of SEQ ID NO:25; and (d) sequences which hybridize to (a) or (b) 

30 under stringent hybridization conditions and encode a protein which exhibits the 
ability to form tendon/ligament-like tissue. 
Description of the Sequences 



WO 95/16035 



PCT/US94/14030 



SEQ ID NO:l is the nucleotide sequence encoding the human BMP-12. 

SEQ ID NO:2 is the amino acid sequence comprising the mature human 
BMP-12 polypeptide. 

SEQ ID NO: 3 is the nucleotide sequence encoding the protein MP52. 
5 SEQ ID NO:4 is the amino acid sequence comprising the mature MP52 

polypeptide. 

SEQ ID NO: 5 is the nucleotide sequence of a specifically amplified portion 
of the human BMP-12 encoding sequence. 

SEQ ID NO: 6 is the amino acid sequence encoded by the nucleotide sequence 
10 of SEQIDNO:5. 

SEQ ID NO: 7 is the nucleotide sequence of a specifically amplified portion 
of the human VL-1 encoding sequence. 

SEQ ID NO: 8 is the amino acid sequence encoded by the nucleotide sequence 
of SEQ ID NO:7. 

15 SEQ ID NO:9 is the nucleotide sequence of the plasmid pALVl-781, used 

for expression of BMP-12 in E. coli. 

SEQ ID NO: 10 is the nucleotide sequence of a fragment of the murine clone, 

mVL 

SEQ ID NO: 11 is the amino acid sequence of a fragment of the murine 
20 protein encoded by mVl . 

SEQ ID NO: 12 is the nucleotide sequence of a fragment of the murine clone, 

mV2. 

SEQ ID NO: 13 is the amino acid sequence of a fragment of the murine 
protein encoded by mV2. 
25 SEQ ID NO: 14 is the nucleotide sequence of a fragment of the murine clone, 

mV9. 

SEQ ID NO: 15 is the amino acid sequence of a fragment of the murine 

protein encoded by mV9. 

SEQ ID NO: 16 is the amino acid sequence of a BMP/TGF-0/Vg-l protein 

30 consensus sequence. The first Xaa represents either Gin or Asn; the second Xaa 

represents either Val or He. 

SEQ ID NO: 17 is the nucleotide sequence of oligonucleotide #1. 

<2^ 



WO 95/16035 



PGT/US94/14030 



SEQ ID NO: 18 is the amino acid sequence of a BMP/TGF-jS/Vg-l protein 
consensus sequence. The Xaa represents either Val or Leu. 

SEQ ID NO: 19 is the nucleotide sequence of oligonucleotide #2. 

SEQ ID NO:20 is the nucleotide sequence of oligonucleotide #3. 
5 SEQ ID NO:21 is the nucleotide sequence of oligonucleotide #4. 

SEQ ID NO:22 is the nucleotide sequence of oligonucleotide #5 

SEQ ID NO:23 is the nucleotide sequence of oligonucleotide #6. 

SEQ ID NO:24 is the nucleotide sequence of oligonucleotide #7. 

SEQ ID NO:25 is the nucleotide sequence of the human VL-1 (BMP-13) 
10 encoding sequence. 

SEQ ID NO:26 is the amino acid sequence encoded by the nucleotide 
sequence of SEQ ID NO:25. 

SEQ ID NO: 27 is the nucleotide sequence encoding a fusion of BMP-2 
propeptide and the mature coding sequence of BMP- 12. 
15 SEQ ID NO:28 is the amino acid sequence encoded by the nucleotide 

sequence of SEQ ID NO:27. 

SEQ ID NO:29 is the nucleotide sequence encoding the murine mVl protein. 
X01 is Val, Ala, Glu or Gly; X02 is Ser, Pro Thr or Ala; X03 is Ser or Arg; X04 
is Leu, Pro, Gin or Arg; X05 is Cys or Trp; X06 is Val, Ala, Asp or Gly; X07 is 
20 Val, Ala, Glu or Gly; X08 is Gin, Lys or Glu. 

SEQ ID NO: 30 is the amino acid sequence encoded by the nucleotide 
sequence of SEQ ID NO:29. X01 through X08 are the same as in SEQ ID NO: 29. 

SEQ ID NO:31 is the nucleotide sequence encoding the murine mV2 protein. 
X01 is Pro or Thr; X02 is Val. 
25 SEQ ID NO:32 is the amino acid sequence encoded by the nucleotide 

sequence of SEQ ID NO:31. X01 and X02 are the same as in SEQ ID NO:31. 

SEQ ID NO:33 is the nucleotide sequence encoding human BMP-12 protein. 

SEQ ID NO: 34 is the amino acid sequence encoded by the nucleotide 
sequence of SEQ ID NO:33. 
30 SEQ ID NO:35 is the nucleotide sequence of oligonucleotide #8. 

Brief Description of the Figures 

Figure 1 is a comparison of the human BMP-12 and human MP52 sequences. 



WO 95/16035 



PCT/US94/14030 



Detailed Description of the Invention 

The DNA sequences of the present invention are useful for producing proteins 
which induce the formation of tendon/ ligament-like tissue, as described further 
below. The DNA sequences of the present invention are further useful for isolating 

5 and cloning further DNA sequences encoding BMP- 12 related proteins with similar 
activity. These BMP-12 related proteins may be homologues from other species, 
or may be related proteins within the same species. 

Still, a further aspect of the invention are DNA sequences coding for 
expression of a tendon/ligament-like tissue inducing protein. Such sequences include 

10 the sequence of nucleotides in a 5' to 3' direction illustrated in SEQ ID NO:l or 
SEQ ID NO:25, DNA sequences which, but for the degeneracy of the genetic code, 
are identical to the DNA sequence SEQ ID NO:l or 25, and encode the protein of 
SEQ ID NO: 2 or 26. Further included in the present invention are DNA sequences 
which hybridize under stringent conditions with the DNA sequence of SEQ ID NO: 1 

15 or 25 and encode a protein having the ability to induce the formation of tendon or 
ligament. Preferred DNA sequences include those which hybridize under stringent 
conditions as described in Maniatis et al, Molecular Cloning (A Laboratory Manual) , 
Cold Spring Harbor Laboratory (1982), pages 387 to 389. Finally, allelic or other 
variations of the sequences of SEQ ID NO:l or 25, whether such nucleotide changes 

20 result in changes in the peptide sequence or not, but where the peptide sequence still 
has tendon/ligament-like tissue inducing activity, are also included in the present 
invention. 

The human BMP-12 DNA sequence (SEQ ID NO: 1) and amino acid sequence 
(SEQ ID NO:2) are set forth in the Sequence Listings. Another protein that is useful 

25 for the compositions and methods of the present invention is VL-1 . VL-1 is a BMP- 
12 related protein which was cloned using sequences from BMP-12. The inventors 
have now designated VL-1 as BMP-13. A partial DNA sequence of VL-1 (SEQ ID 
NO:7) and the encoded amino acid sequence (SEQ ID NO: 8); as well as a DNA 
sequence encoding the mature VL-1 (SEQ ID NO:25) and the encoded amino acid 

30 sequence (SEQ ID NO: 26) are set forth in the Sequence Listings. Although further 
descriptions are made with reference to the BMP-12 sequence of SEQ ID NO:l and 
2, it will be recognized that the invention includes similar modifications and 



WO 95/16035 



PCTAJS94/14030 



improvements which may be made to other BMP- 12 related sequences, such as the 
VL-1 sequence shown in SEQ ID NO:25 and 26. 

The sequence of BMP- 12 shown in SEQ ID NO. 1 includes the entire mature 
sequence and approximately 190 amino acids of the propeptide. The coding 

5 sequence of the mature human BMP- 12 protein appears to begin at nucleotide #496 
or #571 and continues through nucleotide #882 of SEQ ID NO: 1 . The first cysteine 
in the seven cysteine structure characteristic of TGF-/3 proteins begins at nucleotide 
#577. The last cysteine ends at #879. Thus, it is expected that DNA sequences 
encoding active BMP- 12 species will comprise nucleotides #577 to #879 of SEQ ID 

10 NO:l. 

It is expected that BMP- 12, as expressed by mammalian cells such as CHO 
cells, exists as a heterogeneous population of active species of BMP- 12 protein with 
varying N-termini. It is expected that all active species will contain the amino acid 
sequence beginning with the cysteine residue at amino acid #3 of SEQ ID NO: 2 and 

15 continue through at least the cysteine residue at amino acid 103 or until the stop 
codon after amino acid 104. Other active species contain additional amino acid 
sequence in the N-terminal direction. As described further herein, the N-termini of 
active species produced by mammalian cells are expected to begin after the 
occurrence of a consensus cleavage site, encoding a peptide sequence Arg-X-X-Arg. 

20 Thus, it is expected that DNA sequences encoding active BMP- 12 proteins will have 
a nucleotide sequence comprising the nucleotide sequence beginning at any of 
nucleotides #196, 199, 208, 217, 361, 388, 493, 496 or 571 to nucleotide #879 or 
882 of SEQ ID NO:l. 

The N-terminus of one active species of human BMP- 12 has been 

25 experimentally determined by expression in E. coli to be as follows: 
[M]SRXSRKPLHVDF, wherein X designates an amino acid residue with no clear 
signal, which is consistent with a cysteine residue at that location. Thus, it appears 
that the N-terminus of this species of BMP-12 is at amino acid #1 of SEQ ID NO: 1 , 
and a DNA sequence encoding said species of BMP-12 would start at nucleotide 

30 #571 of SEQ ID NO:l. The apparent molecular weight of this species of human 
BMP-12 dimer was determined by SDS-PAGE to be approximately 20-22 kd on a 



WO 95/16035 



PCT/US94/14030 



Novex 16% tricine gel. The human BMP- 12 protein exists as a clear, colorless 
solution in 0.1% trifluoroacetic acid. 

As described earlier, BMP- 12 related proteins are a subset of the BMP/TGF- 
0/Vg-l family of proteins, including BMP-12 and VL-1, which can be defined as 

5 tendon/ligament-like tissue inducing proteins encoded by DNA sequences which can 
be cloned and identified, e.g., using PCR, using BMP-12 specific primers, such as 
primers #6 and #7 described below, with reduced stringency conditions. It is 
preferred that DNA sequences of the present invention share at least about 80% 
homology at the amino acid level from amino acids with the DNA encoding amino 

10 acids #3 to #103 of SEQ ID NO: 1 . For the purposes of the present invention, the 
term BMP-12 related proteins does not include the human MP52 protein. Using the 
sequence information of SEQ ID NO:l and SEQ ID NO:3, and the comparison 
provided in Figure 1, it is within the skill of the art to design primers to the BMP-12 
sequence which will allow for the cloning of genes encoding BMP-12 related 

15 proteins. 

One example of the BMP-12-related proteins of the present invention is VL-1 , 
presently referred to as BMP-13. The sequence of the full mature BMP- 13 sequence 
and at least a part of the propeptide of BMP-13 is given in SEQ ID NO:25. Like 
BMP-12, it is expected that BMP-13, as expressed by mammalian cells such as CHO 

20 cells, exists as a heterogeneous population of active species of BMP-13 protein with 
varying N-termini. It is expected that all active species will contain the amino acid 
sequence beginning with the cysteine residue at amino acid #19 of SEQ ID NO:26 
and continue through at least the cysteine residue at amino acid 1 19 or until the stop 
codon after amino acid 120. Other active species contain additional amino acid 

25 sequence in the N-terminal direction. As described further herein, the N-termini of 
active species produced by mammalian cells are expected to begin after the 
occurrence of a consensus cleavage site, encoding a peptide sequence Arg-X~X-Arg. 
Thus, it is expected that DNA sequences encoding active BMP-13 proteins will have 
a nucleotide sequence comprising the nucleotide sequence beginning at any of 

30 nucleotides #410, 458, 602, 605 or 659, to nucleotide #961 or 964 of SEQ ID 
NO:25. 



WO 95/16035 PCT/US94/14030 

In order to produce the purified tendon/ligament-like tissue inducing proteins 
useful for the present invention, a method is employed comprising culturing a host 
cell transformed with a DNA sequence comprising a suitable coding sequence, 
particularly the DNA coding sequence from nucleotide #496, #571 or # 577 to #879 
5 or #882 of SEQ ID NO:l; and recovering and purifying from the culture medium 
a protein which contains the amino acid sequence or a substantially homologous 
sequence as represented by amino acids #-25, #1 or #3 to #103 or #104 of SEQ ID 
NO:2. In another embodiment, the method employed comprises culturing a host cell 
transformed with a DNA sequence comprising a suitable coding sequence, 
10 particularly the DNA coding sequence from nucleotide #605 or # 659 to #961 or 
#964 of SEQ ID NO: 25; and recovering and purifying from the culture medium a 
protein which contains the amino acid sequence or a substantially homologous 
sequence as represented by amino acids #1 or #19 to #119 or #120 of SEQ ID 
NO:26. 

15 The human MP52 DNA is described in WO93/16099, the disclosure of which 

is incorporated herein by reference. However, this document does not disclose the 
ability of the protein to form tendon/ligament-like tissue, or its use in compositions 
for induction of tendon/ligament-like tissue. Human MP52 was originally isolated 
using RNA from human embryo tissue. The human MP52 nucleotide sequence (SEQ 

20 ID NO:3) and the encoded amino acid sequences (SEQ ID NO:4) are set forth in 
the Sequence Listings herein. The MP52 protein appears to begin at nucleotide #845 
of SEQ ID NO:3 and continues through nucleotide #1204 of SEQ ID NO:3. The 
first cysteine of the seven cysteine structure characteristic of TGF-0 proteins begins 
at nucleotide #899. The last cysteine ends at #1201. Other active species of MP52 

25 protein may have additional nucleotides at the N-terminal direction from nucleotide 
#845 of SEQ ID NO:3. 

Purified human MP52 proteins of the present invention may be produced by 
culturing a host cell transformed with a DNA sequence comprising the DNA coding 
sequence of SEQ ID NO:3 from nucleotide #845 to #1204, and recovering and 

30 purifying from the culture medium a protein which contains the amino acid sequence 

or a substantially homologous sequence as represented by amino acids #1 to #120 

of SEQ ID NO:4. It is also expected that the amino acid sequence from amino acids 

/c 



WO 95/16035 



PCT/US94/14030 



#17 or #19 to #119 or #120 of SEQ ID NO:4 will retain activity. Thus, the DNA 
sequence from nucleotides #845, #893 or #899 to #1201 or #1204 are expected to 
encode active proteins. 

For expression of the protein in mammalian host cells, the host cell is 

5 transformed with a coding sequence encoding a propeptide suitable for the secretion 
of proteins by the host cell is linked in proper reading frame to the coding sequence 
for the mature protein. For example, see United States Patent 5,168,050, the 
disclosure of which is hereby incorporated by reference, in which a DNA encoding 
a precursor portion of a mammalian protein other than BMP-2 is fused to the DNA 

10 encoding a mature BMP-2 protein. Thus, the present invention includes chimeric 
DNA molecules comprising a DNA sequence encoding a propeptide from a member 
of the TGF-/3 superfamily of proteins, is linked in correct reading frame to a DNA 
sequence encoding a tendon/ligament-like tissue inducing polypeptide. The term 
"chimeric" is used to signify that the propeptide originates from a different 

15 polypeptide than the encoded mature polypeptide. Of course, the host cell may be 
transformed with a DNA sequence coding sequence encoding the native propeptide 
linked in correct reading frame to a coding sequence encoding the mature protein 
shown in SEQ ID NO:2, SEQ ID NO:4, or SEQ ID NO:26. The full sequence of 
the native propeptide may be determined through methods known in the art using 

20 the sequences disclosed in SEQ ID NO:l, SEQ ID NO:3, or SEQ ID NO:25 to 
design a suitable probe for identifying and isolating the entire clone. 

The present invention also encompasses the novel DNA sequences, free of 
association with DNA sequences encoding other proteinaceous materials, and coding 
for expression of tendon/ligament-like tissue inducing proteins. These DNA 

25 sequences include those depicted in SEQ ID NO:l in a 5' to 3' direction and those 
sequences which hybridize thereto under stringent hybridization conditions [for 
example, 0.1X SSC, 0.1% SDS at 65 °C; see, T. Maniatis et al, Molecular Cloning 
(A Laboratory Manual) . Cold Spring Harbor Laboratory (1982), pages 387 to 389] 
and encode a protein having tendon/ligament-like tissue inducing activity. 

30 Similarly, DNA sequences which code for proteins coded for by the 

sequences of SEQ ID NO:l or SEQ ID NO:25, or proteins which comprise the 
amino acid sequence of SEQ ID NO:2 or SEQ ID NO:26, but which differ incodon 



WO 95/16035 



PCTAJS94/14030 



sequence due to the degeneracies of the genetic code or allelic variations (naturally- 
occurring base changes in the species population which may or may not result in an 
amino acid change) also encode the tendon/ligament-like tissue inducing proteins 
described herein. Variations in the DNA sequences of SEQ ID NO:l or SEQ ID 

5 NO:25 which are caused by point mutations or by induced modifications (including 
insertion, deletion, and substitution) to enhance the activity, half-life or production 
of the polypeptides encoded are also encompassed in the invention. 

Another aspect of the present invention provides a novel method for 
producing tendon/ligament-like tissue inducing proteins. The method of the present 

10 invention involves culturing a suitable cell line, which has been transformed with 
a DNA sequence encoding a protein of the invention, under the control of known 
regulatory sequences. The transformed host cells are cultured and the proteins 
recovered and purified from the culture medium. The purified proteins are 
substantially free from other proteins with which they are co-produced as well as 

15 from other contaminants. 

Suitable cells or cell lines may be mammalian cells, such as Chinese hamster 
ovary cells (CHO). As described above, expression of protein in mammalian cells 
requires an appropriate propeptide to assure secretion of the protein. The selection 
of suitable mammalian host cells and methods for transformation, culture, 

20 amplification, screening, product production and purification are known in the art. 
See, e.g., Gething and Sambrook, Nature . 293:620-625 (1981), or alternatively, 
Kaufman et al, MoL Cell. Biol. . 5(7): 1750-1759 (1985) or Howley et al, U.S. Patent 
4,419,446. Another suitable mammalian cell line, which is described in the 
accompanying examples, is the monkey COS-1 cell line. The mammalian cell CV-1 

25 may also be suitable. 

Bacteria] cells may also be suitable hosts. For example, the various strains 
of E. coli (e.g., HB101, MC1061) are well-known as host cells in the field of 
biotechnology. Various strains of B. subtilis, Pseudomonas . other bacilli and the 
like may also be employed in this method. For expression of the protein in bacterial 

30 cells, DNA encoding a propeptide is not necessary. 

Bacterial expression of mammalian proteins, including members of the TGF-0 
family is known to produce the proteins in a non-glycosylated form, and in the form 



WO 95/16035 



PCT/US94/14030 



of insoluble pellets, known as inclusion bodies. Techniques have been described in 
the art for solubilizing these inclusion bodies, denaturing the protein using a 
chaotropic agent, and refolding the protein sufficiently correctly to allow for their 
production in a soluble form. For example, see EP 0433225, the disclosure of 
5 which is hereby incorporated by reference. 

Alternatively, methods have been devised which circumvent inclusion body 
formation, such as expression of gene fusion proteins, wherein the desired protein 
is expressed as a fusion protein with a fusion partner. The fusion protein is later 
subjected to cleavage to produce the desired protein. One example of such a gene 

10 fusion expression system for R coli is based on use of the R coli thioredoxin gene 
as a fusion partner, LaVallie et al., Bio/Technology . 11:187-193 (1993), the 
disclosure of which is hereby incorporated by reference. 

Many strains of yeast cells known to those skilled in the art may also be 
available as host cells for expression of the polypeptides of the present invention. 

15 Additionally, where desired, insect cells may be utilized as host cells in the method 
of the present invention. See, e.g. Miller et al, Genetic Engineering . 8:277-298 
(Plenum Press 1986) and references cited therein. 

Another aspect of the present invention provides vectors for use in the method 
of expression of these tendon/ligament-like tissue inducing proteins. Preferably the 

20 vectors contain the full novel DNA sequences described above which encode the 
novel factors of the invention. Additionally, the vectors contain appropriate 
expression control sequences permitting expression of the protein sequences. 
Alternatively, vectors incorporating modified sequences as described above are also 
embodiments of the present invention. Additionally, the sequence of SEQ ID NO: 1 

25 or SEQ ID NO:3 or SEQ ID NO:25 could be manipulated to express a mature 
protein by deleting propeptide sequences and replacing them with sequences encoding 
the complete propeptides of BMP proteins or members of the TGF-/3 superfamily. 
Thus, the present invention includes chimeric DNA molecules encoding a propeptide 
from a member of the TGF-0 superfamily linked in correct reading frame to a DNA 

30 sequence encoding a protein having the amino acid sequence of SEQ ID NO:2 or 
SEQ ID NO:4 or SEQ ID NO:26. The vectors may be employed in the method of 
transforming cell lines and contain selected regulatory sequences in operative 



WO 95/16035 



PCT/US94/14030 



association with the DNA coding sequences of the invention which are capable of 
directing the replication and expression thereof in selected host cells. Regulatory 
sequences for such vectors are known to those skilled in the art and may be selected 
depending upon the host cells. Such selection is routine and does not form part of 

5 the present invention. 

A protein of the present invention, which induces tendon/ligament-like tissue 
or other tissue formation in circumstances where such tissue is not normally formed, 
has application in the healing of tendon or ligament tears, deformities and other 
tendon or ligament defects in humans and other animals. Such a preparation 

10 employing a tendon/ligament-like tissue inducing protein may have prophylactic use 
in preventing damage to tendon or ligament tissue, as well as use in the improved 
fixation of tendon or ligament to bone or other tissues, and in repairing defects to 
tendon or ligament tissue. De novo tendon/ligament-like tissue formation induced 
by a composition of the present invention contributes to the repair of congenital, 

15 trauma induced, or other tendon or ligament defects of other origin, and is also 
useful in cosmetic plastic surgery for attachment or repair of tendons or ligaments. 
The compositions of the invention may also be useful in the treatment of tendinitis, 
carpal tunnel syndrome and other tendon or ligament defects. The compositions of 
the present invention can also be used in other indications wherein it is desirable to 
heal or regenerate tendon and/or ligament tissue. Such indications include, without 
limitation, regeneration or repair of injuries to the periodontal ligament, such as 
occurs in tendonitis, and regeneration or repair of the tendon-to-bone attachment. 
The compositions of the present invention may provide an environment to attract 
tendon- or ligament-forming cells, stimulate growth of tendon- or ligament-forming 
cells or induce differentiation of progenitors of tendon- or ligament-forming cells. 

The BMP-12 related proteins may be recovered from the culture medium and 
purified by isolating them from other proteinaceous materials from which they are 
co-produced and from other contaminants present. The proteins of the present 
invention are capable of inducing the formation of tendon/ligament-like tissue. 
These proteins may be further characterized by the ability to demonstrate 
tendon/ligament-like tissue formation activity in the rat ectopic implant assay 



WO 95/16035 



PCT/US94/14030 



described below. It is contemplated that these proteins may have ability to induce 
the formation of other types of tissue, such as ligaments, as well. 

The tendon/ligament-like tissue inducing proteins provided herein also include 
factors encoded by the sequences similar to those of SEQ ID NO:l or SEQ ID 
NO:25, but into which modifications are naturally provided (e.g. allelic variations 
in the nucleotide sequence which may result in amino acid changes in the 
polypeptide) or deliberately engineered. For example, synthetic polypeptides may 
wholly or partially duplicate continuous sequences of the amino acid residues of SEQ 
ID NO:2. These sequences, by virtue of sharing primary, secondary, or tertiary 
structural and conformational characteristics with tendon/ligament-like tissue growth 
factor polypeptides of SEQ ID NO: 2 may possess tendon/ligament-like or other 
tissue growth factor biological properties in common therewith. Thus, they may be 
employed as biologically active substitutes for naturally-occurring tendon/ligament- 
like tissue inducing polypeptides in therapeutic compositions and processes. 

Other specific mutations of the sequences of tendon/ligament-like tissue 
inducing proteins described herein involve modifications of glycosylation sites. 
These modifications may involve O-linked or N-linked glycosylation sites. For 
instance, the absence of glycosylation or only partial glycosylation results from 
amino acid substitution or deletion at asparagine-linked glycosylation recognition 
sites. The asparagine-linked glycosylation recognition sites comprise tripeptide 
sequences which are specifically recognized by appropriate cellular glycosylation 
enzymes. These tripeptide sequences may be a sparagine-X- threonine, asparagine-X- 
serine or asparagine-X-cysteine, where X is usually any amino acid except proline. 
A variety of amino acid substitutions or deletions at one or both of the first or third 
amino acid positions of a glycosylation recognition site (and/or amino acid deletion 
at the second position) results in non-glycosylation at the modified tripeptide 
sequence. Additionally, bacterial expression of protein will also result in production 
of a non-glycosylated protein, even if the glycosylation sites are left unmodified. 

The compositions of the present invention comprise a purified BMP- 12 
related protein which may be produced by culturing a cell transformed with the DNA 
sequence of SEQ ID NO:l or SEQ ID NO:25 and recovering and purifying protein 
having the amino acid sequence of SEQ ID NO:2 or SEQ ID NO:26 from the culture 



WO 95/16035 



PCTAJS94/14030 



medium. The purified expressed protein is substantially free from other 
proteinaceous materials with which it is co-produced, as well as from other 
contaminants. The recovered purified protein is contemplated to exhibit 
tendon/ligament-like tissue formation activity, and other tissue growth activity, such 
as ligament regeneration. The proteins of the invention may be further characterized 
by the ability to demonstrate tendon/ligament-like tissue formation activity in the rat 
assay described below. 

The compositions for inducing tendon/ligament-like tissue formation of the 
present invention may comprise an effective amount of a tendon/ligament-like tissue 
inducing protein, wherein said protein comprises the amino acid sequence of SEQ 
ID NO:2, preferably amino acids #-25, #1 or #3 to #103 or #104 of SEQ ID NO:2; 
or amino acids #1 or #19 to #120 of SEQ ID NO:26; as well as mutants and/or 
variants of SEQ ID NO:2 or SEQ ID NO:26, which exhibit the ability to form 
tendon and/or ligament like tissue. 

Compositions of the present invention may further comprise additional 
proteins, such as additional members of the TGF-j8 superfamily of proteins, such as 
activins. Another aspect of the invention provides pharmaceutical compositions 
containing a therapeutically effective amount of a tendon/ligament-inducing protein, 
such as BMP-12 or VL-1 , in a pharmaceutical^ acceptable vehicle or carrier. These 
compositions may be used to induce the formation of tendon/ligament-like tissue or 
other tissue. It is contemplated that such compositions may also be used for tendon 
and ligament repair, wound healing and other tissue repair, such as skin repair. It 
is further contemplated that proteins of the invention may increase neuronal survival 
and therefore be useful in transplantation and treatment of conditions exhibiting a 
decrease in neuronal survival. Compositions of the invention may further include 
at least one other therapeutically useful agent, such as the BMP proteins BMP-1, 
BMP-2, BMP-3, BMP-4, BMP-5, BMP-6 and BMP-7, disclosed for instance in 
United States Patents 5,108,922; 5,013,649; 5,116,738; 5,106,748; 5,187,076; and 
5,141,905; BMP-8, disclosed in PCT publication WO91/18098; BMP-9, disclosed 
in PCT publication WO93/00432; and BMP-10 or BMP-1 1 , disclosed in co-pending 
patent applications, serial number 08/061,695 and 08/061,464, filed on May 12, 



WO 95/16035 



PCT/US94/14030 



1993. The disclosure of the above documents are hereby incorporated by reference 
herein. 

The compositions of the invention may comprise, in addition to a 
tendon/ligament-inducing protein such as BMP- 12 or VL-1 (BMP- 13), other 
therapeutically useful agents including MP52, epidermal growth factor (EGF), 
fibroblast growth factor (FGF), platelet derived growth factor (PDGF), transforming 
growth factors (TGF-a and TGF-/3), and fibroblast growth factor-4 (FGF-4), 
parathyroid hormone (PTH), leukemia inhibitory factor (UF/HILDA/DIA), insulin- 
like growth factors (IGF-I and IGF-U). Portions of these agents may also be used 
in compositions of the present invention. For example, a composition comprising 
both BMP-2 and BMP-12 implanted together gives rise to both bone and 
tendon/ligament-like tissue. Such a composition may be useful for treating defects 
of the embryonic joint where tendon, ligaments, and bone form simultaneously at 
contiguous anatomical locations, and may be useful for regenerating tissue at the site 
of tendon attachment to bone. It is contemplated that the compositions of the 
invention may also be used in wound healing, such as skin healing and related tissue 
repair. The types of wounds include, but are not limited to burns, incisions and 
ulcers. (See, e.g. PCT Publication WO84/01106 for discussion of wound healing 
and related tissue repair). 

It is expected that the proteins of the invention may act in concert with or 
perhaps synergistically with other related proteins and growth factors. Further 
therapeutic methods and compositions of the invention therefore comprise a 
therapeutic amount of at least one protein of the invention with a therapeutic amount 
of at least one of the BMP proteins described above. Such compositions may 
comprise separate molecules of the BMP proteins or heteromolecules comprised of 
different BMP moieties. For example, a method and composition of the invention 
may comprise a disulfide linked dimer comprising a BMP-12 related protein subunit 
and a subunit from one of the "BMP" proteins described above. Thus, the present 
invention includes compositions comprising a purified BMP-12 related polypeptide 
which is a heterodimer wherein one subunit comprises the amino acid sequence from 
amino acid #1 to amino acid #104 of SEQ ID NO:2, and one subunit comprises an 
amino acid sequence for a bone morphogenetic protein selected from the group 



WO 95/16035 



PCTAJS94/14030 



consisting of BMP-1, BMP-2, BMP-3, BMP-4, BMP-5, BMP-6, BMP-7, BMP-8, 
BMP-9, BMP- 10 and BMP-1 1 . A further embodiment may comprise a heterodimer 
of disulfide bonded tendon/ligament-like tissue inducing moieties such as BMP-12, 
VL-1 (BMP- 13) or MP52. For example the heterodimer may comprise one subunit 
comprising an amino acid sequence from #1 to # 104 of SEQ ID NO:2 and the other 
subunit may comprise an amino acid sequence from #1 to #120 of SEQ ID NO:4 
or #1 to #120 of SEQ ID NO:26. Further, compositions of the present invention 
may be combined with other agents beneficial to the treatment of the defect, wound, 
or tissue in question. 

The preparation and formulation of such physiologically acceptable protein 
compositions, having due regard to pH, isotonicity, stability and the like, is within 
the skill of the art. The therapeutic compositions are also presently valuable for 
veterinary applications due to the lack of species specificity in TGF-0 proteins. 
Particularly domestic animals and thoroughbred horses in addition to humans are 
desired patients for such treatment with the compositions of the present invention. 

The therapeutic method includes administering the composition topically, 
systemically, or locally as an implant or device. When administered, the therapeutic 
composition for use in this invention is, of course, in a pyrogen-free, physiologically 
acceptable form. Further, the composition may desirably be encapsulated or injected 
in a viscous form for delivery to the site of tissue damage. Topical administration 
may be suitable for wound healing and tissue repair. Therapeutically useful agents 
other than the proteins which may also optionally be included in the composition as 
described above, may alternatively or additionally, be administered simultaneously 
or sequentially with the composition in the methods of the invention. 

The compositions may also include an appropriate matrix and/or sequestering 
agent as a carrier. For instance, the matrix may support the composition or provide 
a surface for tendon/ligament-like tissue formation and/or other tissue formation. 
The matrix may provide slow release of the protein and/or the appropriate 
environment for presentation thereof. The sequestering agent may be a substance 
which aids in ease of administration through injection or other means, or may slow 
the migration of protein from the site of application. 

/r 



WO 95/16035 



PCT/US94/14030 



The choice of a carrier material is based on biocompatibility, 
biodegradability, mechanical properties, cosmetic appearance and interface 
properties. The particular application of the compositions will define the appropriate 
formulation. Potential matrices for the compositions may be biodegradable and 
chemically defined. Further matrices are comprised of pure proteins or extracellular 
matrix components. Other potential matrices are nonbiodegradable and chemically 
defined. Preferred matrices include collagen-based materials, such as Helistat* 
sponge (Integra LifeSciences, Plainsboro, N.J.), or collagen in an injectable form, 
as well as sequestering agents, which may also be biodegradable, and which may 
include alkylcellulosic materials. 

Another preferred class of carrier are porous particulate polymer matrices, 
including polymers of polyGactic acid), poly(glycolic acid) and copolymers of lactic 
acid and glycolic acid. These matrices may also include a sequestering agent. 
Suitable polymer matrices are described, for example, in WO 93/00050, the 
disclosure of which is incorporated herein by reference. 

A preferred family of sequestering agents is cellulosic materials such as 
alkylcelluloses (including hydroxyalkylcelluloses), including methylcellulose, 
ethy Icellulose , hydroxyethy Icellulose , hy droxypropy Icellulose , hy droxypropy 1- 
methylcellulose, and carboxymethylcellulose, the most preferred being cationic salts 
of carboxymethylcellulose (CMC). Other preferred sequestering agents include 
hyaluronic acid, sodium alginate, poly(ethylene glycol), polyoxyethylene oxide, 
carboxy vinyl polymer and poly (vinyl alcohol). The amount of sequestering agent 
useful herein is 0.5-20 wt%, preferably 1-10 wt% based on total formulation weight, 
which represents the amount necessary to prevent desorbtion of the protein from the 
polymer matrix and to provide appropriate handling of the composition, yet not so 
much that the progenitor cells are prevented from infiltrating the matrix, thereby 
providing the protein the opportunity to assist the activity of the progenitor cells. 

Additional optional components useful in the practice of the subject 
application include, e.g. cryogenic protectors such as mannkol, sucrose, lactose, 
glucose, or glycine (to protect the protein from degradation during lyophilization), 
antimicrobial preservatives such as methyl and propyl parabens and benzyl alcohol; 

/? 



95/16035 



PCT/US94/14030 



antioxidants such as EDTA, citrate and BHT (butylated hydroxy toluene); and 
surfactants such as poly(sorbates) and poly(oxyethylenes); etc. 

As described above, the compositions of the invention may be employed in 
methods for treating a number of tendon defects, such as the regeneration of 
tendon/ligament-like tissue in areas of tendon or ligament damage, to assist in repair 
of tears of tendon tissue, ligaments, and various other types of tissue defects or 
wounds. These methods, according to the invention, entail administering to a patient 
needing such tendon/ligament-like tissue or other tissue repair, a composition 
comprising an effective amount of a tendon/ligament-like tissue inducing protein, 
such as described in SEQ ID NO:2, SEQ ID NO:4 and/or SEQ ID NO:26. These 
methods may also entail the administration of a tendon/ligament-like tissue inducing 
protein in conjunction with at least one of the BMP proteins described above. 

In another embodiment, the methods may entail administration of a 
heterodimeric protein in which one of the monomers is a tendon/ligament-like tissue 
inducing polypeptide, such as BMP-12, VL-1 (BMP-13) or MP52, and the second 
monomer is a member of the TGF-/J superfamily of growth factors. In addition, 
these methods may also include the administration of a tendon/ligament-like tissue 
inducing protein with other growth factors including EGF, FGF, TGF-or, TGF-)3, 
and IGF. 

Thus, a further aspect of the invention is a therapeutic method and 
composition for repairing tendon/ligament-like tissue, for repairing tendon or 
ligament as well as treating tendinitis and other conditions related to tendon or 
ligament defects. Such compositions comprise a therapeutically effective amount 
of one or more tendon/ligament-like tissue inducing proteins, such as BMP-12, a 
BMP-12 related protein, or MP52, in admixture with a pharmaceutically acceptable 
vehicle, carrier or matrix. 

The dosage regimen will be determined by the attending physician considering 
various factors which.modify the action of the composition, e.g., amount of tendon 
or ligament tissue desired to be formed, the site of tendon or ligament damage, the 
condition of the damaged tendon or ligament, the size of a wound, type of damaged 
tissue, the patient's age, sex, and diet, the severity of any infection, time of 
administration and other clinical factors. The dosage may vary with the type of 

£0 



WO 95/16035 



PCT/US94/14030 



matrix used in the reconstitution and the types of additional proteins in the 
composition. The addition of other known growth factors, such as IGF-I (insulin 
like growth factor I), to the final composition, may also affect the dosage. 

Progress can be monitored by periodic assessment of tendon/ligament-like 
tissue formation, or tendon or ligament growth and/or repair. The progress can be 
monitored by methods known in the art, for example, X-rays, arthroscopy, 
histomorphometric determinations and tetracycline labeling. 

The following examples illustrate practice of the present invention in 
recovering and characterizing human tendon/ligament-like tissue inducing protein 
and employing them to recover the other tendon/ligament-like tissue inducing 
proteins, obtaining the human proteins, expressing the proteins via recombinant 
techniques, and demonstration of the ability of the compositions of the present 
invention to form tendon/ligament-like tissue in an in vivo model. Although the 
examples demonstrate the invention with respect to BMP-12, with minor 
modifications within the skill of the art, the same results are believed to be attainable 
with MP52 and VL-1. 
EXAMPLE 1 
Isolation of DNA 

DNA sequences encoding BMP-12 and BMP-12 related proteins may be 
isolated by various techniques known to those skilled in the art. As described below, 
oligonucleotide primers may be designed on the basis of amino acid sequences 
present in other BMP proteins, Vg-1 related proteins and other proteins of the TGF- 
0 superfamily . Regions containing amino acid sequences which are highly conserved 
within the BMP family of proteins and within other members of the TGF-/3 
superfamily of proteins can be identified and consensus amino acid sequences of 
these highly conserved regions can be constructed based on the similarity of the 
corresponding regions of individual BMP/TGF~0/Vg-1 proteins. An example of such 
a consensus amino acid sequence is indicated below. 
Consensus amino acid sequence (1): 

Trp-Gln/Asn-Asp-Trp-Ile-Val/Ile-Ala (SEQ ID NO: 16) 
Where X/Y indicates that either amino acid residue may appear at that position. 



WO 95/16035 



PCT/US94/14030 



The following oligonucleotide is designed on the basis of the above identified 
consensus amino acid sequence (1): 

#1: CGGATCCTGGVANGAYTGGATHRTNGC (SEQ ID NO: 17) 

This oligonucleotide sequence is synthesized on an automated DNA 
synthesizer. The standard nucleotide symbols in the above identified oligonucleotide 
primer are as follows: A,adenosine; C,cytosine; G,guanine; T,thymine; N,adenosine 
or cytosine or guanine or thymine; R,adenosine or cytosine; Y,cytosine or thymine; 
H,adenosine or cytosine or thymine; V,adenosine or cytosine or guanine; 
D, adenosine or guanine or thymine. 

The first seven nucleotides of oligonucleotide #1 (underlined) contain the 
recognition sequence for the restriction endonuclease BamHI in order to facilitate 
the manipulation of a specifically amplified DNA sequence encoding the BMP- 12 
protein and are thus not derived from the consensus amino acid sequence (1) 
presented above. 

A second consensus amino acid sequence is derived from another highly 
conserved region of BMP/TGF-0/Vg-l proteins as described below: 
His-Ala-Ile-Val/Leu-Gln-Thr (SEQ ID NO: 18) 

The following oligonucleotide is designed on the basis of the above identified 
consensus amino acid sequence (2): 

#2: TTTCTAGA ARN GTYTGN ACDATNGCRTG (SEQ ID NO: 19) 

This oligonucleotide sequence is synthesized on an automated DNA 
synthesizer. The same nucleotide symbols are used as described above. 

The first seven nucleotides of oligonucleotide #1 (underlined) contain the 
recognition sequence for the restriction endonuclease Xbal in order to facilitate the 
manipulation of a specifically amplified DNA sequence encoding the BMP-12 protein 
and are thus not derived from the consensus amino acid sequence (2) presented 
above. 

It is contemplated that the BMP-12 protein of the invention and other 

BMP/TGF-0/Vg-l related proteins may contain amino acid sequences similar to the 

consensus amino acid sequences described above and that the location of those 

sequences within a BMP-12 protein or other novel related proteins would correspond 

to the relative locations in the proteins from which they were derived. It is further 

<52 



WO 95/16035 



PCMJS94/14030 



contemplated that this positional information derived from the structure of other 
BMP/TGF-0/Vg-l proteins and the oligonucleotide sequences #1 and #2 which have 
been derived from consensus amino acid sequences (1) and (2), respectively, could 
be utilized to specifically amplify DNA sequences encoding the corresponding amino 
acids of a BMP-12 protein or other BMP/TGF-/3/Vg-l related proteins. 

Based on the knowledge of the gene structures of BMP/TGF-j8/Vg-l proteins 
it is further contemplated that human genomic DNA can be used as a template to 
perform specific amplification reactions which would result in the identification of 
BMP-12 BMP/TGF-0/Vg-l (BMP-12 related protein) encoding sequences. Such 
specific amplification reactions of a human genomic DNA template could be initiated 
with the use of oligonucleotide primers #1 and #2 described earlier. 
Oligonucleotides #1 and #2 identified above are utilized as primers to allow the 
specific amplification of a specific nucleotide sequence from human genomic DNA. 
The amplification reaction is performed as follows: 

Human genomic DNA (source: peripheral blood lymphocytes), provided by 
Ken Jacobs of Genetics Institute, is sheared by repeated passage through a 25 gauge 
needle, denatured at 100°C for 5 minutes and then chilled on ice before adding to 
a reaction mixture containing 200 fM each deoxynucleotide triphosphates (dATP, 
dGTP, dCTP and dTTP), 10 mM Tris-HCl pH 8.3, 50 mM KC1, 1.5 mM MgCl 2 , 
0.001% gelatin, 1.25 units Taq DNA polymerase, 100 pM oligonucleotide #1 and 
100 pM oligonucleotide #2. This reaction mixture is incubated at 94°C for two 
minutes and then subjected to thermal cycling in the following manner: 1 minute at 
94°C, 1 minute at 40°C, 1 minute at 72°C for three cycles; then 1 minute at 94°C, 
1 minute at 55°C, 1 minute at 72°C for thirty-seven cycles, followed by a 10 minute 
incubation at 72°C. 

The DNA which is specifically amplified by this reaction is ethanol 

precipitated, digested with the restriction endonucleases BamHI and Xbal and 

subjected to agarose gel electrophoresis. A region of the gel, corresponding to the 

predicted size of the BMP-12 or other BMP/TGF-/5/Vg-l encoding DNA fragment, 

is excised and the specifically amplified DNA fragments contained therein are 

electroeluted and subcloned into the plasmid vector pGEM-3 between the Xbal and 

BamHI sites of the polylinker. DNA sequence analysis of one of the resulting BMP- 

23 



WO 95/16035 



PCT/US94/14030 



12 related subclones indicates the specifically amplified DNA sequence product 
contained therein encodes a portion of the BMP-12 protein of the invention. 

The DNA sequence (SEQ ID NO:5) and derived amino acid sequence (SEQ 
ID NO:6) of this specifically amplified DNA fragment of BMP-12 are shown in the 
SEQUENCE Listings. 

Nucleotides #l-#26 of SEQ ID NO: 5 comprise a portion of oligonucleotide 
#1 and nucleotides #103 - #128 comprise a portion of the reverse compliment of 
oligonucleotide #2 utilized to perform the specific amplification reaction. Due to 
the function of oligonucleotides #1 and #2 in initiating the amplification reaction, 
they may not correspond exactly to the actual sequence encoding a BMP-12 protein 
and are therefore not translated in the corresponding amino acid derivation (SEQ ID 
NO:6). 

DNA sequence analysis of another subclone indicates that the specifically 
amplified DNA product contained therein encodes a portion of another BMP/TGF- 
0/Vg-l (BMP-12 related) protein of the invention named VL-L 

The DNA sequence (SEQ ID NO:7) and derived amino acid sequence (SEQ 
ID NO:8) of this specifically amplified DNA fragment are shown in the Sequence 
Listings. 

Nucleotides #1 - #26 of SEQ ID NO:7 comprise a portion of oligonucleotide 
#1 and nucleotides #103 - #128 comprise a portion of the reverse compliment of 
oligonucleotide #2 utilized to perform the specific amplification reaction. Due to 
the function of oligonucleotides #1 and #2 in initiating the amplification reaction, 
they may not correspond exactly to the actual sequence encoding a VL-1 protein of 
the invention and are therefore not translated in the corresponding amino acid 
derivation (SEQ ID NO:8). 

The following oligonucleotide probe is designed on the basis of the 
specifically amplified BMP-12 human DNA sequence set forth above (SEQ ID 
NO:5) and synthesized on an automated DNA synthesizer: 
#3 : CCACTGCGAGGGCCTTTGCGACTTCCCTTTGCGTTCGCAC (SEQ ID 
NO:20) 

This oligonucleotide probe is radioactively labeled with 32 P and employed to 

screen a human genomic library constructed in the vector XFIX (Stratagene catalog 

9<T 



WO 95/16035 



PCT/US94/14030 



#944201). 500,000 recombinants of the human genomic library are plated at a 
density of approximately 10,000 recombinants per plate on 50 plates. Duplicate 
nitrocellulose replicas of the recombinant bacteriophage plaques and hybridized to 
oligonucleotide probe #3 in standard hybridization buffer (SHB = 5X SSC, 0.1% 
SDS, 5X Denhardt's, 100 ptg/ml salmon sperm DNA) at 65°C overnight. The 
following day the radioactively labelled oligonucleotide containing hybridization 
solution is removed an the filters are washed with 0.2X SSC, 0.1% SDS at 65°C. 
A single positively hybridizing recombinant is identified and plaque purified. This 
plaque purified recombinant bacteriophage clone which hybridizes to the BMP- 12 
oligonucleotide probe #3 is designated XHuG-48. A bacteriophage plate stock is 
made and bacteriophage DNA is isolated from the XHuG-48 human genomic clone. 
The bacteriophage XHuG-48 has been deposited with the American Type Culture 
Collection, 12301 Parklawn Drive, Rockville, MD "ATCC" under the accession 
#75625 on December 7, 1993. This deposit meets the requirements of the Budapest 
Treaty of the International Recognition of the Deposit of Microorganisms for the 
Purpose of Patent Procedure and Regulations thereunder. The oligonucleotide 

hybridizing region of this recombinant, XHuG-48, is localized to a 3.2 kb BamHI 
fragment. This fragment is subcloned into a plasmid vector (pGEM-3) and DNA 
sequence analysis is performed. This plasmid subclone is designated PCR1-1#2 and 
has been deposited with the American Type Culture Collection, 12301 Parklawn 
Drive, Rockville, MD "ATCC" under the accession #69517 on December 7, 1993. 
This deposit meets the requirements of the Budapest Treaty of the International 
Recognition of the Deposit of Microorganisms for the Purpose of Patent Procedure 
and Regulations thereunder. The partial DNA sequence (SEQ ID NO: 1) and 

derived amino acid sequence (SEQ ID NO:2) of the 3.2 kb DNA insert of the 
plasmid subclone PCR1-1#2, derived from clone XHuG-48, are shown in the 
Sequence Listings. 

It should be noted that nucleotides #639 - #714 of SEQ ID NO:l correspond 
to nucleotides #27 - #102 of the specifically amplified BMP-12 encoding DNA 
fragment set forth in SEQ ID NO:5 thus confirming that the human genomic 
bacteriophage clone XHuG-48 and derivative subclone PCR1-1#2 encode at least a 
portion of the BMP-12 protein of the invention. The nucleotide sequence of a 



WO 95/16035 



PCT/US94/14030 



portion of the 3.2 kb BamHI insert of the plasmid PCR1-1#2 contains an open 
reading frame of at least 882 base pairs, as defined by nucleotides #l-#882 of SEQ 
ID NO:l. This open reading frame encodes at least 294 amino acids of the 
human BMP-12 protein of the invention. The encoded 294 amino acid human BMP- 
12 protein includes the full mature human BMP-12 protein (amino acids #1-#104 of 
SEQ ID NO:2), as well as the C-terminal portion of the propeptide region of the 
primary translation product (amino acid #-190 to #-1 of SEQ ID NO:2). 

Additional DNA sequence of the 3.2 kb BamHI insert of the plasmid PCR1- 
1#2 set forth in SEQ ID NO:33 demonstrates the presence of an 1164 bp open 
reading frame, as defined by nucleotides #138 through #1301 of SEQ ID NO:33. 
[NOTE that all the sequence disclosed in SEQ ID NO:l is contained within SEQ ID 
NO:33]. As this sequence is derived from a genomic clone it is difficult to 
determine the boundary between the 5' extent of coding sequence and the 3' limit 
of intervening sequence (intron/non-coding sequence). 

Based on the knowledge of other BMP proteins and other proteins within the 
TGF-0 family, it is predicted that the precursor polypeptide would be cleaved at the 
multibasic sequence Arg-Arg-Gly-Arg in agreement with a proposed consensus 
proteolytic processing sequence of Arg-X-X-Arg. Cleavage of the BMP-12 
precursor polypeptide is expected to generate a 104 amino acid mature peptide 
beginning with the amino acid Ser at position #1 of SEQ ID NO:2. The processing 
of BMP-12 into the mature form is expected to involve dimerization and removal 
of the N-terminal region in a manner analogous to the processing of the related 
protein TGF-jS [Gentry et al., Molec & Cell. Biol. . 8:4162 (1988); Derynck et al. 
Nature . 316:701 (1985)]. 

It is contemplated therefore that the mature active species of BMP-12 
comprises a homodimer of two polypeptide subunits, each subunit comprising amino 
acids #1 to #104 of SEQ ID NO:2 with a predicted molecular weight of 
approximately 12,000 daltons. Further active species are contemplated comprising 
at least amino acids #3 to #103 of SEQ ID NO:2, thereby including the first and last 
conserved cysteine residue. As with other members of the TGF-/3/BMP family of 
proteins, the carboxy-terminal portion of the BMP-12 protein exhibits greater 
sequence conservation than the more amino-terminal portion. The percent amino 



WO 95/16035 



PCT/US94/14030 



acid identity of the human BMP- 12 protein in the cysteine-rich C-terminal domain 
(amino acids #3 - #104) to the corresponding region of human BMP proteins and 
other proteins within the TGF-0 family is as follows: BMP-2, 55%; BMP-3, 43%; 
BMP-4, 53%; BMP-5, 49%; BMP-6, 49%; BMP-7, 50%; BMP-8, 57%; BMP-9, 
48%; BMP-10, 57%; activin WC (BMP-11), 38%; Vgl, 46%; GDF-1, 47%; TGF- 
01, 36%; TGF-02, 36%; TGF-03, 39%; inhibin 0(B), 36%; inhibin /3(A), 41%. 

The human BMP-12 DNA sequence (SEQ ID NO:l), or a portion thereof, 
can be used as a probe to identify a human cell line or tissue which synthesizes 
BMP-12 mRNA. Briefly described, RNA is extracted from a selected cell or tissue 
source and either electrophoresed on a formaldehyde agarose gel and transferred to 
nitrocellulose, or reacted with formaldehyde and spotted on nitrocellulose directly. 
The nitrocellulose is then hybridized to a probe derived from the coding sequence 
of human BMP-12. 

Alternatively, the human BMP-12 sequence is used to design oligonucleotide 
primers which will specifically amplify a portion of the BMP-12 encoding sequence 
located in the region between the primers utilized to perform the specific 
amplification reaction. It is contemplated that these human BMP-12 derived primers 
would allow one to specifically amplify corresponding BMP-12 encoding sequences 
from mRNA, cDNA or genomic DNA templates. Once a positive source has been 
identified by one of the above described methods, mRNA is selected by oligo (dT) 
cellulose chromatography and cDNA is synthesized and cloned in XgtlO or other X 
bacteriophage vectors known to those skilled in the art, for example, XZAP by 
established techniques (Toole et al., supra) . It is also possible to perform the 
oligonucleotide primer directed amplification reaction, described above, directly on 
a pre-established human cDNA or genomic library which has been cloned into a X 
bacteriophage vector. In such cases, a library which yields a specifically amplified 
DNA product encoding a portion of the human BMP-12 protein could be screened 
directly, utilizing the fragment of amplified BMP-12 encoding DNA as a probe. 

Oligonucleotide primers designed on the basis of the DNA sequence of the 

human BMP-12 genomic clone XHuG-48 are predicted to allow the specific 

amplification of human BMP-12 encoding DNA sequences from pre-established 

human cDNA libraries which are commercially available (ie. Stratagene, La Jolla, 

3*7 



WO 95/16035 



PCT/US94/14030 



CA or Clontech Laboratories, Inc., Palo Alto, CA). The following oligonucleotide 
primer is designed on the basis of nucleotides #571 to #590 of the DNA sequence 
set forth in SEQ ID NO:l and synthesized on an automated DNA synthesizer: 

#4: TGCGGATCC AGCCGCTGCAGCCGCAAGCC (SEQ ID NO:21) 
The First nine nucleotides of primer #4 (underlined) comprise the recognition 
sequence for the restriction endonuclease BamHI which can be used to facilitate the 
manipulation of a specifically amplified DNA sequence encoding the human BMP-12 
protein of the invention and are thus not derived from the DNA sequence presented 
inSEQIDNO:!. 

The following oligonucleotide primer is designed on the basis of nucleotides #866 - 
#885 of the DNA sequence set forth in SEQ ID NO:l and synthesized on an 
automated DNA synthesizer: 

#5 GACTCTAGA CTACCTGCAGCCGCAGGCCT (SEQ ID NO:22) 
The first nine nucleotides of primer #5 (underlined) comprise the recognition 
sequence for the restriction endonuclease Xbal which can be used to facilitate the 
manipulation of a specifically amplified DNA sequence encoding the human BMP-12 
protein of the invention and are thus not derived from the DNA sequence presented 
in SEQ ID NO:l. 

The standard nucleotide symbols in the above identified primers are as 
follows: A, adenine; C, cytosine; G, guanine; T, thymine. 

Primers #4 and #5 identified above are utilized as primers to allow the 
amplification of a specific BMP-12 encoding nucleotide sequence from pre- 
established cDNA libraries which may include the following: human fetal brain 
cDNA/XZAPII (Stratagene catalog #936206), human liver/XUNI-ZAP XR 
(Stratagene Catalog #937200), human lung/XUNI-ZAP XR (Stratagene catalog 
#937206), and human fetal spleen/UNI-ZAP XR (Stratagene catalog #937205). 

Approximately 1 x 10 8 pfu (plaque forming units) of Xbacteriophage libraries 
containing human cDNA inserts such as those detailed above are denatured at 95°C 
for five minutes prior to addition to a reaction mixture containing 200 pM each 
deoxynucleotide triphosphates (dATP, dGTP, dCTP and dTTP) 10 mM Tris-HCl 
pH 8.3, 50 mM KC1, 1.5 mM MgCl 2 , 0.001% gelatin, 1.25 units Taq DNA 
polymerase, 100 pM oligonucleotide primer #4 and 100 pM oligonucleotide primer 



WO 95/16035 



PCT/US94/14030 



#5. The reaction mixture is then subjected to thermal cycling in the following 
manner: 1 minute at 94°C, 1 minute at 50°C, 1 minute at 72°C for thirty-nine cycles 
followed by 10 minutes at 72°C. 

The DNA which is specifically amplified by this reaction would be expected 
to generate a BMP- 12 encoding product of approximately 333 base pairs, the internal 
315 bp of which correspond to nucleotides #571 to #885 of SEQ ID NO:l and also 
including 9 bp at each end of the BMP-12 specific fragment which correspond to the 
restriction sites defined by nucleotides #1 - #9 of primers #4 and #5. The resulting 
333 bp DNA product is digested with the restriction endonucleases BamHI and Xbal, 
phenol extracted, chloroform extracted and ethanol precipitated. 

Alternatively, to ethanol precipitation, buffer exchange and removal of small 
fragments of DNA resulting from the BamHI/Xbal restriction digest is accomplished 
by dilution of the digested DNA product in 10 mM Tris-HCl pH 8.0, 1 mM EDTA 
followed by centrifugation through a Centricon™ 30 microconcentrator (W.R. Grace 
& Co., Beverly, MA; Product #4209). The resulting BamHI/Xbal digested 
amplified DNA product is subcloned into a plasmid vector (ie. pBluescript, pGEM-3 
etc.) between the BamHI and Xbal sites of the polylinker region. DNA sequence 
analysis of the resulting subclones would be required to confirm the integrity of the 
BMP-12 encoding insert. Once a positive cDNA source has been identified in this 
manner, the corresponding cDNA library from which a 333 bp BMP-12 specific 
sequence was amplified could be screened directly with the 333 bp insert or other 
BMP-12 specific probes in order to identify and isolate cDNA clones encoding the 
full-length BMP-12 protein of the invention. 

Additional methods known to those skilled in the art may be used to isolate 
other full-length cDNAs encoding human BMP-12 related proteins, or full length 
cDNA clones encoding BMP-12 related proteins of the invention from species other 
than humans, particularly other mammalian species. 

The following examples demonstrate the use of the human BMP-12 sequence 
to isolate homologues from BMP-12 related proteins in a murine genomic DNA 
library. 

The DNA sequence which encodes the human BMP-12 protein of the 

invention is predicted to be significantly homologous to BMP-12 and BMP-12 related 

^9 



WO 95/16035 



PCT/US94/14030 



sequences from species other than humans that it could be utilized to specifically 
amplify DNA sequences from those other species which would encode the 
corresponding BMP-12 related proteins. Specifically, the following oligonucleotides 
are designed on the basis of the human BMP- 12 sequence (SEQ ID NO:l) and are 
synthesized on an automated DNA synthesizer: 

#6: GCGGATCCAAGGAGCTCGGCTGGGACGA (SEQ ID NO:23) 
#7: GGAATTCCCCACCACCATGTCCTCGTAT (SEQ ID NO:24) 
The first eight nucleotides of oligonucleotide primers #6 and #7 (underlined) 
comprise the recognition sequence for the restriction endonucleases BamHI and 
EcoRI, respectively. These sequences are utilized to facilitate the manipulation of 
a specifically amplified DNA sequence encoding a BMP-12 or BMP-12 related 
protein from a species other than human and are thus not derived from the DNA 
sequence presented in SEQ ID NO:l. Oligonucleotide primer #6 is designed 
on the basis of nucleotides #607-#626 of SEQ ID NO: 1 . Oligonucleotide primer #7 
is designed on the basis of the reverse compliment of nucleotides #846-#865 of the 
DNA sequence set forth in SEQ ID NO:l. 

Oligonucleotide primers #6 and #7 identified above are utilized as primers 
to allow the amplification of specific BMP-12 related sequences from genomic DNA 
derived from species other than humans. The amplification reaction is performed 
as follows: 

Murine genomic DNA (source: strain Balb c) is sheared by repeated passage 
through a 25 gauge needle, denatured at 100° C for five minutes and then chilled on 
ice before adding to a reaction mixture containing 200 /xM each deoxynucleotide 
triphosphates (dATP, DGTP, dCTP and dTTP) 10 mM Tris-HCl pH 8.3, 50 mM 
KC1, 1.5 mM MgCl 2 , 0.001% gelatin, 1.25 units Taq DNA polymerase, 100 pM 
oligonucleotide primer #6 and 100 pM oligonucleotide primer #7. The reaction 
mixture is then subjected to thermal cycling in the following manner: 1 minute at 
95°C, 1 minute at 55°C, 1 minute at 72°C for forty cycles followed by 10 minutes 
at 72°C. 

The DNA which is specifically amplified by this reaction is ethanol 

precipitated, digested with the restriction endonucleases BamHI and EcoRI and 

subjected to agarose gel electrophoresis. A region of the gel, corresponding to the 

30 



WO 95/16035 



PCT/US94/14030 



predicted size of the murine BMP-12 or BMP-12 related encoding DNA fragment, 
is excised and the specifically amplified DNA fragments contained therein are 
extracted (by electroelution or by other methods known to those skilled in the an) 
and subcloned in to a plasmid vector, such as pGEM-3 or pBluescript between the 
BamHI and EcoRI sites of the polylinker. DNA sequence analysis of one of the 
resulting subclones named mVl, indicates that the specifically amplified DNA 
sequence contained therein encodes a portion of a protein which appears to be the 
murine homolog to either the BMP-12 or VL-1 sequence of the invention. The DNA 
sequence (SEQ ID NO: 10) and derived amino acid sequence (SEQ ID NO: 11) of 
this specifically amplified murine DNA fragment are shown in the sequence listings. 

Nucleotides #l-#26 of SEQ ID NO: 10 comprise a portion of oligonucleotide 
#6 and nucleotides #246-#272 comprise a portion of the reverse compliment of 
oligonucleotide #7 utilized to perform the specific amplification reaction. Nucleotide 
#27 of SEQ ID NO: 10 appears to be the last nucleotide of a codon triplet, and 
nucleotides #244-#245 of SEQ ID NO: 10 appear to be the first two nucleotides of 
a codon triplet. Therefore, nucleotides #28 to #243 of SEQ ID NO: 10 correspond 
to a partial coding sequence of mVl . Due to the function of oligonucleotides #6 and 
#7 in initiating the amplification reaction, they may not correspond exactly to the 
actual sequence encoding the murine homolog to the human BMP-12 or VL-1 protein 
of the invention and are therefore not translated in the corresponding amino acid 
sequence derivation (SEQ ID NO: 11). 

Oligonucleotide probes designed on the basis of the specifically amplified 
murine BMP-12 or VL-1 DNA sequence set forth in SEQ ID NO: 10 can be utilized 
by those skilled in the art to identify full-length murine BMP-12 or VL-1 encoding 
clones (either cDNA or genomic). 

DNA sequence analysis of another of the resulting subclones named mV2, 
indicates that the specifically amplified DNA sequence contained therein encodes a 
portion of a murine BMP-12 related sequence of the invention. The DNA sequence 
(SEQ ID NO: 12) and derived amino acid sequence (SEQ ID NO: 13) of this 
specifically amplified murine DNA fragment are shown in the sequence listings. 

Nucleotides #l-#26 of SEQ ID NO: 12 comprise a portion of oligonucleotide 

#6 and nucleotides #246-#272 comprise a portion of the reverse compliment of 

Sf 



WO 95/16035 



PCT/US94/14030 



oligonucleotide #7 utilized to perform the specific amplification reaction. Nucleotide 
#27 of SEQ ID NO: 12 appears to be the last nucleotide of a codon triplet, and 
nucleotides #244-#245 of SEQ ID NO: 12 appear to be the first two nucleotides of 
a codon triplet. Therefore, nucleotides #28 to #243 of SEQ ID NO: 12 correspond 
to a partial coding sequence of mV2. Due to the function of oligonucleotides #6 and 
#7 in initiating the amplification reaction, they may not correspond exactly to the 
actual sequence encoding the murine BMP- 12 related protein of the invention and 
are therefore not translated in the corresponding amino acid sequence derivation 
(SEQ ID NO:13). 

Oligonucleotide probes designed on the basis of the specifically amplified 
murine BMP-12 related DNA sequence set forth in SEQ ID NO: 12 can be utilized 
by those skilled in the art to identify full-length murine BMP-12 related encoding 
clones (either cDNA or genomic). 

DNA sequence analysis of another of the resulting subclones named mV9, 
indicates that the specifically amplified DNA sequence contained therein encodes a 
portion of a murine BMP-12 related sequence of the invention. This sequence 
appears to be the murine homolog to the human MP52 DNA sequence described at 
SEQ ID NO:3, The DNA sequence (SEQ ID NO: 14) and derived amino acid 
sequence (SEQ ID NO: 15) of this specifically amplified murine DNA fragment are 
shown in the sequence listings. 

Nucleotides #l-#26 of SEQ ID NO: 14 comprise a portion of oligonucleotide 
#6 and nucleotides #246-#272 comprise a portion of the reverse compliment of 
oligonucleotide #7 utilized to perform the specific amplification reaction. Nucleotide 
#27 of SEQ ID NO: 14 appears to be the last nucleotide of a codon triplet, and 
nucleotides #244-#245 of SEQ ID NO: 14 appear to be the first two nucleotides of 
a codon triplet. Therefore, nucleotides #28 to #243 of SEQ ID NO: 14 correspond 
to a partial coding sequence of mV9. Due to the function of oligonucleotides #6 and 
#7 in initiating the amplification reaction, they may not correspond exactly to the 
actual sequence encoding the murine BMP-12 related protein of the invention and 
are therefore not translated in the corresponding amino acid sequence derivation 
(SEQ ID NO: 15). 

3^ 



WO 95/16035 



PCT/US94/14030 



Oligonucleotide probes designed on the basis of the specifically amplified 
murine BMP-12 related DNA sequence set forth in SEQ ID NO: 14 can be utilized 
by those skilled in the art to identify full-length murine BMP-12 related encoding 
clones (either cDNA or genomic). 

Alternatively, oligonucleotide primers #6 and #7 identified above are utilized 
as primers to allow the specific amplification of a 275 base pair DNA probe, the 
internal 259 bp of which correspond to nucleotides #607 to #865 of SEQ ID NO:l, 
from the BMP-12 encoding plasmid subclone PCR1-1#2. This 275bp DNA probe 
was radioactively labelled with 32 P and employed to screen a murine genomic library 
constructed in the vector X FIX II (Stratagene catalog #946306). 1 million 
recombinants of the murine genomic library are plated at a density of approximately 
20,000 recombinants per plate on 50 plates. Duplicate nitrocellulose replicas of the 
recombinant bacteriophage plaques are hybridized, under reduced stringency 
conditions, to the specifically amplified 333 bp probe in standard hybridization buffer 
(SHB = 5X SSC, 0.1% SDS, 5X Denhardt's, 100 /zg/ml salmon sperm DNA) at 
60°C overnight. The following day the radioactively labelled oligonucleotide 
containing hybridization solution is removed an the filters are washed, under reduced 
stringency conditions, with 2X SSC, 0.1% SDS at 60°C. Multiple positively 
hybridizing recombinants are identified and plaque purified. Fragments of the 
positively hybridizing murine genomic recombinant clones are subcloned into 
standard plasmid vectors (i.e. pGEM-3) and subjected to DNA sequence analysis. 

DNA sequence analysis of one of these subclones named MVR3 indicates that 
it encodes a portion of the mouse gene corresponding to the PCR product mVl 
(murine homolog of the human BMP-12 sequence set forth in SEQ ID NO:l) 
described above. The partial DNA sequence of this subclone and corresponding 
amino acid translation are set forth in SEQ ID NO: 29 and SEQ ID NO:30 
respectively. 

DNA sequence analysis of another one of these subclones named MVR32 
indicates that it encodes a portion of the mouse gene corresponding to the PCR 
product mV2 (murine homolog of the human VL-1 sequence set forth in SEQ ID 
NO:7) described above. The partial DNA sequence of this subclone and 

33 



WO 95/16035 



PCT/US94/14030 



corresponding amino acid translation are set forth in SEQ ID NO: 31 and SEQ ID 
NO: 32 respectively. 

DNA sequence analysis of another of these subclones named MVR23 
indicates that it encodes a portion of the mouse gene corresponding to the PCR 
product mV9 (murine homolog of the MP-52 sequence set forth in SEQ ID NO:3) 
described above. 

In a similar manner to that which is described above for identifying and 
isolating human genomic clones encoding the BMP- 12 protein of the invention, 
oligonucleotide probe(s) corresponding to the VL-1 encoding sequence set forth in 
SEQ ID NO:7 can be designed and utilized to identify human genomic or cDNA 
sequences encoding the VL-1 (BMP- 13) protein. These oligonucleotides would be 
designed to regions specific for VL-1 encoding sequences and would therefore be 
likely to be derived from regions of the lowest degree of nucleotide sequence identity 
between the specifically amplified VL-1 encoding sequence (SEQ ID NO: 7) and the 
specifically amplified BMP-12 encoding sequence (SEQ ID NO:5). 

Alternatively, oligonucleotide primers #4 and #5 identified above are utilized 
as primers to allow the specific amplification of a 333 base pair DNA probe, the 
internal 315 bp of which correspond to nucleotides #571 to #885 of SEQ ID NO:l, 
from the BMP-12 encoding plasmid subclone PCR1-1#2. This 333 bp DNA probe 
was radioactively labelled with 32 P and employed to screen a human genomic library 
constructed in the vector XDASH II (Stratagene catalog #945203). 1 million 
recombinants of the human genomic library are plated at a density of approximately 
20,000 recombinants per plate on 50 plates. Duplicate nitrocellulose replicas of the 
recombinant bacteriophage plaques are hybridized, under reduced stringency 
conditions, to the specifically amplified 333 bp probe in standard hybridization buffer 
(SHB = 5X SSC, 0.1% SDS, 5X Denhardt's, 100 /ig/ml salmon sperm DNA) at 
60°C overnight. The following day the radioactively labelled oligonucleotide 
containing hybridization solution is removed an the filters are washed, under reduced 
stringency conditions, with 2X SSC, 0.1% SDS at 60°C. Multiple (approximately 
15) positively hybridizing recombinants are identified and plaque purified. 

In order to distinguish positively hybridizing recombinants encoding the VL-1 
protein of the invention from BMP-12 and other BMP-12-related encoding 



WO 95/16035 



PCT/US94/14030 



recombinants which would be predicted to hybridize positively to the 333 bp DNA 
probe generated from the BMP-12 encoding plasmid PCR1-1#2 utilized in this 
screening procedure, the following oligonucleotide probe, based on the VL-1 
sequence set forth in SEQ ID NO: 7, is designed and synthesized on an automated 
DNA synthesizer: 

#8: TGTATGCGACTTCCCGC [SEQUENCE ID NO: 35] 
An oligonucleotide corresponding to nucleotides #60 to #76 of SEQ ID NO: 7 
which contains 5 nucleotide differences to the corresponding region of the BMP-12 
encoding sequence set forth in SEQ ID NO:l (nucleotides #672 to #689) One of 
the recombinant bacteriophage clones which hybridizes to the VL-1 oligonucleotide 
probe #8 is designated XJLDc31. This recombinant bacteriophage clone is plaque 
purified, a bacteriophage plate stock is made and bacteriophage DNA is isolated 
from the \JLDc31 human genomic clone. The bacteriophage XJLDc31 has been 
deposited with the American Type Culture Collection, 12301 Parklawn Drive, 
Rockville, MD "ATCC" under the accession #75922 on October 20, 1994. This 
deposit meets the requirements of the Budapest Treaty of the International 
Recognition of the Deposit of Microorganisms for the Purpose of Patent Procedure 
and Regulations thereunder. The oligonucleotide hybridizing region of this 
recombinant,XJLDc31, is localized to a 2.5 kb Eco RI fragment. This fragment is 
subcloned into a plasmid vector (pGEM-3) and DNA sequence analysis is performed. 
This plasmid subclone is designated pGEMJLDc3 1/2.5 and has been deposited with 
the American Type Culture Collection, 12301 Parklawn Drive, Rockville, MD 
w ATCC" under the accession # 69710 on October 20, 1994. This deposit meets the 
requirements of the Budapest Treaty of the International Recognition of the Deposit 
of Microorganisms for the Purpose of Patent Procedure and Regulations thereunder. 

The partial DNA sequence (SEQ ID NO:25) and derived amino acid sequence 
(SEQ ID NO:26) of a portion of the 2.5 kb DNA insert of the plasmid subclone 
pGEMJLDc31/2.5, derived from clone XJLDc31 , are shown in the Sequence Listings 

The DNA sequence of a portion of the 2.5 kb EcoRI insert x>f the plasmid 
pGEMJLDc31/2.5 is set forth in SEQ ID NO:25. 



WO 95/1603S 



PCT/US94/14030 



contains an 912 bp open reading frame, as defined by nucleotides #52 through #963 
of SEQ ID NO:25. As this sequence is derived from a genomic clone it is difficult 
to determine the boundary between the 5' extent of coding sequence and the 3* limit 
of intervening sequence (intron/non-coding sequence). The entire open reading 
frame (nucleotides #52 through #963 of SEQ ID NO:25) encodes a portion of the 
VL-1 protein of the invention of up to 304 amino acids. 

Based on the knowledge of other BMP proteins and other proteins within the 
TGF-/3 family, it is predicted that the precursor polypeptide would be cleaved at the 
multibasic sequence Arg-Arg-Arg-Arg in agreement with a proposed consensus 
proteolytic processing sequence of Arg-X-X-Arg. Cleavage of the VL-1 precursor 
polypeptide is expected to generate a 120 amino acid mature peptide beginning with 
the amino acid Thr at position #1 of SEQ ID NO:26. The processing of VL-1 into 
the mature form is expected to involve dimerization and removal of the N-terminal 
region in a manner analogous to the processing of the related protein TGF-/3 [Gentry 
etal., Molec& Cell. Biol. . 8:4162 (1988); Deiyncket al. Nature . 316:701 (1985)]. 

It is contemplated therefore that the mature active species of VL-1 comprises 
a homodimer of two polypeptide subunits, each subunit comprising amino acids #1 
to #120 of SEQ ID NO:26 with a predicted molecular weight of approximately 
12,000 daltons. Further active species are contemplated comprising at least amino 
acids #19 to # 119 or #120 of SEQ ID NO:26, thereby including the first and last 
conserved cysteine residue. 

Using such a method, a clone encoding the mature human VL-1 (BMP-13) 
was obtained. The nucleotide sequence and corresponding amino acid sequence 
encoded by this clone are listed in the Sequence Listings at SEQ ID NO: 25 and 26, 
respectively. 
EXAMPLE 2 
Expression of BMP-12 

In order to produce human BMP-12 proteins, the DNA encoding it is 
transferred into an appropriate expression vector and introduced into mammalian 
cells or other preferred eukaryotic or prokaryotic hosts by conventional genetic 
engineering techniques. 

2to 



WO 95/16035 



PCT/US94/14030 



In order to produce the human BMP- 12 protein in bacterial cells, the 
following procedure is employed. 
Expression of BMP- 12 in E. coli 

An expression plasmid pALVl-781 , for production of BMP-12 in E. coli was 
constructed which contains the following principal features. Nucleotides 1-2060 
contain DNA sequences originating from the plasmid pUC-18 [Norrander et al., 
Gene 26:101-106 (1983)] including sequences containing the gene for ^-lactamase 
which confers resistance to the antibiotic ampicillin in host £. coli strains, and a 
colEl-derived origin of replication. Nucleotides 2061-2221 contain DNA sequences 
for the major leftward promotor (pL) of bacteriophage X {Sanger et al. , J. Mol. Biol. 
162:729-773 (1982)], including three operator sequences 0 L 1, 0 L 2 and 0 L 3. The 
operators are the binding sites for Xcl repressor protein, intracellular levels of which 
control the amount of transcription initiation from pL. Nucleotides 2222-2723 
contain a strong ribosome binding sequence included on a sequence derived from 
nucleotides 35566 to 35472 and 38137 to 38361 from bacteriophage lambda as 
described in Sanger et al., J. Mol. Biol. 162:729-773 (1982). Nucleotides 2724- 
3041 contain a DNA sequence encoding mature BMP-12 protein with all 3' 
untranslated sequence removed. The BMP-12 DNA sequences introduced into the 
pALVl-781 expression vector were modified at the 5'end to raise the A+T content 
without altering the coding capacity. These changes were made to increase the 
efficiency of translation initiated on the BMP-12 mRNA in £. coli. Nucleotides 
3042-3058 provide a "Linker" DNA sequence containing restriction endonuclease 
sites. Nucleotides 3059-3127 provide a transcription termination sequence based on 
that of the £. coli asp A gene [Takagi et al., Nucl. Acids Res. 13:2063-2074 
(1985)]. Nucleotides 3128-3532 are DNA sequences derived from pUC-18. 

Plasmid pALVl-781 was transformed into the E. coli host strain GI724 (F, 
]acl q , lacp L8 , ampC::XcI + ) by the procedure of Dagert and Ehrlich, Gene 6:23 
(1979). GI724 (ATCC accession No. 55151) contains a copy of the wild-type Xcl 
repressor gene stably integrated into the chromosome at the ampC locus, where it 
has been placed under the transcriptional control of Salmonella typhimurium trp 
promotor/operator sequences. In GI724, XCI protein is made only during growth 
in tryptophan-free media, such as minimal media or a minimal medium supplemented 



WO 95/16035 



PCT/US94/14030 



with casamino acids such as IMC, described above. Addition of tryptophan to a 
culture of GI724 will repress the trg promoter and turn off synthesis of Xcl, 
gradually causing the induction of transcription from pL promoters if they are 
present in the cell. 

Transformants were selected on 1.5% w/v agar plates containing IMC 
medium, which is composed of M9 medium [Miller, "Experiments in Molecular 
Genetics," Cold Spring Harbor Laboratory, New York (1972)] containing 1 mM 
MgS0 4 and supplemented with 0.5% w/v glucose, 0.2% w/v casamino acids and 
100 fig/ml ampicillin. GI724 transformed with pALVl-781 was grown at 37°C to 
an A 550 of 0.5 in IMC medium containing 100 jzg/ml ampicillin. Tryptophan was 
then added to a final concentration of 100 /xg/ml and the culture incubated for a 
further 4 hours. During this time BMP- 12 protein accumulates within the "inclusion 
body" fraction. 

Preparation of Protein Monomer 

18 g of frozen cells were weighed out and resuspended in 60ml of 100 mM 
Tris, 10 mM EDTA, 1 mM phenylmethylsulfonyl fluoride [PMSF], pH 8.3. Cells 
were lysed by 3 passes through a Microfluidizer™ [model #MCF 100 T]. The 
inclusion body pellet was obtained by centrifugation at 15,000g at 4°C for 20 
minutes. The supernatant was decanted, and the pellet was washed with 100 ml of 
100 mM Tris, 1 .0 M NaCl, 10 mM EDTA, 1 mM PMSF, pH 8.3. The suspension 
was centrifuged again at 15,000g at 4°C for 10 minutes, and the supernatant 
decanted. The pellet was then washed with 100 ml of 100 mM Tris, 10 mM EDTA, 
1 % Triton X-100, 1 mM PMSF, pH 8.3. The suspension was centrifuged again at 
15,000g at 4°C for 10 minutes, and the supernatant decanted. The pellet was 
resuspended with 50 ml of 20 mM Tris, 1 mM EDTA, 1 mM PMSF, pH 8.3, 
containing 1 % DTT in a glass tissue homogenizes Monomelic BMP- 12 was then 
solubilized by acidification to pH 2.5 with glacial acetic acid. The soluble fraction 
was isolated by centrifugation at 15,000g for 20 minutes at 4°C. 

The supernatant from this centrifugation was collected and chromatographed 
over a Sephacryl S-100™ size exclusion column (83 cm x 2.6 cm; «440 ml bed) 
in 20 ml increments. The Sephacryl S-100™ column was run with a mobile phase 
of 1% acetic acid at a flow rate of 1 .4 ml/min. Fractions corresponding to BMP-12 



WO 95/16035 



PCT/US94/14030 



monomer were detected by absorbance at 280 nm, and using a computer calculated 
extinction coefficient of ^OOM'cm" 1 and molecular weight (11667 daltons). This 
size exclusion column pooled material was used as starting material for refolding 
reactions. 

As an alternative to the above, 1.0 g of cells stored at 
-80°C are measured. Solution (3.4 ml 100 mM TRIS, 10 mM EDTA, pH 8.5) is 
added. The solution is vortexed until cells are well suspended. 40 pi 100 mM 
PMSF in isopropanol is added. The cells are lysed at 1000 psi in a French pressure 
cell. The inclusion bodies are centrifuged at 4°C for 20 minutes in an Eppendorf 
microfuge to form pellets. The supernatants are decanted. To one pellet (out of 4 
total) 1.0 ml degassed 8.0 M guanidine hydrochloride, 0.5 M TRIS, 5 mM EDTA, 
pH 8.5, containing 250 mM DTT is added. The pellet is dissolved and argon is 
blown over the liquid for 30 seconds. Next the solution is incubated at 37 °C for 
one hour. Insoluble material is pelleted for 2-3 minutes in an Eppendorf microfuge 
at 23 °C. 0.5-1.0 ml of supernatant is injected onto a Supelco 2 cm guard cartridge 
(LC-304), and eluted with an acetonitrile gradient in 0.1% TFA from 1-70% over 
35 minutes. BMP- 12 elutes between 29 and 31 minutes. Fractions are pooled and 
the protein concentration determined by adsorbance at 280 nanometers versus 0.1 % 
TFA, using the theoretical extinction coefficient based upon the amino acid content. 

As a second alternate method to the above, frozen cell pellets obtained from 
the £. coli transformants as described above are thawed in 30 ml of TE8. 3(1 00: 10) 
buffer (100 mM Tris-HCl pH 8.3, 10 mM Na 2 EDTA, 1 mM PMSF). Cells are 
lysed by three passes through a Microfluidizer™ [model #MCF 100 TJ. The initial 
inclusion body material pellet is dissolved in 8 M guanidine-HCl, TE8.5(100:10) 
buffer (100 mM Tris-HCl pH 8.5, 10 mM Na 2 EDTA which contained 100 mM 
DTT, and incubated at 37°C for 1 hour. This material is centrifuged at 12,000 x 
g for 15 minutes at room temperature. 
Refolding of BMP-12 protein using CHAPS system 

A sufficient volume of the BMP-12 pool is lyophilized to give 10 pg of 

protein. 5 pi of glass distilled water is added to redissolve the residue, then 100 /xl 

of refold mix (50 mM Tris, 1.0 M NaCl, 2% 3-(3-chlolamido- 

3«? 



WO 95/16035 



PCTAJS94/14030 



propyl)dimethylammonio-l-propane-sulfate (CHAPS), 5 mM EDTA, 2 mM 
glutathione (reduced) 1 mM glutathione (oxidized); at pH of approximately 8.5). 
The solution is gently mixed and stored at 23 °C for 1-4 days. Dimer formation is 
assessed by running an aliquot on a Novex 16% tricine gel at 125 volts for 2.5 
hours, followed by Coomassie Blue staining and destaining. 

BMP- 12 dimer was purified using a C4 analytical RP-HPLC (reversed phase- 
high performance liquid chromatography) column (Vydac 214TP54) which was 
equilibrated to 1% B buffer (diluted into A buffer) and was run over 35 minutes, 
during which the protein elutes, using the following gradient (A buffer = 0.1% 
trifluoroacetic acid, B buffer = 95% acetonitrile, 0.1% trifluoroacetic acid [TFA]), 
with a flow rate of 1 ml/min: 

1-5 minutes 20% B buffer 

5-10 minutes 20-30% B buffer 

10-30 minutes 30-50% B buffer 

30-35 minutes 50-100% B buffer 

Protein was monitored by absorbance at 280nm. Peak BMP-12 fractions (eluting 
between 29 and 31 minutes) were pooled. Purity was assessed by SDS-PAGE. The 
concentration was determined by absorbance at 280nm, and using the computer 
calculated extinction coefficient and molecular weight as indicated above. 
Expression of BMP-12 in mammalian cells: 

Another contemplated preferred expression system for biologically active 
recombinant human BMP-12 is stably transformed mammalian cells. 

One skilled in the art can construct mammalian expression vectors by 
employing the sequence of SEQ ID NO: 1 , or other DNA sequences encoding BMP- 
12 proteins or other modified sequences and known vectors, such as pCD [Okayama 
et al., Mol. Cell BioL, 2:161-170 (1982)], pJL3, pJL4 [Gough et al., EMBO L» 
4:645-653 (1985)] and pMT2 GXM. 

The mammalian expression vector pMT2 CXM is a derivative of p91023(b) 
(Wong et al. , Science 228:810-815, 1985) differing from the latter in that it contains 
the ampicillin resistance gene in place of the tetracycline resistance gene and further 
contains a Xhol site for insertion of cDNA clones. The functional elements of 
pMT2 CXM have been described (Kaufman, R.J., 1985, Proc. Natl. Acad. Sci. 



WO 95/16035 



PCT/US94/14030 



USA 82:689-693) and include the adenovirus VA genes, the SV40 origin of 
replication including the 72 bp enhancer, the adenovirus major late promoter 
including a 5 5 splice site and the majority of the adenovirus tripartite leader sequence 
present on adenovirus late mRNAs, a 3* splice acceptor site, a DHFR insert, the 
SV40 early polyadenylation site (SV40), and pBR322 sequences needed for 
propagation in R coli . 

Plasmid pMT2 CXM is obtained by EcoRI digestion of pMT2-VWF, which 
has been deposited with the American Type Culture Collection (ATCC), Rockville, 
MD (USA) under accession number ATCC 67122. EcoRI digestion excises the 
cDNA insert present in pMT2-VWF, yielding pMT2 in linear form which can be 
ligated and used to transform E. coli HB 101 or DH-5 to ampicillin resistance. 
Plasmid pMT2 DNA can be prepared by conventional methods. pMT2 CXM is then 
constructed using loopout/in mutagenesis [Morinaga, et al., Biotechnology 84: 636 
(1984). This removes bases 1075 to 1145 relative to the Hind III site near the SV40 
origin of replication and enhancer sequences of pMT2. In addition it inserts a 
sequence containing the recognition site for the restriction endonuclease Xho I. A 
derivative of pMT2CXM, termed pMT23, contains recognition sites for the 
restriction endonucleases PstI, Eco RI, Sail and Xhol. Plasmid pMT2 CXM and 
pMT23 DNA may be prepared by conventional methods. 

pEMC2/Jl derived from pMT21 may also be suitable in practice of the 
invention. pMT21 is derived from pMT2 which is derived from pMT2-VWF. As 
described above EcoRI digestion excises the cDNA insert present in pMT-VWF, 
yielding pMT2 in linear form which can be ligated and used to transform R Coli 
HB 101 or DH-5 to ampicillin resistance. Plasmid pMT2 DNA can be prepared by 
conventional methods. 

pMT21 is derived from pMT2 through the following two modifications. 

First, 76 bp of the 5' untranslated region of the DHFR cDNA including a stretch 

of 19 G residues from G/C tailing for cDNA cloning is deleted. In this process, a 

Xhol site is inserted to obtain the following sequence immediately upstream from 

DHFR. Second, a unique Clal site is introduced by digestion with EcoRV and Xbal, 

treatment with Klenow fragment of DNA polymerase I, and ligation to a Clal linker 

(CATCGATG). This deletes a 250 bp segment from the adenovirus associated RNA 

Hi 



WO 95/16035 



PCT/US94/14030 



(VAI) region but does not interfere with VAI RNA gene expression or function. 
pMT21 is digested with EcoRI and Xhol, and used to derive the vector pEMC2Bl. 

A portion of the EMCV leader is obtained from pMT2-ECATl [S.K. Jung, 
et al, J. Virol 63:1651-1660 (1989)] by digestion with Eco RI and PstI, resulting in 
a 2752 bp fragment. This fragment is digested with TaqI yielding an Eco RI-Taql 
fragment of 508 bp which is purified by electrophoresis on low melting agarose gel. 
A 68 bp adapter and its complementary strand are synthesized with a 5* TaqI 
protruding end and a 3' Xhol protruding end which has a sequence which matches 
the EMC virus leader sequence from nucleotide 763 to 827. It also changes the 
ATG at position 10 within the EMC virus leader to an ATT and is followed by a 
Xhol site. A three way ligation of the pMT21 Eco Rl-Xhol fragment, the EMC 
virus EcoRI-TaqI fragment, and the 68 bp oligonucleotide adapter Taql-Xhol adapter 
resulting in the vector pEMC2/31. 

This vector contains the SV40 origin of replication and enhancer, the 
adenovirus major late promoter, a cDNA copy of the majority of the adenovirus 
tripartite leader sequence, a small hybrid intervening sequence, an SV40 
polyadenylation signal and the adenovirus VA I gene, DHFR and jS-lactamase 
markers and an EMC sequence, in appropriate relationships to direct the high level 
expression of the desired cDNA in mammalian cells. 

The construction of vectors may involve modification of the BMP- 12 DNA 
sequences. For instance, BMP- 12 cDNA can be modified by removing the non- 
coding nucleotides on the 5' and 3' ends of the coding region. The deleted non- 
coding nucleotides may or may not be replaced by other sequences known to be 
beneficial for expression. These vectors are transformed into appropriate host cells 
for expression of BMP- 12 proteins. Additionally, the sequence of SEQ ID NO:l 
or other sequences encoding BMP- 12 proteins can be manipulated to express BMP- 
12 protein by isolating the mature coding sequence of nucleotides 571 to 882 of SEQ 
ID NO:l and adding at the 5' end sequences encoding the complete propeptides of 
other BMP proteins. 

For example, one skilled in the art can make a fusion protein in which the 
propeptide of BMP-2 is linked in operable fashion to the mature BMP-12 peptide 
by preparing a DNA vector in which the DNA sequence encoding the BMP-2 



WO 95/16035 



PCT/US94/14030 



propeptide is linked in proper reading frame to the DNA sequence encoding the 
mature BMP- 12 peptide. The DNA sequence of such a fusion protein is shown in 
SEQUENCE ID NO:27. 

One skilled in the art can manipulate the sequences of SEQ ID NO:l by 
eliminating or replacing the mammalian regulatory sequences flanking the coding 
sequence with bacterial sequences to create bacterial vectors for intracellular or 
extracellular expression by bacterial cells, as described above. As another example, 
the coding sequences could be further manipulated (e.g. ligated to other known 
linkers or modified by deleting non-coding sequences therefrom or altering 
nucleotides therein by other known techniques). The modified BMP- 12 coding 
sequence could then be inserted into a known bacterial vector using procedures such 
as described in T. Taniguchi et al., Proc. Natl Acad. Sci. USA . 77:5230-5233 
(1980). This exemplary bacterial vector could then be transformed into bacterial 
host cells and a BMP- 12 protein expressed thereby. For a strategy for producing 
extracellular expression of BMP-12 proteins in bacterial cells, see, e.g. European 
patent application EPA 177,343. 

Similar manipulations can be performed for the construction of an insect 
vector [See, e.g. procedures described in published European patent application 
155,476] for expression in insect cells. A yeast vector could also be constructed 
employing yeast regulatory sequences for intracellular or extracellular expression of 
the factors of the present invention by yeast cells. [See, e.g., procedures described 
in published PCT application WO86/00639 and European patent application EPA 
123,289]. 

A method for producing high levels of a BMP-12 protein of the invention in 
mammalian cells may involve the construction of cells containing multiple copies 
of the heterologous BMP-12 gene. The heterologous gene is linked to an amplifiable 
marker, e.g. the dihydrofolate reductase (DHFR) gene for which cells containing 
increased gene copies can be selected for propagation in increasing concentrations 
of methotrexate (MTX) according to the procedures of Kaufman and Sharp, J. Mol. 
Biol.' . 159:601-629 (1982). This approach can be employed with a number of 
different cell types. 

V3 



WO 95/16035 



PCT/US94/14030 



For example, a plasmid containing a DNA sequence for a BMP- 12 of the 
invention in operative association with other plasmid sequences enabling expression 
thereof and the DHFR expression plasmid pAdA26SV(A)3 [Kaufman and Sharp, 
Mol. Cell. Biol. . 2:1304 (1982)] can be co-introduced into DHFR-deficient CHO 
cells, DUKX-BII, by various methods including calcium phosphate coprecipitation 
and transfection, electroporation or protoplast fusion. DHFR expressing 
transformants are selected for growth in alpha media with dialyzed fetal calf serum, 
and subsequently selected for amplification by growth in increasing concentrations 
of MTX (e.g. sequential steps in 0.02, 0.2, 1.0 and 5uM MTX) as described in 
Kaufman et ah, Mol Cell Biol. . 5:1750 (1983). Transformants are cloned, and 
biologically active BMP- 12 expression is monitored by the Rosen-modified Sampath- 
Reddi rat assay described below in Example 5. BMP- 12 expression should increase 
with increasing levels of MTX resistance. BMP- 12 polypeptides are characterized 
using standard techniques known in the art such as pulse labeling with [35S] 
methionine or cysteine and poly aery lamide gel electrophoresis. Similar procedures 
can be followed to produce other related BMP-12 proteins. 
EXAMPLE 3 

Preparation of BMP-2 propeptide/BMP- 12 mature peptide fusion 

In order to construct a vector encoding the BMP-2 propeptide/BMP- 12 
mature peptide fusion, the following cloning procedure was used to fuse the two 
sequences together. 

First, a DNA restriction enzyme fragment comprising the propeptide of 
human BMP-2 protein, comprising nucleotides 1 through 843 of SEQ ID NO:27 is 
cut from pBMP2aEMC. pBMP2aEMC is a plasmid derived from lambda U20S-39 
(ATCC #40345) comprising the entire coding sequence for human BMP-2 protein 
with the non-translated 5' and 3' sequences of BMP-2 deleted from the vector. The 
5' restriction enzyme used was Bgl II and it cuts pBMP2aEMC in the vector at 
nucleotide 979. The 3' restriction enzyme used was Mae II and it cuts 
pBMP2 a EMC in the BMP-2 propeptide at nucleotide 1925, just short of the carboxy 
terminus. The resulting 954 base pair product was then ^gel isolated and gene 
cleaned. Second, a DNA restriction enzyme fragment comprising the 5' portion of 
the human BMP-12 mature peptide DNA sequence, is cut from pPCRl-l#2 Vl-1 



WO 95/16035 



PCT7US94/14030 



(ATCC #69517). The 5' restriction enzyme used was Eae I and it cuts pPCRl-l#2 

VI- 1 just 3' of N-terminus of the human BMP- 12 mature peptide sequence. The 

resulting 259 base pair product was gel isolated and gene cleaned. Third, two DNA 

oligos were designed and synthesized, so that when annealed would form a tiny 

DNA fragment comprising fusion sequence of the extreme 3' end of the human 

BMP-2 propeptide and the 5* end of BMP-12 mature peptide. The DNA fragment 

has a 5* Mae II complimentary sticky end which anneals to the 3' restriction enzyme 

fragment comprising the human BMP-2 propeptide. The annealed oligo DNA 

fragment has a 3' Eae I complimentary sticky end which anneals to the 5' of the 

restriction enzyme fragment comprising the mature peptide of human BMP-12. The 

coding strand oligo is named B2/12 and is 13 base pairs long. Next, a DNA 

fragment encoding the 123 base pairs at the 3' end of the BMP-12 mature peptide 

fragment was obtained as follows. First, a DNA fragment comprising the propeptide 

of human BMP-2 protein, comprising nucleotides 1 through 846 is PCR amplified 

from pBMP2AEMC. The 5' primer (oligo 655a) anneals just 5' of the polylinker. 

The 3' primer (BMPpro3) anneals to the BMP-2 propeptide 3' end and introduces 

a Bgl II restriction enzyme site by silent sequence mutations. The resulting PCR 

product was cut with Sal I, which cleaves in the polylinker, and Bgl II. The 850 

base pair restriction enzyme fragment (ending in amino acid sequence REKR) was 

gel isolated and gene cleaned. The BMP-12 mature peptide was PCR amplified 

using a 5' primer (oligo 5-1) encoding the Bgl II restriction enzyme site by silent 

sequence mutations, and annealing to the 5' end of a possible mature cleavage 

product, beginning with amino acid sequence SRCS. The 3* primer (VI -1 3) anneals 

to the BMP-12 mature peptide 3' end and introduces a Xba I restriction enzyme site 

after the stop codon. The resulting PCR product was cut with Bgl II and Xba I. 

The 321 base pair restriction enzyme fragment was gel isolated and gene cleaned. 

The two restriction fragments were three-way ligated into a previously Sail 

and Xbal cut vector. The resultant construct was sequenced to check for PCR 

induced errors and a silent C to T mutation was observed at base pair 185 in the 

propeptide. This plasmid was designated pREKRSRC. Then pREKRSRC was cut 

with Bglll and NgoMI, and the vector fragment encompassing the last 123 base pairs 

of the BMP 12 mature sequence was thereby isolated. The three restriction fragments 

V4- 



WO 95/16035 



PCTYUS94/14030 



and the annealed oligolinker were four-way ligated to yield pREKR-TAL with the 
BMP-2 propeptide with the mature cleavage site at the 3' end fused to the (TAL) 
5' end of the BMP- 12 mature peptide. The coding sequence of the resulting ligated 
vector is shown in SEQ ID NO:27. 
EXAMPLE 4 

Biological Activity of Expressed BMP- 12 

To measure the biological activity of the expressed BMP- 12 proteins obtained 
in Example 2 above, the proteins are recovered from the cell culture and purified 
by isolating the BMP- 12 proteins from other proteinaceous materials with which they 
are co-produced as well as from other contaminants. The purified protein may be 
assayed in accordance with the rat assay described below in Example 5. 

Purification is carried out using standard techniques known to those skilled 
in the art. 

Protein analysis is conducted using standard techniques such as SDS-PAGE 
acrylamide [Laemmli, Nature 227:680 (1970)] stained with Coomassie Blue or silver 
[Oakley, et al. Anal. Biochem. 105 :361 (1980)] and by immunoblot [Towbin, et al. 
Proc. Natl. Acad. Sci. USA 76:4350 (1979)] 
Example 5 

ROSEN MODIFIED SAMPATH-REDDI ASSAY 

A modified version of the rat ectopic implant assay described in Sampath and 
Reddi, Proc. Natl. Acad. Sci. USA . 80:6591-6595 (1983) is used to evaluate the 
activity of the BMP- 12 proteins. This modified assay is herein called the Rosen- 
modified Sampath-Reddi assay. The assay has been widely used to evaluate the bone 
and cartilage-inducing activity of BMPs. The ethanol precipitation step of the 
Sampath-Reddi procedure is replaced by dialyzing (if the composition is a solution) 
or diafiltering (if the composition is a suspension) the fraction to be assayed against 
water. The solution or suspension is then equilibrated to 0.1 % TFA. The resulting 
solution is added to 20 mg of rat matrix. A mock rat matrix sample not treated with 
the protein serves as a control. This material is frozen and lyophilized and the 
resulting powder enclosed in #5 gelatin capsules. The capsules are implanted 
subcutaneously in the abdominal thoracic area of 21-49 day old male Long Evans 
rats. The implants are removed after 10 days. A section of each implant is fixed 



WO 95/16035 



PCT/US94/14030 



and processed for histological analysis. 1 fim glycolmethacrylate sections are stained 
with Von Kossa and acid fuschin to score the amount of induced tendon/ligament-like 
tissue formation present in each implant. 

BMP- 12 was implanted in the rats in doses of 1, 5, 25 and 50 /ig per implant 
for 10 days. BMP-2 at a dose of 5 jig was included as a positive control. For all 
doses of BMP- 12 tested, no bone or cartilage formation was observed in the implants 
after ten days. Instead, the implants were filled with tissue resembling embryonic 
tendon, which is easily recognized by the presence of dense bundles of fibroblasts 
oriented in the same plane and packed tightly together. [Tendon/ligament-like tissue 
is described, for example, in Ham and Cormack, Histology (JB Lippincott Co. 
(1979), pp. 367-369, the disclosure of which is hereby incorporated by reference]. 
These findings were reproduced in a second set of assays in which tendon/ligament- 
like tissues was present in all BMP-12 containing implants. In contrast, the BMP-2 
implants, as expected, showed cartilage and bone formation, but contained no 
tendon/ligament-like tissue. 

The BMP-12 proteins and related proteins of this invention may be assessed 
for activity on this assay. 
Example 6 

Using methods in accordance with the above examples, with minor 
modifications within the skill of the art, human MP52 protein and the murine 
homologue of BMP-13 protein were expressed and assayed for tendon/ligament-like 
tissue inducing activity. All proteins showed comparable results, similar to those 
described above for human BMP-12. 

The foregoing descriptions detail presently preferred embodiments of the 
present invention. Numerous modifications and variations in practice thereof are 
expected to occur to those skilled in the art upon consideration of these descriptions. 
Those modifications and variations are believed to be encompassed within the claims 
appended hereto. The disclosure of all references discussed herein are hereby 
incorporated by reference. 



WO 95/16035 



PCTAJS94/14030 



SEQUENCE LISTING 

(1) GENERAL INFORMATION: 

<i) APPLICANT: GENETICS INSTITUTE, INC. 

PRESIDENT AND FELLOWS OF HARVARD COLLEGE 

(ii) TITLE OF INVENTION: TENDON- INDUCING COMPOSITIONS 

(iii) NUMBER OF SEQUENCES : 35 

(iv) CORRESPONDENCE ADDRESS: 

(A) ADDRESSEE: GENETICS INSTITUTE, INC. 

(B) STREET: 87 CambridgePark Drive 

(C) CITY: Cambridge 

(D) STATE: Massachusetts 

(E) COUNTRY: USA 

(F) ZIP: 02140 

(v) COMPUTER READABLE FORM: 

(A) MEDIUM TYPE : Floppy disk 

(B) COMPUTER: IBM PC compatible 

(C) OPERATING SYSTEM: PC-DOS/MS-DOS 

(D) SOFTWARE: Patentln Release #1.0, Version #1.25 

(vi) CURRENT APPLICATION DATA: 

(A) APPLICATION NUMBER: 

(B) FILING DATE: Herewith 

(C) CLASSIFICATION: 

(vii) PRIOR APPLICATION DATA: 

(A) APPLICATION NUMBER : US 08/164,103 

(B) FILING DATE: 07-DEC-1993 

<C) APPLICATION NUMBER: US 08/217,780 

(D) FILING DATE: 25-MAR-1994 

(E) APPLICATION NUMBER: US 08/333,576 

(F) FILING DATE: 02-N0V-1994 

(viii) ATTORNEY /AGENT INFORMATION: 

(A) NAME: Lazar, Steven R. 

(B) REGISTRATION NUMBER: 32,618 

(C) REFERENCE /DOCKET NUMBER: 5202D-PCT 

(ix) TELECOMMUNICATION INFORMATION: 

(A) TELEPHONE: 617 498-8260 

(B) TELEFAX: 617 876-5851 



(2) INFORMATION FOR SEQ ID NO:l: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 926 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS : single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 

(vi) ORIGINAL SOURCE: 

(A) ORGANISM: Homo sapiens 

(vii) IMMEDIATE SOURCE: 

(B) CLONE: vl-1 

(ix) FEATURE: 

(A) NAME /KEY: mat_peptide 

(B) LOCATION: 571.. 882 
(ix) FEATURE: 

(A) NAME/KEY: CDS 



WO 95/16035 



PCT/US94/14030 



(B) LOCATION: 1..8B2 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l: 

GCG CGT AAT ACG ACT CAC TAT AGG GCG AAT TGG GTA CGG GGC CCA GGC 48 . 

Ala Arg Asn Thr Thr His Tyr Arg Ala Asn Trp Val Arg Gly Pro Gly 
-190 -185 -180 -175 

AGC TGG ACT TCT CCG CCG TTG CTG CTG CTG TCC ACG TGC CCG GGC GCC 96 
Ser Trp Thr Ser Pro Pro Leu Leu Leu Leu Ser Thr Cys Pro Gly Ala 
-170 -165 -160 

GCC CGA GCG CCA CGC CTG CTG TAC TCG CGG GCA GCT GAG CCC CTA GTC 144 
Ala Arg Ala Pro Arg Leu Leu Tyr Ser Arg Ala Ala Glu Pro Leu Val 
-155 -150 -145 

GGT CAG CGC TGG GAG GCG TTC GAC GTG GCG GAC GCC ATG AGG CGC CAC 192 
Gly Gin Arg Trp Glu Ala Phe Asp Val Ala Asp Ala Met Arg Arg His 
-140 -135 -130 

CGT CGT GAA CCG CGC CCC CCC CGC GCG TTC TGC CTC TTG CTG CGC GCA 24 0 

Arg Arg Glu Pro Arg Pro Pro Arg Ala Phe Cys. Leu Leu Leu Arg Ala 
-125 -120 -115 

GTG GCA GGC CCG GTG CCG AGC CCG TTG GCA CTG CGG CGA CTG GGC TTC 288 
Val Ala Gly Pro Val Pro Ser Pro Leu Ala Leu Arg Arg Leu Gly Phe 
-110 -105 -100 -95 

GGC TGG CCG GGC GGA GGG GGC TCT GCG GCA GAG GAG CGC GCG GTG CTA 336 
Gly Trp Pro Gly Gly Gly Gly Ser Ala Ala Glu Glu Arg Ala Val Leu 
-90 -85 -80 

GTC GTC TCC TCC CGC ACG CAG AGG AAA GAG AGC TTA TTC CGG GAG ATC 384 
Val Val Ser Ser Arg Thr Gin Arg Lys Glu Ser Leu Phe Arg Glu lie 
-75 -70 -65 

CGC GCC CAG GCC CGC GCG CTC GGG GCC GCT CTG GCC TCA GAG CCG CTG 432 
Arg Ala Gin Ala Arg Ala Leu Gly Ala Ala Leu Ala Ser Glu Pro Leu 
-60 -55 -50 

CCC GAC CCA GGA ACC GGC ACC GCG TCG CCA AGG GCA GTC ATT GGC GGC 480 
Pro Asp Pro Gly Thr Gly Thr Ala Ser Pro Arg Ala Val lie Gly Gly 
-45 -40 -35 

CGC AGA CGG AGG AGG ACG GCG TTG GCC GGG ACG CGG ACA GCG CAG GGC 528 
Arg Arg Arg Arg Arg Thr Ala Leu Ala Gly Thr Arg Thr Ala Gin Gly 
-30 -25 -20 -15 

AGC GGC GGG GGC GCG GGC CGG GGC CAC <3GG CGC AGG GGC CGG AGC CGC 576 
Ser Gly Gly Gly Ala Gly Arg Gly His Gly Arg Arg Gly Arg Ser Arg 
-10 -5 1 

TGC AGC CGC AAG CCG TTG CAC GTG GAC TTC AAG GAG CTC GGC TGG GAC 624 
Cys Ser Arg Lys Pro Leu His Val Asp Phe Lys Glu Leu Gly Trp Asp 
5 10 15 

GAC TGG ATC ATC GCG CCG CTG GAC TAC GAG GCG TAC CAC TGC GAG GGC 672 
Asp Trp lie lie Ala Pro Leu Asp Tyr Glu Ala Tyr His <ys -Glu Gly 
20 25 . 30 

CTT TGC GAC TTC CCT TTG CGT TCG CAC CTC GAG CCC AGC AAC CAT GCC 720 
Leu Cys Asp Phe Pro Leu Arg Ser His Leu Glu Pro Thr Asn His Ala 
35 40 45 50 



WO 95/16035 



PCT/US94/J4030 



ATC ATT CAG ACG CTG CTC AAC TCC ATG GCA CCA GAC GCG GCG CCG GCC 768 
lie lie Gin Thr Leu Leu Asn Ser Met Ala Pro Asp Ala Ala Pro Ala 
55 60 65 

TCC TGC TGT GTG CCA GCG CGC CTC AGC CCC ATC AGC ATC CTC TAC ATC 816 
Ser Cys Cys Val Pro Ala Arg Leu Ser Pro lie Ser lie Leu Tyr lie 
70 75 80 

GAC GCC GCC AAC AAC GTT GTC TAC AAG CAA TAC GAG GAC ATG GTG GTG 864 
Asp Ala Ala Asn Asn Val Val Tyr Lys Gin Tyr Glu Asp Met Val Val 
85 90 95 

GAG GCC TGC GGC TGC AGG TAGCGCGCGG GCCGGGGAGG GGGCAGCCAC 912 
Glu Ala Cys Gly Cys Arg 
100 

GCGGCCGAGG ATCC 926 

(2) INFORMATION FOR SEQ ID NO: 2: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 294 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

<xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2: 

Ala Arg Asn Thr Thr His Tyr Arg Ala Asn Trp Val Arg Gly Pro Gly 
-190 -185 -180 -175 

Ser Trp Thr Ser Pro Pro Leu Leu Leu Leu Ser Thr Cys Pro Gly Ala 
-170 -165 -160 

Ala Arg Ala Pro Arg Leu Leu Tyr Ser Arg Ala Ala Glu Pro Leu Val 
-155 -150 -145 

Gly Gin Arg Trp Glu Ala Phe Asp Val Ala Asp Ala Met Arg Arg His 
-140 -135 -130 

Arg Arg Glu Pro Arg Pro Pro Arg Ala Phe Cys Leu Leu Leu Arg Ala 
-125 -120 -115 

Val Ala Gly Pro Val Pro Ser Pro Leu Ala Leu Arg Arg Leu Gly Phe 
-110 -105 -100 -95 

Gly Trp Pro Gly Gly Gly Gly Ser Ala Ala Glu Glu Arg Ala Val Leu 
-90 -85 -80 

Val Val Ser Ser Arg Thr Gin Arg Lys Glu Ser Leu Phe Arg Glu lie 
-75 -70 -65 

Arg Ala Gin Ala Arg Ala Leu Gly Ala Ala Leu Ala Ser Glu Pro Leu 
-60 -55 -50 

Pro Asp Pro Gly Thr Gly Thr Ala Ser Pro Arg Ala Val lie Gly Gly 
-45 -40 -35 



Arg Arg Arg Arg Arg Thr Ala Leu Ala Gly Thr Arg Thr Ala Gin Gly 
-30 -25 -20 -15 

Ser Gly Gly Gly Ala Gly Arg Gly His Gly Arg Arg Gly Arg Ser Arg 
-10 -5 1 



WO 95/16035 PCT/US94/14030 



Cys Ser Arg Lys Pro Leu His Val Asp Phe Lys Glu Leu Gly Trp Asp 
5 10 15 

Asp Trp lie He Ala Pro Leu Asp Tyr Glu Ala Tyr His Cys Glu Gly 
20 25 30 

Leu Cys Asp Phe Pro Leu Arg Ser His Leu Glu Pro Thr Asn His Ala 
35 40 45 50 

He He Gin Thr Leu Leu Asn Ser Met Ala Pro Asp Ala Ala Pro Ala 
55 60 65 

Ser Cys Cys Val Pro Ala Arg Leu Ser Pro He Ser He Leu Tyr He 
70 75 80 

Asp Ala Ala Asn Asn Val Val Tyr Lys Gin Tyr Glu Asp Met Val Val 
85 90 95 

Glu Ala Cys Gly Cys Arg 
100 

(2) INFORMATION FOR SEQ ID NO: 3: 

<i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 1207 base pairs 

(B) TYPE : nucleic acid 

(C) STRANDEDNESS : single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 

(vi) ORIGINAL SOURCE: 

(A) ORGANISM: Homo sapiens 

(Vii) IMMEDIATE SOURCE: 

(B) CLONE: MP52 

(ix) FEATURE: 

(A) NAME /KEY : CDS 

(B) LOCATION: 845.. 1204 

<xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: 

ACCGGGCGGC CCTGAACCCA AGCCAGGACA CCCTCCCCAA ACAAGGCAGG CTACAGCCCG 60 

GACTGTGACC CCAAAAGGAC AGCTTCCCGG AGGCAAGGCA CCCCCAAAAG CAGGATCTGT 120 

CCCCAGCTCC TTCCTGCTGA AGAAGGCCAG GGAGCCCGGG CCCCCAGGAG AGCCCAAGGA 180 

GCCGTTTCGC CCACCCCCCA TCACACCCCA CGAGTACATG CTCTCGCTGT ACAGGACGCT 240 

GTCCGATGCT GACAGAAAGG GAGGCAACAG CAGCGTGAAG TTGGAGGCTG <5CCTGGCCAA 300 

CACCATCACC AGCTTTATTG ACAAAGGGCA AGATGACCGA GGTCCCGTGG TCAGGAAGCA 360 

GAGGTACGTG TTTGACATTA GTGCCCTGGA GAAGGATGGG CTGCTGGGGG CCGAGCTCCG 420 

GATCTTGCGG AAGAAGCCCT CGGACACGGC CAAGCCAGCG GCCCCCGGAG GCGGGCGGGC 480 

TGCCCAGCTG AAGCTGTCCA GCTGCCCCAG CGGCCGGCAG COGGCCTCCT TGCTGGATGT 540 

GCGCTCCGTG CCAGGCCTGG ACGGATCTGG CTGGGAGGTG TTCGACATCT GGAAGCTCTT 600 

CCGAAACTTT AAGAACTCGG CCCAGCTGTG CCTGGAGCTG GAGGCCTGGG AACGGGGCAG 660 

GGCCGTGGAC CTCCGTGGCC TGGGCTTCGA CCGCGCCGCC CGGCAGGTCC ACGAGAAGGC 720 

*7 



WO 95/16035 



PCT/US94/14030 



CCTGTTCCTG GTGTTTGGCC GCACCAAGAA ACGGGACCTG TTCTTTAATG AGATTAAGGC 780 

CCGCTCTGGC CAGGACGATA AGACCGTGTA TGAGTACCTG TTCAGCCAGC GGCGAAAACG 840 

GCGG GCC CCA CTG GCC ACT CGC CAG GGC AAG CGA CCC AGC AAG AAC CTT 889 
Ala Pro Leu Ala Thr Arg Gin Gly Lys Arg Pro Ser Lys Asn Leu 
15 10 15 

AAG GCT CGC TGC AGT CGG AAG GCA CTG CAT GTC AAC TTC AAG GAC ATG 937 
Lys Ala Arg Cys Ser Arg Lys Ala Leu His Val Asn Phe Lys Asp Met 
20 25 30 

GGC TGG GAC GAC TGG ATC ATC GCA CCC CTT GAG TAC GAG GCT TTC CAC 985 
Gly Trp Asp Asp Trp lie He Ala Pro Leu Glu Tyr Glu Ala Phe His 
35 40 45 

TGC GAG GGG CTG TGC GAG TTC CCA TTG CGC TCC CAC CTG GAG CCC ACG 103 3 

Cys Glu Gly Leu Cys Glu Phe Pro Leu Arg Ser His Leu Glu Pro Thr 
50 55 60 

AAT CAT GCA GTC ATC CAG ACC CTG ATG AAC TCC ATG GAC CCC GAG TCC 1081 
Asn His Ala Val He Gin Thr Leu Met Asn Ser Met Asp Pro Glu Ser 
65 70 75 

ACA CCA CCC ACC TGC TGT GTG CCC ACG CGG CTG AGT CCC ATC AGC ATC 1129 
Thr Pro Pro Thr Cys Cys Val Pro Thr Arg Leu Ser Pro He Ser lie 
80 85 90 95 

CTC TTC ATT GAC TCT GCC AAC AAC GTG GTG TAT AAG CAG TAT GAG GAC 1177 
Leu Phe He Asp Ser Ala Asn Asn Val Val Tyr Lys Gin Tyr Glu Asp 
100 105 110 

ATG GTC GTG GAG TCG TGT GGC TGC AGG TAG 1207 
Met Val Val Glu Ser Cys Gly Cys Arg 
115 120 

(2) INFORMATION FOR SEQ ID NO:4: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 120 amino acids 
(£) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: 

Ala Pro Leu Ala Thr Arg Gin Gly Lys Arg Pro Ser Lys Asn Leu Lys 
15 10 15 

Ala Arg Cys Ser Arg Lys Ala Leu His Val Asn Phe Lys Asp Met Gly 
20 25 30 

Trp Asp Asp Trp He He Ala Pro Leu Glu Tyr Glu Ala Phe His Cys 
35 40 45 

Glu Gly Leu Cys Glu Phe Pro Leu Arg Ser His Leu Glu Pro Thr Asn 
50 55 60 

His Ala Val He Gin Thr Leu Met Asn Ser Met Asp Pro Glu Ser Thr 
65 70 75 80 

Pro Pro Thr Cys Cys Val Pro Thr Arg Leu Ser Pro He Ser He Leu 
85 90 95 



WO 95/16035 



PCTAJS94/14030 



Phe lie Asp Ser Ala Asn Asn Val Val Tyr Lys Gin Tyr Glu Asp Met 
100 105 110 

Val Val Glu Ser Cys Gly Cys Arg 
115 120 

(2) INFORMATION FOR SEQ ID NO: 5: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 128 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS : single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 

(vi) ORIGINAL SOURCE: 

(A) ORGANISM: Homo Sapiens 

(vii) IMMEDIATE SOURCE: 

(B) CLONE: Vl-1 fragment 

(ix) FEATURE: 

(A) NAME /KEY: CDS 

(B) LOCATION: 28.. 102 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5: 

GGATCCTGGA AGGATTGGAT CATTGCG CCG CTG GAC TAC GAG GCG TAC CAC 51 

Pro Leu Asp Tyr Glu Ala Tyr His 
1 5 

TGC GAG GGC CTT TGC GAC TTC CCT TTG CGT TCG CAC CTC GAG CCC ACC 99 
Cys Glu Gly Leu Cys Asp Phe Pro Leu Arg Ser His Leu Glu Pro Thr 
10 15 20 

AAC CACGCTATAG TCCAAACCTT TCTAGA 128 
Asn 
25 



(2) INFORMATION FOR SEQ ID NO:6: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 25 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: 

Pro Leu Asp Tyr Glu Ala Tyr His Cys Glu Gly Leu Cys Asp Phe Pro 
15 10 15 

Leu Arg Ser His Leu Glu Pro Thr Asn 
20 * 25 

(2) INFORMATION FOR SEQ ID NO : 7 : 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 128 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 



WO 95/16035 



PCT/US94/14030 



(ii) MOLECULE TYPE: DNA (genomic) 

<vi) ORIGINAL SOURCE: 

(A) ORGANISM: Homo Sapiens 

(vii) IMMEDIATE SOURCE: 

(B) CLONE: VL-1 

(ix) FEATURE : 

(A) NAME /KEY: CDS 

(B) LOCATION: 28. .102 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO : 7 : 

GGATCCTGGG ATGACTGGAT TATGGCG CCG CTG GAC TAC GAG GCG TAC CAC 51 

Pro Leu Asp Tyr Glu Ala Tyr His 
1 5 

TGC GAG GGT GTA TGC GAC TTC CCG CTG CGC TCG CAC CTG GAG CCC ACC 99 
Cys Glu Gly Val Cys Asp Phe Pro Leu Arg Ser His Leu Glu Pro Thr 
10 15 20 

AAC CACGCCATGC TACAAACGCT TCTAGA 128 
Asn 
25 



(2) INFORMATION FOR SEQ ID NO: 8: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 25 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8: 

Pro Leu Asp Tyr Glu Ala Tyr His Cys Glu Gly Val Cys Asp Phe Pro 
1 5 10 15 

Leu Arg Ser His Leu Glu Pro Thr Asn 
20 25 

(2) INFORMATION FOR SEQ ID NO: 9: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 3585 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 



(vii) IMMEDIATE SOURCE: 

(B) CLONE: pALVl-781 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9: 
CTAACTACCC AACTCAAAAA AAAAAAAAAA AAAAACCCCC TCTAACCCCC ATTGACGAAA 
GGGCCTCGTG ATACGCCTAT TTTTATAGGT TAATGTCATG ATAATAATGG TTTCTTAGAC 
GTCAGGTGGC ACTTTTCGGG GAAATGTGCG CGGAACCCCT ATTTGTTTAT TTTTCTAAAT 



€0 
120 
180 



WO 95/16035 



PCT/US94/14030 



ACATTCAAAT ATGTATCCGC TCATGAGACA ATAACCCTGA TAAATGCTTC AATAATATTG 24 0 

AAAAAGGAAG AGTATGAGTA TTCAACATTT CCGTGTCGCC CTTATTCCCT TTTTTGCGGC 300 

ATTTTGCCTT CCTGTTTTTG CTCACCCAGA AACGCTGGTG AAAGTAAAAG ATGCTGAAGA " 360 

TCAGTTGGGT GCACGAGTGG GTTACATCGA ACTGGATCTC AACAGCGGTA AGATCCTTGA 420 

■ GAGTTTTCGC CCCGAAGAAC GTTTTCCAAT GATGAGCACT TTTAAAGTTC TGCTATGTGG 480 

CGCGGTATTA TCCCGTATTG ACGCCGGGCA AGAGCAACTC GGTCGCCGCA TACACTATTC 540 

TCAGAATGAC TTGGTTGAGT ACTCACCAGT CACAGAAAAG CATCTTACGG ATGGCATGAC 600 

AGTAAGAGAA TTATGCAGTG CTGCCATAAC CATGAGTGAT AACACTGCGG CCAACTTACT 660 

TCTGACAACG ATCGGAGGAC CGAAGGAGCT AACCGCTTTT TTGCACAACA TGGGGGATCA 720 

TGTAACTCGC CTTGATCGTT GGGAACCGGA GCTGAATGAA GCCATACCAA ACGACGAGCG 780 

TGACACCACG ATGCCTGTAG CAATGGCAAC AACGTTGCGC AAACTATTAA CTGGCGAACT 840 

ACTTACTCTA GCTTCCCGGC AACAATTAAT AGACTGGATG GAGGCGGATA AAGTTGCAGG 900 

ACCACTTCTG CGCTCGGCCC TTCCGGCTGG CTGGTTTATT GCTGATAAAT CTGGAGCCGG 960 

TGAGCGTGGG TCTCGCGGTA TCATTGCAGC ACTGGGGCCA GATGGTAAGC CCTCCCGTAT 1020 

CGTAGTTATC TACACGACGG GGAGTCAGGC AACTATGGAT GAACGAAATA GACAGATCGC 1080 

TGAGATAGGT GCCTCACTGA TTAAGCATTG GTAACTGTCA GACCAAGTTT ACTCATATAT 1140 

ACTTTAGATT GATTTAAAAC TTCATTTTTA ATTTAAAAGG ATCTAGGTGA AGATCCTTTT 1200 

TGATAATCTC ATGACCAAAA TCCCTTAACG TGAGTTTTCG TTCCACTGAG CGTCAGACCC 1260 

CGTAGAAAAG ATCAAAGGAT CTTCTTGAGA TCCTTTTTTT CTGCGCGTAA TCTGCTGCTT 1320 

GCAAACAAAA AAACCACCGC TACCAGCGGT GGTTTGTTTG CCGGATCAAG AGCTACCAAC 1380 

TCTTTTTCCG AAGGTAACTG GCTTCAGCAG AGCGCAGATA CCAAATACTG TCCTTCTAGT 144 0 

GTAGCCGTAG TTAGGCCACC ACTTCAAGAA CTCTGTAGCA CCGCCTACAT ACCTCGCTCT 1500 

GCTAATCCTG TTACCAGTGG CTGCTGCCAG TGGCGATAAG TCGTGTCTTA CCGGGTTGGA 1560 

CTCAAGACGA TAGTTACCGG ATAAGGCGCA -GCGGTCGGGC TGAACGGGGG GTTCGTGCAC 1620 

ACAGCCCAGC TTGGAGCGAA CGACCTACAC CGAACTGAGA TACCTACAGC GTGAGCATTG 1680 

AGAAAGCGCC ACGCTTCCCG AAGGGAGAAA GGCGGACAGG TATCCGGTAA GCGGCAGGGT 1740 

CGGAACAGGA GAGCGCACGA GGGAGCTTCC AGGGGGAAAC GCCTGGTATC TTTATAGTCC 1800 

TGTCGGGTTT CGCCACCTCT GACTTGAGOG TCGATTTTTG TGATGCTCGT CAGGGGGGCG I860 

GAGCCTATGG AAAAACGCCA GCAACGCGGC CTTTTTACGG TTCCTGGCCT TTTGCTGGCC 1920 

TTTTGCTCAC ATGTTCTTTC CTGCGTTATC CCCTGATTCT -GTGGATAACC GTATTACCGC 1980 

CTTTGAGTGA GCTGATACCG CTCGCGGCAG CCGAACGACC GAGCGCAGCG AGTCAGTGAG 2040 

CGAGGAAGCG GAAGAGCGCC CAATACGCAA ACCGCCTCTC CCCGCGCGTT GGCCGATTCA 2100 

TTAATGCAGA ATTGATCTCT CACCTACCAA ACAATGCCCC CCTGCAAAAA ATAAATTCAT 2160 

ATAAAAAACA TACAGATAAC CATCTGCGGT GATAAATTAT CTCTGGCGGT CTTGACATAA 2220 



WO 95/16035 



PCT/US94/14030 



ATACCACTGG CGGTGATACT GAGCACATCA GCAGGACGCA CTGACCACCA TGAAGGTGAC 2280 

GCTCTTAAAA ATTAAGCCCT GAAGAAGGGC AGCATTCAAA GCAGAAGGCT TTGGGGTGTG 234 0 

TGATACGAAA CGAAGCATTG GCCGTAAGTG CGATTCCGGA TTAGCTGCCA ATGTGCCAAT 2400 

CGCGGGGGGT TTTCGTTCAG GACTACAACT GCCACACACC ACCAAAGCTA ACTGACAGGA 2460 

GAATCCAGAT GGATGCACAA ACACGCCGCC GCGAACGTCG CGCAGAGAAA CAGGCTCAAT 2520 

GGAAAGCAGC AAATCCCCTG TTGGTTGGGG TAAGCGCAAA ACCAGTTCCG AAAGATTTTT 2580 

TTAACTATAA ACGCTGATGG AAGCGTTTAT GCGGAAGAGG TAAAGCCCTT CCCGAGTAAC 264 0 

AAAAAAACAA CAGCATAAAT AACCCCGCTC TTACACATTC CAGCCCTGAA AAAGGGCATC 2700 

AAATTAAACC ACACCTATGG TGTATGCATT TATTTGCATA CATTCAATCA ATTGTTATCT 2760 

AAGGAAATAC TTACATATGT CTCGTTGTTC TCGTAAACCA CTGCATGTAG ATTTTAAAGA 2820 

GCTCGGCTGG GACGACTGGA TCATCGCGCC GCTGGACTAC GAGGCGTACC ACTGCGAGGG 2880 

CCTTTGCGAC TTCCCTTTGC GTTCGCACCT CGAGCCCACC AACCATGCCA TCATTCAGAC 294 0 

GCTGCTCAAC TCCATGGCAC CAGACGCGGC GCCGGCCTCC TGCTGTGTGC CAGCGCGCCT 3000 

CAGCCCCATC AGCATCCTCT ACATCGACGC CGCCAACAAC GTTGTCTACA AGCAATACGA 3060 

GGACATGGTG GTGGAGGCCT GCGGCTGCAG GTAGTCTAGA GTCGACCTGC AGTAATCGTA 3120 

CAGGGTAGTA CAAATAAAAA AGGCACGTCA GATGACGTGC CTTTTTTCTT GTGAGCAGTA 3180 

AGCTTGGCAC TGGCCGTCGT TTTACAACGT CGTGACTGGG AAAACCCTGG CGTTACCCAA 3240 

CTTAATCGCC TTGCAGCACA TCCCCCTTTC GCCAGCTGGC GTAATAGCGA AGAGGCCCGC 3300 

ACCGATCGCC CTTCCCAACA GTTGCGCAGC CTGAATGGCG AATGGCGCCT GATGCGGTAT 3360 

TTTCTCCTTA CGCATCTGTG CGGTATTTCA CACCGCATAT ATGGTGCACT CTCAGTACAA 3420 

TCTGCTCTGA TGCCGCATAG TTAAGCCAGC CCGGACACCC GCCAACACCC GCTGACGCGC 3480 

CCTGACGGGC TTGTCTGCTC CCGGCATCCG CTTACAGACA AGCTGTGACC GTCTCCGGGA 354 0 

GCTGCATGTG TCAGAGGTTT TCACCGTCAT CACCGAAACG CGCGA 3585 
(2) INFORMATION FOR SEQ ID NO: 10: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 272 base pairs 

(B) TYPE: nucleic acid 

(C) STRAND EDNESS : single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 

(vi) ORIGINAL SOURCE : 

(A) ORGANISM: mouse 

(vii) IMMEDIATE SOURCE: 

(B) CLONE: mVl 

(ix) FEATURE: 

(A) NAM! /KEY: CDS 

(B) LOCATION: 28.. 243 



WO 95/16035 



PCT/US94/14030 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10: 

GGATCCAAGG AGCTCGGCTG GGACGAC TGG ATC ATC GCG CCA TTA GAC TAC 51 

Trp lie lie Ala Pro Leu Asp Tyr 
1 5 

GAG GCA TAC CAC TGC GAG GGC GTT TGC GAC TTT CCT CTG CGC TCG CAC 99 
Glu Ala Tyr His Cys Glu Gly Val Cys Asp Phe Pro Leu Arg Ser His 
10 15 20 

CTG GAG CCT ACC AAC CAC GCC ATC ATT CAG ACG CTG CTC AAC TCC ATG 14 7 

Leu Glu Pro Thr Asn His Ala lie lie Gin Thr Leu Leu Asn Ser Met 
25 30 35 40 

GCG CCC GAC GCT GCG CCA GCC TCC TGC TGC GTG CCC GCA AGG CTC AGT 195 
Ala Pro Asp Ala Ala Pro Ala Ser Cys Cys Val Pro Ala Arg Leu Ser 
45 50 55 

CCC ATC AGC ATT CTC TAC ATC GAT GCC GCC AAC AAC GTG GTC TAC AAG 24 3 

Pro lie Ser lie Leu Tyr lie Asp Ala Ala Asn Asn Val Val Tyr Lys 
60 65 70 

CAATACGAGG ACATGGTGGT GGGGAATTC 272 

(2) INFORMATION FOR SEQ ID NO: 11: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 72 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11: 

Trp lie lie Ala Pro Leu Asp Tyr Glu Ala Tyr His Cys <*lu Gly Val 
15 10 15 

Cys Asp Phe Pro Leu Arg Ser His Leu Glu Pro Thr Asn His Ala lie 
20 25 30 

He Gin Thr Leu Leu Asn Ser Met Ala Pro Asp Ala Ala Pro Ala Ser 
35 40 45 

Cys Cys Val Pro Ala Arg Leu Ser Pro He Ser He Leu Tyr He Asp 
50 55 60 

Ala Ala Asn Asn Val Val Tyr Lys 
65 70 

(2) INFORMATION FOR SEQ ID NO: 12: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 272 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS : single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA ^genomic) 

(vi) ORIGINAL SOURCE: 

(A) ORGANISM: mouse 

(vii) IMMEDIATE SOURCE: 
<B) CLONE: tnV2 



WO 95/16035 



PCT/US94/14030 



(ix) FEATURE: 

(A) NAME /KEY: CDS 

(B) LOCATION: 28. .243 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12: 

GGATCCAAGG AGCTCGGCTG GGACGAC TGG ATT ATC GCG CCC CTA GAG TAC 51 

Trp lie lie Ala Pro Leu Glu Tyr 
1 5 

GAG GCC TAT CAC TGC GAG GGC GTG TGC GAC TTT CCG CTG CGC TCG CAC 99 
Glu Ala Tyr His Cys Glu Gly Val Cys Asp Phe Pro Leu Arg Ser His 
10 15 20 

CTT GAG CCC ACT AAC CAT GCC ATC ATT CAG ACG CTG ATG AAC TCC ATG 14 7 

Leu Glu Pro Thr Asn His Ala lie lie Gin Thr Leu Met Asn Ser Met 
25 30 35 40 

GAC CCG GGC TCC ACC CCG CCT AGC TGC TGC GTT CCC ACC AAA CTG ACT 195 
Asp Pro Gly Ser Thr Pro Pro Ser Cys Cys Val Pro Thr Lys Leu Thr 
45 50 55 

CCC ATT AGC ATC CTG TAC ATC GAC GCG GGC AAT AAT GTA GTC TAC AAG 24 3 

Pro lie Ser lie Leu Tyr lie Asp Ala Gly Asn Asn Val Val Tyr Lys 
60 65 70 

CAATACGAGG ACATGGTGGT GGGGAATTC 272 



(2) INFORMATION FOR SEQ ID NO: 13: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 72 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

<ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 13: 

Trp lie lie Ala Pro Leu Glu Tyr Glu Ala Tyr His Cys Glu Gly Val 
15 10 15 

Cys Asp Phe Pro Leu Arg Ser His Leu Glu Pro Thr Asn His Ala lie 
20 25 30 

lie Gin Thr Leu Met Asn Ser Met Asp Pro <31y Ser Thr Pro Pro Ser 
35 40 45 

Cys Cys Val Pro Thr Lys Leu Thr Pro lie Ser lie Leu Tyr lie Asp 
50 55 60 

Ala Gly Asn Asn Val Val Tyr Lys 
65 70 

(2) INFORMATION FOR SEQ ID NO: 14: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 272 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA {genomic} 

<rsr 



WO 95/16035 



PCT/US94/14030 



(vi) ORIGINAL SOURCE: 

(A) ORGANISM: mouse 

(vii) IMMEDIATE SOURCE: 

(B) CLONE: mV9 

(ix). FEATURE: 

(A) NAME/KEY: CDS 

(B) LOCATION: 28.. 243 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14: 

GGATCCAAGG AGCTCGGCTG GGACGAC TGG ATC ATC GCA CCT CTT GAG TAT 51 

Trp lie He Ala Pro Leu Glu Tyr 
1 5 

GAG GCC TTC CAC TGC GAA GGA CTG TGT GAG TTC CCC TTG CGC TCC CAC 99 
Glu Ala Phe His Cys Glu Gly Leu Cys Glu Phe Pro Leu Arg Ser His 
10 15 20 

TTG GAG CCC ACA AAC CAC GCA GTC ATT CAG ACC CTA ATG AAC TCT ATG 14 7 

Leu Glu Pro Thr Asn His Ala Val He Gin Thr Leu Met Asn Ser Met 
25 30 35 40 

GAC CCT GAA TCC ACA CCA CCC ACT TGT TGT GTG CCT ACA CGG CTG AGT 195 
Asp Pro Glu Ser Thr Pro Pro Thr Cys Cys Val Pro Thr Arg Leu Ser 
45 50 55 

CCT ATT AGC ATC CTC TTC ATC GAC TCT GCC AAC AAC GTG GTG TAT AAA 24 3 

Pro He Ser He Leu Phe He Asp Ser Ala Asn Asn Val Val Tyr Lys 
60 65 70 

CAATACGAGG ACATGGTGGT GGGGAATTC 272 



(2) INFORMATION FOR SEO ID NO: 15: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 72 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 15: 

Trp He lie Ala Pro Leu Glu Tyr Glu Ala Phe His Cys Glu Gly Leu 
15 10 15 

Cys Glu Phe Pro Leu Arg Ser His Leu Glu Pro Thr Asn His Ala Val 
20 25 30 

He Gin Thr Leu Met Asn Ser Met Asp Pro Glu Ser Thr Pro Pro Thr 
35 40 45 

Cys Cys Val Pro Thr Arg Leu Ser Pro He Ser He Leu Phe He Asp 
50 55 60 

Ser Ala Asn Asn Val Val Tyr Lys 
65 70 

(2) INFORMATION FOR SEQ ID NO: 16: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 7 amino acids 

(B) TYPE: amino acid r# 



WO 95/16035 



PCT/US94/14030 



(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: peptide 

(vi) ORIGINAL SOURCE: 

(A) ORGANISM: BMP /TGF -beta consensus sequence 



<xi) SEQUENCE DESCRIPTION: SEQ ID N0:16: 

Trp Xaa Asp Trp lie Xaa Ala 
1 5 

(2) INFORMATION FOR SEQ ID NO: 17: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 27 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS : single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 



(vii) IMMEDIATE SOURCE : 

(B) CLONE: oligonucleotide #1 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO:17: 
CGGATCCTGG VANGAYTGGA THRTNGC 27 
(2) INFORMATION FOR SEQ ID NO: 18: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 6 amino acids 

(B) TYPE: amino acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: peptide 



(vii) IMMEDIATE SOURCE: 

(B) CLONE: BMP/TGF-beta consensus sequence 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18: 

His Ala He Xaa Gin Thr 
1 5 

(2) INFORMATION FOR SEQ ID NO: 19: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 28 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 



(vii) IMMEDIATE SOURCE: 

(B) CLONE: oligonucleotide #2 



WO 95/16035 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 19 
TTTCTAGAAR NGTYTGNACD ATNGCRTG 
(2) INFORMATION FOR SEQ ID NO: 20: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 40 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS : single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE : DNA (genomic) 



(vii) IMMEDIATE SOURCE: 

(B) CLONE: oligonucleotide #3 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 20 
CCACTGCGAG GGCCTTTGCG ACTTCCCTTT GCGTTCGCAC 
(2) INFORMATION FOR SEQ ID NO: 21: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 29 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 



(vii) IMMEDIATE SOURCE: 

(A) LIBRARY: oligonucleotide #4 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 21 
TGCGGATCCA GCCGCTGCAG CCGCAAGCC 
(2) INFORMATION FOR SEQ ID NO: 22: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH : 29 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 



(Vii) IMMEDIATE SOURCE : 

(B) CLONE: oligonucleotide #5 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 22 
GACTCTAGAC TACCTGCAGC CGCAGGCCT 
(2) INFORMATION FOR SEQ ID NO: 23: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 28 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single . 



WO 95/16035 



PCT/US94/14030 



(D) TOPOLOGY: linear 
<ii) MOLECULE TYPE: DNA (genomic) 



(vii) IMMEDIATE SOURCE: 

(A) LIBRARY: oligonucleotide #6 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO:23: 
GCGGATCCAA GGAGCTCGGC TGGGACGA 28 
(2) INFORMATION FOR SEQ ID NO:24: 

( i ) SEQUENCE CHARACTERISTICS : 

(A) LENGTH: 28 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS : single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 



(vii) IMMEDIATE SOURCE: 

(B) CLONE: oligonucleotide #7 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO:24: 
GGAATTCCCC ACCACCATGT CCTCGTAT 28 



(2) INFORMATION FOR SEQ ID NO: 25: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 1171 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 



(vii) IMMEDIATE SOURCE: 

(B) CLONE: Human VL-1 protein 

(ix) FEATURE: 

(A) NAME/KEY: CDS 

(B) LOCATION: 2. .964 

(ix) FEATURE: 

(A) NAME /KEY: mat_peptide 

(B) LOCATION: 605.. 964 



(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:25: 

G AAT TCG GAT CTC TCG CAC ACT CCT CTC CGG AGA CAG AAG TAT TTG 46 
Asn Ser Asp Leu Ser His Thr Pro Leu Arg Arg Gin Lys Tyr Leu 
-201-200 -195 -190 

TTT GAT GTG TCC ATG CTC TCA GAC AAA GAA GAG CTG GTG GGC <3CG GAG 94 
Phe Asp Val Ser Met Leu Ser Asp Lys -Glu Glu Leu Val <31y Ala Glu 
-185 -180 -175 

G>2 



WO 95/16035 



PCTAJS94/14030 



CTG CGG CTC TTT CGC CAG GCG CCC TCA GCG CCC TGG GGG CCA CCA GCC 142 
Leu Arg Leu Phe Arg Gin Ala Pro Ser Ala Pro Trp Gly Pro Pro Ala 
-170 -165 -160 -155 

GGG CCG CTC CAC GTG CAG CTC TTC CCT TGC CTT TCG CCC CTA CTG CTG 190 
Gly Pro Leu His Val Gin Leu Phe Pro Cys Leu Ser Pro Leu Leu Leu 
-150 -145 -140 



■GAC GCG CGG ACC CTG GAC CCG CAG GGG GCG CCG CCG GCC GGC TGG GAA 238 
Asp Ala Arg Thr Leu Asp Pro Gin Gly Ala Pro Pro Ala Gly Trp Glu 
-135 -130 -125 

GTC TTC GAC GTG TGG CAG GGC CTG CGC CAC CAG CCC TGG AAG CAG CTG 286 
Val Phe Asp Val Trp Gin Gly Leu Arg His Gin Pro Trp Lys Gin Leu 
-120 -115 -no 

TGC TTG GAG CTG CGG GCC GCA TGG GGC GAG CTG GAC GCC GGG GAG GCC 334 
Cys Leu Glu Leu Arg Ala Ala Trp Gly Glu Leu Asp Ala Gly Glu Ala 
-105 -100 -95 

GAG GCG CGC GCG CGG GGA CCC CAG CAA CCG CCG CCC CCG GAC CTG CGG 382 
Glu Ala Arg Ala Arg Gly Pro Gin Gin Pro Pro Pro Pro Asp Leu Arg 
-90 -85 -80 -75 

AGT CTG GGC TTC GGC CGG AGG GTG CGG CCT CCC CAG GAG CGG GCC CTG 430 
Ser Leu Gly Phe Gly Arg Arg Val Arg Pro Pro Gin Glu Arg Ala Leu 
-70 -65 -60 

CTG GTG GTA TTC ACC AGA TCC CAG CGC AAG AAC CTG TTC GCA GAG ATG 478 
Leu Val Val Phe Thr Arg Ser Gin Arg Lys Asn Leu Phe Ala Glu Met 
-55 -50 -45 

CGC GAG CAG CTG GGC TCG GCC GAG GCT GCG GGC CCG GGC GCG GGC GCC 526 
Arg Glu Gin Leu Gly Ser Ala Glu Ala Ala Gly Pro Gly Ala Gly Ala 
-40 -35 -30 

GAG GGG TCG TGG CCG CCG CCG TCG GGC GCC CCG GAT GCC AGG CCT TGG 574 
Glu Gly Ser Trp Pro Pro Pro Ser Gly Ala Pro Asp Ala Arg Pro Trp 
-25 -20 -15 

CTG CCC TCG CCC GGC CGC CGG CGG CGG CGC ACG GCC TTC GCC AGT CGC 622 
Leu Pro Ser Pro Gly Arg Arg Arg Arg Arg Thr Ala Phe Ala Ser Arg 
-10 -5 i 5 

CAT GGC AAG CGG CAC GGC AAG AAG TCC AGG CTA CGC TGC AGC AAG AAG 670 
His Gly Lys Arg His Gly Lys Lys Ser Arg Leu Arg Cys Ser Lys Lys 
10 15 20 



' CTG CAC GTG AAC TTC AAG GAG CTG GGC TGG GAC GAC TGG ATT ATC 718 
Leu His Val Asn Phe Lys Glu Leu Gly Trp Asp Asp Trp lie lie 
25 30 35 

C CTG GAG TAC GAG GCC TAT CAC TGC GAG GGT GTA TGC GAC TTC 766 
Leu Glu Tyr Glu Ala Tyr His Cys Glu Gly Val Cys Asp Phe 
45 50 



"C TCG CAC CTG GAG CCC ACC AAC CAC GCC ATC ATC CAG ACG 814 
1 Ser His Leu Glu Pro Thr Asn His Ala lie lie Gin Thr 
60 65 70 

'CC ATG GAC CCC GGC TCC ACC CCG CCC AGC. TGC TGC GTG 862 
r Met Asp Pro Gly Ser Thr Pro Pro Ser Cys Cys Val 
75 80 85 

\CT CCC ATC AGC ATT CTA TAC ATC GAC GCG GGC AAT 910 
hr Pro lie Ser lie Leu Tyr lie Asp Ala Gly Asn 
95^3 100 



WO 95/16035 



PCT/US94/14030 



AAT GTG GTC TAC AAG CAG TAC GAG GAC ATG GTG GTG GAG TCG TGC GGC 958 
Asn Val Val Tyr Lys Gin Tyr Glu Asp Met Val Val Glu Ser Cys Gly 
105 110 115 

TGC AGG TAGCGGTGCC TTTCCCGCCG CCTTGGCCCG GAACCAAGGT GGGCCAAGGT 1014 
Cys Arg 
120 

CCGCCTTGCA GGGGAGGCCT GGCTGCAGAG AGGCGGAGGA GGAAGCTGGC GCTGGGGGAG 1074 

GCTGAGGGTG AGGGAACAGC CTGGATGTGA GAGCCGGTGG GAGAGAAGGG AGCGCACCTT 1134 

CCCAGTAACT TCTACCTGCC AGCCCAGAGG GAAATAT 1171 

(2) INFORMATION FOR SEQ ID NO: 26: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 321 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 26: 

Asn Ser Asp Leu Ser His Thr Pro Leu Arg. Arg Gin Lys Tyr Leu Phe 
-201 -200 -195 -190 

Asp Val Ser Met Leu Ser Asp Lys Glu Glu Leu Val Gly Ala Glu Leu 
-185 -180 -175 -170 

Arg Leu Phe Arg Gin Ala Pro Ser Ala Pro Trp Gly Pro Pro Ala Gly 
-165 -160 -155 

Pro Leu His Val Gin Leu Phe Pro Cys Leu Ser Pro Leu Leu Leu Asp 
-150 -145 -140 

Ala Arg Thr Leu Asp Pro Gin Gly Ala Pro Pro Ala Gly Trp Glu Val 
-135 -130 -125 

Phe Asp Val Trp Gin Gly Leu Arg His Gin Pro Trp Lys Gin Leu Cys 
-120 -115 -110 

Leu Glu Leu Arg Ala Ala Trp Gly Glu Leu Asp Ala Gly Glu Ala Glu 
-105 -100 -95 -90 

Ala Arg Ala Arg Gly Pro Gin Gin Pro Pro Pro Pro Asp Leu Arg Ser 
-85 -80 -75 

Leu Gly Phe Gly Arg Arg Val Arg Pro Pro Gin Glu Arg Ala Leu Leu 
-70 -65 -60 

Val Val Phe Thr Arg Ser Gin Arg Lys Asn Leu Phe Ala Glu Met Arg 
-55 -50 -45 

Glu Gin Leu Gly Ser Ala Glu Ala Ala Gly Pro Gly Ala Gly Ala Glu 
-40 -35 -30 

Gly Ser Trp Pro Pro Pro Ser Gly Ala Pro Asp Ala Arg Pro Trp Leu 
-25 -20 -15 -10 

Pro Ser Pro Gly Arg Arg Arg Arg Arg Thr Ala Phe Ala Ser Arg His 
-5 15 

Gly Lys Arg His Gly Lys Lys Ser Arg Leu Arg Cys Ser Lys Lys Pro 
10 15 ^ 20 



WO 95/16035 



PCT/US94/14030 



Leu His Val Asn Phe Lys Glu Leu Gly Trp Asp Asp Trp lie lie Ala 
25 30 35 

Pro Leu Glu Tyr Glu Ala Tyr His Cys Glu Gly Val Cys Asp Phe Pro 
40 45 50 55 

Leu Arg Ser His Leu Glu Pro Thr Asn His Ala lie He Gin Thr Leu 
60 65 70 

Met Asn Ser Met Asp Pro Gly Ser Thr Pro Pro Ser Cys Cys Val Pro 
75 80 85 

Thr Lys Leu Thr Pro He Ser He Leu Tyr He Asp Ala Gly Asn Asn 
90 95 100 

Val Val Tyr Lys Gin Tyr Glu Asp Met Val Val Glu Ser Cys Gly Cys 
105 HO 115 

Arg 
120 

(2) INFORMATION FOR SEQ ID NO: 27: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 1233 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS : single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 

(vii) IMMEDIATE SOURCE : 

(B) CLONE: DNA encoding BMP2 propeptide /BMP- 12 mature 
peptide 

<ix) FEATURE: 

(A) NAME/KEY: CDS 

(B) LOCATION: 1..1233 

( ix ) FEATURE : 

(A) NAME /KEY: mat_peptide 

(B) LOCATION: 847.. 1233 

<xi) SEQUENCE DESCRIPTION: SEQ ID NO:27: 

ATG GTG GCC GGG ACC CGC TGT CTT CTA GCG TTG CTG CTT CCC CAG GTC 48 
Met Val Ala Gly Thr Arg Cys Leu Leu Ala Leu Leu Leu Pro Gin Val 
-282 -280 -275 -270 

CTC CTG GGC GGC GCG GCT GGC CTC GTT CCG GAG CTG GGC CGC AGG AAG 96 
Leu Leu Gly Gly Ala Ala Gly Leu Val Pro Glu Leu Gly Arg Arg Lys 
-265 -260 -255 

TTC GCG GCG GCG TCG TCG GGC CGC CCC TCA TCC CAG CCC TCT GAC -GAG 144 
Phe Ala Ala Ala Ser Ser Gly Arg Pro -Ser Ser Gin Pro Ser Asp Glu 
-250 -245 -240 -235 

GTC CTG AGC GAG TTC GAG TTG CGG CTG CTC AGC ATG TTC -GGC CTG AAA 192 
Val Leu Ser Glu Phe Glu Leu Arg Leu Leu Ser Met Phe Gly Leu Lys 
-230 -225 -220 

CAG AGA CCC ACC CCC AGC AGG GAC <3CC GTG GTG CCC CCC TAC ATG CTA 240 
Gin Arg Pro Thr Pro Ser Arg Asp Ala Val Val Pro Pro Tyr Met Leu 
-215 -210 -205 



WO 95/16035 



PCT/US94/14030 



GAC CTG TAT CGC AGG CAC TCA GGT CAG CCG GGC TCA CCC GCC CCA GAC 288 
Asp Leu Tyr Arg Arg His Ser Gly Gin Pro Gly Ser Pro Ala Pro Asp 
-200 -195 -190 

CAC CGG TTG GAG AGG GCA GCC AGC CGA GCC AAC ACT GTG CGC AGC TTC 336 
His Arg Leu Glu Arg Ala Ala Ser Arg Ala Asn Thr Val Arg Ser Phe 
-185 -180 -175 

CAC CAT GAA GAA TCT TTG GAA GAA CTA CCA GAA ACG AGT GGG AAA ACA 384 
His His Glu Glu Ser Leu Glu Glu Leu Pro Glu Thr Ser Gly Lys Thr 
"170 -165 -160 -155 

ACC CGG AGA TTC TTC TTT AAT TTA AGT TCT ATC CCC ACG GAG GAG TTT 432 
Thr Arg Arg Phe Phe Phe Asn Leu Ser Ser He Pro Thr Glu Glu Phe 
-150 -145 -140 

ATC ACC TCA GCA GAG CTT CAG GTT TTC CGA GAA CAG ATG CAA GAT GCT 480 
He Thr Ser Ala Glu Leu Gin Val Phe Arg Glu Gin Met Gin Asp Ala 
-135 -130 -125 

TTA GGA AAC AAT AGC AGT TTC CAT CAC CGA ATT AAT ATT TAT GAA ATC 528 
Leu Gly Asn Asn Ser Ser Phe His His Arg He Asn He Tyr Glu He 
-120 -us -no 

ATA AAA CCT GCA ACA GCC AAC TCG AAA TTC CCC GTG ACC AGA CTT TTG 576 
He Lys Pro Ala Thr Ala Asn Ser Lys Phe Pro Val Thr Arg Leu Leu 
-105 -100 -95 

GAC ACC AGG TTG GTG AAT CAG AAT GCA AGC AGG TGG GAA AGT TTT GAT 624 
Asp Thr Arg Leu Val Asn Gin Asn Ala Ser Arg Trp Glu Ser Phe Asp 
-90 -85 -80 -75 

GTC ACC CCC GCT GTG ATG CGG TGG ACT GCA CAG GGA CAC GCC AAC CAT 672 
Val Thr Pro Ala Val Met Arg Trp Thr Ala Gin Gly His Ala Asn His 
-70 -65 -60 

GGA TTC GTG GTG GAA GTG GCC CAC TTG GAG GAG AAA CAA GGT GTC TCC 720 
Gly Phe Val Val Glu Val Ala His Leu Glu Glu Lys Gin Gly Val Ser 
-55 -50 -45 

AAG AGA CAT GTT AGG ATA AGC AGG TCT TTG CAC CAA GAT GAA CAC AGC 768 
Lys Arg His Val Arg He Ser Arg Ser Leu His Gin Asp Glu His Ser 
-40 -35 -30 

TGG TCA CAG ATA AGG CCA TTG CTA GTA ACT TTT GGC CAT GAT GGA AAA 816 
Trp Ser Gin He Arg Pro Leu Leu Val Thr Phe Gly His Asp Glv Lvs 
-25 -20 -15 

GGG CAT CCT CTC CAC AAA AGA GAA AAA CGT ACG GCG TTG GCC GGG ACG 864 
Gly His Pro Leu His Lys Arg Glu Lys Arg Thr Ala Leu Ala Gly Thr 
-10 -5 is 

CGG ACA GCG CAG GGC AGC GGC GGG GGC GCG -GGC CGG GGC CAC GGG -CGC 912 
Arg Thr Ala Gin Gly Ser Gly Gly Gly Ala Gly Arg Gly His Gly Arg 
10 15 20 

AGG GGC CGG AGC CGC TGC AGC CGC AAG CCG TTG CAC GTG GAC TTC AAG 960 
Arg Gly Arg Ser Arg Cys Ser Arg Lys Pro Leu His Val Asp Phe Lys 
25 30 35 

GAG CTC GGC TGG GAC GAC TGG ATC ATC GCG CCG CTG GAC TAC GAG GCG 1008 
Glu Leu Gly Trp Asp Asp Trp He He Ala Pro Leu Asp Tyr Glu Ala 
40 45 50 



TAC CAC TGC GAG GGC CTT TGC GAC TTC CCT TTG CGT TCG CAC CTC GAG 1056 
Tyr His Cys Glu Gly Leu Cys Asp Phe Pro Leu Arg Ser His Leu Glu 
55 60 65 70 



WO 95/16035 



PCT/US94/14030 



CCC ACC AAC CAT GCC ATC ATT CAG ACG CTG CTC AAC TCC ATG GCA CCA 1104 
Pro Thr Asn His Ala lie He Gin Thr Leu Leu Asn Ser Met Ala Pro 
75 80 85 

GAC GCG GCG CCG GCC TCC TGC TGT GTG CCA GCG CGC CTC AGC CCC ATC 1152 
Asp Ala Ala Pro Ala Ser Cys Cys Val Pro Ala Arg Leu Ser Pro He 
90 95 100 

AGC ATC CTC TAC ATC GAC GCC GCC AAC AAC GTT GTC TAC AAG CAA TAC 1200 
Ser He Leu Tyr He Asp Ala Ala Asn Asn Val Val Tyr Lys Gin Tyr 
105 110 115 

GAG GAC ATG GTG GTG GAG GCC TGC GGC TGC AGG 1233 
Glu Asp Met Val Val Glu Ala Cys Gly Cys Arg 
120 125 



(2) INFORMATION FOR SEQ ID NO: 28: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 411 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:28: 

Met Val Ala Gly Thr Arg Cys Leu Leu Ala Leu Leu Leu Pro Gin Val 
-282 -280 -275 -270 

Leu Leu Gly Gly Ala Ala Gly Leu Val Pro Glu Leu Gly Arg Arg Lys 
-265 -260 -255 

Phe Ala Ala Ala Ser Ser Gly Arg Pro Ser Ser <31n Pro Ser Asp Glu 
-250 -245 -240 -235 

Val Leu Ser Glu Phe Glu Leu Arg Leu Leu Ser Met Phe Gly Leu Lys 
-230 -225 -220 

Gin Arg Pro Thr Pro Ser Arg Asp Ala Val Val Pro Pro Tyr Met Leu 
-215 -210 -205 

Asp Leu Tyr Arg Arg His Ser Gly Gin Pro Gly Ser Pro Ala Pro Asp 
-200 -195 -190 

His Arg Leu Glu Arg Ala Ala Ser Arg Ala Asn Thr Val Arg Ser Phe 
-185 -180 -175 

His His Glu Glu Ser Leu Glu Glu Leu Pro Glu Thr Ser <31y Lys Thr 
-170 -165 -160 -155 

Thr Arg Arg Phe Phe Phe Asn Leu Ser Ser He Pro Thr Glu Glu Phe 
-150 -145 -140 

He Thr Ser Ala Glu Leu Gin Val Phe Arg Glu Gin Met Gin Asp Ala 
-135 -130 -125 

Leu Gly Asn Asn Ser Ser Phe His His Arg He Asn He Tyr Glu He 
-120 -115 -110 

lie Lys Pro Ala Thr Ala Asn Ser Lys Phe Pro Val Thr Arg Leu Leu 
-105 -100 -95 

. Asp Thr Arg Leu Val Asn Gin Asn Ala Ser Arg Trp Glu Ser Phe Asp 
-90 -85 -80 -75 



WO 95/16035 



PCT/US94/14030 



Val Thr Pro Ala Val Met Arg Trp Thr Ala Gin Gly His Ala Asn His 
-70 -65 -60 

Gly Phe Val Val Glu Val Ala His Leu Glu Glu Lys Gin Gly Val Ser 
-55 -50 -45 

Lys Arg His Val Arg lie Ser Arg Ser Leu His Gin Asp Glu His Ser 
-40 -35 -30 

Trp Ser Gin He Arg Pro Leu Leu Val Thr Phe Gly His Asp Gly Lys 
-25 -20 -15 

Gly His Pro Leu His Lys Arg Glu Lys Arg Thr Ala Leu Ala Gly Thr 
-10 -5 15 

Arg Thr Ala Gin Gly Ser Gly Gly Gly Ala Gly Arg Gly His Gly Arg 
10 15 20 

Arg Gly Arg Ser Arg Cys Ser Arg Lys Pro Leu His Val Asp Phe Lys 
25 30 35 

Glu Leu Gly Trp Asp Asp Trp He He Ala Pro Leu Asp Tyr Glu Ala 
40 45 50 

Tyr His Cys Glu Gly Leu Cys Asp Phe Pro Leu Arg Ser His Leu Glu 
55 60 65 70 

Pro Thr Asn His Ala He He Gin Thr Leu Leu Asn Ser Met Ala Pro 
75 80 85 

Asp Ala Ala Pro Ala Ser Cys Cys Val Pro Ala Arg Leu Ser Pro He 
90 95 100 

Ser He Leu Tyr He Asp Ala Ala Asn Asn Val Val Tyr Lys Gin Tyr 
105 110 115 

Glu Asp Met Val Val Glu Ala Cys Gly Cys Arg 
120 125 

(2) INFORMATION FOR SEQ ID NO: 29: 

<i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 1203 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS : single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 

(vii) IMMEDIATE SOURCE: 

(B) CLONE: murine MV1 

(ix) FEATURE: 

(A) NAME/KEY: CDS 

(B) LOCATION: 2.. 721 

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 29: 

A AAG TTC TGC CTG GTG CTG GNG NCG GTG ACG *GCC TCG -GAG AGC AGN 46 
Lys Phe Cys Leu Val Leu X01 X02 Val Thr Ala Ser <31u Ser X03 
15 10 15 

CNG CTG GCC CTG AGA CGA CTG GGC TTC GGC TGN CCG GGC GGT GGC GAC 94 
X04 Leu Ala Leu Arg Arg Leu Gly Phe Gly X05 Pro Gly Gly Gly Asp 
20 25, 30 



WO 95/16035 



PCT/US94/14030 



GGC GGC GGC ACT GCG GNC GAG GAG CGC GCG CTG TTG GTG ATC TCC TCC 142 
Gly Gly Gly Thr Ala X06 Glu Glu Arg Ala Leu Leu Val lie Ser Ser 
35 40 45 

CGT ACG CAA AGG AAA GAG AGT CTG TTC CGG GAG ATC CGA GCC CAG GCC ' 190 

Arg Thr Gin Arg Lys Glu Ser Leu Phe Arg Glu lie Arg Ala Gin Ala 
50 55 60 

CGT GCT CTC CGG GCC GCT GCA GAG CCG CCA CCG GAT CCA GGA CCA GGC 238 
Arg Ala Leu Arg Ala Ala Ala Glu Pro Pro Pro Asp Pro Gly Pro Gly 
65 70 75 

GCT GGG TCA CGC AAA GCC AAC CTG GGC GGT CGC AGG CGG CAG CGG ACT 2B6 
Ala Gly Ser Arg Lys Ala Asn Leu Gly Gly Arg Arg Arg Gin Arg Thr 
80 85 90 95 

GCG CTG GCT GGG ACT CGG GGA GNG NAG GGA AGC GGT GGT GGC GGC GGT 334 
Ala Leu Ala Gly Thr Arg Gly X07 X08 Gly Ser Gly Gly Gly Gly Gly 
100 105 no 

GGC GGT GGC GGC GGC GGC GGC GGC GGC GGC GGC GGC GGC GGC GGC GCA 382 
Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Ala 
115 120 ' 125 

GGC AGG GGC CAC GGG CGC AGA GGC CGG AGC CGC TGC GGT C<3C AAG TCA 430 
Gly Arg Gly His Gly Arg Arg Gly Arg Ser Arg Cys Gly Arg Lys Ser 
130 135 140 

CTG CAC GTG GAC TTT AAG GAG CTG GGC TGG GAC GAC TGG ATC ATC GCG 478 
Leu His Val Asp Phe Lys Glu Leu Gly Trp Asp Asp Trp He He Ala 
145 150 155 

CCA TTA GAC TAC GAG GCA TAC CAC TGC GAG GGC GTT TGC GAC TTT CCT 526 
Pro Leu Asp Tyr Glu Ala Tyr His Cys Glu Gly Val Cys Asp Phe Pro 
160 165 170 175 

CTG CGC TCG CAC CTG GAG CCT ACC AAC CAC GCC ATC ATT CAG ACG CTG 574 
Leu Arg Ser His Leu Glu Pro Thr Asn His Ala He He Gin Thr Leu 
180 185 190 

CTC AAC TCC ATG GCG CCC GAC GCT GCG CCA GCC TCC TGC TGC GTG CCC 622 
Leu Asn Ser Met Ala Pro Asp Ala Ala Pro Ala Ser Cys Cys Val Pro 
195 200 205 

GCA AGG CTC AGT CCC ATC AGC ATT CTC TAC ATC GAT GCC <3CC AAC AAC 670 
Ala Arg Leu Ser Pro He Ser He Leu Tyr He Asp Ala Ala Asn Asn 
210 215 220 

GTG GTC TAC AAG CAG TAC GAA GAC ATG GTG GTG GAG -GCC TGC GGC TGC 718 
Val Val Tyr Lys Gin Tyr Glu Asp Met Val Val Glu Ala Cys <31y Cys 
225 230 235 



AGG TAGCATGCGG TCTGGGGAGG GTCTGGCCGC CCAGGACCCT AGCTCAAGAG 771 

Arg 

240 



CAGGTGTCAT CAGGCCCGAG GGACGGCGGA CTATGGCCTC TGCCAGCACA GAGGAGAGCA 831 

CACAGTTAAC ACTCACATTT ACACACTCCT TCACTCACGC ACATGTTTAC CGTGGACGGC 891 

AGGCGCTAAA AGCCTTGCTT ATTTGCTACC ATTGATACAA ACCTCTGTCC TTTTCGGGAG 951 

AGGGAAGGGC ATCTGTGTTT ATGTTGCAGT AATTGGCACT AAATCCAAGT AGAAATGGGT 1011 

TAGCATTGGA TTCTCCTTTT AGTTGGAGGC <3GTGTGGCTG GATTCCTGAC GTTGGATATG 1071 

gagtgcactg cagggctggg atacccagat tctctggagt gggcattggg aaccttcaaa 1131 

<p9 



WO 95/16035 



PCT/US94/14030 



AGTAAGGAGC CACTGGGGCT TGGGAGGGAG CACCCGGTTC CTAAACAAGT CTGATGTGTA 1191 
CTGCTCAGTT TG 1203 

(2) INFORMATION FOR SEQ ID NO: 30: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 240 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 30: 

Lys Phe Cys Leu Val Leu X01 X02 Val Thr Ala Ser Glu Ser X03 X04 
15 10 15 

Leu Ala Leu Arg Arg Leu Gly Phe Gly X05 Pro Gly Gly Gly Asp Gly 
20 25 30 

Gly Gly Thr Ala X06 Glu Glu Arg Ala Leu Leu Val lie Ser Ser Arg 
35 40 45 

Thr Gin Arg Lys Glu Ser Leu Phe Arg Glu lie Arg Ala Gin Ala Arg 
50 55 60 

Ala Leu Arg Ala Ala Ala Glu Pro Pro Pro Asp Pro Gly Pro Gly Ala 
65 70 75 80 

Gly Ser Arg Lys Ala Asn Leu Gly Gly Arg Arg Arg Gin Arg Thr Ala 
85 90 95 

Leu Ala Gly Thr Arg Gly X07 X08 Gly Ser Gly Gly Gly Gly Gly Gly 
100 105 110 

Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Ala Gly 
115 120 125 

Arg Gly His Gly Arg Arg Gly Arg Ser Arg Cys Gly Arg Lys Ser Leu 
130 135 140 

His Val Asp Phe Lys Glu Leu Gly Trp Asp Asp Trp lie lie Ala Pro 
145 150 155 160 

Leu Asp Tyr Glu Ala Tyr His Cys Glu Gly Val Cys Asp Phe Pro Leu 
165 170 175 

Arg Ser His Leu Glu Pro Thr Asn His Ala lie lie Gin Thr Leu Leu 
180 185 190 

Asn Ser Met Ala Pro Asp Ala Ala Pro Ala Ser Cys Cys Val Pro Ala 
195 200 205 

Arg Leu Ser Pro lie Ser lie Leu Tyr lie Asp Ala Ala Asn Asn Val 
210 215 220 

Val Tyr Lys Gin Tyr Glu Asp Met Val Val Glu Ala Cys Gly Cys Arg 
225 230 235 240 

(2) INFORMATION FOR SEQ ID NO:31: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 1046 base pairs 

(B) TYPE: nucleic acid 

10 



WO 95/16035 



PCT/US94/14030 



(C) STRANDEDNESS : single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 
(iii) HYPOTHETICAL: NO 
(iv) ANTI- SENSE: NO 

(vii) IMMEDIATE SOURCE: 

(B) CLONE: MURINE MV2 

(ix) FEATURE: 

(A) NAME/KEY: CDS 

(B) LOCATION: 2. .790 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 31: 

A AGA AAA CAA GCT TGC ATT CCT GCA GGT CCG ACT CTA AGA GGA TCC 46 
Arg Lys Gin Ala Cys lie Pro Ala Gly Pro Thr Leu Arg Gly Ser 
1 5 10 15 

TCA GGG ACC CAA CCC AGG CCG GCT GGG AAG TCT TTC GAC GTG TGG CAG 94 
Ser Gly Thr Gin Pro Arg Pro Ala Gly Lys Ser Phe Asp Val Trp Gin 
20 25 30 

GGC CTG CGC CCT CAG CCT TGG AAG CAG CTG TGC CTG GAG TTG CGG GCA 142 
Gly Leu Arg Pro Gin Pro Trp Lys Gin Leu Cys Leu Glu Leu Arg Ala . 
35 40 45 

GCC TGG GGT GAG CTG GAC RCC GGG GAT ACG GGG GCG CGC GCG AGG GGT 190 
Ala Trp Gly Glu Leu Asp X01 Gly Asp Thr Gly Ala Arg Ala Arg Gly 
50 55 60 

CCC CAG CAG CCA CCG CCT CTG GAC CTG CGG AGT CTG GGC TTC GGT CGG 238 
Pro Gin Gin Pro Pro Pro Leu Asp Leu Arg Ser Leu Gly Phe Gly Arg 
65 70 75 

AGG GTG AGA CCG CCC CAG GAG CGC GCC CTG CTT GTA <5TG TTC ACC AGA 286 
Arg Val Arg Pro Pro Gin Glu Arg Ala Leu Leu Val Val Phe Thr Arg 
80 85 90 95 

TCG CAG CGC AAG AAC CTG TTC ACT GAG ATG CAT GAG CAG CTG GGC TCT 334 
Ser Gin Arg Lys Asn Leu Phe Thr Glu Met His Glu Gin Leu Gly Ser 
100 105 110 

GCA GAG GCT GCG GGA GCC GAG GGG TCA TGT CCA GCG -CCG TCG GGC TCC 382 
Ala Glu Ala Ala Gly Ala Glu Gly Ser Cys Pro Ala Pro Ser Gly Ser 
115 120 125 

CCA GAC ACC GGG TCT TGG CTG CCC TCG CCC GGC CGC CGG CGG CGA CGC 430 
Pro Asp Thr Gly Ser Trp Leu Pro Ser Pro Gly Arg Arg Arg Arg Arg 
130 135 140 

ACC GCC TTC GCC AGC CGT CAC GGC AAG CGA CAT GGC AAG AAG TCC AGG 478 
Thr Ala Phe Ala Ser Arg His Gly Lys Arg His Gly Lys Lys Ser Arg 
145 150 155 

CTG CGC TGC AGC AGA AAG CCT CTG CAC GTG AAT TTT AAG GAG TTA GGC 526 
Leu Arg Cys Ser Arg Lys Pro Leu His Val Asn Phe Lys Glu Leu Gly 
160 165 170 175 

TGG GAC GAC TGG ATT ATC GCG CCC CTA GAG TAC GAG GCC TAT CAC TGC 574 
Trp Asp Asp Trp lie lie Ala Pro Leu Glu Tyr Glu Ala Tyr His Cys 
180 185 190 

7( 



WO 95/16035 



PCT/US94/14030 



GAG GGC GTG TGC GAC TTT CCG CTG CGC TCG CAC CTT GAG CCC ACT AAC 622 
Glu Gly Val Cys Asp Phe Pro Leu Arg Ser His Leu Glu Pro Thr Asn 
195 200 205 

CAT GCC ATC ATT CAG ACG CTG ATG AAC TCC ATG GAC CCG GGC TCC ACC 670 
His Ala He He Gin Thr Leu Met Asn Ser Met Asp Pro Gly Ser Thr 
210 215 220 

CCG CCT AGC TGC TGC GTT CCC ACC AAA CTG ACT CCC ATT AGC ATC CTG 718 
Pro Pro Ser Cys Cys Val Pro Thr Lys Leu Thr Pro He Ser He Leu 
225 230 235 

TAC ATC GAC GCG GGC AAT AAT GTN GTC TAC AAG CAG TAT GAG GAC ATG 766 
Tyr He Asp Ala Gly Asn Asn X02 Val Tyr Lys Gin Tyr Glu Asp Met 
240 245 250 255 

GTG GTG GAG TCC TGC GGC TGT AGG TAGCGGTGCT GTCCCGCCAC CTGGGCCAGG 820 
Val Val Glu Ser Cys Gly Cys Arg 
260 

GACCATGGAG GGAGGCCTGA CTGCCGAGAA AGGAGCAGGA GCTGGCCTTG GAAGAGGCCA 880 

CAGGTGGGGG ACAGCCTGAA AGTAGGAGCA CAGTAAGAAG CAGCCCAGCC TTCCCAGAAC 94 0 

CTTCCAATCC CCCAACCCAG AAGCAGCTAA GGGGTTTCAC AACTTTTGGC CTTGCCAGCC 1000 

TGGAAAGACT AGACAAGAGG GATTCTTCTC TTTTTATTAT GGCTTG 104 6 

(2) INFORMATION FOR SEQ ID NO: 32: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 263 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:32: 

Arg Lys Gin Ala Cys He Pro Ala Gly Pro Thr Leu Arg Gly Ser Ser 
1 5 10 15 

Gly Thr Gin Pro Arg Pro. Ala Gly Lys Ser Phe Asp Val Trp Gin Gly 
20 25 30 

Leu Arg Pro Gin Pro Trp Lys Gin Leu Cys Leu Glu Leu Arg Ala Ala 
35 40 45 

Trp Gly Glu Leu Asp X01 Gly Asp Thr Gly Ala Arg Ala Arg Gly Pro 
50 55 60 

Gin Gin Pro Pro Pro Leu Asp Leu Arg Ser Leu Gly Phe Gly Arg Arg 
65 70 75 80 

Val Arg Pro Pro Gin Glu Arg Ala Leu Leu Val Val Phe Thr Arg Ser 
85 90 95 

Gin Arg Lys Asn Leu Phe Thr Glu Met His *Glu Gin Leu Gly Ser Ala 
100 105 110 

Glu Ala Ala Gly Ala Glu Gly Ser Cys Pro Ala Pro Ser <31y Ser Pro 
115 120 125 

Asp Thr Gly Ser Trp Leu Pro Ser Pro <3ly Arg Arg Arg Arg Arg Thr 
130 135 140 

7^ 



WO 95/16035 



PCT/US94/14030 



Ala Phe Ala Ser Arg His Gly Lys Arg His Gly Lys Lys Ser Arg Leu 
145 150 155 160 

Arg Cys Ser Arg . Lys Pro Leu His Val Asn Phe Lys Glu Leu Gly Trp 
165 170 175 

Asp Asp Trp lie lie Ala Pro Leu Glu Tyr Glu Ala Tyr His Cys Glu 
180 185 190 

Gly Val Cys Asp Phe Pro Leu Arg Ser His Leu Glu Pro Thr Asn His 
195 200 205 

Ala lie lie Gin Thr Leu Met Asn Ser Met Asp Pro Gly Ser Thr Pro 
210 215 220 

Pro Ser Cys Cys Val Pro Thr Lys Leu Thr Pro lie Ser lie Leu Tyr 
225 230 235 240 

lie Asp Ala Gly Asn Asn X02 Val Tyr Lys Gin Tyr Glu Asp Met Val 
245 250 255 

Val Glu Ser Cys Gly Cys Arg 
260 

(2) INFORMATION FOR SEQ ID NO: 33: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 1345 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS : single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 
(iii) HYPOTHETICAL: NO 
(iv) ANTI-SENSE: NO 



(vii) IMMEDIATE SOURCE: 

(B) CLONE: HUMAN VI -1 

(ix) FEATURE: 

(A) NAME/KEY: CDS 

(B) LOCATION: 138.. 1301 

(ix) FEATURE: 

(A) NAME/KEY: mat _peptide 

(B) LOCATION: 990.. 1301 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 33: 

AACTATAGCA CCTGCAGTCC CTGGTCTTGG GTGTAGGGGT GCGCTCCTGG TCCCGCGGCT 60 

CAGGGATATG CAGTGACCAA TGGGTTGTTG -GCCTGATGGG ACTTTTGGCT TGCTAAACCA 120 

AAGCTCGGTT CGGATAG CCC GGG CGA AGA CGT CCG CTG CTC TGG GCC AGG 170 
Pro Gly Arg Arg Arg Pro Leu Leu Trp Ala Arg 
-284 -280 -275 

CTG GCA GCG TTC AGG CTG GGG CAG AGA GGC GGA GTC <3GG CGC TGG CTC 218 
Leu Ala Ala Phe Arg Leu <31y Gin Arg Arg Gly Val Gly Arg Trp Leu 
-270 -265 -260 

73 



WO 95/16035 



PCT/US94/14030 



CAA CAG GCC TGG CTC CCA CAT CGA AGA CAG CTG GGC CAT TTG CTG TTA 266 
Gin Gin Ala Trp Leu Pro His Arg Arg Gin Leu Gly His Leu Leu Leu 
-255 -250 -245 

GGA GGC CCC GCG CTG ACA GTG TGC AGG ATT TGC TCT TAC ACA GCT CTT * 314 

Gly Gly Pro Ala Leu Thr Val Cys Arg lie Cys Ser Tyr Thr Ala Leu 
-240 -235 -230 

TCT CTC TGT CCC TGC CGG TCC CCC GCA GAC GAA TCG GCA GCC GAA ACA 362 
Ser Leu Cys Pro Cys Arg Ser Pro Ala Asp Glu Ser Ala. Ala Glu Thr 
.225 -220 -215 -210 

GGC CAG AGC TTC CTG TTC GAC GTG TCC AGC CTT AAC GAC GCA GAC GAG 410 
Gly Gin Ser Phe Leu Phe Asp Val Ser Ser Leu Asn Asp Ala Asp Glu 
-205 -200 -195 

GTG GTG GGT GCC GAG CTG CGC GTG CTG CGC CGG GGA TCT CCA GAG TCG 458 
Val Val Gly Ala Glu Leu Arg Val Leu Arg Arg Gly Ser Pro Glu Ser 
-190 -185 -180 

GGC CCA GGC AGC TGG ACT TCT CCG CCG TTG CTG CTG CTG TCC ACG TGC 506 
Gly Pro Gly Ser Trp Thr Ser Pro Pro Leu Leu Leu Leu Ser Thr Cys 
-175 -170 -165 

CCG GGC GCC GCC CGA GCG CCA CGC CTG CTG TAC TCG CGG GCA GCT GAG 554 
Pro Gly Ala Ala Arg Ala Pro Arg Leu Leu Tyr Ser Arg Ala Ala Glu 
-160 -155 -150 

CCC CTA GTC GGT CAG CGC TGG GAG GCG TTC GAC GTG GCG GAC GCC ATG €02 
Pro Leu Val Gly Gin Arg Trp Glu Ala Phe Asp Val Ala Asp Ala Met 
-145 -140 -135 -130 

AGG CGC CAC CGT CGT GAA CCG CGC CCC CCC CGC GCG TTC TGC CTC TTG 650 
Arg Arg His Arg Arg Glu Pro Arg Pro Pro Arg Ala Phe Cys Leu Leu 
-125 -120 -115 

CTG CGC GCA GTG GCA GGC CCG GTG CCG AGC CCG TTG GCA CTG CGG CGA 698 
Leu Arg Ala Val Ala Gly Pro Val Pro Ser Pro Leu Ala Leu Arg Arg 
-110 -105 -100 

CTG GGC TTC GGC TGG CCG GGC GGA GGG GGC TCT GCG X3CA GAG GAG CGC 746 
Leu Gly Phe Gly Trp Pro Gly Gly Gly Gly Ser Ala Ala Glu Glu Arg 
-95 -90 -85 

GCG GTG CTA GTC GTC TCC TCC CGC ACG CAG AGG AAA GAG A<3C TTA TTC 794 
Ala Val Leu Val Val Ser Ser Arg Thr Gin Arg Lys Glu Ser Leu Phe 
-80 -75 -70 

CGG GAG ATC CGC GCC CAG GCC CGC GCG CTC GGG GCC GCT CTG GCC TCA 842 
Arg Glu lie Arg Ala Gin Ala Arg Ala Leu Gly Ala Ala Leu Ala Ser 
-65 -60 -55 -50 

GAG CCG CTG CCC GAC CCA GGA ACC GGC ACC GCG TCG CCA AGG GCA GTC 890 
Glu Pro Leu Pro Asp Pro Gly Thr Gly Thr Ala Ser Pro Arg Ala Val 
-45 -40 -35 

ATT GGC GGC CGC AGA CGG AGG AGG ACG GCG TTG GCC GGG AGG CGG ACA 938 
lie Gly Gly Arg Arg Arg Arg Arg Thr Ala Leu Ala Gly Thr Arg Thr 
-30 -25 -20 

GCG CAG GGC AGC GGC GGG GGC GCG GGC CGG GGC CAC GGG CGC AGG GGC 986 
Ala Gin Gly Ser Gly Gly Gly Ala Gly Arg Gly His Gly Arg Arg Gly 
-15 -10 -5 



CGG AGC CGC TGC AGC CGC AAG CCG TTG CAC GTG GAC TTC AAG <3AG CTC 1034 
Arg Ser Arg Cys Ser Arg Lys Pro Leu His Val Asp Phe Lys Glu Leu 



1 5 10 15 



WO 95/16035 



PCT/US94/14030 



GGC TGG GAC GAC TGG ATC ATC GCG CCG CTG GAC TAC GAG GCG TAC CAC 1082 
Gly Trp Asp Asp Trp He He Ala Pro Leu Asp Tyr Glu Ala Tyr His 
20 25 30 

TGC GAG GGC CTT TGC GAC TTC CCT TTG CGT TCG CAC CTC GAG CCC ACC -1130 
Cys Glu Gly Leu Cys Asp Phe Pro Leu Arg Ser His Leu Glu Pro Thr 
35 40 .45 

o AAC CAT GCC ATC ATT CAG ACG CTG CTC AAC TCC ATG GCA CCA GAC GCG 1178 
Asn His Ala He He Gin Thr Leu Leu Asn Ser Met Ala Pro Asp Ala 
50 55 60 

GCG CCG GCC TCC TGC TGT GTG CCA GCG CGC CTC AGC CCC ATC AGC ATC 1226 
Ala Pro Ala Ser Cys Cys Val Pro Ala Arg Leu Ser Pro He Ser He 
65 70 75 

CTC TAC ATC GAC GCC GCC AAC AAC GTT GTC TAC AAG CAA TAC -GAG GAC 1274 
Leu Tyr He Asp Ala Ala Asn Asn Val Val Tyr Lys Gin Tyr Glu Asp 
80 85 90 95 

ATG GTG GTG GAG GCC TGC GGC TGC AGG TAGCGCGCGG GCCGGGGAGG 1321 
Met Val Val Glu Ala Cys Gly Cys Arg 
100 

GGGCAGCCAC GCGGCCGAGG ATCC 1345 



(2) INFORMATION FOR SEQ ID NO: 34: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 388 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

<ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 34: 

Pro Gly Arg Arg Arg Pro Leu Leu Trp Ala Arg Leu Ala Ala Phe Arg 
-284 -280 -275 -270 

Leu Gly Gin Arg Arg Gly Val Gly Arg Trp Leu <31n Gin Ala Trp Leu 
-265 -260 -255 

Pro His Arg Arg Gin Leu Gly His Leu Leu Leu Gly Gly Pro Ala Leu 
-250 -245 -240 

Thr Val Cys Arg He Cys Ser Tyr Thr Ala Leu Ser Leu Cys Pro Cys 
-235 -230 -225 

Arg Ser Pro Ala Asp Glu Ser Ala Ala Glu Thr Gly X31n Ser Phe Leu 
-220 -215 -210 -205 

Phe Asp Val Ser Ser Leu Asn Asp Ala Asp Glu Val Val Gly Ala <31u 
-200 -195 -190 

Leu Arg Val Leu Arg Arg Gly Ser Pro Glu Ser Gly Pro -Gly Ser Trp 
-185 -180 -175 

Thr Ser Pro Pro Leu Leu Leu Leu Ser Thr Cys Pro <31y Ala Ala Arg 
-170 -165 -160 

Ala Pro Arg Leu Leu Tyr Ser Arg Ala Ala Glu Pro Leu Val Gly Gin 
-155 -150 -145 

Arg Trp Glu Ala Phe Asp Val Ala Asp Ala Met Arg Arg His Arg Arg 
-140 -135 ^ -130 -125 

*7J 



WO 95/16035 



PCT/US94/J4030 



Glu Pro Arg Pro Pro Arg Ala Phe Cys Leu Leu Leu Arg Ala Val Ala 
-120 -lis -no 

Gly Pro Val Pro Ser Pro Leu Ala Leu Arg Arg Leu Gly Phe Gly Trp 
-105 -100 -95 

Pro Gly Gly Gly Gly Ser Ala Ala Glu Glu Arg Ala Val Leu Val Val 
-90 -85 -80 

Ser Ser Arg Thr Gin Arg Lys Glu Ser Leu Phe Arg Glu lie Arg Ala 
-75 -70 -65 

Gin Ala Arg Ala Leu Gly Ala Ala Leu Ala Ser Glu Pro Leu Pro Asp 
-60 -55 -50 -45 

Pro Gly Thr Gly Thr Ala Ser Pro Arg Ala Val lie Gly Gly Arg Arg 
-40 -35 -30 

Arg Arg Arg Thr Ala Leu Ala Gly Thr Arg Thr Ala Gin Gly Ser Gly 
-25 -20 -15 

Gly Gly Ala Gly Arg Gly His Gly Arg Arg Gly Arg Ser Arg Cys Ser 
-10 -5 l 

Arg Lys Pro Leu His Val Asp Phe Lys Glu Leu Gly Trp Asp Asp Trp 
5 10 15 20 

lie He Ala Pro Leu Asp Tyr Glu Ala Tyr His Cys Glu Gly Leu Cys 
25 30 35 

Asp Phe Pro Leu Arg Ser His Leu Glu Pro Thr Asn His Ala He He 
40 45 50 

Gin Thr Leu Leu Asn Ser Met Ala Pro Asp Ala Ala Pro Ala Ser Cys 
55 60 65 

Cys Val Pro Ala Arg Leu Ser Pro He Ser He Leu Tyr He Asp Ala 
70 75 80 

Ala Asn Asn Val Val Tyr Lys Gin Tyr Glu Asp Met Val Val Glu Ala 
85 90 95 100 

Cys Gly Cys Arg 

(2) INFORMATION FOR SEQ ID NO: 35: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 17 base pairs 

(B) TYPE : nucleic acid 

(C) STRANDEDNESS : single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 

(iii) HYPOTHETICAL: NO 

(iv) ANTI -SENSE: NO 

(vi) ORIGINAL SOURCE: 

(C) INDIVIDUAL ISOLATE: primer number 8 

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 35: 
TGTATGCGAC TTCCCGC 



WO 95/16035 



PCT/US94/14030 



What is claimed is: 

1 . A DNA molecule comprising an isolated DN A sequence encoding a 
BMP- 12 related protein. 
5 2. A DNA molecule according to claim 1, wherein said DNA sequence 

is selected from the group consisting of: 

(a) nucleotides #496, #571 or #577 to #882 of SEQ ID NO:l; 

(b) nucleotides #605 or #659 to #964 of SEQ ID NO:25; and 

(c) sequences which hybridize to (a) or (b) under stringent hybridization 
10 conditions and encode a BMP- 12 related protein which exhibits the ability to 

form tendon/ligament-like tissue. 

3. A DNA molecule comprising the DNA sequence of claim 1 wherein 
said DNA sequence is selected from the group consisting of: 

(a) nucleotides encoding for amino acids #-25, #1 or #3 to #104 of 
15 SEQ ID NO:2; 

(b) in a 5' to 3' direction, nucleotides encoding a propeptide selected 
from the group consisting of native BMP- 12 propeptide and a BMP protein 
propeptide; and nucleotides encoding for amino acids #-25, #1 or #3 to #104 of 
SEQ ID NO:2; and 

20 (c) nucleotides encoding for amino acids #1 or #19 to #120 of SEQ ID 

NO:26; 

(d) in a 5' to 3' direction, nucleotides encoding a propeptide selected 
from the group consisting of native BMP- 12 propeptide and a BMP protein 
propeptide; and nucleotides encoding for amino acids #1 or #19 to #120 of SEQ 

25 ID NO:26; 

(e) sequences which hybridize to any of (a) through (d) under 
stringent hybridization conditions and encode a BMP-12 related protein which 
exhibits the ability to form cartilage and/or bone. 

4. A host cell transformed with a DNA molecule according to claim 

30 1. 

5. A host cell transformed with the DNA molecule of claim 2. 

6. A host cell transformed with the DNA molecule of claim 3. 



11 



WO 95/16035 



PCI7US94/14030 



7. An isolated DNA molecule having a sequence encoding a BMP- 12 
protein which is characterized by the ability to induce the formation of 
tendon/ligament-like tissue, said DNA molecule comprising a DNA sequence 
selected from the group consisting of: 

5 (a) nucleotide #496, #571 or #577 to #882 of SEQ ID NO:l; 

(b) nucleotide #605 or #659 to #964 of SEQ ID NO:25; and 

(c) naturally occurring allelic sequences and equivalent degenerative 
codon sequences of (a) or (b). 

8. A host cell transformed with the DNA molecule of claim 7. 
10 9. A vector comprising a DNA molecule of claim 7 in operative 

association with an expression control sequence therefor. 

10. A host cell transformed with the vector of claim 9. 

11. A method for producing a purified BMP-12 protein, said method 
comprising the steps of: 

15 (a) culturing a host cell transformed with a DNA molecule according to 

claim 2, comprising a nucleotide sequence encoding a BMP-12 related protein; 
and 

(b) recovering and purifying said BMP-12 related protein from the culture 
medium. 

20 12. A method for producing a purified BMP-12 related protein said 

method comprising the steps of: 

(a) culturing a host cell transformed with a DNA molecule according to 
claim 3, comprising a nucleotide sequence encoding a BMP-12 related protein; 
and 

25 (b) recovering and purifying said BMP-12 related protein from the culture 

medium. 

13. A method for producing a purified BMP-12 related protein said 
method comprising the steps of: 

(a) culturing a host cell transformed with a DNA molecule according to 
30 claim 7, comprising a nucleotide sequence encoding a BMP-12 related protein; 
and 



WO 95/16035 



PCT/US94/14030 



(b) recovering and purifying said BMP-12 related protein from the culture 
medium. 

14. A purified polypeptide comprising an amino acid sequence selected 
from the following group: 

5 (a) from amino acid #-25 to amino acid #104 as set forth in SEQ ID 

NO:2; 

(b) from amino acid #1 to amino acid #104 as set forth in SEQ ID NO:2. 

(c) from amino acid #3 to amino acid #104 as set forth in SEQ ID NO:2. 

(d) from amino acid #1 to amino acid #120 as set forth in SEQ ID 
10 NO:26; and 

(d) from amino acid #19 to amino acid #120 as set forth in SEQ ID 

NO:26. 

15. A purified polypeptide wherein said polypeptide is in the form of a 
dimer comprised of two subunits, each with the amino acid sequence of claim 

15 14. 

16. A purified protein produced by the steps of 

(a) culturing a cell transformed with a DNA molecule comprising the 
nucleotide sequence from nucleotide #496, #571 or #577 to #882 as shown in 
SEQ ID NO:l; and 

20 (b) recovering and purifying from said culture medium a protein 

comprising the amino acid sequence from amino acid #-25, amino acid #1 or 
amino acid #3 to amino acid #104 as shown in SEQ ID NO:2. 

17. A purified BMP-12 related protein characterized by the ability to 
induce the formation of tendon/ligament-like tissue. 

25 18. A pharmaceutical composition comprising an effective amount of the 

BMP-12 related protein of claim 17 in admixture with a pharmaceutically 
acceptable vehicle. 

19. A method for inducing tendon/ligament-like tissue formation in a 
patient in need of same comprising administering to said patient an effective 

30 amount of the composition of claim 18. 



13 



WO 95/16035 



PCT/US94/14030 



20. A pharmaceutical composition for tendon/ligament-like tissue healing 
and tissue repair said composition comprising an effective amount of the protein 
of a BMP- 12 related protein in a pharmaceutical^ acceptable vehicle. 

21. A method for treating tendinitis, or other tendon or ligament defect in 
5 a patient in need of same, said method comprising administering to said patient 

an effective amount of the composition of claim 20. 

22. A chimeric DNA molecule comprising a DNA sequence encoding a 
propeptide from a member of the TGF-/3 superfamily of proteins linked in 
correct reading frame to a DNA sequence encoding a BMP- 12 related 

10 polypeptide. 

23. A chimeric DNA molecule according to claim 22, wherein the 
propeptide is the propeptide from BMP-2. 

24. A heterodimeric protein molecule comprising one monomer having 
the amino acid sequence of the polypeptide of claim 14, and one monomer 

15 having the amino acid sequence of a protein of the TGF-0 superfamily. 

25. A method for inducing tendon/ligament-like tissue formation in a 
patient in need of same comprising administering to said patient an effective 
amount of a composition comprising a protein encoded by a DNA sequence 
selected from the group consisting of: 

20 (a) nucleotides #496, #571 or #577 to #882 of SEQ ID NO:l; 

(b) nucleotides #845 or #899 to #1204 of SEQ ID NO:3; 

(c) nucleotides #605 or #659 to #964 of SEQ ID NO:25; and 

(d) sequences which hybridize to (a), (b) or (c) under stringent 
hybridization conditions and encode a protein which exhibits the ability to 

25 form tendon/ligament-like tissue. 

26. A method for inducing tendon/ligament-like tissue formation in a 
patient in need of same comprising administering to said patient an effective 
amount of the composition comprising a tendon/ligament-like tissue inducing 
protein having an amino acid sequence selected from the group consisting of: 

30 (a) amino acids #-25, #1 or #3 to #104 of SEQ ID NO:2; 

(b) amino acids #1 or #19 to #120 of SEQ ID NO:4; 

(c) amino acids #1 or #19 to #120 of SEQ ID NO:26; and 



$0 



95/16035 



PCT/US94/14030 



(d) mutants and/or variants of (a), (b) or (c) which exhibit the ability to 
form tendon and/or ligament. 

27. A pharmaceutical composition for tendon/ligament-like tissue repair, 
said composition comprising an effective amount of a BMP-12 related protein in 

5 a pharmaceutical^ acceptable vehicle. 

28. A method for treating tendinitis, or other tendon or ligament defect 
in a patient in need of same, said method comprising administering to said 
patient an effective amount of the composition of claim 27. 



WO 95/16035 



PCT/US94/14030 



FIG 1/1 

COMPARISON OF HUMAN Vl-1 VS. HUMAN MP-52 



Vl-1 

1 


Ser 
AGC 


Arg 
CGC 
i t i 


Cys 
TGC 


Ser 

AGC 

t i 


Arg 
CGC 


Lys 

AAG 

i i i 


Pro 
CCG 


Leu 
TTG 


His 
CAC 


Val 
GTG 


Asp 
GAC 


Phe 
TTC 


Lys 
AAG 


Glu 

GAG 
i i 


Leu 

CTC 
i 


MP52 
1 


GCT 
Ala 


i i i 
CGC 
Arg 


i j | 

TGC 
Cys 


i i 

AGT 
Ser 


II 

CGG 
Arg 


i i i 
AAG 
Lys 


j 

GCA 
Ala 


II 
CTG 
Leu 


II 

CAT 
His 


II 

GTC 
Val 


II 
AAC 
Asn 


ii! 

TTC 
Phe 


III 
AAG 
Lys 


i i i 
GAC ATG 
Asp Met 


16 
46 


Gly 

GGC 
i t I 


Trp 
TGG 
! 1 1 


Asp 

GAC 
i t i 


Asp 
GAC 


Trp 
TGG 


He 
ATC 
i 1 * 


He 
ATC 


Ala 
GCG 


Pro 
CCG 


Leu 
CTG 


Asp 
GAC 

II 


Tyr 
TAC 


Glu 
GAG 


Ala 
GCG 


Tyr 
TAC 


46 
16 


i i i 
GGC 
Gly 


r i i 
TGG 
Trp 


i t i 
GAC 
Asp 


II! 

GAC 
Asp 


II! 
TGG 
Trp 


i 1 i 
ATC 
He 


III 
ATC 
He 


II 

GCA 
Ala 


II 

CCC 
Pro 


II 

CTT 
Leu 


GAG 
Glu 


III 
TAC 
Tyr 


III 
GAG 
Glu 


1 1 

GCT 
Ala 


1 I 
TTC 
Phe 


31 
91 


His 
CAC 


Cys 
TGC 


Glu 
GAG 


Gly 
GGC 


Leu 
CTT 
1 i i 


Cys 
TGC 


Asp 
GAC 


Phe 
TTC 


Pro 
CCT 


Leu 

TTG 

i t 


Arg 
CGT 


Ser 
TCG 


His 
CAC 


Leu 
CTC 


Glu 
GAG 


91 
31 


II! 
CAC 
His 


ill 
TGC 
Cys 


II 

GAG 
Glu 


1! 

GGG 
Gly 


1 i i 
CTG 
Leu 


II 

TGC 
Cys 


III 
GAG 
Glu 


II 

TTC 
Phe 


III 
CCA 
Pro 


i i 

TTG 
Leu 


II 

CGC 
Arg 


III 
TCC 
Ser 


j i 

CAC 
His 


III 
CTG 
Leu 


III 
GAG 
Glu 


46 
121 


Pro 

CCC 
i i i 


Thr 
ACC 


Asn 
AAC 


His 

CAT 

i i i 


Ala 
GCC 


He 
ATC 


He 
ATT 


Gin 
CAG 
i ■ f 


Thr 

ACG 
i i 


Leu 

CTG 
i i i 


Leu 
CTC 


Asn 
AAC 


Ser 
TCC 


Met 

ATG 
i i i 


Ala 
GCA 


121 
46 


i i i 
CCC 
Pro 


!! 

ACG 
Thr 


II 

AAT 
Asn 


i t i 
CAT 
His 


II 

GCA 
Ala 


II 
GTC 
Val 


II 

ATC 
He 


i i i 
CAG 
Gin 


i i 

ACC 
Thr 


t i i 
CTG 
Leu 


1 

ATG 
Met 


III 
AAC 
Asn 


III 
TCC 
Ser 


i i i 
ATG 
Met 


j 

GAC 
Asp 


61 

TOT 

161 


Pro 

LCA 
1 I 


Asp 

1 1 


Ala 


Ala 


Pro 

l l 


Ala 


Ser Cys 
TCC TGC 


Cys 
TGT 


Val 

GTG 
i i i 


Pro 
CCA 


Ala 
GCG 


Arg 


Leu 

CTC 
i i 


Ser 

AGC 

t i 


181 
61 


1 1 

CCC 
Pro 


1 t 

GAG 
Glu 


j 

TCC 
Ser 


1 

ACA 
Thr 


1 t 

CCA 
Pro 


1! 

CCC 
Pro 


II III 
ACC TGC 
Thr Cys 


Ml til 
TGT GTG 
Cys Val 


II 

CCC 
Pro 


1! 

ACG 
Thr 


II 

CGG 
Arg 


i i 

CTG 
Leu 


i i 

AGT 
Ser 


76 
226 


Pro 

CCC 
i i i 


lie 

ATC 
i i t 


Ser 

AGC 
i i i 


He 

ATC 
i i i 


Leu 

CTC 
i i t 


Tyr 
TAC 


He Asp 

ATC GAC 

i i mi 


Ala 
GCC 


Ala 
GCC 


Asn 

AAC 

i i i 


Asn 
AAC 


Val 

GTT 

i i 


Val 

GTC 

i i 


Tyr 
TAC 


226 
76 


i i i 
CCC 
Pro 


i i > 
ATC 
lie 


i i i 
AGC 
Ser 


i i i 
ATC 
He 


i i t 
CTC 
Leu 


i ! 

TTC 
Phe 


ii i i i 
ATT GAC 
He Asp 


! 

TCT 
Ser 


III 
GCC 
Ala 


i i i 
AAC 
Asn 


III 
AAC 
Asn 


i i 

GTG 
Val 


i i 

GTG 
Val 


i j 

TAT 
Tyr 


91 
271 


Lys 

AAG 
i i i 


Gin 

CAA 
i i 


Tyr 

TAC 
i i 


Glu 
GAG 


Asp 
GAC 


Met 
ATG 


Val 
GTG 


val 
GTG 


Glu 
GAG 


Ala 
GCC 

1 


Cys 

TGC 
i 1 


Gly 

GGC 
i i i 


Cys 
TGC 


Arg 
AGG 




271 
91 


i I i 
AAG 
Lys 


i i 

CAG 
Gin 


i i 

TAT 
Tyr 


III 
GAG 
Glu 


III 
GAC 
Asp 


II! 
ATG 
Met 


II 

GTC 
Val 


III 
GTG 
Val 


III 
GAG 
Glu 


TCG 
Ser 


ii lit 
TGT GGC 
Cys Gly 


III 
TGC 
Cys 


III 
AGG 
Arg 





Homology at the nucleotide level: 249/312 « 79.8% 
Homology at the amino acid level: 84/104 = 80.8% 



A /A 



SUBSTITUTE SHEET (RULE 26) 



WORLD INTELLKTUAL PROPERTY ORGANIZATION 
International Bureau 




PCT 

INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) 



(51) International Patent Classification 6 : 

C12N 15/12, 15/70, 15/62, 1/21, C07K 
14/51 



A3 



(11) International Publication Number: 
(43) International Publication Date: 



WO 95/16035 

15 June 1995(15.06.95) 



(21) International Application Number: PCT/US94/14030 

(22) International Filing Date: 6 December 1994 (06.12.94) 



(30) Priority Data: 

08/164,103 
08/217,780 
08/333,576 



7 December 1993 (07.12.93) US 
25 March 1994 (25.03.94) US 
2 November 1994 (02.1 1.94) US 



(71) Applicants: GENETICS INSTITUTE, INC. [US/US]; 87 

CambridgcPark Drive, Cambridge, MA 02140 (US). 
PRESIDENT AND FELLOWS OF HARVARD COLLEGE 
[US/US]; 17 Quincy Street, Cambridge, MA 02139 (US). 

(72) Inventors: CELESTE, Anthony, J.; 86 Packard Street, Hudson, 

MA 01749 (US). WOZNEY, John, M; 59 Old Bolton Road, 
Hudson. MA 01749 (US). ROSEN, Vicki, A.; 127 Kilsyth 
Road #7, Brookline, MA 02146 (US). WOLFMAN, Neil, 
M; 30 Rolling Lane, Dover, MA 02030 (US). THOMSEN, 
Gerald, H; 201 Bayview Terrace, Port Jefferson, NY 1 1777 
(US). MELTON, Douglas, A; 22 Slocum Road, Lexington, 
MA 02173 (US). 



(74) Agent LAZAR, Steven, R; Genetics Institute, Inc. 
CambridgePark Drive, Cambridge, MA 02140 (US). 



87 



(81) Designated States: AU, CA, CN, Ft HU, JP, KP, KR, NO, 
RU, European patent (AT, BE, CH. DE, DK, ES, FR, GB, 
GR, IE, IT, LU, MC, NL, PT, SE), OAPI patent (BF, BJ, 
CF, CG, CI CM, GA, GN, ML, MR, NE, SN, TD, TG). 



Published 

With international search report. 

Before the expiration of the time limit for amending the 
claims and to be republished in the event of the receipt of 
amendments. 

(88) Date of publication of the international search report: 

13 July 1995(13.07.95) 



(54) Tide: BMP- 12, BMP- 13 AND TENDON-INDUCING COMPOSITIONS THEREOF 
(57) Abstract 



Bone morpbogenetic proteins BMP- 12 and BMP- 13 have been cloned. Compositions of these proteins with tendon/ligamem-like 
tissue inducing activity are disclosed The compositions are useful in the treatment of tendinitis and tendon or ligament defects and in 
related tissue repair. 



FOR THE PURPOSES OF INFORMATION ONLY 

Codes used to identify States party to the PCT on the front pages of pamphlets publishing international 
applications under the PCT. 



AT 


Austria 


CB 


United Kingdom 


MR 


Mauritania 


AU 


Australia 


GE 


Georgia 


MW 


Malawi 


BB 


Barbados 


GN 


Guinea 


NE 


Niger 


BE 


Belgium 


CR 


Greece 


NL 


Netherlands 


BF 


Burkina Faso 


HU 


Hungary 


NO 


Norway 


BC 


Bulgaria 


IE 


Ireland 


NZ 


New Zealand 


BJ 


Benin 


IT 


Italy 


PL 


Poland 


BR 


Brazil 


JP 


Japan 


PT 


Portugal 


BY 


Belarus 


KE 


Kenya 


RO 


Romania 


CA 


Canada 


KG 


Kyrgystan 


RU 


Russian Federation 


CF 


Central African Republic 


KP 


Democratic People's Republic 


SD 


Sudan 


CC 


Congo 




of Korea 


SE 


Sweden 


CH 


Switzerland 


KR 


Republic of Korea 


SI 


Slovenia 


CI 


Cote d*l voire 


KZ 


Kazakhstan 


SK 


Slovakia 


CM 


Cameroon 


LI 


Liechtenstein 


SN 


Senegal 


CH 


China 


LK 


Sri Lanka 


TD 


Chad 


CS 


Czechoslovakia 


LI) 


Luxembourg 


TG 


Togo 


d 


Czech Republic 


LV 


Latvia 


TJ 


Tajikistan 


DE 


Germany 


MC 


Monaco 


TT 


Trinidad and Tobago 


DK 


Denmark 


MD 


Republic of Moldova 


UA 


Ukraine 


ES 


Spain 


MG 


Madagascar 


US 


United States of America 


Fl 


Finland 


ML 


Mali 


uz 


Uzbekistan 


PR 


France 


MN 


Mongolia 


VN 


Viet Nam 


CA 


Gabon 









INTERNATIONAL SEARCH REPORT 



Inter nal Application No 

PCT/US 94/14030 



A. CLASSIFICATION OF SUBJECT MATTER — 

IPC 6 C12N15/12 C12N15/70 C12N15/62 C12N1/21 C07K14/51 
A61K38/17 


According to International Patent Classification (IPC) or to both national classification and IPC 




B. FIELDS SEARCHED 


Minimum documentation searched (classification system followed by classification symbols) 

tpp n?M rn7k AfiiK 


Documentation searched other than minimum documentation to the extent that such documents are included in the fields searched 


Electronic data base consulted during the international search (name of data base and, where practical, search terms used) 


C. DOCUMENTS CONSIDERED TO BE RELEVANT 


Category* 


Citation of document, with indication, where appropriate, of the relevant passages 


Relevant to claim No. 


X 


W0,A,93 16099 (BI0PHARM GESSELLSCHAFT ZUR 

BI0TECHN0L0GISCHEN ENTWICKLUNG VON 

PHARMAKA) 19 August 1993 

cited In the application 

see page 4, paragraph 3 

see page 7, paragraph 3 

see page 9, paragraph 2 


25,26 


A 


W0, A, 91 18047 (GENENTECH, INC.) 28 

November 1991 

cited in the application 

see page 4, line 4 - line 22 


22,23 


A 


W0, A, 93 00432 (GENETICS INSTITUTE, INC.) 7 

January 1993 

cited in the application 

see page 4, line 21 * line 33 

see page 8, line 15 - page 10, line 2 


1-28 


j j Further documents are listed in the continuation of box C. 


[)( j Patent family members arc listed in annex. 


* Special categories of cited documents : 

"A* document defining the general state of the art which is not 

considered to be of particular relevance 
"E* earlier document but published on or after the international 

filing date 

"L* document which may throw doubts on priority daim(s) or 
which is cited to establish the publication date of another 
citation or other special reason (as specified) 

'O* document referring to an oral disclosure, use, exhibition or 
other means 

*P" document published prior to the international filing date but 
later than the priority date claimed 


"T later document published after the international filing date 
or priority date and not in conflict with the application but 
cited to understand the principle or theory underlying the 
invention 

"X" document of particular relevance; the daimed invention 
cannot be considered novel or cannot be considered to 
involve an inventive step when the document is taken alone 

*Y* document of particular relevance; the daimed invention 
cannot be considered to involve an inventive step when the 
document is combined with one or more other such docu- 
ments, such combination being obvious to a person skilled 
in the art 

document member of the same patent family 


Date of the 


actual completion of the international search 


Date of mailing of the international search report 


19 May 1995 






Name and mailing address of the ISA 

European Patent Office, P.B. 581 8 Patentlaan 2 
NL - 2280 HV Rijswijk 
Tel. (+ 31-70) 340-2040, Tx. 31 651 cpo n), 
Fax (+31-70) 340-3016 


Authorized officer 

Montero Lopez, B 



Form PCT/1SA/21D (second Khtet} (July 1993) 



INTERNATIONAL SEARCH REPORT 



.ernational application No. 



PCT/US94/ 14030 



Box I Observations where certain claims were found unsearchable (Continuation of item I of first sheet) 



This international search report has not been established in respect of certain claims under Article 17(2)(a) for the following reasons: 



1. X Claims Nos.: 

because they relate to subject matter not required to be searched by this Authority, namely: 

Remark: Although claims 19,21,25,26 and 28 are directed to a mehtod of 
treatment of the human/animal body the search has been carried out and 
based on the alleged effects of the composition. 



□ 



be^se'toey relate to parts of the international application that do not comply with the prescribed requirements to such 
an extent that no meaningful international search can be carried out, specifically: 



□ 



beoiuse'uiey are dependent claims and are not drafted in accordance with the second and third sentences of Rule 6.4(a). 



Box JJ Observations where unity of invention is lacking (Continuation of item 2 of first sheet) 



This International Searching Authority found multiple inventions in this international application, as follows: 



I. [""I As all required additional search fees were timely paid by the applicant, this international search report covers all 
searchable claims. 

2t l~] as all searchable daims could be searches without effort justifying an additional fee, this Authority did not invite payment 
of any additional fee. 



3 I I As only some of the required additional search fees were timely paid by the applicant, this international search report 
1 — 1 covers only those claims for which fees were paid, specifically claims Nos^ 



4. No required additional search fees were timely paid by the applicant Cc 
— restricted to the invention first mentioned in the claims; it is covered by 



Consequently, this international search report is 
claims Nos.: 



Remark on Protest [ [ The additional search fees were accompanied by the applicant's protest. 

j | No protest accompanied the payment of additional search fees. 



Form PCT/ISA/210 (continuation of first sheet (1)) (July 1992) 





INTERNATIONAL SEARCH REPORT 

information on patent family members 


Inteh i&I Application No 

PCT/US 94/14030 




Patent document 
cited in search report 


Publication 
date 


Patent family 
member(s) 


Publication 
date 




WO-A-9316099 


19-08-93 


AU-B- 3497193 


03-09-93 



CA-A- 2129820 19-08-93 
EP-A- 0625989 30-11-94 



WO-A-9118047 28-11-91 



US-A- 


5168050 


01-12-92 


AT-T- 


114163 


15-12-94 


DE-D- 


69105205 


22-12-94 


DE-T- 


69105205 


18-05-95 


EP-A- 


0531448 


17-03-93 


ES-T- 


2067238 


16-03-95 



WO-A-9300432 


07-01-93 


AU-B- 


652472 


25-08-94 






AU-A- 


2269992 


25-01-93 






EP-A- 


0592562 


20-04-94 






JP-T- 


6508990 


13-10-94 



Fcm PCT/1S A/210 (pstent family 



0 fjuty 1993) 



This Page is Inserted by IFW Indexing and Scanning 
Operations and is not part of the Official Record 

BEST AVAILABLE IMAGES 

Defective images within this document are accurate representations of the original 
documents submitted by the applicant. 

Defects in the images include but are not limited to the items checked: 

□ BLACK BORDERS 

□ IMAGE CUT OFF AT TOP, BOTTOM OR SIDES 
□fFADED TEXT OR DRAWING 
[^BLURRED OR ILLEGIBLE TEXT OR DRAWING 

□ SKEWED/SLANTED IMAGES 

□ COLOR OR BLACK AND WHITE PHOTOGRAPHS 

□ GRAY SCALE DOCUMENTS 

□ LINES OR MARKS ON ORIGINAL DOCUMENT 

□ REFERENCE(S) OR EXHIBIT(S) SUBMITTED ARE POOR QUALITY 

□ OTHER: . 

IMAGES ARE BEST AVAILABLE COPY. 
As rescanning these documents will not correct the image 
problems checked, please do not report these problems to 
the IFW Image Problem Mailbox.