Skip to main content

Full text of "USPTO Patents Application 09804625"

See other formats


per 



WORLD INTELLECTUAL PROPERTY ORGANIZATION 
International Bureau 




INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) 



(51) International Patent Gassification ^ 
C12N 15/12, C07K 13/00 
C12N5/10, A61K 37/02 
COIN 33/68 



A2 



(11) International Publication Number: 
(43) International Publication Date : 



WO 94/11502 

26 May 1994 (26.05.94) 



(21) International Application Number: PCT/GB93/02367 

(22) International filing Date: 1 7 November 1993 (1 7.1 1.93) 



(30) Priority data: 
9224057.1 
9304677.9 
9304680.3 
9311047.6 
9313763.6 
9316099.2 
9321344.5 



17 November 1992(17.11.92) GB 

8 March 1993 (08.03.93) GB 

8 March 1993 (08.03.93) GB 

28 May 1993(28.05.93) GB 

2 July 1993 (02.07.93) GB 

3 August 1993 (03.08.93) GB 
15 October 1993(15.10.93) GB 



(71) Applicant (for all designated States except US): LUDWIG 
INSTITUTE FOR CANCER RESEARCH [GB/GB]; 
St. Mary's Hospital Medical School, Norfolk Place, Pad- 
dington, London W2 IPG (GB). 



(72) Inventors; and 

(75) Inventors/Applicants (for US only) : MIYAZONO, Kohei 
[JP/SE]; FlogstavSgen 63D, S-752 63 Uppsala (SE). 
DUKE, Peter, Ten [NL/SE]; Flogstavagen 25C, S-752 
63 Uppsala (SE). FRANZEN. Petra [SE/SE]; Linds- 
bergsgatan 15b. S-752 40 Uppsala (SE). YAMASHITA, 
Hidetoshi [JP/SE]; FlogstavSgen 33A, S-752 63 Uppsala 
(SE). HELDIN, Cari-Henrik [SE/SE]; Hesselmans vSg 
35, S-752 63 Uppsala (SE). 

(74) Agent: GILL JENNINGS & EVERY; Broadgate House, 7 
Eldon Street, London EC2M 7LH (GB). 



(81) Designated States: AU, CA, JP, KR, NZ, US, European 
patent (AT, BE, CH, DE, DK, ES, FR, GB, GR, IE, IT, 
LU, MC, NL, PT, SE). 



Published 

Without international search report and to be republished 
upon receipt of that report. 



(54) Title: ACTIVIN RECEPTOR-LIKE KINASES, PROTEINS HAVING SERINE THREONINE KINASE DOMAINS 
AND THEIR USE 



cons.aa G iG 6 V AK E 

MXSFBR - 1 1 liyZT«V(nCGIU^AEVYKAlaJC021TSEQFETV^VICI FPYDHYASWKDRXDI FSDINUOtQaiiOF 

mACta- IIB LI£IKARGRFGCVWKAQ!Ilfl9 DFVAVKI KPtiQDKOSWOSEREZ FSTFGMKHQlUiOF 

inACCa*ZI LLCVXARGRFCCVHKAQU^H EYVAVKIFPIODXOSWQNEyEVYSIKafKHQIILQP 

daf-l . }.^URVGSGRrGKVSRCDYRG EAVAVlCVFNAZD£PAFHKEIEIFEin4UtHI'ZIVWY 

subdomalns i ZI III iv 



llTGFBR- Z X hTPEERXTELCKQfm^VeMKmaajQZYhTfOm SHEDUtNVGSSIARlGIjSHUiSDiOT- C 

BACta- 1 IB IAAEKRGSHI£VEIXUlAnmKGSLI0YIXGNIITWNEU3n/AEl^^ 

mACtR-ZI IGAEKRGTSVDVDIA^I^TAFHEKGSl^Fl-KANVVSWNEIXM 

daf - 1 IGSimVDKiFVTEaAa>VZCyHPSGSUiDFU£tnVNI CTTYNUIRSTASCZAFUaiQIGGSK 
subdomalns v VZ-A 



cons.aa duC N dfc 

hTGFBR- Z 1 - GRPKMPZ VHRDI*KSSNZLVKNDi;rCCLCDrGIiSUU* GPYSSVDDLANSGOVGTARYMAP 

mAcCR- ZZB GECaiia^SIAHROFKSKKVLIJCSDLTAVLADFGIAVRF- • • EPGKPPGD- • THGQVGTltRyMAP 

mActR-zi -DGHKPAZSHimiKSicmauaimyrAciADPGiAucr — eagksagd- - tugovgtorymap 

tJaf - 1 - ESKKPAMAHRl)IKSKNZMyKKDI.TCAIGDlJGLSLSKPEDAASDZI AN • • E1TY1CCGTVRYLAP 

subdomalns VI -B vzz vill 



(57) Abstract 

A new receptor family has been identified, of activin-like kinases. Novel proteins have activin/TGF-p-type I receptor func- 
tionality, and have consequential diagnostic/therapeutic utility. They may have a serine/threonine kinase domain, a DFKSRN or 
DLKSKN sequence in subdomain VIB and/or a GTKRYM sequence in subdomain VIII. 



FOR THE PURPOSES OF INFORMATION ONLY 

Codes used to identify States party to the PCT on the front pages of pamphlets publishing international 
applications under the PCT. 



AT 


Austria 


GB 


United Kingdom 


MR 


Mauritania 


AU 


Australia 


GE 


Georgia 


MW 


Malawi 


BB 


Bartiados 


GN 


Guinea 


NE 


Niger 


BE 


Belgium 


GR 


Greece 


NL 


Netherlands 


BF 


Burkina Faso 


HU 


Hungary 


NO 


Norway 


BC 


Bulgaria 


IE 


Ireland 


NZ 


New Zealand 


BJ 


Benin 


rr 


Italy 


PL 


Poland 


BR 


Brazil . 


JP 


Japan 


PT 


Portugal 


BV 


Belarus 


KE 


Kenya 


RO 


Romania 


CA 


Canada 


KG 


Kyrgystan 


RU 


Russian Federation 


CF 


Central African Republic 


KP 


Democratic People *s Republic 


SD 


Sudan 


CC 


Congo 




of Korea 


SE 


Sweden 


CH 


Switzerland 


KR 


Republic or Korea 


SI 


Slovenia 


CI 


Cote d*lvoire 


KZ 


Kazakhstan 


SK 


Slovakia 


CM 


Cameroon 


LI 


Liechtenstein 


SN 


Senegal 


CN 


China 


LK 


Sri Lanka 


TO 


Chad 


CS 


Czechoslovakia 


14J 


Luxembourg 


TC 


Togo 


CI 


Czech Republic 


LV 


Latvia 


TJ 


Tajikistan 


DE 


Germany 


MC 


Monaco 


TT 


Trinidad and Tohago 


DK 


Denmark 


MD 


Republic of Moldova 


UA 


Ukraine 


es 


Spain 


MG 


Madagascar 


US 


United Sutes of America 


Fl 


Fmland 


ML 


Mali 


uz 


Uzbekistan 


FR 


France 


MN 


Mongolia 


VN 


Vict Nam 


GA 


Gabon 











wo 94/11502 



PCT/GB93/02367 



ACTIVIN RECEPTOR-LIKE KINASES, PROTEINS HAVING 
SERINE THREONINE KINASE DOMAINS AND THEIR USE. 

Field of the Invention 

This invention relates to proteins having 
J 5 serine/ threonine kinase domains, corresponding nucleic acid 

molecules, and their use. 
Background of the Invention 

The transforming growth factor-fl (TGF-fl) superfamily 
consists of a family of structurally-related proteins, 

10 including three different mammalian isof orms of TGF-a (TGF- 
61, B2 and B3), activins, inhibins, miillerian-inhibiting 
substance and bone morphogenic proteins (BMPs) (for reviews 
see Roberts and Spom, (1990) Peptide Growth Factors and 
Their Receptors, Pt.l, Sporn and Roberts, eds. (Berlin: 

15 Springer - Verlag) pp 419-472; Moses et al (1990) Cell §2, 
245-247) . The proteins of the TGF-B superfamily have a 
wide variety of biological activities. TGF-fl acts as a 
growth inhibitor for many cell types and appears to play a 
central role in the regulation of embryonic development, 

20 tissue regeneration, immxino-regulation, as well as in 
fibrosis and carcinogenesis (Roberts and Sporn (199) see 
above) , 

Activins and inhibins were originally identified as 
factors which regulate secretion of follicle-stimulating 

25 hormone secretion (Vale et al (1990) Peptide Growth Factors 
and Their Receptors, Ft. 2, Sporn and Roberts, eds. (Berlin: 
Springer-Verlag) pp. 211-248). Activins were also shown to 
induce the differentiation of haematopoietic progenitor 
cells (Murata et al (1988) Proc. Natl. Acad. Sci. USA fi5# 

30 2434 - 2438; Eto et al (1987) Biochem. Biophys. Res. 
Commun. 142 , 1095-1103) and induce mesoderm formation in 
Xenopus embryos (Smith et ^ (1990) Nature 141, 729-731; 
van den Eijnden-Van Raaij et al (1990) Nature IAS, 732- 
734). 

35 BMPs or osteogenic proteins which induce the formation 

of bone and cartilage when implanted subcutaneous ly (Wozney 
e£ (1988) Science 242, 1528-1534), facilitate neuronal 



wo 94/11502 



PCr/GB93/02367 



differentiation (Paralkar £t ^ (1992) J. Cell Biol. 119 . 
1721-1728) and induce monocyte chemotaxis (Cunningham e£ ^lI 
(1992) Proc, Natl, Acad. Sci. USA 8£^ 11740-11744). 
Mtillerian-inhibiting substance induces regression of the 
5 Miillericin duct in the male reproductive system (Gate et fll 
(1986) Cell 4S, 685-698), and a glial cell line-derived 
neurotrophic factor enhances survival of midbrain 
dopaminergic neurons (Lin et al (1993) Science 260 , 1130- 
1132). The action of these growth factors is mediated 

10 through binding to specific cell surface receptors. 

Within this family, TGF-6 receptors have been most 
thoroughly characterized. By covalently cross-linking 
radio-labelled TGF-B to cell surface molecules followed by 
polyacrylamide gel electrophoresis of the affinity- labelled 

15 complexes, three distinct size classes of cell surface 
proteins (in most cases) have been identified, denoted 
receptor type I (53 kd) , type II (75 kd) , type III or 
betaglycan (a 300 kd proteoglycan with a 120 kd core 
protein) (for a review see Hassague (1992) Cell 6a 1067- 

20 1070) and more recently endoglin (a homodimer of two 95 kd 
subunits) (Cheifetz et ^ (1992) J. Biol. Chem. 267 19027- 
19030) . Current evidence suggests that type I and type II 
receptors are directly involved in receptor signal 
transduction (Segarini et ai (1989) Mol. Endo., 3, 261-272; 

25 Laiho et al (1991) J. Biol. Chem. 266 , 9100-9112) and may 
form a heteromeric complex; the type II receptor is needed 
for the binding of TGF-B to the type I receptor and the 
type I receptor is needed for the signal transduction 
induced by the type II receptor (Wrana efe al (1992) Cell, 

30 71, 1003-1004). The type III receptor and endoglin may 
have more indirect roles, possibly by facilitating the 
binding of ligand to type II receptors (Wang et al (1991) 
Cell, 67 797-805; L6pez-Casillas ^ al (1993) Cell, 21 
1435-1444) . 

35 Binding analyses with activin A and BMP4 have led to 

the identification of two co-existing cross-linked affinity 
complexes of 50-60 kDa and 70-80 kDa on responsive cells 



wo 94/11502 



PCr/GB93/02367 



3 

(Hino ai (1989) J. Bid. Chem. 264, 10309 - 10314; 
Mathews and Vale (1991), Cell 68# 775-785; Paralker et al 

(1991) Proc. Natl. Acad. Sci. USA 87, 8913-8917). By 
analogy with TGF-B receptors they are thought to be 

5 signalling receptors and have been named type I and type II 
receptors. 

Among the type II receptors for the TGF-B superfamily 
of proteins, the cDNA for the activin type II receptor (Act 
RII) was the first to be cloned (Mathews and Vale (1991) 

10 Cell 973-982) . The predicted structure of the receptor 
was shown to be a transmembrane protein with an 
intracellular serine/ threonine kinase domain. The activin 
receptor is related to the C. eleaans daf -1 gene product, 
but the ligand is currently unknown (Georgi al (1990) 

15 Cell §1, 635-645) . Thereafter, another form of the activin 
type II receptor (activin type IIB receptor) , of which 
there are different splicing variants (Mathews ^ al 

(1992) , Science ZZSl, 1702-1705; Attisano e£ al (1992) Cell 
SB, 97-108), and the TGF-B type II receptor (TBRII) (Lin et 

20 al (1992) Cell SB, 775-785) were cloned, both of which have 
putative serine/threonine kinase domains. 
Summary of the Invention 

The present invention involves the discovery of 
related novel peptides, including peptides having the 

25 activity of those defined herein as S£Q ID Nos. 2, 4, 8, 
10, 12, 14, 16 and 18. Their discovery is based on the 
realisation that receptor serine/threonine kinases form a 
new receptor family, which may include the type II 
receptors for other proteins in the TGF-B superfamily. To 

30 ascertain whether there were other members of this family 
of receptors, a protocol was designed to clone ActRII/ daf 
I related cDNAs. This approach made use of the polymerase 
chain reaction (PCR) , using degenerate primers based upon 
the amino-acid sequence similarity between kinase domains 

35 of the mouse activin type II receptor and daf -I gene 
products. 



wo 94/11502 



PCr/GB93/02367 



4 

This strategy resulted in the isolation of a new 
family of receptor kinases called ^ctivin receptor like 
kinases (ALK's) 1-6. These cDNAs shoved an overall 33-39% 
sequence similarity with ActRII and TGF-fi type II receptor 
5 and 40-92% sequence similarity towards each other in the 
kinase domains « 

Soluble receptors according to the invention comprise 
at least predominantly the extracellular domain. These can 
be selected from the information provided herein, prepared 
10 in conventional manner, and used in any manner associated 
with the invention. 

Antibodies to the peptides described herein may be 
raised in conventional manner. By selecting unique 
sec[uences of the peptides, antibodies having desired 
15 specificity can be obtained. 

The antibodies may be monoclonal, prepared in known 
manner. In particular, monoclonal antibodies to the 
extracellular domain are of potential value in therapy. 

Products of the invention are useful in diagnostic 
20 methods, e.g. to determine the presence in a sample for an 
analyte binding therewith, such as in an antagonist assay. 
Conventional techniques, e.g. an enzyme-linked 
immunosorbent assay, may be used. 

Products of the invention having a specific receptor 
activity can be used in therapy, e.g. to modulate 
conditions associated with activin or TGF-/3 activity. Such 
conditions include fibrosis, e.g. liver cirrhosis and 
pulmonary fibrosis, cancer, rheumatoid arthritis and 
glomeronephr it is • 
Brief Description of the Drawings 

Figiire 1 shows the alignment of the serine/threonine 
(S/T) kinase domains (I-VIII) of related receptors from 
transmembrane proteins, including embodiments of the 
present invention. The nomenclature of the subdomains is 
accordingly to Hanks et al (1988) • 

Figures 2A to 2D shows the sequences and 
characteristics of the respective primers used in the 



wo 94/1 1502 



PCT/GB93/02367 



5 

initial PGR reactions. The nucleic acid sequences are also 
given as SEQ ID Nos. 19 to 22. 

Figure 3 is a comparison of the amino-^acid sequences 
of human activin type II receptor (Act R-II) , mouse activin 
5 type IIB receptor (Act R-IIB) , human TGF-B type II receptor 
(TBR-II) , human TGF-B type I receptor (ALK-5) ^ human 
activin receptor type lA (ALK-2), and type IB (ALK-4) , ALKs 
1 & 3 and mouse ALK-6. 

Figure 4 shows, schematically, the structures for Daf - 
10 1, Act R-II, Act R-IIB, TBR-II, TBR-I/ALK-5, ALK's -1, -2 
(Act RIA), -3, -4 (Act RIB) & -6. 

Figure 5 shows the sequence alignment of the cysteine- 
rich domains of the ALKs, TBR-II, Act R-II, Act R-IIB and 
daf -1 receptors. 
15 Figure 6 is a comparison of kinase domains of 

serine/ threonine kinases, showing the percentage €uaino-acid 
identity of the kinase domains. 

Figtire 7 shows the pairwise alignment relationship 
between the kinase domains of the receptor serine/threonine 
20 kinases. The dendrogxam was generated using the Jotun-Hein 
alignment program (Hein (1990) Heth. Enzymol. 183 . 626- 
645) . 

Brief Description of the Sequence Listings 

Sequences 1 and 2 are the nucleotide and deduced 
25 amino-acid sequences of cDNA for hALK-1 (clone HP57) . 

Sequences 3 and 4 are the nucleotide smd deduced 
amino-acid sequences of cDNA for hALK-2 (clone HP53) • 

Sequences 5 and 6 are the nucleotide and deduced 
amino-acid sequences of cDNA for hALK-3 (clone 0NF5} • 
30 Sequences 7 and 8 the nucleotide and deduced amino- 

acid sequences of cDNA for hAIiK-4 (clone 11H8) , 
complemented with PGR product encoding extracellular 
domain. 

Sequences 9 and 10 are the nucleotide and deduced 
35 amino-acid secpiences of cDNA for hALK-S (clone EHBLA) • 

Sequences 11 and 12 are the nucleotide and deduced 
amino-acid sequences of cDNA f or mALK-1 (clone AM6) . 



wo 94/11562 



PCT/GB93/02367 



Sequences 13 and 14 are the nucleotide and deduced 
amino-acid sequences of cDNA for aALK-3 {clones ME-7 and 
ME-D) . 

Sequences 15 and 16 are the nucleotide and deduced 
5 amino-acid sequences of cDNA for iaALK**4 (clone 8al) • 

Sequences 17 and 18 are the nucleotide and deduced 
amino-acid sequences of cDNA for inALK-6 (clone ME-6) . 

Sequence 19 (Bl-S) is a sense primer, extracellular 
domain, cysteine-rich region, BamHI site at 5' end, 28-sier, 
10 64-fold degeneracy. 

Sequence 20 (B3-S) is a sense primer, kinase domain 
II, BamHI site at 5' end, 25-mer, 162-fold degeneracy. 

Sequence 21 (B7-S) is a sense primer, kinase domain 
VIB, S/T kinase specific residues, BamHI site at 5' end, 
15 24-mer, 288-fold degeneracy. 

Sequence 22 (E8-AS) is an anti-sense primer, kinase 
domain, S/T kinase-specif ic residues EcoRI site at 5' end, 
20-mer, 18-fold degeneracy. 

Sequence 23 is an oligonucleotide probe. 
20 Sequence 24 is a 5' primer. 

Sequence 25 is a 3' primer. 

Sequence 26 is a consensus sequence in Subdomain I. 
Sequences 27 and 28 are novel sequence motifs in 
Subdomain VIB. 

25 Secfuence 29 is a novel sequence motif in Subdomain 

VIII. 

Description cf the Invention 

As described in more detail below, nucleic acid 
sequences have been isolated, coding for a new sub-family 

30 of serine/ threonine receptor kinases. The term nucleic 
acid molecules as used herein refers to any secpience which 
codes for the murine, hxman or mammalian form, amino-acid 
sequences of which are presented herein. It is imderstocd 
that the well known phenomenon of codon degeneracy provides 

35 for a great deal of sequence veuriation and all such 
varieties are included within the scope of this invention. 



WO94/nS02 



PCr/GB93/02367 



7 

The nucleic acid sequences described herein may be 
used to clone the respective genomic DNA sequences in order 
to study the genes' structure and regulation. The murine 
and human cDNA or genomic sequences can also be used to 
5 isolate the homologous genes from other mammalian species. 
The mammalian DNA sequences can be used to study the 
receptors' functions in various in vitro and in vivo model 
systems. 

As exemplified below for ALK-S cDNA, it is also 

10 recognised that^ given the sequence information provided 
herein, the artisan could easily combine the molecules with 
a pertinent promoter in a vector, so as to produce a 
cloning vehicle for expression of the molecule. The 
promoter and coding molecule must be operably linked via 

15 any of the well-recognized and easily-practised 
methodologies for so doing. The resulting vectors, as well 
as the isolated nucleic acid molecules themselves, may be 
used to transform prokaryotic cells (e.g. £. coli ) ^ or 
transfect eukaryotes such as yeast (S. cerevisiae ) ^ PAE, 

20 COS or CHO cell lines. Other appropriate expression 
systems will also be apparent to the skilled artisan. 

Several methods may be used to isolate the ligands for 
the ALKs. As shown for ALK-5 cDNA, cDNA clones encoding 
the active open reading frames can be subcloned into 

25 expression vectors and transfected into eukaryotic cells, 
for example COS cells. The transfected cells which can 
express the receptor can be subjected to binding assays for 
radioactively-labelled members of the TGF-B superfamily 
(TGF-B, activins, inhibins, bone morphogenic proteins and 

30 mailerian- inhibiting substances) , as it may be expected 
that the receptors will bind members of the T<3F-B 
superfamily. Various biochemical or cell-based assays can 
be designed to identify the ligands, in tissue extracts or 
conditioned media, for receptors in which a ligand is not 

35 known. Antibodies raised to the receptors may also be used 
to identify the ligands, using the immunoprecipitation of 
the cross-linked complexes. Alternatively, purified 



wo 94/11502 



PCT/GB93/02367 



receptor could be used to isolate the ligands using an 
affinity-based approach. The determination of the 
expression patterns of the receptors may also aid in the 
isolation of the ligand. These studies may be carried out 
5 using ALK DNA or RNA sequences as probes to perform in situ 
hybridisation studies. 

The use of various model systems or structural studies 
should enable the rational development of specific agonists 
and antagonists useful in regulating receptor function. It 

10 may be envisaged that these can be peptides, mutated 
ligands, antibodies or other molecules able to interact 
with the receptors. 

The foregoing provides examples of the invention 
Applicants intend to claim which includes , inter alia, 

15 isolated nucleic acid molecules coding for activin 
receptor-like kinases (ALKs) , as defined herein. These 
include such sequences isolated from mammalian species such 
as mouse, human, rat, rabbit and monkey. 

The following description relates to specific 

20 embodiments. It will be understood that the specification 
and examples are illustrative but not limitative of the 
present invention and that other embodiments within the 
spirit and scope of the invention will suggest themselves 
to those skilled in the art. 

25 Preparation of mRNA and Construction of a cDNA Library 

For construction of a cDNA library, poly (A)* RNA was 
isolated from a human erythroleukemia cell line (HEL 
92.1.7) obtained from the American Type Culture Collection 
(ATCC TIB 180) . These cells were chosen as they have been 

30 shown to respond to both activin and TGF-B. Moreover 
leukaemic cells have proved to be rich sources for the 
cloning of novel receptor tyrosine kinases (Partanen efc al 
(1990) Proc. Natl. Acad. Sci. USA 87, 8913-8917 and (1992) 
Mol. Cell. Biol. 12., 1698-1707). (Total) RNA was prepared 

35 by the guanidinium isothiocyanate method (Chirgwin et al 
(1979) Biochemistry 18, 5294-S299) . mRNA was selected 
using the poly-A or poly AT tract mRNA isolation kit 



wo 94/11502 



PCr/GB93/02367 



(Promega, Madison, Wisconsin, U.S.A.) as described by the 
manufacturers, or purified through an oligo (dT) -cellulose 
column as described by Aviv and Leder (1972) Proc. Natl. 
Acad. Sci. USA jg£, 1408-1412. The isolated mRNA was used 
5 for the synthesis of random primed (Amersham) cONA, that 
was used to make a IgtlO library with Ixio' independent 
cONA clones using the Riboclone cDNA synthesis system 
(Promega) and XgtlO jn vjitro packaging kit (Amersham) 
according to the manufacturers' procedures. An amplified 

10 oligo (dT) primed human placenta XZAPII cDNA library of 
5xlo' independent clones was used. Poly (A)* RNA isolated 
from AG1518 human foreskin fibroblasts was used to prepare 
a primary random primed AZAPII cDNA library of 1.5x10* 
independent clones using the RiboClone cDNA synthesis 

15 system and Gigapack Gold II packaging extract (Stratagene) . 
In addition, a primary oligo (dT) primed human foreskin 
fibroblast AgtlO cDNA library (Claesson-Welsh et al (1989) 
Proc. Natl. Acad. Sci. USA. 86 4917-4912) was prepared. An 
amplified oligo (dT) primed HEL cell Agtll cDNA library of 

20 1.5 X 10* independent clones (Poncz et al (1987) Blood 62 
219-223) was used. A twelve-day mouse embryo AEXIox cDNA 
library was obtained from Novagen (Madison, Wisconsin, 
U.S.A.); a mouse placenta A.ZAPII cDNA library was also 
used. 

25 Generation of cDNA Probes bv PGR 

For the generation of cDNA probes by PCR (Lee et al 
(1988) Science 239 , 1288-1291) degenerate PCR primers were 
constructed based upon the amino-acid sequence similarity 
between the mouse activin type II receptor (Mathews and 

30 Vale (1991) Cell 65, 973-982) and daf-1 (George e^ ai 
(1990) Cell 61, 635-645) in the kinase domains II and VIII. 
Figure 1 shows the aligned serine /threonine kinase domains 
(I-VIII) , of four related receptors of the TGF-B 
superfamily, i.e. hTBR-II, mActR-IIB, mActR-II and the daf- 

35 1 gene product, using the nomenclattire of the subdomains 
according to Hanks et aJL (1988) Science 241, 45-52, 



WO94/11S02 



PCr/GB93/02367 



10 

Several considerations were applied in the design of 
the PGR primers. The sequences were taken from regions of 
homology between the activin type II receptor and the daf -i 
gene product, with particular emphasis on residues that 
5 confer serine/threonine specificity (see Table 2) and on 
residues that are shared by transmembrane kinase proteins 
and not by cytoplasmic kinases. The primers were designed 
so that each primer of a PGR set had an approximately 
similar GC composition, and so that self complementarity 

10 and complementarity between the 2' ends of the primer sets 
were avoided. Degeneracy of the primers was kept as low as 
possible, in particular avoiding serine, leucine and 
arginine residues (6 possible codons) , and himan codon 
preference was applied. Degeneracy was particularly 

15 avoided at the 3' end as, unlike the 5' end, where 
mismatches are tolerated, mismatches at the 3' end 
dramatically reduce the efficiency of PGR. 

In order to facilitate directional subcloning, 
restriction enzyme sites were included at the 5' end of the 

20 primers, with a GC clamp, which permits efficient 
restriction enzyme digestion. The primers utilised are 
shown in Figure 2 . Oligonucleotides were synthesized using 
Gene assembler plus (Pharmacia « LKB) according to the 
manufacturers instructions • 

25 ' The mRNA prepared from H£L cells as described above 

was reverse-transcribed into cDNA in the presence of 50 mM 
Tris-HGl, pH 8.3, 8 mM MgClj, 30 mM KCl, 10 mM 
dithiothreitol, 2mM nucleotide triphosphates, excess oligo 
(dT) primers and 34 units of AMV reverse transcriptase at 

30 42**C for 2 hours in 40 til of reaction volume. 
Amplification by PGR was carried out with a 7.5% aliquot (3 
Ml) of the reverse-transcribed mRNA, in the presence of 10 
mM Tris-HGl, pH 8.3, 50 mM KGl, 1.5 M MgClj, 0.01% gelatin, 
0.2 mM nucleotide triphosphates, 1 of both sense and 

35 antisense primers and 2.5 units of Tag polymerase (Perkin 
Elmer Getus) in 100 ill reaction volime. Amplifications 
were performed on a thermal cycler (Perkin Elmer Cetus) 



wo 94/11502 



PCT/GB93/02367 



11 

using the following program: first 5 thermal cycles with 
denaturation for 1 minute at S4^C, annealing for 1 minute 
at 50*C, a 2 minute ramp to 55**C and elongation for 1 minute 
at 72®C, followed by 20 cycles of 1 minute at 94^*0, 30 
5 seconds at 55*^0 and 1 minute at 72*^0. A second round of PGR 
was performed with 2 til of the first reaction as a 
template. This involved 25 thermal cycles, each composed 
of 94^*0 (1 min), 55^*0 (0.5 min) , 72''c (1 min) . 

General procedures such as purification of nucleic 

10 acids, restriction enzyme digestion, gel electrophoresis, 
transfer of nucleic acid to solid supports and subcloning 
were performed essentially according to established 
procedures as described by Sambrook et al, (1989) , 
Molecular cloning: A Laboratory Manual, 2"^ Ed. Cold Spring 

15 Harbor Laboratory (Cold Spring Harbor, New York, USA) . 

Samples of the PCR products were digested with BamH I 
and EcoRI and subsequently fractionated by low melting 
point agarose gel electrophoresis. Beoids corresponding to 
the approximate expected sizes, (see Table 1: »460 bp for 

20 primer pair B3-S and E8-AS and » 140 bp for primer pair B7- 
S and E8-AS) were excised from the gel and the DNA was 
purified. Subsequently, these fragments were ligated into 
pUC19 (Yanisch-Perron et al (1985) Gene 33, 103-119), which 
had been previously linearised with SamHI and EcoRl and 

25 transformed into E. coli strain DH5a using standard 
protocols (Sambrook et supra ) . Individual clones were 
sequenced using standard double-stranded sequencing 
techniques and the dideoxynucleotide chain termination 
method as described by Sanger gt al (1977) Proc. Natl. 

30 Acad. Sci. USA 24# 5463-5467, and T7 DNA polymerase. 

Employing Reverse Transcriptase PCR on HEL mRNA with 
the primer pair B3-S and E8-AS, three PCR products were 
obtained, termed 11.1, 11.2 and 11.3, that corresponded to 
novel genes. Using the primer pair B7-S and E8-AS, an 

35 additional novel PCR product was obtained termed 5.2. 



wo 94/11502 



PCT/GB93/02367 



12 



1 NAMB 
OP PGR 
PRODUCT 


PRIMERS 


INSERT 
SIZE 

(>>P) 


8ISE OP DNA 

PRAOMENT IK 

■ActRII/ 

hXfiRII 

CLONES 

(bp) 


SEQUENCS 
IDENTITY KITH 
SEQUENCE 
BActRII/hTBRII 
(*) 


SEQUENCE 1 
IDENTITY 1 
BB^ifEEN 1 
BActRII 1 
and 1 
TBR-II 
(%) 


11.1 


B3-S/E8-AS 


460 


460 


46/40 


42 


11.2 


B3-S/E8-AS 


460 


460 


49/44 


47 


11.3 


B3-S/E8-AS 


460 


460 


44/36 


48 


11.29 


B3-S/E8-AS 


460 


460 


ND/100 


ND 


9.2 


B1-S/E8-AS 


800 


795 


100/ND 


ND 


5.2 


B7-S/E8-AS 


140 


143 


40/38 


60 

===== 



15 Isolation of cDNA Clones 

The PGR products obtained were used to screen various 
cDNA libraries described supra . Labelling of the inserts 
of PGR products was performed using random priming method 
(Feinberg and Vogelstein (1983) Anal. Biochem, 132 6-13) 

20 using the Megaprime DNA labelling system (Amersham) . The 
oligonucleotide derived from the sequence of the PGR 
product 5.2 was labelled by phosphorylation with T4 
polynucleotide kinase following standard protocols 
(Sambrook efc al, supra ) . Hybridization and purification of 

25 positive bacteriophages were performed using standard 
molecular biological techniques. 

The double-stranded DNA clones were all sequenced 
using the dideoxynucleotide chain-termination method as 
described by Sanger et al^ supra . using T7 DNA polymerase 

30 (Pharmacia - LKB) or Sequenase (U.S. Biochemi*cal 
Corporation, Cleveland, Ohio, U.S.A.). Compressions of 
nucleotides were resolved using 7-deaza-GTP (U.S. 
Biochemical Corp.) DNA sequences were analyzed using the 
DNA STAR computer program (DNA STAR Ltd. U.K.). Analyses 

35 of the sequences obtained revealed the existence of six 



wo 94/11502 PCr/GB93/02367 

13 

distinct putative receptor serine /threonine kinases which 
have been named ALK 1-6 • 

To clone cDNA for ALK-1 the oligo (dT) primed human 
placenta cDNA library was screened with a radiolabelled 
5 insert derived from the PGR product 11, 3; based upon their 
restriction enzyme digestion patterns, three different 
types of clones with approximate insert sizes, of 1.7 kb, 
2 kb & 3.5 kb were identified. The 2 kb clone, named 
HP57, was chosen as representative of this class and 

10 subjected to complete sequencing. Sequence analysis of 
ALK-1 revealed a sequence of 1984 nucleotides including a 
poly-A tail (SEQ ID No. 1) • The longest open reading frame 
encodes a protein of 503 amino-acids, with high sec[uence 
similarity to receptor serine/threonine kinases (see 

15 below) . The first methionine codon, the putative 
translation start site, is at nucleotide 283-285 and is 
preceded by an in- frame stop codon. This first ATG is in 
a more favourable context for translation initiation (Kozak 
(1987) Nucl. Acids Res., 15, 8125-8148) than the second and 

20 third in-frame ATG at nucleotides 316-318 and 325-327. The 
putative initiation codon is preceded by a 5' untranslated 
sequence of 282 nucleotides that is GC-rich (80% GC) , which 
is not uncommon for growth factor receptors (Kozak (1991) 
J. Cell Biol., 115, 887-903). The 3' untranslated sequence 

25 comprises 193 nucleotides and ends with a poly-A tail. No 
bona fide poly-A addition signal is found, but there is a 
sequence (AATACA) , 17-22 nucleotides upstream of the poly-A 
tail, which may serve as a poly-A addition signal. 

AIiK-2 cDNA was cloned by screening an amplified oligo 

30 (dT) primed human placenta cDNA library with a 
radiolabelled insert derived from the PGR product 11.2. 
Two clones, termed HP53 and HP64, with insert sizes of 2.7 
kb and 2.4 kb respectively, were identified and their 
sequences were determined. No sec[uence difference in the 

35 overlapping clones was found, suggesting they are both 
derived from transcripts of the same gene. 



wo 94/11502 



PCT/GB93/02367 



14 

Sequence analysis of cDNA clone HP53 (SEQ ID No. 3) 
revealed a sequence of 2719 nucleotides with a poly-A tail. 
The longest open reading frame encodes a protein of 509 
amino-acids. The first ATG at nucleotides 104-106 agrees 
5 favourably with Kozak's consensus sequence with an A at 
position 3. This ATG is preceded in-frame by a stop codon. 
There are four ATG codons in close proximity further 
downstream, which agree with the Kozak's consensus sequence 
(Kozak, supra ) , but according to Kozak^s scanning model the 

10 first ATG is predicted to be the translation start site. 
The 5' untranslated sequence is 103 nucleotides. The 3' 
untranslated sequence of 1089 nucleotides contains a 
polyadenylation signal located 9-14 nucleotides upstream 
from the poly-A tail. The cDNA clone HP64 lacks 498 

15 nucleotides from the 5 ' end compared to HP53 , but the 
sequence extended at the 3' end with 190 nucleotides and 
poly-A tail is absent. This suggests that different 
polyadenylation sites occur for ALK-2. In Northern blots, 
however, only one transcript was detected (see below). 

20 The cDNA for human ALK-3 was cloned by initially 

screening an oligo (dT) primed human foreskin fibroblast 
cDNA library with an oligonucleotide (SEQ ID No. 23) 
derived from the PGR product 5.2. One positive cDNA clone 
with an insert size of 3 kb, termed ONll, was identified. 

25 However, upon partial sequencing, it appeared that this 
clone was incomplete; it encodes only part of the kinase 
domain and lacks the extracelluar domain. The most 5' 
sequence of ONll, a 540 nucleotide Xba l restriction 
fragment encoding a truncated kinase domain, was 

30 subsequently used to probe a random primed fibroblast cDNA 
library from which one cDNA clone with an insert size of 3 
kb, termed 0NF5, was isolated (SEQ ID No. 5). Sequence 
analysis of 0NF5 revealed a sequence of 2932 nucleotides 
without a poly-A tail, suggesting that this clone was 

35 derived by internal priming. The longest open reading 
frame codes for a protein of 532 amino-acids. The first 
ATG codon which is compatible with Koz£dc's consensus 



wo 94/11502 



PCT/GB93/02367 



sequence (Kozak, supra ) p is at 310-312 nucleotides and is 
preceded by an in-frame stop codon. The 5' and 3' 
tmtranslated sequences are 309 and 1027 nucleotides long, 
respectively. 

5 ALK-4 cDNA was identified by screening a human oligo 

(dT) primed human erythroleukemia cDNA library with the 
radiolabelled insert of the PGR product 11.1 as a probe. 
One cDNA clone, termed 11H8, was identified with an insert 
size of 2 kb (SEQ ID No. 7) . An open reading frame was 
10 found encoding a protein sequence of 383 amino-acids 
encoding a trxincated extracellular domain with high 
similarity to receptor serine/threonine kinases. The 3' 
untranslated sequence is 818 nucleotides and does not 
contain a poly-A tail, suggesting that the cDNA was 
15 internally primed. cDNA encoding the complete 

extracellular domain (nucleotides 1-3 66) was obtained from 
HEL ceils by RT-PCR with 5' primer (SEQ ID No. 24) derived 
in part from sequence at translation start site of SKR-2 (a 
cDNA sequence deposited in GenBank data base, accesion 
20 number L10125, that is identical in part to ALK-4) and 3' 
primer (SEQ ID No. 25) derived from 11H8 cDNA clone. 

AIiK-5 was identified by screening the random primed 
HEL cell Xgt 10 cDNA library with the PGR product 11.1 as 
a probe. This yielded one positive clone termed EMBLA 
25 (insert size of 5.3 kb with 2 internal EcoRI sites). 
Nucleotide sequencing revealed an open reading frame of 
1509 bp, coding for 503 amino-acids. The open reading 
frame was flanked by a 5' untranslated sequence of 76 bp, 
and a 3' untranslated sequence of 3.7 kb which was not 
30 completely sequenced. The nucleotide and deduced amino- 
acid sequences of ALK-5 are shown in SEQ ID Nos. 9 and 10. 
In the 5' part of the open reading frame, only one ATG 
codon was found; this codon fulfils the rules of 
translation initiation (Kozak, supra ) . An in-frame stop 
35 codon was found at nucleotides (-54)-(-52) in the 5' 
untranslated region. The predicted ATG start codon is 
followed by a stretch of hydrophobic amino-acid residues 



wo 94/11502 



PCr/GB93/02367 



16 

which has characteristics of a cleavable signal sequence. 
Therefore, the first ATG codon is likely to be used as a 
translation initiation site. A preferred cleavage site for 
the signal peptidase, according to von Heijne (1986) Nucl. 
5 Acid. Res. i4# 4683-4690^ is located between amino-acid 
residues 24 and 25. The calculated molecular mass of the 
primeury translated product of the ALK-5 without signal 
sequence is 53,646 Da. 

Screening of the mouse embryo AEX I ox cDNA library 

10 using PGR, product 11.1 as a probe yielded 20 positive 
clones. DNAs from the positive clones obtained from this 
library were digested with IcoRI and Hind lll > 
electrophoretically separated on a 1.3% agarose gel and 
transferred to nitrocellulose filters according to 

15 established procedures as described by Sambrook et al . 
supr^. The filters were then hybridized with specific 
probes for human AIiK-l (nucleotide 288-670) , ALK-2 
(nucleotide 1-581), ALK-3 (nucleotide 79-824) or AIiK-4 
nucleotide 1178-1967) . Such analyses revealed that a clone 

20 termed ME-7 hybridised with the human AIiK-3 probe. 
However, nucleotide sequencing revealed that this clone was 
incomplete, and lacked the 5' part of the translated 
region. Screening the same cDNA library with a probe 
corresponding to the extracelluar domain of human AIiK-3 

25 (nucleotides 79-824) revealed the clone ME-D. This clone 
was isolated and the sequence was analyzed. Although this 
clone was incomplete in the 3' end of the translated 
region, ME-7 and ME-D overlapped and together covered the 
complete sequence of mouse ALK-3 . The predicted amino-acid 

30 sequence of mouse ALK-3 is very similar to the human 
sequence; only 8 coaino-acid residues differ (98% identity; 
see SEQ ID No. 14) and the calculated molecular mass of the 
primary translated product without the putative signal 
sequence is 57,447 Da. 

35 Of the clones obtained from the initial library 

screening with PGR product ll.l, four clones hybridized to 
the probe corresponding to the conserved kinase domain of 



wo 94/11502 



PCT/GB93/02367 



17 

ALK~4 but not to probes from more divergent parts of ALK-1 
to -4 . Analysis of these clones revealed that they have an 
identical sequence which differs from those of ALK-1 to -5 
and was termed The longest clone H£6 with a 2.0 kb 

5 insert was completely sequenced yielding a 1952 bp fragment 
consisting of an open reading frame of 1506 bp (502 amino- 
acids), flanked by a 5' untranslated sequence of 186 bp, 
and a 3' untranslated sequence of 160 bp. The nucleotide 
and predicted amino-acid sequences of mouse ALK-6 are shown 

10 in SEQ ID Nos. 17 and 18. No polyadenylation signal was 
found in the 3' untranslated region of ME6, indicating that 
the cDNA was internally primed in the 3' end. Only one ATG 
codon was found in the 5' part of the open reading frame, 
which fulfils the rules for translation initiation (Kozak, 

15 supra ) , and was preceded by an in-frame stop codon at 
nucleotides 163-165. However, a typical hydrophobic leader 
sequence was not observed at the N terminus of the 
translated region. Since there is no ATG codon and 
putative hydrophobic leader sequence, this ATG codon is 

20 likely to be used as a translation initiation site. The 
calculated molecular mass of the primary translated product 
with the putative signal sequence is 55,576 Da. 

Mouse ALK-1 (clone AM6 with 1.9 kb insert) was 
obtained from the mouse placenta A.ZAPII cDNA library using 

25 human ALK-l cDNA as a probe (see SEQ ID No. 11). Mouse 
ALK-4 (clone 8al with 2.3kb insert) was also obtained from 
this library using human ALK-4 cDNA library as a probe (SEQ 
ID No. 15) . 

To siammarise, clones HP22, HP57, ONFl, 0NF3, 0NP4 and 
30 HP29 encode the same gene, ALK-l. Clone AM6 encodes mouse 
ALK-1. HP53, HP64 and HPB4 encode the same gene, ALK-2. 
ONF5, 0NF2 and ONll encode the same gene ALK-3. ME-7 and 
ME-D encodie the mouse counterpart of hximan ALK-3. 11H8 
encodes a different gene ALK-4, whilst 8al encodes the 
35 mouse equivalent. EHBLA encodes ALK-5, and ME-6 encodes 
ALK-6. 



WOSM/11502 



PCT/GB93/02367 



18 

The sequence alignment between the 6 ALK genes and 
TfiR*II, mActR-II and ActR-IIB is shown in Figure 3. These 
molecules have a similar domain structure; an N-terminal 
predicted hydrophobic signal sec[uence (von Heijne (1986) 
5 Nucl* Acids Res. 2A* 4683-4690) is followed by a relatively 
small extracellular cysteine-rich ligand binding domain, a 
single hydrophobic transmembrane region (Kyte & Doolittle 
(1982) J. Mol. Biol. 157 , 105-132) and a C-terminal 
intracellular portion, which consists almost entirely of a 

10 kinase domain (Figures 3 and 4). 

The extracelluar domains of these receptors have 
cysteine-rich regions, but they show little sequence 
similarity; for example, less than 20% sequence identity is 
found between Daf-1, ActR-II, TBR-II and ALK-5. The ALKs 

15 appear to form a subfamily as they show higher sequence 
similarities (15-47% identity) in their extracellular 
domains. The extracellular domains of ALK-5 and ALK-4 have 
about 29% sequence identity. In addition, ALK-3 and ALK-6 
share a high degree of sequence similarity in their 

20 extracellular domains (46% identity) • 

The positions of many of the cysteine residues in all 
receptors can be aligned, suggesting that the extracellular 
domains may adopt a similar structural conf igiiratlon. See 
Figure 5 for ALXs-1,-2,-3 &- 5. Each of the ALKs (except 

25 ALK-6) has a potential N-linked glycosylation site, the 
position of which is conserved between ALK-1 and AIiK-2, and 
between ALK-3, ALK-4 and ALK-5 (see Figiire 4). 

The sec[uence similarities in the kinase domains 
between daf -1, ActR-II, TBR-II and ALK-5 are approximately 

30 40%, whereas the sequence similarity between the ALKs 1 to 
6 is higher (between 59% and 90%; see Figure 6). Pairwise 
comparison using the Jutun-Hein secpience alignment program 
(Hein (1990) Meth, Enzymol., 183 , 626-645), between all 
family members, identifies the ALKs as a separate subclass 

35 among serine/threonine kinases (Figure 7) . 

The catalytic domains of kinases can be divided into 
12 subdomains with stretches of conserved amino-acid 



wo 94/1 1502 



PCr/GB93/02367 



19 

residues. The key motifs are found in serine/ threonine 
kinase receptors suggesting that they are functional 
kinases. The consensus sequence for the binding of ATP 
(Gly-X-Gly-X-X-Gly in subdomain I followed by a Lys residue 
5 further downstream in subdomain II) is found in all the 
ALKs. 

The kinase domains of daf-l, ActR-II, and ALKs show 
approximately equal sequence similarity with tyrosine and 
serine/threonine protein kinases. However analysis of the 

10 amino-acid sequences in subdomains VI and VIII ^ which are 
the most useful to distinguish a specificity for 
phosphorylation of tyrosine residues versus 
serine/threonine residues (Hanks et al (1988) Science 241 
42-52) indicates that these kinases are serine/ threonine 

15 kinases; refer to Table 2. 



wo 94/11502 



PCT/GB93/02367 



20 



KINASE 


8UBD0MAIN8 1 




VIB 


VIII 


Serine/threonine kinase consensus 


DLKPEN 


G (T/S) XX 
(Y/F) X 


Tyrosine kinase consensus 


DLAARN 


XP(I/V) 
(K/R) W 
(T/M) 


Act R-II 


DIXSKN 


GTRRYM 


Act R-IIB 






TBR-II 


DLKSSN 


GTARYH 


ALK-I 


DFKSRN 


GTKRYM 


ALK '2, -3, -4, -5, & -6 


DLKSKN 


GTKRYH 



The sequence motifs DLKSKN (Subdomain VIB) and GTKRYH 
(Subdomain VIII) , that are found in most of the 
serine/threonine kinase receptors, agree well with the 

15 consensus sequences for all protein serine/ threonine kinase 
receptors in these regions. In addition, these receptors, 
except for ALK-1, do not have a tyrosine residue surrounded 
by acidic residues between subdomains VII and VIII, which 
is common for tyrosine kinases. A unique characteristic of 

20 the members of the ALK serine/ threonine kinase receptor 
family is the presence of two short inserts in the kinase 



wo 94/11502 



PCr/GB93/02367 



21 

domain between subdomains VIA and VIB and between 
subdomains X and XI, In the intracellular domain, these 
regions, together with the juxtamembrane part and C- 
terminal tail, are the most divergent between family 
5 members (see Figures 3 and 4) . Based on the sequence 
similarity with the type II receptors for TGP-6 and 
activin, the C termini of the kinase domains of ALKs -1 to 
-6 are set at Ser-4g5, Ser-501, Ser-527, Gln-500, Gln-49B 
and Ser-497, respectively, 

10 mRNA Expression 

The distribution of ALK-l, -2, -3, -4 was determined 
by Northern blot analysis. A Northern blot filter with 
mRNAs from different human tissues was obtained from 
Clontech (Palo Alto, C.A.). The filters were hybridized 

15 with '^-labelled probes at 42**C overnight in 50% 
formaldehyde, 5 x standard saline citrate (SSC; IxSSC is 
50mM sodium citrate, pH 7.0, 150 mM NaCl) , 0.1% SDS, 50 mM 
soditam phosphate, 5 x Denhardt's solution and 0.1 mg/ml 
salmon sperm DNA. In order to minimize cross- 

20 hybridization, probes were used that did not encode pcirt of 
the kinase domains, but corresponded to the highly diverged 
sequences of either 5' untranslated and ligand-binding 
regions (probes for ALK-l, -2 and -3) or 3' untranslated 
sequences (probe for AIiK-4) . The probes were labelled by 

25 random priming using the Multiprime (or Mega-prime) DNA 
labelling system and [a-'^P] dCTP (Feinberg & Vogelstein 
(1983) Anal. Biochem. 132 ; 6-13). Unincorporated label was 
removed by Sephadex G-25 chromatography. Filters were 
washed at 65°C, twice for 30 minutes in 2.5 x SSC, 0.1% SDS 

30 and twice for 30 minutes in 0.3 x SSC, 0.1% SDS before 
being exposed to X-ray film. Stripping of blots was 
performed by incubation at 90-lOO^C in water for 20 
minutes • 

The AIiK-5 mRNA size and distribution were determined 
35 by Northern blot analysis as above. An EcoR l fragment of 
980bp of the full length ALK-5 cDNA clone, corresponding to 
the C-terminal part of the kinase domain and 3' 



wo 94/11502 



PCr/GB93/02367 



22 

untranslated region (nucleotides 1259-2232 in SEQ ID No. 9) 
was used as a probe. The filter was washed twice in 0.5 x 
SSC, 0.1% SDS at 55^C for 15 minutes. 

Using the probe for ALK-l. two transcripts of 2.2 and 
5 4.9)09 were detected. The ALK-1 expression level varied 
strongly between different tissues, high in placenta and 
lung, moderate in heart, muscle and kidney, and low (to not 
detectable) in brain, liver and pancreas. The relative 
ratios between the two transcripts were similar in most 

10 tissues; in Icidney, however, there was relatively more of 
the 4.9 )cb transcript. By reprobing the blot with a probe 
for AIiK-2, one transcript of 4.0 )cb was detected with a 
ubiquitous expression pattern. Expression was detected in 
every tissue investigated and was highest in placenta and 

15 s)celetal muscle. Subsequently the blot was reprobed for 
AIiK-3. One major transcript of 4.4 )cb and a minor 
transcript of 7.9 kh were detected. Expression was high in 
s)celetal muscle, in which also an additional minor 
transcript of 10 )cb was observed. Moderate levels of AIiK-3 

20 mRNA were detected in heart, placenta, )cidney and pancreas, 
and low (to not detectable) expression was found in brain, 
Ixing and liver. The relative ratios between the different 
transcripts were similar in the tested tissues, the 4.4 )cb 
transcript being the predominant one, with the exception 

25 for brain where both transcripts were expressed at a 
similar level. Probing the blot with ALK-4 indicated the 
presence of a transcript with the estimated size of 5.2 )cb 
and revealed an ubiquitous expression pattern. The results 
of Northern blot analysis using the probe for AIiK-5 showed 

30 that a 5.5 }cb transcript is expressed in all human tissues 
tested, being most abundant in placenta and least abundant 
in brain and heaort. 

The distribution of mRNA for mouse ALK-3 and -6 in 
various mouse tissues was also determined by Northern blot 

35 analysis. A multiple mouse tissue blot was obtained from 
Clontech, Palo Alto, California, U.S.A. The filter was 
hybridized as described above with probes for mouse ALK-3 



wo 94/11502 



PCr/GB93/02367 



23 

and ALK-6. The EcoR I- Pst I restriction fragment, 
corresponding to nucleotides 79-1100 of ALK-3, and the 
Sac l- Hoa l fragment, corresponding to nucleotides 57-720 of 
ALK-6, were used as probes. The filter was washed at 65^C 
5 twice for 30 minutes in 2.5 x SSC, 0.1% SDS and twice for 
30 minutes with 0.3 x BSC, 0.1% SDS and then subjected to 
autoradiography • 

Using the probe for mouse AIiK-3, a 1.1 kb transcript 
was found only in spleen. By reprobing the blot with the 

10 ALK-6 specific probe, a transcript of 7.2 kb was found in 
brain and a weak signal was also seen in lung. No other 
signal was seen in the other tissues tested, i.e. heart, 
liver, skeletal muscle, kidney and testis. 

All detected transcript sizes were different, and thus 

15 no cross-reaction between mJWAs for the different ALKs was 
observed when the specific probes were used. This suggests 
that the multiple transcripts of ALK-1 and ALK-3 are coded 
from the same gene. The mechanism for generation of the 
different transcripts is unknown at present; they may be 

20 formed by alternative mRNA splicing, differential 
poly adenylat ion, use of different promoters, or by a 
combination of these events. Differences in mRNA splicing 
in the regions coding for the extracellular domains may 
lead to the synthesis of receptors with different 

25 affinities for ligands, as was shown for mActR-IIB 
(Attisano gt aJL (1992) Cell 68/ 97-108) or to the 
production of soluble binding protein. 

The above experiments describe the isolation of 
nucleic acid sequences coding for new family of hiiman 

30 receptor kinases. The cDNA for ALK-5 was then used to 
determine the encoded protein size and binding properties. 
Properties of the AIJCs cDNA Encoded Proteins 

To study the properties of the proteins encoded by the 
different ALK cDNAs, the cDNA for each ALK was subcloned 

35 into a eukaryotic expression vector and transfected into 
various cell types and then sxibjected to 
immunoprecipitation using a rabbit antiserum raised against 



wo 94/11502 



PCT/GB93/02367 



24 

a synthetic peptide corresponding to part of the 
intracellular juxtamembrane region. This region is 
divergent in sequence between the various serine/ threonine 
kinase receptors. The following amino-acid residues were 
5 used: 

ALK-1 145-166 
ALK-2 151-172 
ALK-3 181-202 
ALK-4 153-171 

10 ALK-5 158-179 
ALK-6 151-168 

The rabbit antiserum against ALK-5 was designated VPN. 
The peptides were synthesized with an Applied 
Biosysteins 430A Peptide Synthesizer using t-butoxycarbonyl 

15 chemistry and purified by reversed-phase high performance 
liquid chromatography. The peptides were coupled to 
keyhole limpet haemocyanin (Calbiochem-Behring) using 
glutaraldehyde, as described by Guillick et al (1985) EMBO 
J. 4, 2869-2877. The coupled peptides were mixed with 

20 Freunds adjuvant and used to immunize rabbits. 
Transient transfection of the ALK-5 cDNA 

COS-1 cells (American Type Culture Collection) and the 
H mutant of HvlLu cells (for references, see below) were 
cultured in Dulbecco's modified Eagle's medixim containing 

25 10% fetal bovine serum (FBS) and 100 units/ml penicillin 
and 50 1ml streptomycin in 5% COg atmosphere at 37®C. 
The ALK-5 cDNA (nucleotides (-76) - 2232), which includes 
the complete coding region, was cloned in the pSV7d vector 
(Truett et gl, (1985) DNA 4, 333-349), and used for 

30 transfection. Transfection into COS-1 cells was performed 
by the calcium phosphate precipitation method (Wigler gt ai 
(1979) Cell 16, 777-785). Briefly, cells were seeded into 
6-well cell culture plates at a density of 5x10^ 
cells/well, and transfected the following day with 10 fig of 

35 recombinant plasmid. After overnight incubation, cells 
were washed three times with a buffer containing 25 mM 
Tris-HCl, pH 7.4, 138 mM NaCl, 5 mM KCl, 0.7 mM CaClg, 0.5 



wo 94/11502 PCr/GB93/02367 

25 

mM MgClj and 0.6 mM NajHPO^, and then incubated with 
Dulbecco's modified Eagle's medium containing FBS and 
antibiotics. Two days after transfection, the cells were 
metabolically labelled by incubating the cells for 6 hours 
5 in methionine and cysteine-free MCDB 104 meditm with 150 
/iCl/ml of t^'s] -methionine and [^^S] -cysteine (in vivo 
labelling mix; Amersham) . After labelling, the cells were 
washed with 150 mM NaCI, 25 mM Tris-HCl, pH 7.4, and then 
solubilized with a buffer containing 20mM Tris-HCl, pH 7.4, 

10 150 mM NaCl, 10 mM EDTA, 1% Triton X-100, 1% deoxycholate, 
1.5% Trasylol (Bayer) and 1 mM phenylmethylsulf onylf luoride 
(PMSF; Sigma) . After 15 minutes on ice, the cell ly sates 
were pelleted by centrifugation, and the supernatants were 
then incubated with 7 ^1 of preimmune serum for 1.5 hours 

15 at 4**C. Samples were then given 50 /il of protein A- 
Sepharose (Pharmacia-LKB) slurry (50% packed beads in 150 
mM NaCl, 20 mM Tris-HCl, pH 7.4, 0.2% Triton XlOO) and 
incubated for 45 minutes at 4''c. The beads were spun down 
by centrifugation, and the supernatants (1 ml) were then 

20 incubated with either 7 /il of preimmune sertam or the VPN 
antiserum for 1.5 hoxirs at 4*C. For blocking, 10 ng of 
peptide was added together with the antiserum. Immtxne 
complexes were then given 50 /xl of protein A-Sepharose 
(Pharmacia - LKB) slxirry (50% packed beads in 150 mM NaCl, 

25 20mM Tris-HCl, pH 7.4, 0.2% Triton X-100) and incubated for 
45 minutes at 4^C. The beads were spun down and washed 
four times with a washing buffer (20 mM Tris-HCl, pH 7.4, 
500 mM NaCI, 1% Triton X-100, 1% deoxycholate and 0.2% 
SDS) , followed by one wash in distilled water. The immiine 

30 complexes were eluted by boiling for 5 minutes in the SDS- 
sample buffer (100 mM Tris-HCl, pH 8.8, 0.01% bromophenol 
blue, 36% glycerol, 4% SDS) in the presence of 10 mM DTT, 
and analyzed by SDS-gel electrophoresis using 7-15% 
polyacrylamide gels (Blobel and Dobberstein, (1975) J. Cell 

35 Biol. 62, 835-851). Gels were fixed, incubated with 
Amplify (Amersham) for 20 minutes, and subjected to 
fluorography. A component of 53Da was seen. This 



wo 94/11502 



PCr/GB93/02367 



component was nol: seen when preimmune serum was used, or 
when 10 fig blocking peptide was added together with the 
antiserim. Moreover, it was not detectable in samples 
derived from untransfected COS-1 cells using either 
5 preimmune serum or the antisemm* 
Digestion with Endoalvcosidase F 

Samples immunoprecipitated with the VPN antisera 
obtained as described above were incubated with 0.5 U of 
endoglycosidase F (Boehringer Mannheim Biochemica) in a 

10 buffer containing 100 mM sodi\im phosphate, pH 6.1, 50 mM 
EDTA, 1% Triton X-100, 0.1% SDS and 1% B-mercaptoethanol at 
21^C for 24 hours. Samples were eluted by boiling for 5 
minutes in the SDS-sample buffer, and analyzed by SDS- 
polyacrylamide gel electrophoresis as described above. 

15 Hydrolysis of N-linked carbohydrates by endoglycosidase F 
shifted the 53 kDa band to 51 kDa. The extracelluar domain 
of ALK-5 contains one potential acceptor site for N- 
glycosylation and the size of the deglycosylated protein is 
close to the predicted size of the core protein. 

20 Establishment of PAE Cell Lines Expressing ALK-5 

In order to investigate whether the ALK-5 cDNA encodes 
a receptor for TGF-6, porcine aortic endothelial (PAE) 
cells were transfected with an expression vector containing 
the ALK-5 cDNA, and analyzed for the binding of '^I-TGF-Bl. 

25 PAE cells were cultured in Ham's F-12 medium 

supplemented with 10% FBS and antibiotics (Miyazono et al* # 
(1988) J. Biol. Chem. 163, 6407-6415). The AIiK-5 cDNA was 
cloned into the cytomegalovirus (CM7) -based expression 
vector pcDNA I/NEO (Invitrogen) , and transfected into PAE 

30 cells by electr operation. After 48 hours, selection was 
initiated by adding Geneticin (G418 sulphate; Gibco - BRL) 
to the culture medium at a final concentration of 0.5 mg/ml 
(Westermark et al., (1990) Proc. Natl. Acad. Sci. USA fiZ, 
128-132) . Several clones were obtained, and after analysis 

35 by immunoprecipitation using the VPN antisenun, one clone 
denoted PAE/T6R-1 was chosen and further analyzed. 



wo 94/11502 



PCr/GB93/02367 



27 

Todination of TGF-fil. Binding and Affinil^ v Crossl inking 

Recombinant human TGF-Bl was iodinated using the 
chloramine T method according to Frolik et al, , (1984) J. 
Biol. Chem. 259 ,. 10995-11000. Cross- linking experiments 
5 were performed as previously described (Ichijo et al, ^ 
(1990) Exp. Cell Res. ISl, 263-269). Briefly, cells in 6- 
well plates were washed with binding buffer (phosphate- 
buffered saline containing 0.9 mM CaClj, 0.49 mM MgCl^ and 
1 mg/ml bovine serum albxamin (BSA) ) , and incubated on ice 

10 in the same buffer with I-TGF-fll in the presence or 
absence of excess unlabelled TGF-Bl for 3 hotirs. Cells 
were washed and cross-linking was done in the binding 
buffer without BSA together with 0.28 mM disuccinimidyl 
suberate (DSS; Pierce Chemical Co.) for 15 minutes on ice. 

15 The cells were harvested by the addition of 1 ml of 
detachment buffer (10 mM Tris-HCl, pH 7.4, 1 mM EDTA, 10% 
glycerol, 0.3 mM PMSF) . The cells were pelleted by 
centrifugation, then resuspended in 50 /xl of solubilization 
buffer (125 mM NaCl, 10 mM Tris-HCl, pH 7.4, 1 mM EDTA, 1% 

20 Triton X-100, 0.3 mM PMSF, 1% Trasylol) and incubated for 
40 minutes on ice. Cells were centrifuged again and 
supernatants were subjected to analysis by SDS-gel 
electrophoresis using 4-15% polyacryleunide gels, followed 

• 125 

by autoradiography. I-TGF-Bl formed a 70 kDa cross- 
25 linked complex in the transf ected PAE cells (PAE/TBR-I 
cells) . The size of this complex was very similar to that 
of the TGF-B type I receptor complex observed at lower 
amounts in the untransf ected cells. A concomitant increase 
of 94 kDa TGF-B type II receptor complex could also be 
30 observed in the PAE/TBR-I cells. Components of 150-190 
kDa, which may represent crosslinked complexes between the 
type I and type II receptors, were also observed in the 
PAE/TBR-I cells. 

In order to determine whether the cross-linked 70 kDa 
35 complex contained the protein encoded by the ALK-5 cDNA^ 
the affinity cross-linking was followed . by 
immunoprecipitation using the VPN antiserxm. For this. 



wo 94/11502 



PCT/GB93/02367 



28 

cells in 25 cm^ flasks were used. The supernatants 
obtained after cross-linking were incubated with 7 iil of 
preinunune serum or VPN antiserum in the presence or absence 
of 10 tig of peptide for l.Sh at 4®C. Immune complexes were 
5 then added to 50 nl of protein' A-Sepharose slurry and 
inciabated for 45 minutes at 4'*C* The protein A-Sepharose 
beads were washed four times with the washing buffer, once 
with distilled water, and the samples were analyzed by SDS- 
gel electrophoresis using 4-15% polyacrylamide gradient 

10 gels and autoradiography. A 70 kDa cross-linked complex 
was precipitated by the VPN antiserum in PAE/TBR-1 cells, 
and a weaker band of the same size was also seen in the 
untransfected cells, indicating that the untransfected PAE 
cells contained a low amount of endogenous ALK-5. The 70 

15 kDa complex was not observed when preimmxme senm was used, 
or when immune serum was blocked by 10 /ig of peptide. 
Moreover, a coprecipitated 94 kDa component could also be 
observed in the PAE/TBR-I cells. The latter component is 
likely to represent a TGF-B type II receptor complex, since 

20 an antiserum, termed DRL, which was raised against a 
synthetic peptide from the C-terminal par± of the TGP-fl 
type II receptor, precipitated a 94 )cDa TGF-B type II 
receptor complex, as well as a 70 kDa type I receptor 
complex from PAE/TBR-I cells. 

25 The carbohydrate contents of Al*K-5 and the TGF-B type 

II receptor were characterized by deglycosylation using 
endoglycosidase F as described above and analyzed by SDS- 
polyacrylamide gel electrophoresis and autoradiography. 
The ALK-5 cross-linked complex shifted from 70 kDa to 66 

30 kDa, whereas that of the type II receptor shifted from 94 
kDa to 82 kDa. The observed larger shift of the type II 
receptor band compared with that of the ALK-5 band is 
consistent with the deglycosylation data of the type I and 
type II receptors on rat liver cells reported previously 

35 (Cheifetz et al (1988) J. Biol. Chem. 263, 16984-16991), 
and fits well with the fact that the porcine TGF-B type II 
receptor has two N-glycosylation sites (Lin et al (1992) 



wo 94/11502 



PCr/GB93/02367 



29 

Cell 68# 775-785) , whereas ALK-5 has only one (see SEQ ID 
No. 9). 

Binding of TGF-fll to the type I receptor is known to 
be abolished by transient treatment of the cells with 
5 dithiothreitol (DTT) (Cheifetz and Massague (1991) J. Biol. 
Chem. 266 , 20767-20772; Wrana et al (1992) Cell 71, 1003- 
1014) . When analyzed by affinity cross-linking, binding of 
^^^1-TGF-Bl to ALK-5, but not to the type II receptor, was 
completely abolished by DTT treatment of PAE/TflR-1 cells. 

10 Affinity cross-linking followed by immunoprecipitation by 
the VPN antisenm showed that neither the ALK-5 nor the 
type II receptor complexes was precipitated after DTT 
treatment, indicating that the VPN antiserxm reacts only 
with ALK-5. The data show that the VPN antiserum 

15 recognizes a TGF-B type I receptor, and that the type I and 
type II receptors form a heteromeric complex. 
'^I-TGF-Bl Binding & Affinity Cr ossltnkina of Transfected 
COS Cells 

Transient expression plasmids of ALKs -1 to -6 and 
20 TBR-II were generated by sxibcloning into the pSV7d 
expression vector or into the pcDNA I expression vector 
(Invitrogen) . Transient transfection of COS-1 cells and 
iodination of TGF-fll were carried out as described above. 
Crosslinking and immunoprecipitation were performed as 
described for PA£ cells above. 

Transfection of cDNAs for ALKs into COS-1 cells did 
not show any appreciable binding of ^^I-TGFBl, consistent 
with the observation that type I receptors do not bind T<;f- 
B in the absence of type II receptors. When the TBR-II 
cDNA was co-transfected with cDNAs for the different ALKs, 
type I receptor-like complexes were seen, at different 
levels, in each case. COS-1 cells transfected with TBR-II 
and ALK cDNAs were analyzed by affinity crosslinking 
followed by immunoprecipitation using the DRL antisera or 
specific antisera against ALKs. Each one of the ALKs bound 

125 

I-TGF-Bl and was coimmunoprecipitated with the TBR-II 
complex using the DRL antiserum. Comparison of the 



wo 94/11502 



PCr/GB93/02367 



efficiency of the different ALKs to form heteromeric 
complexes with TBR-II, revealed that ALK-5 formed such 
complexes more efficiently than the other ALKs. The size 
_ - _ of the crosslinked complex was larger for ALK-3 than for 
5 other ALKs, consistent with its slightly larger size. 
Expression of the ALK Protein in Different Cell yyp Ag 

Two different approaches were used to elucidate which 
ALK's are physiological type I receptors for TGF-B. 

Firstly, several cell lines were tested for the 

10 expression of the ALK proteins by cross-linking followed by 
immunoprecipitation using the specific antiseras against 
ALKs and the TGF-fl type II receptor. The mink lung 
epithelial cell line, MvlLu, is widely used to provide 
target cells for TGF-B action and is well characterized 

15 regarding TGF-B receptors (Laiho et al (1990) J. Biol. 
Chem. 265, 18518-18524; Laiho et ai (1991) J. Biol. Chem. 
266, 9108-9112). Only the VPN antiserum efficiently 
precipitated both type I and type II TGF-B receptors in the 
wild type MvlLu cells. The DRL antiserum also precipitated 

20 components with the same size as those precipitated by the 
VPN antiserxm. A mutant cell line (R mutant) which lacks 
the TGF-B type I receptor and does not respond to TGF-B 
(Laiho et al , supra) was also investigated by cross-linking 
followed by immunoprecipitation. Consistent with the 

25 results obtained by Laiho et al (1990), supra the type III 
and type II TGF-B receptor complexes, but not the type I 
receptor complex, were observed by affinity crosslinking. 
crosslinking followed by immunoprecipatition using the DRL 
antisertun revealed only the type II receptor complex, 

30 whereas neither the type I nor type II receptor complexes 
was seen using the VPN antiserum. When the cells were 
metabolically labelled and subjected to immunoprecipitation 
using the VPN antisertam, the 53 )cDa ALK-5 protein was 
precipitated in both the wild-type and R mutant MvlLu 

35 cells. These results suggest that the type I receptor 
expressed in the R mutant is ALK-5, which has lost the 
affinity for binding to TGF-B after mutation. 



wo 94/11502 



PCr/GB93/02367 



31 

Ibe type I and type II TGF-B receptor complexes could 
be precipitated by the VPN and DRL antisera in other cell 
lines^ including himan foreskin fibroblasts (AG1518), human 
lung adenocarcinoma cells (A549) , and human oral squamous 
5 cell carcinoma cells (HSC-2), Affinity cross-linking 
studies revealed multiple TGF-B type I receptor-liXe 
complexes of 70-77 kDa in these cells. These components 
were less efficiently competed by excess unlabelled TGF-fil 
in HSC-2 cells. Moreover, the type II receptor complex was 

10 low or not detectable in A549 and HSC-2 cells. Cross- 
linking followed by immxinoprecipitation revealed that the 
VPN antisertun precipitated only the 70 kOa complex among 
the 70-77 kDa components. The DRL antiserum precipitated 
the 94 kDa type II receptor complex as veil as the 70 kDa 

15 type I receptor complex in these cells, but not the 
putative type I receptor complexes of slightly larger 
sizes. These results suggest that multiple type I TGF-B 
receptors may exist and that the 70 kDa complex containing 
ALK-S forms a heteromeric complex with the TGF-B type II 

20 receptor cloned by Lin et al (1992) Cell 775-785, more 
efficiently that the other species. In rat 

pheochromocytoma cells (PC12) which have been reported to 
have no TGF-B receptor complexes by affinity cross-linking 
(Massague et al (1990) Ann. N.Y. Acad. Sci. 593 . 59-72), 

25 neither VPN nor DRL antisera precipitated the TGF-B 
receptor complexes. The antisera against ALKs -1 to -4 and 
ALKS did not efficiently immxinoprecipitate the crosslinked 
receptor complexes in porcine aortic endothelial (PAE) 
cells or human foreskin fibroblasts. 

30 Next, it was investigated whether ALKs could restore 

responsiveness to TGF-6 in the R mutant of HvlLu cells, 
which lack the ligand-binding ability of the TGF-B type I 
receptor but have intact type II receptor. Wild-type MvlLu 
cells and mutant cells were rransfected with ALK cDNA and 

35 were then assayed for the production of plasminogen 
activator inhibitor-1 (PAI-1) which is produced as a result 
of TGF-B receptor activation as described previously by 



wo 94/1 1502 PCr/GB93/02367 

32 

Laiho et al (1991) Mol. Cell Biol, 11, 972-978, Briefly, 
cells were added with or without 10 ng/ml of TGF-Bl for 2 
hours in serum-free MCDB 104 without methionine • 
Thereafter, cultiires were labelled with [^^S] methionine (40 
5 /iCi/ml) for 2 hours. The cells were removed by washing on 
ice once in PBS, twice in 10 mM Tris-HCl (pH 8.0), 0.5% 
soditim deoxycholate, 1 mM PMSF, twice in 2 mM Tris-HCl (pH 
8.0), and once in PBS. Extracellular matrix proteins were 
extracted by scraping cells into the SDS-sample buffer 

10 containing DTT, and analyzed by SDS-gel electrophoresis 
followed by fluorography using Amplify. PAI-1 can be 
identified as a characteristic 45kDa band (Laiho £t ai 
(1991) Mol. Cell Biol. H, 972-978). Wild-type MvlLu cells 
responded to TGF-B and produced PAI-1, whereas the R mutant 

15 clone did not, even after stimulation by TGF-Bl. Transient 
transf ection of the ALK-5 cDNA into the R mutant clone led 
to the production of PAI-1 in response to the stimulation 
by TGF-Bl, indicating that the ALK-5 cDNA encodes a 
functional TGF-B type I receptor. In contrast, the R 

20 mutant cells that were transf ected with other ALKs did not 
produce PAI-1 upon the addition of TGF-Bl. 

Using similar approaches as those described above for 
the identification of TGF-B-binding ALKs, the ability of 
ALKs to bind activin in the presence of ActRIl was 

25 examined. COS-1 cells were co-transf ected as described 
above. Recombinant human activin A was iodinated using the 
chloramine T method (Mathews and Vale (1991) Cell £5, 973- 
982). Transf ected COS-1 cells were analysed for binding 
and crosslinJcing of '^I-activin A in the presence or 

30 absence of excess unlabelled activin A. The crosslinked 
complexes were subjected to immunoprecipitation using DRL 
antisera or specific ALK antisera. 

All ALKs appear tc bind activin A in the presence of 
Act R-II. This is more clearly demonstrated by affinity 

35 cross-linking followed by immunopreciptation. ALK-2 and 
ALK-4 bound ^^I-activin A and were coimmxinoprecipitated 



wo 94/1 1502 PCT/GB93/02367 

33 

with ActR-II. Other ALKs also bound '^^I-activin A but with 
a lower efficiency compared to ALK-2 and ALK-4. 

In order to investigate whether ALKs are physiological 
activin type I receptors, activin responsive cells were 
5 examined for the expression of endogenous activin type I 
receptors. MvlLu cells, as well as the R mutant, express 
both type I and type II receptors for activin, and the R 
mutant cells produce PAI-1 upon the addition of activin A. 
MvlLu cells were labeled with ^^I-activin A, cross-linked 

10 and immunoprecipitated by the antisera against ActR-II or 
ALKs as described above* 

The type I and type II receptor complexes in MvlLu 
cells were immunoprecipitated only by the antisera against 
ALK-2, ALK-4 and ActR-II. Similar results were obtained 

15 using the R mutant cells. PAE cells do not bind activin 
because of the lack of type II receptors for activin, and 
so cells were transfected with a chimeric receptor, to 
enable them to bind activin, as described herein. A 
plasmid (chim A) containing the extracelluar domain and C- 

20 terminal tail of Act R-II (amino-acids -19 to 116 and 465 
to 494, respectively (Mathews and Vale (1991) Cell, 65# 
973-982)) and the kinase domain of TBR-II (amino-acids 160- 
543) (Lin et al (1992) Cell, 68# 775-785) was constructed 
and transfected into pcDNA/neo (Invitrogen) . PAE cells 

25 were stably transfected with the chim A plasmid by 
electroporation, and cells expressing the chim A protein 
were established as described previously. PAE/Chim A cells 
were then subjected to '^I-activin A labelling crosslinking 
and immunoprecipitation as described above. 

30 Similar to MvlLu cells, activin type I receptor 

complexes in PAE/Chim A cells were immunoprecipitated by 
the AIiK-2 and ALK-4 antisera. These results show that both 
ALK-2 and ALK-4 serve as high affinity type I receptors for 
activin A in these cells. 

35 ALK-1, ALK-3 and ALK-6 bind TGF-Bl and activin A in 

the presence of their respective type II receptors, but the 



wo 94/11502 



PCr/GB93/02367 



34 

fiinctional consequences of the binding of the ligands 
remains to be elucidated. 

The invention has been described by way of example 
only, without restriction of its scope. The invention is 
5 defined by the subject matter herein, including the claims 
that follow the immediately following full Secjuence 
Listings. 



wo 94/11502 



PCT/GB93/02367 



35 



SEQUENCE LISTING 

(1) GENERAL INPOKMATIONs 

(i) APPLICANTS 

(A) NAKE: Ludwig Institute for Cancer Reaearch 

(B) STREETS St. Mary '8 Hospital Medical School, Norfolk 

Place 

(C) CITY: Pdddington, London 

(E) COUNTRY: United Kingdom 

(F) POSTAL CODE (ZIP): H2 IPG 

(ii) TITLE OF INVENTION: PROTEINS HAVING SERINE /THREONINE KINASE 
DOMAINS, CORRESPONDING NUCLEIC ACID MOLECULES, AND THEIR 
USE 

(iii) NUMBER OF SEQUENCES: 29 

(iv) COMPUTER READABLE FORM: 

(A) MEDIUM TYPE: Floppy disk 

(B) COMPUTER: IBM PC compatible 

(C) OPERATING SYSTEM: PC-DOS /M$ -DOS 

(D) SOFTWARE: Patentin Release #1.0, Version #1.25 (EPO) 



(2) INFORMATION FOR SEQ ID NO: 1: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 1984 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS : unknown 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: cDNA 

(iii) HYPOTHETICAL: NO 

(iii) ANTI-SENSE: NO 

(V) FRAGMENT TYPE: internal 

(vi) ORIGINAL SOURCE: 

(A) ORGANISM: Homo sapiens 

( ix ) FEATURE : 

(A) NAME/KEY: CDS 

(B) LOCATION: 283.. 1791 



(xi) SEQUENCE DESCRIPTION: SEQ ID NOl 1: 

AGGAAACGGT TTATTAGGAG CGAGTCGTCG AGCTGGCCCA GGCAGGAAGA CGCTGGAATA 60 

AGAAACATTT TTGCTCCAGC CCCCATCCCA GTCCCGGGAG GCTGCCGCGC CAGCTGCGCC 120 

GAGCGAGCCC CTCCCCGGCT CCAGCCCCGT CCCGGGCCGC GCCGGACCCC AGCCCGCCGT 180 

CCAGCGCTGG CGGTGCAACT GCGGCCGCGC GGTGGAGGGG AGGTGGCCCC G6TCCGCCGA 240 



SUBSnrUTi SHEET 



wo 94/11502 



PCr/GB93/02367 



36 

AGGCTAGCGC CCCGCCACCC GCA6ACCGGC CCCAGAGGGA CC ATG ACC TTG GGC 294 

Mot Thr LOU Cly 
1 

TCC CCC ACC AAA CCC CTT CTG ATG CTG CTC ATG GCC TTG GTG ACC CAG 342 
Ser Pro Arg Lye Cly Leu Leu Met Leu Leu Mot Ala Leu Val Thr Gin 
5 10 15 20 

GGA GAC CCT GTG AAG CCG TCT CCC GGC CCC CTG GTG ACC TGC AOG T6T 390 
Gly Asp Pro Val Lye Pro Ser Arg Gly Pro Lou Val Thr Cys Thr Cys 
25 30 35 

GAG AGC CCA CAT TGC AAG GGG CCT ACC TGC CGG GGG CCC TCC TGC ACA 436 
Glu Ser Pro His Cys Lya Gly Pro Thr Cys Arg Gly Ala Trp Cys Thr 
40 45 50 

GTA GTG CTG GTG CGG GAG GAG GGG AGG CAC CCC CAG GAA CAT CGG GGC 486 
Val Val Leu Val Arg Glu Glu Gly Arg Hie Pro Gin Glu His Arg Gly 
55 60 65 

TGC GGG AAC TTG CAC AGG CAG CTC TGC AGG GGG CGC CCC ACC GAG TTC 534 
Cys Gly Asn Leu His Arg Glu Leu Cys Arg Gly Arg Pro Thr Glu Phe 
70 75 BO 

GTC AAC CAC TAC TGC TGC GAC AGC CAC CTC TGC AAC CAC AAC GTG TCC 582 
Val Asn His Tyr Cys Cys Asp Ser His Leu Cys Asn His Asn Val Ser 
85 90 95 100 

CTC GTG CTG GAG GCC ACC CAA CCT CCT TCG GAG CAG CCG GGA ACA GAT 630 
Leu Val Leu Glu Ala Thr Gin Pro Pro Ser Glu Gin Pro Gly Thr Asp 
105 110 115 

GGC CAG CTG GCC CTG ATC CTG GGC CCC GTG CTG GCC TTG CTG GCC CTG 678 
Gly Gin Leu Ala Leu lie Leu Gly Pro Val Leu Ala Leu Lou Ala Leu 
120 125 130 

GTG GCC CTG GGT GTC CTG GGC CTG TG6 CAT CTC CGA CGG AGG CAG GAG 726 
Val Ala Leu Gly Val Leu Gly Leu Tzp His Val Arg Arg Arg Gin Glu 
135 140 145 

AAG CAG CGT GGC CTG CAC AGC GAG CTG GGA GAG TCC ACT CTC ATC CTG 774 
Lys Gin Arg Gly Leu His Ser Glu Leu Gly Glu Ser Ser Leu lie Leu 
150 155 160 

AAA GCA TCT GAG CAG GGC GAC ACG ATG TTG GGG GAC CTC CTG GAC ACT 822 
Lys Ala Ser Glu Gin Gly Asp Thr Mot Leu Gly Asp Leu Leu Asp Ser 
165 170 175 180 

GAC TGC ACC ACA GGG AGT GGC TCA GGG CTC CCC TTC CTG GTG CAG AGG 870 
Asp Cys Thr Thr Gly Ser Gly Ser Gly Leu Pro Phe Leu Val Gin Arg 
185 190 195 

ACA GTG GCA CGG CAG GTT GCC TTG GTG GAG TCT GTG GGA AAA GGC CGC 918 
Thr Val Ala Arg Gin Val Ala Lou Val Glu Cys Val Gly Lys Gly Arg 
200 205 210 

TAT GGC GAA GTG TGG CGG GGC TTG TGG CAC GGT GAG AGT GTG GCC GTC 966 
Tyr Gly Glu Val Trp Arg Gly Leu Trp His Gly Glu Ser Val Ala Val 
215 220 225 



SUBSTITUTE SHEET 



wo 94/11502 



PCr/GB93/02367 



37 

AAG ATC TTC TCC TCC AGG GAT GAA CAG TCC TGG TTC CGG GAG ACT GAG 10X4 
Lys lie Phe Ser Set Arg Asp Glu Gin Ser Trp Phe Arg Glu Thr Glu 
230 235 240 

ATC TAT AAC ACA CTA TTG CTC AGA CAC GAC AAC ATC CTA GGC TTC ATC 1062 
He Tyr Asn Thr Val Leu Leu Arg Hio Aep Asn He Leu Gly Phe He 
245 250 255 260 

GCC TCA GAC ATG ACC TCC CGC AAC TCG AGC ACG CAG CTG TGG CTC ATC 1110 
Ala Ser Asp Met Thr Ser Arg Asn Ser Ser Thr Gin Leu Trp Leu He 
265 270 275 

ACG CAC TAC CAC GAG CAC GGC TCC CTC TAC GAC ITT CTG CAG AGA CAG 1158 
Thr His Tyr His Glu His Gly Ser Leu Tyr Asp Phe Leu Gin Arg Gin 
280 285 290 

ACG CTG GAG CCC CAT CTG GCT CTG AGG CTA GCT GTG TCC GOG GCA TGC 1206 
Thr Leu Glu Pro His Leu Ala Leu Arg Leu Ala Val Ser Ala Ala Cys 
295 300 305 

GGC CTG GCG CAC CTG CAC GTG GAG ATC TTC GGT ACA CAG GGC AAA CCA 1254 
Gly I^u Ala His Leu His Val Glu He Phe Gly Thr Gin Gly Lys Pro 
310 315 320 

GCC ATT GCC CAC CGC GAC TTC AAG AGC CGC AAT GTG CTC GTC AAG AGC 1302 
Ala He Ala His Arg Asp Phe Lys Ser Arg Asn Val Leu Val Lys Ser 
325 330 335 340 

AAC CTG CAG TGT TGC ATC GCC GAC CTG GGC CTG GCT GTG ATG CAC TCA 1350 
Asn Leu Gin Cys Cys He Ala Aep Leu Gly Leu Ala Val Met Bis Ser 
345 350 355 

CAG GGC AGC GAT TAC CTG GAC ATC GGC AAC AAC CCG AGA GTG GGC ACC 1398 
Gin Gly Ser Asp Tyr Leu Asp He Gly Asn Asn Pro Arg Val Gly Thr 
360 365 370 

AAG CGG TAC ATG GCA CCC GAG GTG CTG GAC GAG CAG ATC CGC ACG GAC 1446 
Lys Arg Tyr Met Ala Pro Glu Val Leu Asp Glu Gin He Arg Thr Asp 
375 380 385 

TGC TTT GAG TCC TAC AAG TGG ACT GAC ATC TGG GCC TTT GGC CTG GTG 1494 
Cys Phe Glu Ser Tyr Lys Trp Thr Asp He Trp Ala Phe Gly Leu Val 
390 395 400 

CTG TGG GAG ATT GCC CGC CGG ACC ATC GTG AAT GGC ATC GTG GAG GAC 1542 
Leu Trp Glu He Ala Arg Arg Thr He Val Asn Gly He Val Glu Asp 
405 410 415 420 

TAT AGA CCA CCC TTC TAT GAT GTG GTG CCC AAT GAC CCC AGC TTT GAG 1590 
Tyr Arg Pro Pro Phe Tyr Asp Val Val Pro Asn Asp Pro Ser Phe Glu 
425 430 435 

GAC ATG AAG AAG GTG GTG TGT GTG GAT CAG CAG ACC CCC ACC ATC OCT 1638 
Asp Met Lys Lys Val Val Cys Val Asp Gin Gin Thr Pro Thr He Pro 
440 445 450 

AAC CGG CTG GCT GCA GAC CCG GTC CTC TCA GGC CTA GCT CAG ATG ATG 1686 
Asn Arg Leu Ala Ala Asp Pro Val Leu Ser Gly Leu Ala Gin Met Met 
455 460 465 



SUBSmUTE SHEET 



WO94/11S02 



PCT/GB93/02367 



38 

CGG GAG TGC TGG TAC CCA AAC CCC TCT GCC CCA CTC ACC GC6 CTG CGC 1734 
Ara Glu Cye Txp Tyr Pro Asn Pro Sor Ala Arg Lou Thr Ala Leu Arg 
470 475 480 

ATC AAG AAG ACA CTA CAA AAA ATT AGO AAC AGT CCA GAG AAG CCT AAA 17B2 
lie Lys Lys Thr Leu Gin Lye lie Set Asn Ser Pro Glu Lys Pro Lys 
485 490 495 500 

GTG ATT CAA TAGCCCAGGA GCACCTGATT CCTTTCTCCC T6CAGGGGGC 1831 
Val lie Gin 

TGGGGGGGTG GGGGGCAGT6 GATGGTGCCC TATCTGGGTA GAGGTAGTGT GAGTGTGGTG 1891 

TGTGCTGGGG ATGGGCAGCT GCGCCTGCCT GCTCGGCCCC CAGCCCACCC AGCCAAAAAT 1951 

ACAGCTGGGC TGAAACCTGA AAAAAAAAAA AAA 1984 



(2) INFORMATION FOR SEQ ID NO: 2: 

(i) SEQUENCE CHARACTERISTICS: 
<A) LENGTH: 503 amino acids 
(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2: 

Met Thr Leu Gly Ser Pro Arg Lys Gly Leu Leu Met Leu Leu Met Ala 
1 5 10 15 

Leu Val Thr Gin Gly Asp Pro Val Lys Pro Ser Arg Gly Pro Leu Val 
20 25 30 

Thr Cys Thr Cys Glu Ser Pro His Cys Lys Gly Pro Thr Cys Arg Gly 
35 40 45 

Ala Trp Cye Thr Val Val Leu Val Arg Glu Glu Gly Arg His Pro Gin 
50 55 60 

Glu His Arg Gly Cys Gly Asn Leu His Arg Glu Leu Cys Arg Gly Arg 
65 70 75 80 

Pro Thr Glu Phe Val Asn His Tyr Cys Cys Asp Ser His Leu Cys Asn 
85 90 95 

His Asn Val Ser Leu Val Leu Glu Ala Thr Gin Pro Pro Ser Glu Gin 
100 105 110 

Pro Gly Thr Asp Gly Gin Leu Ala I«eu lie Leu Gly Pro Val Leu Ala 
115 120 125 

Leu Leu Ala Leu Val Ala Leu Gly Val Leu Gly Leu Trp His Val Arg 
130 135 140 

Arg Arg Gin Glu Lys Gin Arg Gly Leu His Ser Glu Leu Gly ^lu Ser 
145 150 155 160 



SUBSTITUTE SHEET 



wo 94/1 1502 PCr/GB93/02367 

Ser Leu He Leu Lye Ala Ser Clu Gin Gly Aep Thr Met Leu Gly Asp 
165 170 175 

Leu Leu Asp Ser Asp Cys Thr Thr Gly Ser Gly Ser Gly Leu Pro Phe 
180 185 190 

Leu Val Gin Arg Thr Val Ala Arg Gin Val Ala Leu Val Glu Cys Val 
195 200 205 

Gly Lya Gly Arg Tyr Gly Glu Val Trp Arg Gly Leu Trp His Gly Glu 
210 215 220 

Ser Val Ala Val Lys He Phe Ser Ser Arg Asp Glu Gin Ser Trp Phe 
225 230 235 240 

Arg Glu Thr Glu He Tyr Asn Thr Val Leu Leu Arg His Asp Asn He 
245 250 255 

Leu Gly Phe He Ala Ser Asp Met Thr Ser Arg Asn Ser Ser Thr Gin 
260 265 270 

Leu Trp Leu He Thr His Tyr His Glu His Gly Ser Leu Tyr Asp Phe 
275 280 285 

Leu Gin Arg Gin Thr Leu Clu Pro His Leu Ala Leu Arg Leu Ala Val 
290 295 300 

Ser Ala Ala Cys Gly Leu Ala His Leu His Val Glu He Phe Gly Thr 
305 310 315 320 

Gin Gly Lys Pro Ala He Ala His Arg Asp Phe Lye Ser Arg Asn Val 
325 330 335 

Leu Val Lys Ser Asn Leu Gin Cys Cys He Ala Asp Leu Gly Leu Ala 
340 345 350 

Val Met His Ser Gin Gly Ser Asp Tyr Leu Asp He Gly Asn Asn Pro 
355 360 365 

Arg Val Cly Thr Lys Arg Tyr Met Ala Pro Glu Val Leu Asp Glu Gin 
370 375 380 

He Arg Thr Asp Cys Phe Glu Ser Tyr Lys Trp Thr Asp He Trp Ala 
385 390 395 400 

Phe Cly Leu Val Leu Trp Glu He Ala Arg Arg Thr He Val Asn Gly 
405 410 415 

He Val Glu Asp Tyr Arg Pro Pro Phe Tyr Asp Val Val Pro Asn Asp 
420 425 430 

Pro Ser Phe Glu Asp Met Lys Lys Val Val Cys Val Asp Gin Gin Thr 
435 440 445 

Pro Thr He Pro Asn Arg Leu Ala Ala Asp Pro Val Leu Ser Gly Leu 
450 455 460 

Ala Gin Met Met Arg Glu Cys Trp Tyr Pro Asn Pro Ser Ala Arg Leu 
465 470 475 480 



SUBSTTTUTE SHEET 



wo 94/11502 



PCr/GB93/02367 



40 

Thr Ala Leu Arg lie Lye Lys Thr Vm GXn lyu lie Ser Aen Ser Pro 
485 490 495 

Glu Lys Pro Lys Val lie Gin 
500 



(2) INFOIUIATION FOR SEQ ID NO: 3: 

(i) SEQX7ENCE CHARACTERISTICS: 

<A) LENGTH: 2724 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS : unknown 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: cDNA 

(iii) HYPOTHETICAL: NO 

(iii) ANTI-SENSE: NO 

(V) FRAGMENT TYPE: internal 

(vi) ORIGINAL SOURCE: 

(A) ORGANISM: Homo sapiens 

(ix) FEATURE: 

(A) NAME/KEY: CDS 

(B) LOCATION: 104.. 1630 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3; 

CTCCGAGTAC CCCAGTGACC AGAGTGAGAG AAGCTCTGAA CGAGGGCACG OGGCTTGAA6 60 

GACTGTGGGC AGATGTGACC AAGAGCCTGC ATTAAGTTGT ACA ATG GTA GAT GGA 115 

Met Val Asp Gly 
1 

GTG ATG ATT CTT CCT GTG CTT ATC ATG ATT GCT CTC CCC TCC CCT ACT 163 
Val Met lie Leu Pro Val Leu lie Met lie Ala Leu Pro Ser Pro Ser 
5 10 15 20 

ATG GAA GAT GAG AAG CCC AAG GTC AAC CCC AAA CTC TAC ATG TGT GTG 211 
Met Glu Asp Glu Lys Pro Lys Val Asn Pro Lys Leu Tyr Met Cys Val 
25 30 35 

TGT GAA GGT CTC TCC TGC GGT AAT GAG GAC CAC TGT GAA GGC CAG CAG 259 
Cys Glu Gly Leu Ser Cys Gly Asn Glu Asp His Cys Glu Gly Gin Gin 
40 45 50 

TGC TTT TCC TCA CTG AGC ATC AAC GAT GGC TTC CAC GTC TAC CAG AAA 307 
Cys Phe Ser Ser Leu Ser lie Asn Asp Gly Phe Bis Val Tyr Gin Lys 
55 60 65 

GGC TGC TTC CAG GTT TAT GAG CAG GGA AAG ATG ACC TGT AAG ACC CCG 355 
Gly Cys Phe Gin Val Tyr Glu Gin Gly Lys Met Thr Cys Lys Thr Pro 
70 75 80 



SUBSTITUTE SHEET 



wo 94/11502 



PCT/GB93/02367 



41 

CCC TCC CCT GCC CAA CCT GTC GAG TGC TCC CAA CGC GAC TCC TCT AAC 403 
Pro Sor Pro Cly Cln Ala Val Glu Cy« Cy« Cln Gly Asp Trp Cy« Asn 
85 90 95 100 

AGG AAC ATC ACC GCC CAC CTG CCC ACT AAA GGA AAA TCC TTC CCT GGA 451 
Arg Asn He Thr Ala Gin Leu Pro Thr Lye Gly Lye Ser Phe Pro Gly 
105 110 115 

ACA CAG AAT TTC CAC TTG GAG GTT CGC CTC ATT ATT CTC TCT GTA GTG 499 
Thr Gin Asn Phe Hie Z^u Glu Val Gly Leu He He Leu Ser Val Val 
120 125 130 

TTC GCA GTA TGT CTT TTA GCC TGC CTC CTG GGA GTT GCT CTC CGA AAA 547 
Phe Ala Val Cys Leu Leu Ala Cye Leu Leu Gly Val Ala Leu Arg Lye 
135 140 145 

TTT AAA AGG CGC AAC CAA GAA CGC CTC AAT CCC CGA GAC GTG GAG TAT 595 
Phe Lye Arg Arg Aan Gin Glu Arg Leu Aen Pro Arg Asp Val Glu Tyr 
150 155 160 

GGC ACT ATC GAA GGG CTC ATC ACC ACC AAT GTT GGA GAC AGC ACT TTA 643 
Gly Thr He Glu Gly Leu He Thr Thr Aan Val Gly Asp Ser Thr Leu 
165 170 175 IBO 

CCA GAT TTA TTG GAT CAT TCG TGT ACA TCA GGA ACT CGC TCT GGT CTT 691 
Ala Asp Leu Leu Asp His Ser Cys Thr Ser Gly Ser Gly Ser Gly Leu 
185 190 195 

CCT TTT CTG GTA CAA AGA ACA CTG GCT CCC CAG ATT ACA CTG TTG GAG 739 
Pro Phe Leu Val Gin Arg Thr Val Ala Arg Gin He Thr Leu Leu Glu 
200 205 210 

TGT GTC GGG AAA GGC AGG TAT GGT GAG GTG TGG AGG GGC AGC TGG CAA 787 
Cys Val Gly Lys Gly Arg Tyr Gly Glu Val Trp Arg Gly Ser Trp Cln 
215 220 225 

GGG GAA AAT GTT GCC GTG AAG ATC TTC TCC TCC CGT GAT GAG AA6 TCA 835 
Gly Glu Asn Val Ala Val Lys He Phe Ser Ser Arg Asp Glu Lys Ser 
230 235 240 

TGG TTC AGG GAA ACG CAA TTG TAC AAC ACT GTG ATG CTG AGG CAT GAA 883 
Trp Phe Arg Glu Thr Glu Leu Tyr Asn Thr Val Met Leu Arg His Glu 
245 250 255 260 

AAT ATC TTA GGT TTC ATT GCT TCA GAC ATC ACA TCA AGA CAC TCC ACT 931 
Asn He Leu Gly Phe He Ala Ser Asp Met Thr Ser Arg His Ser Ser 
265 270 275 

ACC CAG CTG TGG TTA ATT ACA CAT TAT CAT GAA ATG GGA TCG TTG TAC 979 
Thr Gin Leu Trp Leu He Thr Bis Tyr His Glu Met Gly Ser Leu Tyr 
280 285 290 

GAC TAT CTT CAG CTT ACT ACT CTG GAT ACA CTT AGC TGC CTT CGA ATA 1027 
Asp Tyr Leu Gin Leu Thr Thr Leu Asp Thr Val Ser Cys Leu Arg He 
295 300 305 

GTG CTG TCC ATA CCT ACT CGT CTT GCA CAT TTC CAC ATA GAG ATA TTT 1075 
Val Leu Ser He Ala Ser Gly Leu Ala His Leu His He Glu He Phe 
310 315 320 



SUBSrmJTE SHEET 



wo 94/11502 



PCr/GB93/02367 



42 



GGG ACC CAA GGG AAA CCA CCC ATT GCC CAT CGA CAT TTA AAC AGC AAA 1123 
Gly Thr Gin Cly Lys Pro Ala Ila Ala Hia Arg Asp Leu Ly» Ser Lya 
325 330 33S 340 

AAT ATT CTC GTT AAG AAC AAT GGA CAG TGT TGC ATA CCA GAT TTG GGC 1171 
Asn He Leu Val Lys Ly« Asn Gly Gin Cys Cye He Ala Asp Leu Gly 
345 350 355 

CTG GCA GTC ATC CAT TCC CAG AGC ACC AAT CAG CTT GAT CTG GGC AAC 1219 
Leu Ala Val Met His Ser Gin Ser Thr Asn Gin Leu Asp Val Gly Asn 
360 365 370 

AAT CCC CGT CTC GGC ACC AAG CGC TAC ATG GCC CCC GAA GTT CTA GAT 1267 
Asn Pro Arg Val Gly Thr Lys Arg Tyr Met Ala Pro Glu Val Leu Asp 
375 380 385 

GAA ACC ATC CAG CTG GAT TGT TTC GAT TCT TAT AAA AGC GTC GAT ATT 1315 
Glu Thr He Gin Val Asp Cys Phe Asp Ser Tyr Lys Arg Val Asp He 
390 395 400 

TGG GCC TTT GGA CTT GTT TTG TGG GAA CTG GCC AGG CGG ATG GTG AGC 1363 
Trp Ala Phe Gly Leu Val Leu Trp Glu Val Ala Arg Arg Met Val Ser 
405 410 415 420 

AAT GGT ATA GTC GAG GAT TAC AAG CCA CCG TTC TAC GAT GTG GTT CCC 1411 
Asn Gly He Val Glu Asp Tyr Lys Pro Pro Phe Tyr Asp Val Val Pro 
425 430 435 

AAT GAC CCA ACT TTT GAA CAT ATG AGG AAG GTA GTC TGT GTG GAT CAA 1459 
Asn Asp Pro Ser Pho Glu Asp Met Arg Lys Val Val Cys Val Asp Gin 
440 445 450 

CAA AGG CCA AAC ATA CCC AAC AGA TGG TTC TCA GAC CCC ACA TTA ACC 1507 
Gin Arg Pro Asn He Pro Asn Arg Trp Phe Ser Asp Pro Thr Leu Thr 
455 460 465 

TCT CTG GCC AAC CTA ATG AAA GAA TGC TGG TAT CAA AAT CCA TCC GCA 1555 
Ser Leu Ala Lys Leu Met Lys Glu Cys Trp Tyr Gin Asn Pro Ser Ala 
470 475 480 

AGA CTC ACA GCA CTG CGT ATC AAA AAG ACT TTG ACC AAA ATT GAT AAT 1603 
Arg Leu Thr Ala Leu Arg He Lys Lys Thr Leu Thr Lys He Asp Asn 
485 490 495 500 

TCC CTC GAC AAA TTG AAA ACT GAC TGT TGACATTTTC ATAGTGTCAA 1650 
Ser Leu Asp Lys Leu Lys Thr Asp Cys 
505 



GAAGGAAGAT 


TTGACGTTGT 


TGTCATTGTC 


CAGCTGGGAC 


CTAATGCTGC 


CCTGACTCGT 


1710 


TGTCAGAATG 


GAATCCATCT 


GTCTCCCTCC 


CCAAATGGCT 


GCTTTGAGAA 


GGCAGACGTC 


1770 


GTACCCAGCC 


ATGTGTTGGG 


GAGACATCAA 


AACCACCCTA 


ACCTCGCTCG 


ATGACTGTGA 


1830 


ACTGGGCATT 


TCACGAACTC 


TTCACACTGC 


AGAGACTAAT 


GTTGGACAGA 


CACTGTTGCA 


1890 


AAGGTAGGGA 


CTGGAGGAAC 


ACACAGAAAT 


CCTAAAAGAG 


ATCTGGGCAT 


TAAGTCAGTG 


1950 


GCTTTGCATA 


-GCTTTCACAA 


GTCTCCTAGA 


CACTCCCCAC 


GGGAAACTCA 


AGGAGGTGGT 


2010 



SUBSTITUTE SHEET 



wo 94/11502 



PCT/GB93/02367 



GAATTTTTAA 

CATTCCTTAC 

GCGTACTCCA 

TGTCAGACTT 

AATTGTTTAT 

AACTGCTTTG 

ATGTTTTTAA 

TTTAAGTGCT 

ACGTATTTAG 

TTTCAGTAGA 

ATTACGTGCA 

TATTTAGTAG 



TCAGCAATAT 

TTGCACTGTT 

CTGGTCTGTC 

TGCTGCATTT 

ACACAACTTT 

TGCATATGTT 

CACTATACTC 

TCACATTTGT 

CCATTACCCA 

ATTTTAGTCC 

TTTAAACTCT 

TTATTTGTAT 



TGCCTGTGCT 

ACTCTTAATT 

TTTGGATAAT 

TACACATGTG 

GCAAATTATT 

AAAGCTTATT 

TAAAATGGAC 

ATGTGTGTAG 

CGTGACACCA 

TGAAC6CTAC 

GCCAGAAAAA 

AAATTAAATA 



43 

TCTCTTCTTT 

TTAAAGACCC 

AGGAATTCAA 

CTGATCTTTA 

TATTACTTGT 

TTTATCTGCT 

ATTTTCTTTT 

ACTGTAACTT 

CCGAATATAT 

GGGGAAAAT6 

AATAACTATT 

AACTGTTT.TC 



ATTGCACTAC 

AACTTCCCAA 

TTTCGCAAAA 

CAATGATGCC 

GCACTTAGTA 

CTTATGATTT 

ATTATCAGTT 

TTTTTCAGTT 

TATCCATTTA 

CATTTTCTTC 

TTGTTTTAAT 

AAGTCAAAAA 



GAATTCTTTG 
AATGTTGGCT 
CAAAATGTAA 
GAACATTAGG 
GTTTTTACAA 
TATTACAGAA 
AAAATCACAT 
CATATGCAGA 
GAAGCAAAGA 
AGAATTATCC 
CTACTTTTTC 
AAAA 



(2) INFORMATION TOR SEQ ID NOt 4: 

(i) SEQUENCE CHARACTERISTICS: 
<A) LENGTHS 509 amino acide 
(B) TYPES amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4: 

Met val ABp Gly Val Met He Leu Pro Val Leu He Met He Ala Leu 



Pro Ser Pro 



Ser Met Glu Asp Glu Ly« Pro Lye Val Aan Pro Lys Leu 



20 25 

Tvr Met eye Val Cye Glu Gly Leu Ser Cya Gly Aan Glu Aap Hia Cy« 
' 35 40 

Glu Gly Gin Gin Cye Phe Ser Ser Leu Ser He Aon Asp Gly Phe Hie 



50 55 
val Tyr Gin LyB Gly Cys Phe Gin Val Tyr Glu Cln Gly Lya Met Thr 
65 '^^ 

Thr Pro Pro Ser Pro Gly Gin Ala Val Glu Cys Cye Cln Gly 



Cye Lya 



B5 90 
ABP Trp eye Aan Arg Asn He Thr Ala Cln Leu Pro Thr Ly. Gly Lye 



100 



ser Phe Pro Gly Thr Gin Aan Phe His Leu Glu Val Gly Leu He He 



2070 
2130 
2190 
2250 
2310 
2370 
2430 
2490 
2550 
2610 
2670 
2724 



115 



120 



5UBSTmJTt SHEET 



wo 94/11502 PCr/GB93/02367 

44 

I,eu ser val Val Ph. Ala Val Cy. Leu Leu Ala Cy. Leu Leu Cly Val 
130 1^0 

Ala Leu Arg Lye Phe Lys Arg Arg Asn Gin Glu Arg Leu Aan Pro Arg 
145 150 15b -tow 

A8P val Glu Tyr Gly Thr He Glu Gly Leu Ha Thr Thr Asn Val Gly 
*^ 165 170 1'5 

ASP ser Thr Leu Ala Aap Leu Leu Asp His Ser Cys Thr Ser Gly ser 
180 185 190 

Gly ser Gly Leu Pro Phe Leu Val Gin Arg Thr Val Ala Arg Gin He 
195 200 205 

Thr Leu Leu Glu Cys Val Gly Lys Gly Arg Tyr Gly Glu Val Trp Arg 
210 215 220 

Gly ser Trp Gin Gly Glu Asn Val Ala Val Lys He Phe Ser Ser Arg 
225 230 235 240 

ASP Glu Lys ser Trp Phe Arg Glu Thr Glu Leu Tyr Asn Thr Val Met 
245 250 255 

Leu Arg His Glu Asn He Leu Gly Phe He Ala Ser Asp Met Thr Ser 
260 265 270 

Ara His ser Ser Thr Gin Leu Trp Leu He Thr His Tyr His Glu Met 
^ 275 280 285 

Civ Ser Leu Tyr Asp Tyr Leu Gin Leu Thr Thr Leu Asp Thr Val Ser 
^ 290 295 300 

cva Leu Arg He val Leu Ser He Ala Ser Gly Leu Ala His Leu His 
305 310 "° 

He Glu He Phe Gly Thr Gin Gly Lys Pro Ala He Ala His Arg Asp 
325 330 335 

Leu Lys Ser Lys Asn He Leu Val Lys Lys Asn Gly Gin Cys Cys He 
^ 340 345 350 

Ala Asp Leu Gly Leu Ala Val Met His Ser Gin Ser Thr Asn Gin Leu 
355 360 365 

Asp Val Gly Asn Asn Pro Arg Val Cly Thr Lys Arg Tyr Met Ala Pro 
*^ 370 375 380 

Glu val Leu Asp Glu Thr He Gin Val Asp Cys Phe Asp Ser Tyr Lys 

Aro val Asp He Trp Ala Phe Gly Leu Val Leu Trp Glu Val Ala Arg 
405 410 415 

Arg Met Val Ser Asn Gly He Val Glu Asp Tyr Lye Pro Pro Phe Tyr 
420 425 430 

Asp Val Val Pro Asn Asp Pro Ser Phe Glu Asp Met Arg Lys Val Val 
435 440 445 



SUBSTITUTE SHEET 



wo 94/11502 PCT/GB93/02367 

45 

CVS Val Abo Gin Gin Arg Pro Aen He Pro Aan Arg Trp Ph« Sar Aap 
^ 450 455 460 

Pro Thr Leu Thr Ser Leu Ala Ly» Leu Met Lye Glu Cye Trp Tyr Gin 
465 470 475 480 

Aen Pro Ser Ala Arg Leu Thr Ala Leu Arg He Lye Lye Thr Leu Thr 
485 490 495 

LvB He Asp Aen Ser Lou Aep Lye Leu Lye Thr Aep Cye 

^ 500 505 

(2) IKFORMATION FOR SEQ ID NO: 5: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTHS 2932 base pairs 

(B) TYPES nucleic acid 

(C) STRANDEDMESSS unknown 

(D) TOPOLOGY s linear 

(II) MOLECULE TYPE: cDNA 

(iii) HYPOTHETICAL: NO 

(iii) ANTI-SENSE s NO 

(V) FRAGMENT TYPE: internal 

<vi) ORIGINAL SOURCE: 

(A) ORGANISMS Homo sapiens 

(ix) FEATXTREs 

(A) NAME/KEYS CDS 

(B) LOCATION: 310. .1905 

(xi) SEQUENCE DESCRIPTION: SEQ ID NOs 5: 

GCTCCGCGCC CAGGGCTCGA GGATGCCTTC CCTGCGGTCC GGACTTATGA AAATATGCAT 60 

CAGTTTAATA CTGTCTTGGA ATTCATGAGA TGCAAGCATA GGTCAAAGCT GTTTGGAGAA 120 

AATCAGAACT ACAGTTTTAT CTAGCCACAT CTTCGACCAG TCCTAACAAA GCAGTGGGAG 180 

TTGAAGTCAT TGTCAACTGC TTGCGATCTT TTACAAGAAA ATCTCACTGA ATGATAGTCA 240 

TTTAAATTGG TGAAGTAGCA AGACCAATTA TTAAACGTGA CAGTACACAG CAAACATTAC 300 

AATTGAACA ATG ACT CAC CTA TAC ATT TAC ATC AGA TTA TTG GCA GCC 348 
Met Thr Gin Lou Tyr He Tyr He Arg Leu Leu Gly Ala 
1 5 10 

TAT TTG TTC ATC ATT TCT CCT GTT CAA GGA CA6 AAT CTC GAT AGT ATC 396 
Tvr Leu Phe He He Ser Arg Val Cln Gly Gin Asn Leu Asp Ser Met 
^ 15 20 25 



SUBSTITUTE SHEET 



wo 94/11502 



PCT/GB93/02367 



46 

CTT CAT CGC ACT GGC ATG AAA TCA CAC TCC GAC CAC AAA AAG TCA GAA 444 

Leu HiB Cly Thr Gly Met Lya Ser Asp Ser Aop Gin Lys Ly» Sor Glu 
30 35 40 45 

AAT GGA OTA ACC TTA GCA CCA GAC GAT ACC TTC CCT TTT TTA AAG TCC 492 
Aen Gly Val Thr Leu Ala Pro Glu Asp Thr Leu Pro Phe Leu Lys Cy» 
50 55 60 

TAT TGC TCA GGG CAC TGT CCA GAT GAT GCT ATT AAT AAC ACA TGC ATA 540 
Tyr Cys Ser Gly His Cys Pro Asp Asp Ala lie Asn Asn Thr Cye He 
65 70 75 

ACT AAT GGA CAT TGC TTT GCC ATC ATA GAA GAA GAT GAC CAC GGA GAA 588 
Thr Asn Gly His Cys Phe Ala He He Glu Glu Asp Asp Gin Gly Glu 
80 ^5 

ACC ACA TTA GCT TCA GGG TGT ATG AAA TAT GAA GGA TCT GAT TTT CAG 636 
Thr Thr Leu Ala Ser Gly Cys Met Lys Tyr Glu Gly Ser Asp Phe Gin 
95 100 105 

TGC AAA CAT TCT CCA AAA GCC CAG CTA CGC CGG ACA ATA GAA TCT TCT 684 
Cys Lys Asp Ser Pro Lys Ala Gin Leu Arg Arg Thr He Glu Cys Cys 
110 115 120 125 

CGG ACC AAT TTA TGT AAC CAG TAT TTG CAA CCC ACA CTG CCC CCT GTT 732 
Arg Thr Asn Leu Cys Asn Gin Tyr Leu Gin Pro Thr Leu Pro Pro Val 
130 135 140 

GTC ATA CGT CCG TTT TTT GAT GGC AGC ATT CGA TGG CTG GTT TTG CTC 780 
Val He Gly Pro Phe Phe Asp Gly Ser He Arg Trp Leu Val Leu Leu 
145 150 155 

ATT TCT ATG GCT CTC TGC ATA ATT CCT ATG ATC ATC TTC TCC AGC TGC 828 
He Ser Met Ala Val Cye He He Ala Met He He Phe Ser Ser Cys 
160 165 170 

TTT TGT TAC AAA CAT TAT TGC AAG AGC ATC TCA ACC ACA CCT CCT TAC 876 
Phe Cys Tyr Lys His Tyr Cys Lys Ser He Ser Ser Arg Arg Arg Tyr 
175 180 185 

AAT CGT GAT TTG GAA CAG GAT GAA GCA TTT ATT CCA GTT GGA GAA TCA 924 
Asn Arg Asp Leu Glu Gin Asp Glu Ala Phe He Pro Val Gly Glu Ser 
190 195 200 205 

CTA AAA GAC CTT ATT GAC CAG TCA CAA ACT TCT CGT ACT GGG TCT GGA 972 
Leu Lys Asp Leu He Asp Gin Ser Gin Ser Ser Gly Ser Gly ser Gly 
210 215 220 

CTA CCT TTA TTG GTT CAC CGA ACT ATT GCC AAA CAG ATT CAG ATG GTC 1020 
Leu Pro Leu Leu Val Gin Arg Thr He Ala Lys Gin He Gin Met Val 
225 230 235 

CGG CAA GTT CGT AAA GGC CGA TAT GGA GAA GTA TGG ATG GGC AAA TGG 1068 
Arg Gin Val Gly Lys Gly Arg Tyr Gly Glu Val Trp Met Gly Lys Trp 
240 245 250 

CGT GGC GAA AAA CTG GCC CTG AAA GTA TTC TTT ACC ACT GAA GAA GCC 1116 
Arg Gly Glu Lys Val Ala Val Lys Val Phe Phe Thr Thr Glu Glu Ala . 
255 260 265 



SUBSTITUTE SHEET 



wo 94/1 1502 PCr/GB93/02367 

47 

AGO TGC TTT CGA GAA ACA CAA ATC TAC CAA ACT GTG CTA ATG CCC CAT 1164 
ser Trp Phc Glu Thr Glu He Tyr Gin Thr Val Leu Met Arg Hie 
270 275 280 285 

GAA AAC ATA CTT GGT TTC ATA GCG CCA CAC ATT AAA GGT ACA GCT TCC 1212 
Glu Asn He Leu Gly Phe He Ala Ala Asp He Lys Gly Thr Gly Ser 
290 295 300 

TGG ACT CAG CTC TAT TTG ATT ACT GAT TAC CAT GAA AAT GGA TCT CTC 1260 
Tru Thr Gin Leu Tyr Leu He Thr Asp Tyr His Glu Asn Gly Ser Leu 
^ 305 310 315 

TAT GAC TTC CTG AAA TGT GCT ACA CTC GAC ACC AGA GCC CTG CTT AAA 1308 
Tvr Asp Phe Leu Lys Cys Ala Thr Leu Asp Thr Arg Ala Leu Leu Lys 
^ 320 325 330 

TTG GCT TAT TCA GCT GCC TGT GCT CTG TGC CAC CTC CAC ACA GAA ATT 1356 
Leu Ala Tyr Ser Ala Ala Cys Gly Leu Cys His Leu His Thr Glu He 
335 340 345 

TAT GGC ACC CAA GGA AAG CCC GCA ATT GCT CAT CGA CAC CTA AAG AGC 1404 
Tyr Gly Thr Gin Gly Lys Pro Ala He Ala His Arg Asp Leu Lys Ser 
350 355 360 365 

AAA AAC ATC CTC ATC AAG AAA AAT GCG AGT TGC TGC ATT GCT GAC CTG 1452 
Lys Asn He Leu He Lys Lys Asn Gly Ser Cys Cys He Ala Asp Leu 
^ 370 375 380 

GGC CTT GCT GTT AAA TTC AAC AGT GAC ACA AAT CAA CTT GAT GTG CCC 1500 
Gly Leu Ala Val Lys Phe Asn Ser Asp Thr Asn Glu Val Asp Val Pro 
385 390 395 

TTG AAT ACC AGG GTG GCC ACC AAA CGC TAC ATC GCT CCC GAA GTG CTC 1548 
Leu Aan Thr Arg Val Gly Thr Lys Arg Tyr Met Ala Pro Glu Val Leu 
400 405 410 

GAC GAA AGC CTG AAC AAA AAC CAC TTC CAG CCC TAC ATC ATC GCT GAC 1596 
Asp Glu Ser Leu Asn Lys Aen His Phe Gin Pro Tyr He Met Ala Asp 
415 420 425 

ATC TAC AGC TTC GGC CTA ATC ATT TGG GAG ATG GCT CGT CGT TGT ATC 1644 
He Tyr Ser Phe Gly Leu He He Trp Glu Met Ala Arg Arg Cys He 
430 435 440 445 

ACA GGA GGG ATC CTG GAA GAA TAC CAA TTC CCA TAT TAC AAC ATG CTA 1692 
Thr Glv Gly He Val Glu Glu Tyr Gin Leu Pro Tyr Tyr Asn Met Val 
450 455 460 

CCG AGT GAT CCG TCA TAC GAA GAT ATG CGT GAG GTT GTG TGT CTC AAA 1740 
Pro Ser Asp Pro Ser Tyr Glu Asp Met Arg Glu Val Val Cys Val Lys 
465 470 475 

CGT TTG CGG CCA ATT GTG TCT AAT CCG TGG AAC AGT GAT GAA TCT CTA 1788 
Arg Leu Arg Pro He Val Ser Asn Arg Trp Asn Ser Asp Glu Cys Leu 
480 485 490 

CGA GCA GTT TTG AAG CTA ATG TCA GAA TGC TGG GCC CAC AAT CCA GCC 1836 
Arg Ala Val Leu Lys Leu Met Ser Glu Cys Trp Ala His Asn Pro Ala 
495 500 505 



<;iiRCTmiTF^HErr 



wo 94/11502 PCT/GB93/02367 

TCC AGA CTC ACA GCA TTO ACA ATT AAC AAG ACG CTT CCC AAG ATO CTT 1884 
Sar Arg Leu Thr AXa Leu Arg !!• Ly« Ly« Thr Leu AlA Ly« Met Val 
510 515 520 525 

GAA TCC CAA GAT GTA AAA ATC TCATGGTTAA ACCATCGGAG GACAAACTCT 1935 
Glu Ser Gin Asp Val Lys lie 
530 

AGACTGCAAG AACTGTTTTT ACCCATGCCA TCCGTGGAAT TAGAGTGCAA TAAGGATCTT 1995 

AACTTGGTTC TCAGACTCTT TCTTCACTAC GTGTTCACAG CCTGCTAATA TTAAACCTTT 2055 

CACTACTCTT ATTAGGATAC AAGCTGGGAA CTTCTAAACA CTTCATTCTT TATATATGGA 2115 

CACCTTTATT TTAAATGTGC TTTTTCATGC C TTTTTTT A A GTGGGTTTTT ATGAACTGCA 2175 

TCAAGACTTC AATCCTGATT AGTGTCTCCA GTCAAGCTCT GGGTACTGAA TTGCCTGTTC 2235 

ATAAAACGGT GCTTTCTGTG AAAGCCTTAA GAAGATAAAT GAGCGCAGCA GAGATGGA6A 2295 

AATAGACTTT GCCTTTTACC TGAGACATTC AGTTOGTTTC TATTCTACCT TTGTAAAACA 2355 

GCCTATAGAT GATGATGTGT TTGGGATACT GCTTATTTTA TGATACTTTG TCCTCTGTCC 2415 

TTAGTGATGT GTCTGTGTCT CCATGCACAT GCACGCOGGG ATTCCTCTGC TGCCATTT6A 2475 

ATTAGAAGAA AATAATTTAT ATGCATGCAC AGGAAGATAT TGGTCGCCGG TGGTTTTCTC 2535 

CTTTAAAAAT GCAATATCTG ACCAAGATTC GCCAATCTCA TACAAGCCAT TTACTTTGCA 2595 

AGTGAGATAG CTTCCCCACC AGCTTTATTT TTTAACATGA AAGCTGATGC CAACGCCAAA 2655 

AGAAGTTTAA ACCATCTCTA AATTTGGACT GTTTTCCTTC AACCACCATT TTTTTTGTGC 2715 

TTATTATTTT TGTCACCGAA AGCATCCTCT CCAAAGTTGG ACCTTCTATT GCCAT6AACC 2775 

ATGCTTACAA AGAAAGCACT TCTTATTGAA GTGAATTCCT GCATTTGATA GCAATGTAAG 2835 

TGCCTATAAC CATCTTCTAT ATTCTTTATT CTCAGTAACT TTTAAAAGCC AAGTTATTTA 2895 

TATTTTGTCT ATAATGTCCT TTATTTGCAA ATCACCC 2932 

(2) INFORMATION TOR SEQ ID NOi 6: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 532 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6: 

Met Thr Gin Leu Tyr lie Tyr He Arg Leu Leu Gly Ala Tyr Leu Phe 
1 5 10 15 

He lie Ser Arg Val Gin Gly Gin Asn Leu Asp Ser Met Leu His Gly 
20 25 30 



SUBSTITUTE SHEET 



wo 94/1 1502 PCT/GB93/02367 

Thr Gly Met Lym Ser Aap Ser Asp Gin Lya Lya Sor Glu Asn Cly Val 
35 40 45 

Thr Leu Ala Pro Glu Aap Thr Leu Pro Phe Leu Lya Cya Tyr Cya Ser 
SO 55 60 

Cly Hia Cya Pro Aap Aap Ala lie Aan Aan Thr Cya He Thr Aan Gly 
65 70 75 80 

Hia Cya Phe Ala He lie Glu Glu Aap Aap Gin Gly Glu Thr Thr Leu 
85 90 95 

Ala Ser Gly Cya Met Lya Tyr Glu Gly Ser Aap Phe Gin Cya Lya Aap 
100 105 110 

Ser Pro Lya Ala Gin Leu Arg Arg Thr Ha Glu Cya Cya Arg Thr Aan 
115 120 125 

Leu Cya Aan Gin Tyr Leu Gin Pro Thr Leu Pro Pro Val Val He Cly 
130 135 140 

Pro Phe Phe Aap Gly Ser He Arg Trp Leu Val Leu Leu He Ser Met 
145 ISO 155 160 

Ala Val Cya He He Ala Met He He Phe Ser Ser Cya Phe Cya Tyr 
165 170 175 

Lya Hia Tyr Cya Lya Ser He Ser Ser Arg Arg Arg Tyr Aan Arg Aap 
180 185 190 

Leu Glu Gin Aap Glu Ala Phe He Pro Val Gly Glu Ser Leu Lya Aap 
195 200 205 

Leu He Aap Gin Ser Gin Ser Ser Gly Ser Gly Ser Gly Leu Pro Leu 
210 215 220 

Leu Val Cln Arg Thr He Ala Lya Gin He Gin Met Val Arg Gin Val 
225 230 235 240 

Gly Lya Gly Arg Tyr Gly Glu Val Trp Met Gly Lya Trp Arg Gly Glu 
245 250 255 

Lya Val Ala Val Lya Val Phe Phe Thr Thr Glu Glu Ala Ser Trp Phe 
260 265 270 

Arg Glu Thr Glu He Tyr Gin Thr Val Leu Met Arg Hia Glu Aan He 
275 280 285 

Leu Gly Phe He Ala Ala Aap He Lya Gly Thr Gly Ser Trp Thr Gin 
290 295 300 

Leu Tyr Leu He Thr Aap Tyr Hia Glu Aan Gly Ser Leu Tyr Aap Phe 
305 310 315 320 

Leu Lya Cya Ala Thr Leu Aap Thr Arg Ala Leu Leu Lya Leu Ala Tyr 
325 330 335 

Ser Ala Ala Cya Gly Leu Cys Hia Leu Hia Thr Glu He Tyr Gly Thr 
340 345 350 



SUBSTITUTE SHEET 



wo 94/11502 



PCT/GB93/02367 



50 



GXn Gly Lys Pro Ala lie Ala Bia Arg Aep Leu Lya Ser Lys Aan lie 

355 360 365 

Leu He Lya Lys Aan Gly Ser Cya Cya He Ala Aap Leu Gly Leu Ala 
370 375 380 

Val Lys Phe Aan Ser Asp Thr Asn Glu Val Aap Val Pro Leu Aen Thr 
385 390 395 400 

Arg Val Gly Thr Lya Arg Tyr Met Ala Pro Glu Val Leu Aep Glu Ser 
405 410 415 

Leu Asn Lys Aan Hia Phe Gin Pro Tyr He Het Ala Asp He Tyr Ser 
420 425 430 

Phe Gly Leu He He Trp Glu Met Ala Arg Arg Cya He Thr Gly Gly 
435 440 445 

He Val Glu Glu Tyr Gin Leu Pro Tyr Tyr Aan Met Val Pro Ser Asp 
450 455 460 

Pro Ser Tyr Glu Asp Net Arg Glu Val Val Cya Val Lys Arg Leu Arg 
465 470 475 480 

Pro He Val Ser Aan Arg Trp Aan Ser Asp Glu Cya Leu Arg Ala Val 
485 490 495 

Leu Lya Leu Met Ser Glu Cya Trp Ala Hia Asn Pro Ala Ser Arg Leu 
500 505 510 

Thr Ala Leu Arg He Lya Lys Thr Leu Ala Lya Met Val Glu Ser Gin 
515 520 525 

Aap Val Lya He 
530 



(2) INFOHMATZON FOR SEQ ID NO: 7z 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH! 2333 base paira 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: unknown 

(D) TOPOLOGY: linear 

<ii) MOLECULE TYPE: CDNA 

(iii) HYPOTHETICAL: NO 

(iii) ANTI-SENSE: NO 

(V) FRAGMENT TYPE: internal 

<vi) ORIGINAL SOURCE: 

(A) ORGANISM: Homo sapiena 

(ix) FEATURE: 

(A) NAME/KEY: CDS 

(B) LOCATION: 1*.1515 



SUBSTTTUTE SHEET 



wo 94/11502 



PCT/GB93/02367 



51 

(xi) 5EQUENCB DESCRIPTION! SBQ ID NOl 7: 

ATG GCG GAG TCG GCC CGA GCC TCC TCC TTC TTC CCC CTT GTT GTC CTC 48 
Met Ala Glu Ser Ala Gly Ala Ser Ser Phe Phe Pro Leu Val Val Leu 
15 10 15 

CTG CTC GCC GGC AGC GGC GGG TCC GGG CCC CGG GGG GTC CAG CCT CTG 96 
Leu Leu Ala Gly Ser Gly Gly Ser Gly Pro Arg Gly Val Gin Ala Leu 
20 25 30 

CTG TGT GCC TGC ACC AGC TGC CTC CAG GCC AAC TAC ACG TGT GAG ACA 144 
Leu Cys Ala Cys Thr Ser Cya Leu Gin Ala Asn Tyr Thr Cys Glu Thr 
35 40 45 

GAT GGG GCC TGC ATG GTT TCC TTT TTC AAT CTG GAT GGG ATG GAG CAC 192 
Asp Gly Ala Cys Met Val Ser Phe Phe Asn Leu Asp Gly Met Glu His 
50 55 60 

CAT GTG CGC ACC TGC ATC CCC AAA GTG GAG CTG GTC CCT GCC GGG AAG 240 
His Val Arg Thr Cys lie Pro Lys Val Glu Leu Val Pro Ala Gly Lys 
65 70 75 80 

CCC TTC TAC TGC CTG AGC TCG GAG GAC CTG CGC AAC ACC CAC TGC TGC 288 
Pro Phe Tyr Cys Leu Ser Ser Glu Asp Leu Arg Asn Thr His Cys Cys 
85 90 95 

TAC ACT GAC TAC TGC AAC AGG ATC GAC TTG AGG GTG CCC ACT GGT CAC 336 
Tyr Thr Asp Tyr Cvs Asn Arg lie Asp Leu Arg Val Pro Ser Gly His 
100 105 110 

CTC AAG GAG CCT GAG CAC CCG TCC ATG TGG GGC CCG GTG GAG CTG GTA 384 
Leu Lys Glu Pro Glu His Pro Ser Met Trp Gly Pro Val Glu Leu Val 
115 120 125 

GGC ATC ATC GCC GGC CCG GTG TTC CTC CTG TTC CTC ATC ATC ATC ATT 432 
Gly lie lie Ala Gly Pro Val Phe Leu Leu Phe Leu lie lie lie lie 
130 135 140 

GTT TTC CTT GTC ATT AAC TAT CAT CAG CGT CTC TAT CAC AAC CCC CAG 480 
Val Phe Leu Val lie Asn Tyr His Gin Arg Val Tyr His Asn Arg Gin 
145 150 155 160 

AGA CTG GAC ATG GAA GAT CCC TCA TGT GAG ATG TGT CTC TCC AAA GAC 528 
Arg Leu Asp Met Glu Asp Pro Ser Cys Glu Met Cys Leu Ser Lys Asp 
165 170 175 

AAG ACG CTC CAG GAT CTT GTC TAC GAT CTC TCC ACC TCA GGG TCT GGC 576 
Lys Thr Leu Gin Asp Leu Val Tyr Asp Leu Ser Thr Ser Gly Ser Gly 
180 185 190 

TCA GGG TTA CCC CTC TTT GTC CAG CCC ACA CTG CCC CGA ACC ATC CTT 624 
Ser Gly Leu Pro Leu Phe Val Gin Arg Thr Val Ala Arg Thr lie Val 
195 200 205 

TTA CAA GAG ATT ATT GGC AAG GGT CGG TTT GGG GAA GTA TGG CGG GGC 672 
Leu Gin Glu He He Gly Lys Gly Arg Phe Gly Glu Val Trp Arg Gly 
210 215 220 



5UBSTmJTE SHEET 



wo 94/11502 



PCT/GB93/02367 



52 

CGC TGG AGG GGT GGT GAT CTG CCT GTG AAA ATA TTC TCT TCT OCT CAA 720 
Ara Trp Arg Gly Gly Asp Val Ala Val Lys lie Phm Ser Ser Arg Glu 
225 230 235 240 

GAA CGG TCT TGG TTC AGG 6AA GCA GAG ATA TAG CAG ACG GTC ATG CTG 768 
Glu Arg Ser Trp Phe Arg Glu Ala Glu He Tyr Gin Thr Val Het Leu 
245 250 255 

CGC CAT GAA AAC ATC CTT GGA TTT ATT GCT GCT GAC AAT AAA GAT AAT 816 
Arg His Glu Aan He Leu Gly Phe He Ala Ala Asp Aan Lya Aep Aan 
260 265 270 

GGC ACC TGG ACA CAG CTG TGG CTT GTT TCT GAC TAT CAT GAG CAC GGG 864 
Gly Thr Trp Thr Gin Leu Trp Leu Val Ser Asp Tyr His Glu His Gly 
275 280 285 

TCC CTG TTT CAT TAT CTG AAC CGC TAC ACA GTC ACA ATT GAG GGG ATG 912 
Ser Leu Phe Asp Tyr Leu Asn Arg Tyr Thr Val Thr He Glu Gly Met 
290 295 300 

ATT AAG CTG GCC TTG TCT GCT GCT AGT GGG CTG GCA CAC CTG CAC ATG 960 
He Lys Leu Ala Leu Ser Ala Ala Ser Gly Leu Ala His Leu His Met 
305 310 315 320 

GAG ATC CTG GGC ACC CAA GGG AAG CCT GGA ATT GCT CAT CGA GAC TTA 1008 
Glu He Val Gly Thr Gin Gly Lys Pro Gly He Ala His Arg Asp Leu 
325 330 335 

AAG TCA AAG AAC ATT CTG GTG AAG AAA AAT GGC ATG TGT GCC ATA GCA 1056 
Lys Ser Lys Asn He Leu Val Lys Lys Asn Gly Met Cys Ala He Ala 
340 345 350 

GAC CTG GGC CTG GCT GTC CGT CAT GAT GCA GTC ACT GAC ACC ATT GAC 1104 
Asp Leu Gly Leu Ala Val Arg His Asp Ala Val Thr Asp Thr He Asp 
355 360 365 

ATT GCC CCG AAT CAG AGG GTG GGG ACC AAA CGA TAC ATG GCC CCT GAA 1152 
He Ala Pro Asn Gin Arg Val Gly Thr Lys Arg Tyr Met Ala Pro Glu 
370 375 380 

GTA CTT GAT GAA ACC ATT AAT ATG AAA CAC TTT GAC TCC TTT AAA TGT 1200 
Val Leu Asp Glu Thr He Asn Met Lys His Phe Asp Ser Phe Lys Cys 
385 390 395 400 

GCT GAT ATT TAT GCC CTC GGG CTT GTA TAT TGG GAG ATT GCT CGA AGA 1248 
Ala Asp He Tyr Ala Leu Gly Leu Val Tyr Trp Glu He Ala Arg Arg 
405 410 415 

TGC AAT TCT GGA GGA GTC CAT GAA GAA TAT CAG CTG CCA TAT TAC GAC 1296 
Cys Asn Ser Gly Gly Val His Glu Glu Tyr Gin Leu Pro Tyr Tyr Asp 
420 425 430 

TTA GTG CCC TCT GAC CCT TCC ATT GAG GAA ATG CGA AAG GTT GTA TGT 1344 
Leu Val Pro Ser Asp Pro Ser He Glu Glu Met Arg Lys Val Val Cys 
435 440 445 

GAT CAG AAG CTG CGT CCC AAC ATC CCC AAC TGG TGG CAG AGT TAT GAG 1392 
Asp Gin Lys Leu Arg Pro Asn He Pro Asn Trp Trp Gin Ser Tyr Glu 
450 455 460 



SUBSTITUTE SHEET 



wo 94/11502 



PCT/GB93/02367 



53 



GCA CTC CGC GTC ATG CGC AAG ATG ATC CGK GAG TGT TGC TAT CCC AAC 1440 
Ala Lpu Ar9 Val M«t Gly Lym Met Met Arg Glu Cya Trp Tyr Ala Asn 
465 470 475 480 

GGC GCA GCC CGC CTG ACG GCC CTG CGC ATC AAG AAG ACC CTC TCC CAG 1488 
Gly Ala Ala Arg Leu Thr Ala Leu Arg lie Lys Lya Thr Leu Ser Gin 
485 490 495 

CTC AGC GTG CAG GAA GAC GTG AAG ATC TAACTCCTCC CTCTCTCCAC 1535 
Leu Ser Val Gin Glu Asp Val Lye lie 
500 SOS 



ACGGAGCTCC 


TGGCAGCGAG 


AACTACGCAC 


AGCTGCCGCG 


TTGAGCGTAC 


GATGGAGGCC 


1595 


TACCTCTCGT 


TTCTGCCCAG 


CCCTCTGTGG 


CCAGGAGCCC 


TGGCCCGCAA 


GAGGGACA6A 


1655 


GCCCGGGAGA 


GACTCGCTCA 


CTCCCATCTT 


GGGTTTGAGA 


CAGACACCTT 


TTCTATTTAC 


1715 


CTCCTAATGG 


CATGGAGACT 


CTGAGAGCGA 


ATTGTGTGGA 


GAACTCAGTG 


CCACACCTCG 


1775 


AACTCCTTGT 


AGTGGGAAGT 


CCCGCGAAAC 


CCGGTGCATC 


TGGCACGTGG 


CCAGGAGCCA 


1835 


TGACAGGGGC 


GCTTGGGAGG 


GGCCGGAGGA 


ACCGAGGTGT 


TGCCAGTGCT 


AAGCT6CCCT 


1895 


GAGGGTTTCC 


TTCGGGGACC 


AGCCCACAGC 


ACACCAAGGT 


GGCCCGGAAG 


AACCAGAAGT 


1955 


GCAGCCCCTC 


TCACAGGCAG 


CTCTGAGCC6 


CGCTTTCCCC 


TCCTCCCTCG 


GATGGAC6CT 


2015 


GCCGGGAGAC 


TGCCAGTGGA 


GACGGAATCT 


GCCGCTTTGT 


CTGTCCAGCC 


GTGTGTGCAT 


2075 


GTGCCGAGGT 


GCCTCCCCCG 


TTGTGCCTGG 


TTCGTGCCAT 


GCCCTTACAC 


GTGCCTGTGA 


2135 


GTGTGTGTGT 


GTGTCTGTAG 


GTGCCCACTT 


ACCTCCTTCA 


GCTTTCTGTG 


CATGTGCAGG 


2195 


TCGGGGGTGT 


GGTCGTCATG 


CTGTCCGTGC 


TTCCTGGTGC 


CTCTTTTCAG 


TAGTGAGCAG 


2255 


CATCTAGTTT 


CCCTGGTGCC 


CTTCCCTGGA 


GGTCTCTCCC 


TCCCCCAGAG 


CCCCTCATGC 


2315 


CACAGTGGTA 


CTCTGTGT 










2333 



(2) IKFORMATION FOR SEQ 10 NOs 8: 

<i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 505 amino acide 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTIONS SEQ ID NOt 8i 

Met Ala Glu Ser Ala Gly Ala Ser Ser Phe Phe Pro Leu Val Val Leu 
15 10 IS 

Leu Leu Ala Gly Ser Gly Gly Ser Gly Pro Arg Gly Val Gin Ala Leu 
20 25 30 



<;UB5TmiTE SHEET 



wo 94/1 1502 PCT/GB93/02367 

54 

Leu Cye Ala Cys Thr Ser Cys Leu Gin Ala Asn Tyr Thr cys Glu Thr 
35 40 45 

Asp Gly Ala Cye Met Val Ser Phe Phe Asn Leu Aep Gly Met Glu His 
50 55 60 

His Val Arg Thr Cys lie Pro Lys Val Glu Leu Val Pro Ala Gly Lys 
65 70 75 80 

Pro Phe Tyr Cys Leu Ser Ser Glu Aep Leu Arg Asn Thr His Cys Cys 
"85 90 95 

Tyr Thr Asp Tyr Cys Asn Arg He Asp Leu Arg Val Pro Ser Gly His 
100 105 110 

Leu Lys Glu Pro Glu His Pro Ser Met Trp Gly Pro Val Glu Leu Val 
115 120 125 

Gly He He Ala Gly Pro Val Phe Leu Leu Phe Leu He He He He 
130 135 140 

Val Phe Leu Val He Asn Tyr His Gin Arg Val Tyr His Asn Arg Gin 
145 150 155 160 

Arg Leu Asp Met Glu Asp Pro Ser Cys Glu Met Cys Leu Ser Lys Asp 
165 170 175 

Lys Thr Leu Gin Asp Leu Val Tyr Asp Leu Ser Thr Ser Gly Ser Gly 
IBO 185 190 

Ser Gly Leu Pro Leu Phe Val Gin Arg Thr Val Ala Arg Thr He Val 
195 200 205 

Leu Gin Glu He He Gly Lys Gly Arg Phe Gly Glu Val Trp Arg Gly 
210 215 220 

Arg Trp Arg Gly Gly Asp Val Ala Val Lys He Phe Ser Ser Arg Glu 
225 230 235 240 

Glu Arg Ser Trp Phe Arg Glu Ala Glu He Tyr Gin Thr val Met Leu 
245 250 255 

Arg His Glu Asn He Leu Gly Phe He Ala Ala Asp Asn Lys Asp Asn 
260 265 270 

Gly Thr Trp Thr Gin Leu Trp Leu Val Ser Asp Tyr His Glu His Gly 
275 280 285 

ser Leu Phe Asp Tyr Leu Asn Arg Tyr Thr Val Thr He Glu Gly Met 
290 295 300 

He Lys Leu Ala Leu Ser Ala Ala Ser Gly Leu Ala His Leu His Met 
305 310 315 320 

Glu He Val Gly Thr Gin Gly Lys Pro Gly He Ala His Arg Asp Leu 
325 330 335 

Lys ser Lys Asn He Leu Val Lys Lys Asn Gly Met Cys Ala He Ala 
340 345 350 



SUBSTTTUTE SHEET 



wo 94/1 1502 



PCT/GB93/02367 



55 



Asp Leu Gly Leu Ala Val Arg His Asp Ala Val Thr Asp Thr lie Asp 
355 360 365 

He Ala Pro Asn Gin Arg Val Gly Thr Lys Arg Tyr Met Ala Pro Glu 
370 375 380 

Val Leu Asp Glu Thr He Asn Met Lys His Phe Asp Ser Phe Lys Cys 
385 390 395 400 

Ala Asp He Tyr Ala Leu Gly Leu Val Tyr Trp Glu Zle Ala Arg Arg 
405 410 415 

Cys Asn Ser Gly Gly Val His Glu Glu Tyr Gin Leu Pro Tyr Tyr Asp 
420 425 430 

Leu Val Pro Ser Asp Pro Ser He Glu Glu Met Arg Lys Val Val Cys 
435 440 445 

Asp Gin Lys Leu Arg Pro Asn He Pro Asn Trp Trp Gin Ser Tyr Glu 
450 455 460 

Ala Leu Arg Val Met Gly Lys Met Met Arg Glu Cys Trp Tyr Ala Asn 
465 470 ^75 480 

Gly Ala Ala Arg Leu Thr Ala Leu Arg He Lys Lys Thr Leu Ser Gin 
485 490 495 

Leu Ser Val Gin Glu Asp Val Lys lie 
500 505 



(2) INFORMATION FOR SEQ ID NOs 9: 

(i) SEQUENCE CHARACTERISTICS s 

(A) LENGTH: 2308 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS : unknom 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: cDNA 

(iii) HYPOTHETICAL: NO 

(iii) ANTI-SENSE: NO 

(V) FRAGMENT TYPE: internal 

(vi) ORIGINAL SOURCE: 

(A) ORGANISM: Mouse 

(ix) FEATURE: 

(A) NAME/KEY: CDS 

(B) LOCATION: 77.. 1585 



(xi) SEQUENCE DESCRIPTION: SEQ 10 NO: 9: 
GGCGAGGCGA GGTTTGCTGG GGTGAGGCAG CGGCGCGGCC GGGCCGGGCC GGGCCACAGG 60 



SUBSTITUTE SHEET 



wo 94/11502 



PCr/GB93/02367 



56 

CCCTGCCCGC CCCACC ATC GAG CCC CCC 6TC GCT OCT CCG CCT CCC CCG 109 

Met Glu AlA Ala Val Ala Ala Pro Arg Pro Arg 
15 10 

CTG CTC CTC CTC CTG CTG COG GCC GOG GOG GOG GCG GOG GOG GOG CTG 157 
Leu Leu Leu Leu Val Leu Ala Ala Ala Ala Ala Ala Ala Ala Ala Leu 
15 20 25 

CTC CCG CGG GCG ACG GCG TOA CAG TGT TTC TCC CAC CTC TGT ACA AAA 205 
Leu Pro Gly Ala Thr Ala Leu Gin Cy» Phe Cye His Leu Cya Thr Lya 
30 35 40 

GAC AAT TTT ACT TGT GTG ACA GAT GGG CTC TGC TTT GTC TCT CTC ACA 253 
Aap Asn Phe Thr Cye Val Thr Aop Gly Leu Cyo Phe Val Ser Val Thr 
45 50 55 

CAG ACC ACA CAC AAA CTT ATA CAC AAC AGC ATC TCT ATA GCT CAA ATT 301 
Glu Thr Thr Asp Lys Val lie His Asn Ser Met Cys lie Ala Glu lie 
60 65 70 75 

GAC TTA ATT CCT CCA CAT ACC CCG TTT CTA TGT CCA CCC TCT TCA AAA 349 
Asp Leu lie Pro Arg Asp Arg Pro Phe Val Cys Ala Pro Ser Ser Lye 
80 85 90 

ACT CGG TCT CTC ACT ACA ACA TAT TGC TCC AAT CAG GAC CAT TGC AAT 397 
Thr Gly Ser Val Thr Thr Thr Tyr Cys Cys Asn Gin Asp His Cys Asn 
95 100 105 

AAA ATA CAA CTT CCA ACT ACT CTA AAC TCA TCA CCT CGC CTT CGT CCT 445 
Lys He Glu Leu Pro Thr Thr Val Lys Ser Ser Pro Gly Leu Gly Pro 
110 115 120 

GTC CAA CTC CCA CCT CTC ATT CCT CCA CCA CTG TCC TTC CTC TCC ATC 493 
Val Glu Leu Ala Ala Val He Ala Gly Pro Val Cys Phe Val Cys He 
125 130 135 

TCA CTC ATC TTC ATC CTC TAT ATC TCC CAC AAC CCC ACT CTC ATT CAC 541 
Ser Leu Met Leu Met Val Tyr He Cys His Asn Arg Thr Val He His 
140 145 150 155 

CAT CCA CTC CCA AAT CAA CAC CAC CCT TCA TTA CAT CCC CCT TTT ATT 589 
His Arg Val Pro Asn Glu Glu Asp Pro Ser Leu Asp Arg Pro Phe He 
160 165 170 

TCA CAG CGT ACT ACG TTC AAA GAC TTA ATT TAT GAT ATC ACA ACG TCA 637 
Ser Clu Gly Thr Thr Leu Lys Asp Leu He Tyr Asp Met Thr Thr Ser 
175 180 185 

CGT TCT CCC TCA CGT TTA CCA TTC CTT CTT CAC ACA ACA ATT CCC ACA 685 
Gly Ser Gly Ser Cly Leu Pro Leu Leu Val Gin Arg Thr He Ala Arg 
190 195 200 

ACT ATT CTG TTA CAA CAA ACC ATT CCC AAA CGT CCA TTT CCA CAA GTT 733 
Thr He Val Leu Gin Glu Ser He Gly Lys Gly Arg Phe Gly Glu Val 
205 210 215 

TGC ACA CCA AAC TGC CCG CCA CAA CAA CTT CCT CTT AAC ATA TTC TCC 781 
Trp Arg Gly Lys Trp Arg Gly Glu Glu Val Ala Val Lys He Phe Sar 
220 225 230 235 



SUBSTTTUTE SHEET 



WO94/11S02 



PGT/GB93/02367 



57 

TCT AGA CAA GAA CGT TCG TGG TTC CGT CAG GCA GAG ATT TAT CAA ACT 829 
Ser Arc Glu Glu Arg Sor Trp Fho Arg Clu Ala Glu I la Tyr Gin Thr 
240 245 250 

GTA ATG TTA CGT CAT GAA AAC ATC CTG GGA TTT ATA GCA GCA GAC AAT 877 
Val Met Leu Arg Hia Glu Asn lie Leu Gly Phe lie Ala Ala Asp Asn 
255 260 265 

AAA GAC AAT GGT ACT TCG ACT CAG CTC TGG TTC CTG TCA GAT TAT CAT 925 
Lye Asp Asn Gly Thr Trp Thr Gin Leu Trp Leu Val Ser Asp Tyr His 
270 275 280 

GAC CAT GGA TCC CTT TTT GAT TAC TTA AAC AGA TAC ACA GTT ACT GT6 973 
Glu His Gly ser Leu Phe Asp Tyr Leu Asn Arg Tyr Thr Val Thr Val 
285 290 295 

GAA GGA ATG ATA AAA CTT GCT CTG TCC ACG GCG AGC GGT CTT GCC CAT 1021 
Glu Gly Met lie Lys Leu Ala Leu Ser Thr Ala Ser Gly Leu Ala His 
300 305 310 315 

CTT CAC ATG GAG ATT GTT GGT ACC CAA GGA AAG CCA GCC ATT GCT CAT 1069 
Leu His Met Glu He Val Gly Thr Gin Gly Lys Pro Ala He Ala His 
320 325 330 

AGA GAT TTC AAA TCA AAG AAT ATC TTG GTA AAG AAG AAT GGA ACT TCC 1117 
Arg Asp Lieu Lys Ser Lys Asn He Leu Val Lys Lys Asn Gly Thr Cys 
335 340 345 

TGT ATT GCA GAC TTA GGA CTG GCA GTA ACA CAT GAT TCA GCC ACA GAT 1165 
Cvs He Ala Asp Leu Gly Leu Ala Val Arg His Asp Ser Ala Thr Asp 
350 355 360 

ACC ATT GAT ATT GCT CCA AAC CAC AGA CTG GGA ACA AAA AGG TAC ATG 1213 
Thr He Asp He Ala Pro Asn His Arg Val Gly Thr Lys Arg Tyr Met 
365 370 375 

GCC CCT GAA CTT CTC GAT GAT TCC ATA AAT ATG AAA CAT TTT GAA TCC 1261 
Ala Pro Glu Val Leu Asp Asp Ser He Asn Met Lys His Phe Glu Ser 
380 385 390 395 

TTC AAA CGT GCT GAC ATC TAT GCA ATG GGC TTA GTA TTC TGG GAA ATT 1309 
Phe Lys Arg Ala Asp He Tyr Ala Met Gly Leu Val Phe Trp Glu He 
400 405 410 

CCT CGA CCA TGT TCC ATT GGT GGA ATT CAT CAA GAT TAC CAA CTG CCT 1357 
Ala Arg Arg Cys Ser He Gly Gly He His Glu Asp Tyr Gin Leu Pro 
415 420 425 

TAT TAT GAT CTT GTA CCT TCT GAC CCA TCA GTT GAA GAA ATG ACA AAA 1405 
Tyr Tyr Asp Leu Val Pro Ser Asp Pro Ser Val Glu Glu Met Arg Lys 
430 435 440 

GTT GTT TGT GAA CAG AAG TTA AGG CCA AAT ATC CCA AAC AGA TGG CAG 1453 
Val Val Cys Glu Gin Lys Leu Arg Pro Asn He Pro Asn Arg Trp Gin 
445 450 455 

AGC TGT GAA GCC TTG AGA GTA ATG GCT AAA ATT ATG AGA GAA TGT TGG 1501 
Ser Cvs Glu Ala Leu Arg Val Met Ala Lys He Met Arg Glu Cys Trp 
460 " 465 470 475 



SUBSTITUTE SHEET 



wo 94/11502 PCr/GB93/02367 

58 

TAT GCC AAT CGA GCA OCT AGO CTT ACA OCA TTG CGC ATT AAO AAA ACA 1549 
Tvr Ala Asn cly Ala Ala Arg Leu Thr Ala Lou Arg Ilo Lye Lyo Thr 
480 485 490 



TTA TCG CAA CTC AGT CAA CAG CAA CGC ATC AAA ATC TAATTCTACA 1595 
Leu Ser Gin Leu Ser Gin Gin Glu Gly He Lye Het 
495 500 



GCTTTGCCTC 


AACTCTCCTT 


TTTTCTTCAG 


ATCTGCTCCT 


GGGTTTTAAT 


TTGGGAGGTC 


1655 


AGTTGTTCTA 


CCTCACTGAG 


AGGGAACAGA 


AGGATATTGC 


TTCCTTTTGC 


AGCAGTGTAA 


1715 


TAAAGTCAAT 


TAAAAACTTC 


CCAGCATTTC 


TTTCGACCCA 


GGAAACAGCC 


ATGTGGGTCC 


1775 


TTTCTGTGCA 


CTATCAACGC 




GGACAGAAAA 


TGTGTACTCT 


ACCTTTATTT 


1835 


TTTATTAACA 


AAACTTGTTT 


TTTAAAAAGA 


TGATTGCTGG 


TCTTAACTTT 


AGGTAACTCT 


1895 


GCTGTGCTGG 


AGATCATCTT 


TAAGGGCAAA 


GGAGTTGGAT 


TGCTGAATTA 


CAATGAAACA 


1955 


TGTCTTATTA 


CTAAAGAAAG 


TGATTTACTC 


CTGGTTAGTA 


CATTCTCAGA 


GGATTCTGAA 


2015 


CCACTAGAGT 


TTCCTTGATT 


CAGACTTTGA 


ATGTACTGTT 


CTATAGTTTT 


TCAGGATCTT 


2075 


AAAACTAACA 


CTTATAAAAC 


TCTTATCTTG 


AGTCTAAAAA 


TGACCTCATA 


TAGTAGTGAG 


2135 


GAACATAATT 


CATGCAATTG 


TATTTTGTAT 


ACTATTATTG 


TTCTTTCACT 


TATTCAGAAC 


2195 


ATTACATCCC 


TTCAAAATGG 


GATTCTACTA 


TACCACTAAG 


TGCCACTTCT 


CTGTCTTTCT 


2255 


AATGGAAATG 


AGTAGAATTG 


CTGAAAGTCT 


CTATGTTAAA 


ACCTATAGTC 


TTT 


2308 



(2) INFOHMATION FOR SEQ ID NO: 10: 

(i) SEQUENCE CHAKACTERXSTICS: 

(A) LENGTH: 503 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10: 

Het, Glu Ala Ala Val Ala Ala Pro Arg Pro Arg Leu Leu Leu Leu Val 
15 10 15 

Leu Ala Ala Ala Ala Ala Ala Ala Ala Ala Leu Leu Pro Gly Ala Thr 
20 25 30 

Ala Leu Gin Cye Phe Cye His Leu Cye Thr Lys Asp Asn Phe Thr Cys 
35 40 45 

Val Thr Asp Gly Leu Cys Phe Val Ser Val Thr Glu Thr Thr Asp Lys 
50 55 60 

Val He His Asn Ser Met Cys He Ala Glu He Asp Leu He Pro Arg 
65 70 75 80 



SUBSTTTUTE SHEET 



wo 94/11502 



PCT/GB93/02367 



59 

Aap Arq Pro Phe Val Cys Ala Pro Ser Ser Ly» Thr Cly Ser Val Thr 
85 90 95 

Thr Thr Tyr Cyo Cyo Aen Gin Aop Hia Cya Aan Lya lie Clu Leu Pro 
100 105 110 

Thr Thr Val Lya Ser Ser Pro 61y Leu Gly Pro Val Glu Leu Ala Ala 
115 120 125 

Val He Ala Gly Pro Val Cya Phe Val Cya He Ser Leu Met Leu Met 
130 135 140 

Val Tyr He Cya Hia Aan Arg Thr Val He Hia Hia Arg Val Pro Aan 
145 150 155 160 

Glu Glu Aap Pro Ser Leu Aap Arg Pro Phe He Ser Glu Gly Thr Thr 
165 170 175 

Leu Lya Aap Leu He Tyr Aap Met Thr Thr Ser Gly Ser Gly Ser Gly 
180 185 190 

Leu Pro Leu Leu Val Gin Arg Thr He Ala Arg Thr He Val Leu Gin 
195 200 205 

Glu Ser He Gly Lya Gly Arg Phe Gly Glu Val Trp Arg Cly Lya Trp 
210 215 220 

Arg Gly Glu Glu Val Ala Val Lya He Phe Ser Ser Arg Glu Glu Arg 
225 230 235 240 

Ser Trp Phe Arg Glu Ala Glu He T^'r Gin Thr Val Met Leu Arg Hia 
245 250 255 

Glu Aan He Leu Gly Phe He Ala Ala Aap Aan Lya Aap Aan Gly Thr 
260 265 270 

Trp Thr Gin Leu Trp Leu Val Ser Aap Tyr Hia Glu Bia Gly Ser Leu 
275 280 285 

Phe Aap Tyr Leu Aan Arg Tyr Thr Val Thr Val Glu Gly Met He Lya 
290 295 300 

Leu Ala Leu Ser Thr Ala Ser Gly Leu Ala Hia Leu Bia Met Glu He 
305 310 315 320 

Val Gly Thr Gin Gly Lya Pro Ala He Ala Hia Arg Aap Leu Lya Ser 
325 330 335 

Lya Aan He Leu Val Lya Lya Aan Gly Thr Cya Cya He Ala Aap Leu 
340 345 350 

Gly Leu Ala Val Arg Hia Aap Ser Ala Thr Aap Thr He Aap He Ala 
355 360 365 

Pro Aan Hia Arg Val Gly Thr Lya Arg Tyr Met Ala Pro Glu Val Leu 
370 375 380 

Aap Aap Ser He Aan Met Lya Hia Phe Glu Ser Phe Lya Arg Ala Aap 
385 390 395 400 



SUBSTITUTE SHEFT 



wo 94/11502 PCr/GB93/02367 

60 

He Tyr Ala Met Gly Leu Val Phe Trp Glu He Ala Arg Arg Cya Ser 
405 410 415 

He Glv Glv He His Glu Aop Tyr Gin Leu Pro Tyr Tyr Aep Leu Val 
^420 425 430 

Pro ser Asp Pro Ser Val Glu Glu Met Arg Lys Val Val Cys Glu Gin 
435 440 445 

Lvs Leu Arg Pro Aen He Pro Aen Arg Trp Gin Sor Cye Glu Ala Leu 
450 455 460 

Arg Val Met Ala Lys He Met Arg Glu Cye Trp Tyr Ala Aen Gly Ala 
465 470 475 480 

Ala Arq Leu Thr Ala Leu Arg He Lys Lye Thr Leu Ser Gin Leu Ser 
485 490 495 

Gin Gin Glu Gly Ho Lys Met 
500 

(2) INFORMATIOM FOR SEQ ID NO: 11: 

(i) SEQUENCE CHARACTERISTICS: 

<A) LENGTH: 1922 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: unknown 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: cDNA 

(iii) HYPOTHETICAL: NO 

(iii) ANTI-SENSE: NO 

(V) FRAGMENT TYPE: internal 

(vi) ORIGINAL SOURCE: 

(A) ORGANISM: Mouse 

(ix) FEATURE: 

(A) NAME/KEY: CDS 

(B) LOCATION: 241* .1746 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11: 

GAGAGCACAG CCCTTCCCAG TCCCCCGACC CGCCGCGCCA CGCCCGCATG ATCAAGACCT 60 

TTTCCCCGGC CCCACAGCCC CTCTGGACGT GAGACCX^CGG CCGCCTCCGC AAGGAGAGGC 120 

GGGGGTCGAG TCGCCCTGTC CAAAGGCCTC AATCTAAACA ATCTTGATTC CTGTTCCCGG 180 

CTGGCGGGAC CCTGAATGGC AGGAAATCTC ACCACATCTC TTCTCCTATC TCCAAGGACC 240 

ATG ACC TTG GGG AGC TTC ACA AGG GGC CTT TTC ATG CTG TCG CTG GCC 288 
Met Thr Leu Gly Ser Phe Arg Arg Gly Leu Leu Mot Leu Ser Val Ala 
1 5 10 15 



SUBSnTUT£ SHEET 



wo 94/1 1502 



PCr/GB93/02367 



61 

TTG CGC CTA ACC CAC GGG AGA CTT CCX; AAG CCT TCC AAG CTG CTG AAC 336 
Leu Gly Leu Thr Gin Gly Arg Leu Ala Lys Pro Ser Lye Leu Val Aan 
20 25 30 

TGC ACT TGT GAG AGC CCA CAC TCC AAG AGA CCA TTC TGC CAG GGG TCA 384 
Cv8 Thr Cy» Glu Ser Pro HLm Cys Lys Arg Pro Phe Cye Gin Gly Ser 
35 40 45 

TGG TGC ACA GTG GTG CTG GTT CGA GAG CAG GGC AGG CAC CCC CAG GTC 432 
Trp Cys Thr Val Val Leu Val Arg Glu Gin Gly Arg His Pro Glii Val 
50 55 60 

TAT CGG GGC TGT GGG AGC CTG AAC CAG GAG CTC TGC TTG GGA CGT CCC 480 
Tyr Arg Gly Cys Gly Ser Leu Asn Gin Glu Leu Cys Leu Gly Arg Pro 
65 70 75 80 

ACG GAG TTT CTG AAC CAT CAC TCC TGC TAT AGA TCC TTC TGC AAC CAC 528 
Thr Glu Phe Leu Asn His Hio Cys Cys Tyr Arg Ser Phe Cys Asn His 
85 90 95 

AAC GTG TCT CTG ATG CTG GAG GCC ACC CAA ACT CCT TOG GAG GAG CCA 576 
Asn Val Ser Leu Met Leu Glu Ala Thr Gin Thr Pro Ser Glu Glu Pro 
100 105 110 

GAA GTT GAT GCC CAT CTG CCT CTG ATC CTG GGT CCT GTG CTG GCC TTG 624 
Glu Val Asp Ala His Leu Pro Leu lie Leu Gly Pro Val Leu Ala Leu 
115 120 125 

CCG GTC CTG GTG GCC CTC GGT GCT CTG GGC TTG TGG CGT CTC CGC CGG 672 
Pro Val Leu Val Ala Leu Gly Ala Leu Gly Leu Trp Arg Val Arg Arg 
130 135 140 

AGG CAG GAG AAG CAG CGG GAT TTG CAC AGT GAC CTG GGC GAG TCC AGT 720 
Arg Gin Glu Lys Gin Arg Asp Leu His Ser Asp Leu Gly Glu Ser Ser 
145 150 155 160 

CTC ATC CTG AAG GCA TCT CAA CAG GCA GAC AGC ATG TTC GGC GAC TTC 768 
Leu lie Leu Lys Ala Ser Glu Gin Ala Asp Ser Met Leu Gly Asp Phe 
165 170 175 

CTG GAC AGC GAC TGT ACC ACG GGC AGC GGC TCG GGG CTC CCC TTC TTG 816 
Leu Asp Ser Asp Cys Thr Thr Gly Ser Gly Ser Gly Leu Pro Phe Leu 
180 185 190 

GTG CAG ACG ACG GTA GCT CGG CAG GTT GCG CTG GTA GAG TGT GTG GGA 864 
Val Gin Arg Thr Val Ala Arg Gin Val Ala Leu Val Glu Cys Val Gly 
195 200 205 

AAG GGC CGA TAT GGC GAG GTG TGC CGC GGT TCC TGG CAT GGC GAA AGC 912 
Lys Gly Arg Tyr Gly Glu Val Trp Arg Gly Ser Trp His Gly Glu Ser 
210 215 220 

GTG GCG GTC AAG ATT TTC TCC TCA CGA CAT CAG CAG TCC TGC TTC CGG 960 
Val Ala Val Lys lie Phe Ser Ser Arg Asp Glu Gin Ser Trp Phe Arg 
225 230 235 240 

GAG ACG GAG ATC TAC AAC ACA GTT CTG CTT AGA CAC GAC AAC ATC CTA 1008 
Glu Thr Glu lie Tyr Asn Thr Val Leu Leu Arg His Asp Asn He Leu 
245 250 255 



SUBSTITUTE SHEET 



wo 94/1 1S02 PCr/GB93/02367 

GGC TTC ATC GCC TCC CAC ATC ACT TCXS CGC AAC TCC AGC ACC CAC CTG 1056 
Glv Phe lie Ala Ser Asp Met Thr Ser Arg Aan Ser Ser Thr Gin Leu 
^ 260 265 270 

TGG CTC ATC ACC CAC TAC CAT GAA CAC CGC TCC CTC TAT GAC TTT CTG 1104 
Tro Leu He Thr His Tyr Hie Glu His Gly Ser Leu Tyr Aep Phe Leu 
275 280 285 

CAG AGG CAG ACG CTG GAG CCC CAG TTO GCC CTG AGG CTA GCT GTC TCC 1152 
Gin Arg Gin Thr Leu Glu Pro Gin Leu Ala Leu Arg Leu Ala Val Ser 
290 295 300 

CCC GCC TGC GGC CTG GCG CAC CTA CAT GTG GAC ATC TTT GCC ACT CAA 1200 
Pro Ala Cys Gly Leu Ala Bis Leu His Val Glu He Phe Gly Thr Gin 
305 310 315 320 

GGC AAA CCA GCC ATT GCC CAT CGT GAC CTC AAG AGT CGC AAT CTC CTC 1248 
Glv Lys Pro Ala He Ala His Arg Asp Leu Lys Ser Arg Asn Val Leu 
325 330 335 

GTC AAG AGT AAC TTC CAG TGT TGC ATT GCA GAC CTG GGA CTG GCT GTG 1296 
Val Lys Ser Asn Leu Gin Cys Cys He Ala Asp Leu Gly Leu Ala Val 
340 345 350 

ATG CAC TCA CAA AGC AAC CAG TAC CTG CAT ATC GGC AAC ACA CCC CCA 1344 
Met His Ser Gin Ser Aan Glu Tyr Leu Asp He Gly Asn Thr Pro Arg 
355 360 365 

GTG GGT ACC AAA ACA TAC ATC GCA CCC CAG GTC CTC CAT GAG CAC ATC 1392 
Val Gly Thr Lys Arg Tyr Met Ala Pro Glu Val Leu Asp Glu His He 
370 375 380 

CGC ACA GAC TGC TTT CAC TCC TAC AAG TGG ACA GAC ATC TGG GCC TTT 1440 
Arg Thr Asp Cys Phe Glu Ser Tyr Lys Trp Thr Asp He Trp Ala Phe 
385 390 395 400 

GGC CTA GTG CTA TGG GAG ATC CCC CGG OGG ACC ATC ATC AAT GGC ATT 1488 
Gly Leu Val Leu Trp Glu He Ala Arg Arg Thr Ho He Asn Gly He 
405 410 415 

GTG GAG CAT TAC AGG CCA CCT TTC TAT CAC ATC GTA CCC AAT GAC CCC 1536 
Val Glu Asp Tyr Arg Pro Pro Phe Tyr Asp Met Val Pro Asn Asp Pro 
420 425 430 

AGT TTT GAG GAC ATG AAA AAG CTC GTG TGC GTT GAC CAG CAG ACA CCC 1584 
Ser Phe Glu Aep Met Lys Lys Val Val Cys Val Asp Gin Gin Thr Pro 
435 440 445 

ACC ATC CCT AAC CCC CTG CCT CCA CAT CCC GTC CTC TCC CGG CTG GCC 1632 
Thr He Pro Asn Arg Leu Ala Ala Asp Pro Val Leu Ser Gly Leu Ala 
450 455 460 

CAG ATG ATG ACA GAG TGC TGG TAC CCC AAC CCC TCT GCT CCC CTC ACC 1680 
Gin Met Met Arg Glu Cys Trp Tyr Pro Asn Pro Ser Ala Arg Leu Thr 
465 470 475 480 

GCA CTG CGC ATA AAG AAG ACA TTC CAG AAG CTC AGT CAC AAT CCA GAG 1728 
Ala Leu Arg He Lys Lvs Thr Leu Gin Lys Leu Ser His Asn Pro Glu 
485 " 490 495 



SUBSTITUTE SHEET 



wo 94/1 1502 PCr/GB93/02367 

63 

AAG CCC AAA CTG ATT CAC TAGCCCAGGC CCACCAGGCT TCCTCTCCCT 1776 
Lys Pro Lya VaX He His 
500 

AAAGTGTCTG CTCGGCAAGA ACACATAGCC TGTCTGGGTA GAGGCAGTGA ACAGAGTGTG 1836 

CACCCTCCCC TGTGTCTGCC TGCTCAGCTT GCTCCCAGCC CATCCAGCCA AAAATACAGC 1896 

TGAGCTGAAA TTCAAAAAAA AAAAAA 1922 

(2) INFORMATION FOR SEQ ID NO: 12: 

(1) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 502 amino acids 

(B) TYPE: asino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 12: 

Met Thr Leu Gly Ser Phe Arg Arg Gly Leu' Leu Met Leu Ser Val Ala 
IS 10 15 

Leu Gly Leu Thr Gin Gly Arg Leu Ala Lys Pro Ser Lys Leu Val Asn 
20 25 30 

Cys Thr Cys Glu Ser Pro His Cys Lys Arg Pro Phe Cys Gin Gly Ser 
35 40 45 

Trp Cys Thr Val Val Leu Val Arg Glu Gin Gly Arg His Pro Gin Val 
50 55 60 

Tyr Arg Gly Cys Gly Ser Leu Asn Gin Glu Leu Cys Leu Gly Arg Pro 
65 70 75 80 

Thr Glu Phe Leu Asn His His Cys Cys Tyr Arg Ser Phe Cys Asn His 
85 90 95 

Asn Val Ser Leu Met Leu Glu Ala Thr Gin Thr Pro Ser Glu Glu Pro 
100 105 110 

Glu Val Asp Ala His Leu Pro Leu He Leu Gly Pro Val Leu Ala Leu 
115 120 125 

Pro Val Leu Val Ala Leu Gly Ala Leu Gly Leu Trp Arg Val Arg Arg 
130 135 140 

Arg Gin Glu Lys Gin Arg Asp Leu His Ser Asp Leu Gly Glu Ser Ser 
145 150 155 160 

Leu He Leu Lys Ala Ser Glu Gin Ala Asp Ser Met Leu Gly Asp Phe 
165 170 175 

Leu Asp Ser Asp Cys Thr Thr Gly Ser Gly Ser Gly Leu Pro Phe Leu 
180 185 190 



SUBSnrUTi SHEET 



wo 94/1 1502 PCT/GB93/02367 

Val Gin Arg Thr Val Ala Arg Gin Val Ala Leu Val Glu Cys Val Gly 
X95 200 205 

Lya Gly Arg Tyr Gly Glu Val Trp Arg Gly Ser Trp Hia Gly Glu Ser 
210 215 220 

Val Ala Val Lya He Phe Ser Ser Arg Aap Glu Gin Ser Trp Phe Arg 
225 230 235 240 

Glu Thr Glu He Tyr Acn Thr Val Lou Leu Arg His Aap Aan Ha Leu 
245 250 255 

Gly Phe He Ala Ser Asp Met Thr Ser Arg Asn Ser Ser Thr Gin Leu 
260 265 270 

Trp Leu He Thr His Tvr His Glu His Gly Ser Leu Tyr Asp Phe Leu 
275 ' 280 285 

Gin Arg Gin Thr Leu Glu Pro Gin Leu Ala Leu Arg Leu Ala Val Ser 
290 295 300 

Pro Ala Cys Gly Leu Ala His Leu His Val Glu He Phe Gly Thr Gin 
305 310 315 320 

Gly Lys Pro Ala He Ala His Arg Asp Leu Lys Ser Arg Asn Val Leu 
325 330 335 

Val Lys Ser Aan Leu Gin Cys Cys He Ala Asp Leu Gly Leu Ala Val 
340 345 350 

Met His Ser Gin Ser Asn Glu Tyr Leu Asp He Gly Asn Thr Pro Arg 
355 360 365 

Val Gly Thr Lys Arg Tyr Met Ala Pro Glu Val Leu Asp Glu His He 
370 375 380 

Arg Thr Asp Cys Phe Glu Ser Tyr Lya Trp Thr Asp He Trp Ala Phe 
385 390 395 400 

Gly Leu Val Leu Trp Glu He Ala Arg Arg Thr He He Asn Gly He 
405 410 415 

Val Glu Asp Tyr Arg Pro Pro Phe Tyr Asp Met Val Pro Asn Asp Pro 
420 425 430 

Ser Phe Glu Asp Met Lys Lys Val Val Cys Val Asp Gin Gin Thr Pro 
435 440 445 

Thr He Pro Asn Arg Leu Ala Ala Asp Pro Val Leu Ser Gly Leu Ala 
450 455 460 

Gin Met Met Arg Glu Cys Trp Tyr Pro Aan Pro Ser Ala Arg Leu Thr 
465 470 475 480 

Ala Leu Arg He Lys Lys Thr Leu Gin Lys Leu Ser His Asn Pro Glu 
485 490 495 

Lys Pro Lys Val He His 
500 



SUBSTTTUTE SHEFT 



wo 94/1 1502 



PCT/GB93/02367 



65 



(2) INFORMATION FOR SEQ ID NO: 13: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 2070 base pairs 

(B) TYPE 2 nucleic acid 

(C) STRANDEDNESS: unknown 

(D) TOPOXXXSY: linear 

(ii) MOLECUl^ TYPE: CDNA 

(iii) HYPOTHETICAL: NO 

(iii) ANTI-SENSEs NO 

(V) FRAGMENT TYPE: internal 

(vi) ORIGINAL SOURCE: 

(A) ORGANISM: Mouse 

<ix) FEATX7RE: 

(A) NAME/KEY: CDS 

(B) LOCATION: 217. •1812 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 13: 

ATTCATGAGA TGGAAGCATA GGTCAAAGCT GTTCGGAGAA ATTGGAACTA CACTTTTATC 60 

TAGCCACATC TCTGAGAATT CTGAAGAAAG CAGCACCTGA AAGTCATTGC CAAGTGATTT 120 

TGTTCTGTAA GGAAGCCTCC CTCATTCACT TACACCAGTG AGACAGCAGG ACCAGTCATT 180 

CAAAGGGCCG TGTACAGGAC GCCTGGCAAT CAGACA ATG ACT CAC CTA TAC ACT 234 

Met Thr Gin Leu Tyr Thr 
1 5 

TAC ATC ACA TTA CTG GGA GCC TGT CTG TTC ATC ATT TCT CAT GTT CAA 282 
Tyr lie Arg Leu Leu Gly Ala Cys Leu Phe lie lie Ser His Val Gin 
10 IS 20 



GGG GAG AAT CTA GAT AGT ATG CTC CAT GGC ACT CGT ATC AAA TCA GAC 330 
Gly Gin Asn Leu Asp Ser Met Leu His Gly Thr Gly Met Lys Ser Asp 
25 30 35 

TTG GAC CAG AAG AAC CCA GAA AAT GGA GTG ACT TTA CCA CCA GAG GAT 378 
Leu Asp Gin Lys Lys Pro Glu Asn Gly Val Thr Leu Ala Pro Glu Asp 
40 45 50 

ACC TTG CCT TTC TTA AAG TGC TAT TGC TCA GGA CAC TGC CCA GAT GAT 426 
Thr Leu Pro Phe Leu Lys Cys Tyr Cys Ser Gly His Cys Pro Asp Asp 
55 60 65 70 

GCT ATT AAT AAC ACA TGC ATA ACT AAT GCC CAT TGC TTT GCC ATT ATA 474 
Ala He Asn Asn Thr Cys He Thr Asn Gly His Cys Phe Ala He He 
75 80 85 

GAA GAA GAT GAT CAG GGA GAA ACC ACA TTA ACT TCT GGG TGT ATG AAG 522 
Glu Glu Asp Asp Gin Gly Glu Thr Thr Leu Thr Ser Gly Cys Met Lys 
90 95 100 



SUBSTITUTE SHE€T 



wo 94/11502 



PCT/GB93/02367 



66 

TAT GAA GGC TCT GAT TTT CAA TGC AAG GAT TCA CCC AAA GCC CAC CTA 570 
Tyr Glu Gly Ser Aep Phe GXn Cye Lys Asp Ser Pro Lya Ala Gin Leu 
105 115 

CGC AGG ACA ATA GAA TGT TGT CGG ACC AAT TTG TGC AAC CAG TAT TTG 618 
Arq Arg Thr lie Glu Cys Cys Arg Thr Asn Leu Cys Asn Gin Tyr Leu 
120 125 130 

CAG CCT ACA CTG CCC CCT GTT GTT ATA GGT CCG TTC TTT GAT GGC AGC 666 
Gin pro Thr Leu Pro Pro Val Val He Gly Pro Phe Phe Asp Gly Ser 
135 140 145 150 

ATC CGA TGC CTG GTT GTG CTC ATT TCC ATG GCT GTC TGT ATA GTT GCT 714 
He Arg Trp Leu Val Val Leu He Ser Met Ala Val Cys He Val Ala 
155 160 165 

ATG ATC ATC TTC TCC AGC TGC TTT TGC TAT AAG CAT TAT TGT AAG AGT 762 
Met He He Phe Ser Ser Cys Phe Cys Tyr Lys His Tyr Cys Lys Ser 
170 175 180 

ATC TCA AGC AGC GGT CGT TAC AAC CGT CAT TTG GAA CAG GAT GAA GCA 810 
He ser Ser Arg Gly Arg Tyr Asn Arg Asp Leu Glu Gin Asp Glu Ala 
185 190 195 

TTT ATT CCA CTA GGA GAA TCA TTG AAA CAC CTC ATT GAC CAC TCC CAA 858 
Phe He Pro Val Gly Glu Ser Leu Lys Asp Leu He Aep Gin Ser Gin 
200 205 210 

AGC TCT GGG AGT GGA TCT GGA TTG CCT TTA TTG GTT CAG CGA ACT ATT 906 
Ser Ser Gly Ser Gly Ser Gly Leu Pro Leu Leu Val Gin Arg Thr He 
215 220 225 230 

GCC AAA CAG ATT CAG ATG GTT CGC CAG GTT GGT AAA GGC CCC TAT GGA 954 
Ala Lys Gin He Gin Met Val Arg Cln Val Gly Lys Gly Arg Tyr Gly 
235 240 245 

GAA GTA TGG ATG CGT AAA TGC CGT GGT CAA AAA GTG GCT GTC AAA GTG 1002 
Glu Val Trp Met Gly Lys Trp Arg Gly Glu Lys Val Ala Val Lys Val 
250 255 260 

TTT TTT ACC ACT GAA GAA GCT AGC TGG TTT AGA GAA ACA GAA ATC TAC 1050 
Phe Phe Thr Thr Glu Glu Ala Ser Trp Phe Arg Glu Thr Glu He Tyr 
265 270 275 

CAG ACC GTG TTA ATG CGT CAT GAA AAT ATA CTT GCT TTT ATA GCT GCA 1098 
Gin Thr Val Leu Met Arg His Glu Asn He Leu Gly Phe He Ala Ala 
280 285 290 

GAC ATT AAA GGC ACT CGT TCC TGG ACT CAG CTG TAT TTG ATT ACT GAT 1146 
Asp He Lys Gly Thr Gly Ser Trp Thr Cln Leu Tyr Leu He Thr Asp 
295 300 305 310 

TAC CAT GAA AAT GGA TCT CTC TAT CAC TTC CTG AAA TGT GCC ACA CTA 1194 
Tvr His Glu Asn Gly Ser Leu Tyr Asp Phe Leu Lys Cys Ala Thr Leu 
^ 315 320 325 

GAC ACC AGA GCC CTA CTC AAG TTA CCT TAT TCT CCT GCT TGT GGT CTC 1242 
Asp Thr Arg Ala Leu Leu Lys Leu Ala Tyr Ser Ala Ala Cys Gly Leu 
330 335 340 



SUBSnrUTE SHEET 



wo 94/1 1502 



PCr/GB93/02367 



67 

TGC CAC CTC CAC ACA CAA ATT TAT OCT ACC CAA CGG AA6 CCT CCA ATT 1290 
Cyo His Leu Hie Thr Clu lie Tyr Cly Thr Cln Gly hyu Pro Ala Ilo 
345 350 355 

OCT CAT CGA GAC CTC AAG AGC AAA AAC ATC CTT ATT AAG AAA AAT GGA 1338 
Ala Hi8 Arg Aep Leu Lys Ser Lys Asn lie Leu He Lys Lye Aen Gly 
360 365 370 

ACT TGC TCT ATT GCT CAC CTC CCC CTA CCT CTT AAA TTC AAC ACT CAT 1386 
Ser Cye Cye lie Ala Aep Leu Gly Leu Ala Val Lye Phe Aen Ser Aep 
375 380 385 390 

ACA AAT CAA CTT GAC ATA CCC TTC AAT ACC AGC CTC CCC ACC AAC CGG 1434 
Thr Aen Glu Val Aep lie Pro Leu Aen Thr Arg Val Gly Thr Lye Arg 
395 400 405 

TAC ATC GCT CCA GAA CTC CTC GAT GAA AGC CTC AAT AAA AAC CAT TTC 1482 
Tyr Met Ala Pro Glu Val Leu Asp Glu Ser Leu Aen Lye Aen Hie Phe 
410 415 420 

CAG CCC TAC ATC ATG GCT CAC ATC TAT ACC TTT CCT TTC ATC ATT TGC 1530 
Gin Pro Tyr He Met Ala Asp He Tyr Ser Phe Cly Leu He He Trp 
425 430 435 

GAA ATG GCT CCT CCT TCT ATT ACA GGA CGA ATC CTC GAG GAA TAT CAA 1578 
Glu Met Ala Arg Arg Cye He Thr Gly Gly He Val Glu Glu Tyr Gin 
440 445 450 

TTA CCA TAT TAC AAC ATG CTC CCC ACT GAC CCA TCC TAT GAC GAC ATG 1626 
Leu Pro Tyr Tyr Asn Met Val Pro Ser Aep Pro Ser Tyr Glu Asp Met 
455 460 465 470 

CCT GAG CTT CTC TGT CTC AAA CCC TTC CGG CCA ATC CTC TCT AAC CCC 1674 
Arg Glu Val Val Cye Val Lye Arg Leu Arg Pro He Val Ser Aen Arg 
475 480 485 

TGC AAC AGC GAT CAA TGT CTT CGA CCA CTT TTC AAC CTA ATG TCA GAA 1722 
Trp Asn Ser Aep Glu Cye Leu Arg Ala Val Leu Lye Leu Met Ser Glu 
490 495 500 

TGT TGC CCC CAT AAT CCA CCC TCC ACA CTC ACA GCT TTC ACA ATC AAC 1770 
Cye Trp Ala Hie Asn Pro Ala Ser Arg Leu Thr Ala Leu Arg He Lye 
505 510 515 

AAG ACA CTT CCA AAA ATG GTT GAA TCC CAG GAT CTA AAC ATT 1812 
Lye Thr Leu Ala Lye Met Val Glu Ser Gin Aep Val Lye He 
520 525 530 



TGACAATTAA 


ACAATTTTGA 


GGGAGAATTT 


AGACTCCAAC 


AACTTCTTCA 


CCCAACGAAT 


1872 


GGCTCCGATT 


AGCATGGAAT 


AGGATGTTGA 


CTTGGTTTCC 


AGACTCCTTC 


CTCTACATCT 


1932 


TCACAGGCTG 


CTAACAGTAA 


ACCTTACCGT 


ACTCTACAGA 


ATACAAGATT 


GCAACTTCCA 


1992 


ACTTCAAACA 


TGTCATTCTT 


TATATATCAC 


AGCTTTCTTT 


TAATCTCCGC 


TTTTTTTGTT 


2052 


TGCTTTTTTT 


GTTTTGTT 










2070 



SUBSTITUTE SHEET 



wo 94/11502 PCT/GB93/02367 

68 

(2) INFORMATION FOR SEQ ID NO: 14: 

(i) SEQUBNCB CHARACTERISTICS: 

(A) LENGTH: 532 vnino acidfl 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 14: 

Met Thr Gin Leu Tyr Thr Tyr He Arg Leu Leu Cly Ala Cya Leu Phe 
1 5 10 15 

He He Ser His Val Gin Gly Gin Asn Leu Aap Ser Met Leu Hie Gly 
20 25 30 

Thr Gly Met Lys Ser Asp Leu Asp Gin Lys Lys Pro Clu Asn Gly Val 
35 40 45 

Thr Leu Ala Pro Glu Aep Thr Leu Pro Phe Leu Lys Cys Tyr Cys Ser 
50 55 60 

Gly His Cys Pro Asp Asp Ala He Asn Asn Thr Cys He Thr Asn Gly 
65 70 75 80 

His Cys Phe Ala He He Glu Glu Asp Asp Gin Gly Glu Thr Thr Leu 
85 90 95 

Thr Ser Gly Cys Met Lys Tyr Glu Gly Ser Asp Phe Gin Cys Lys Asp 
100 105 110 

Ser Pro Lys Ala Gin Leu Arg Arg Thr He Glu Cys Cys Arg Thr Asn 
115 120 125 

Leu Cye Asn Gin Tyr Leu Gin Pro Thr Leu Pro Pro Val Val He Gly 
130 135 140 

Pro Phe Phe Asp Gly Ser He Arg Trp Leu Val Val Leu He Ser Met 
145 150 155 160 

Ala Val Cys He Val Ala Met He He Phe Ser Ser Cys Phe Cys Tyr 
165 170 175 

Lys His Tyr Cys Lys Ser He Ser Ser Arg Gly Arg Tyr Asn Arg Aap 
180 185 190 

Leu Glu Gin Asp Glu Ala Phe He Pro Val Gly Glu Ser Leu Lys Aap 
195 200 205 

Leu He Asp Gin Ser Gin Ser Ser Gly Ser Gly Ser Gly Leu Pro heu 
210 215 220 

Leu Val Gin Arg Thr He Ala Lys Gin He Gin Met Val Arg Gin Val 
225 230 235 240 

Gly Lys Gly Arg Tyr Gly Glu Val Trp Met Gly Lys Trp Arg Gly Glu 
245 250 255 



SUBSTITUTE SHEET. 



wo 94/11502 



PCT/GB93/02367 



69 

Lys Val Ala Val Lys Val Pho Phe Thr Thr Clu GIu Ala Ser Trp Phe 
260 265 270 

Arg Clu Thr Glu He Tyr Gin Thr Val Leu Met Arg Hie Glu Asn He 
275 280 285 

Leu Cly Phe He Ala Ala Aep He Lys Gly Thr Gly Ser Trp Thr Gin 
290 295 300 

Leu Tyr Leu He Thr Asp Tyr His Glu Asn Gly Ser Leu Tyr Asp Phe 
305 310 315 320 

Leu Lys Cys Ala Thr Leu Asp Thr Arg Ala Leu Leu Lys Leu Ala Tyr 
325 330 335 

ser Ala Ala Cya Gly Leu Cys His Leu Bis Thr Glu Ha Tyr Gly Thr 
340 345 350 

Gin Gly Lys Pro Ala He Ala Hia Arg Asp Leu Lys Ser Lys Asn He 
355 360 365 

Leu He Lys Lys Asn Gly Ser Cys Cys He Ala Asp Leu Gly Leu Ala 
370 375 380 

Val Lys Phe Asn Ser Asp Thr Asn Glu Val Asp He Pro Leu Asn Thr 
385 390 395 400 

Arg Val Gly Thr Lys Arg Tyr Met Ala Pro Glu Val Leu Asp Glu Ser 
405 410 415 

Leu Asn Lys Asn His Phe Gin Pro Tyr He Met Ala Asp He Tyr Ser 
420 425 430 

Phe Gly Leu He He Trp Glu Met Ala Arg Arg Cys He Thr Gly Gly 
435 440 445 

He Val Glu Glu Tyr Gin Leu Pro Tyr Tyr Asn Met Val Pro Ser Asp 
450 455 460 

Pro Ser Tyr Glu Asp Met Arg Glu Val Val Cys Val Lys Arg Leu Arg 
465 470 475 480 

Pro He Val Ser Asn Arg Trp Asn Ser Asp Glu Cys Leu Arg Ala Val 
485 490 495 

Leu Lye Leu Met Ser Glu Cys Trp Ala His Asn Pro Ala Ser Arg Leu 
500 505 510 

Thr Ala Leu Arg He Lys Lys Thr Leu Ala Lys Met Val Glu Ser Gin 
515 520 525 

Asp Val Lys He 
530 

(2) INPORMATION FOR SEQ ID NO: 15: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 2160 base pairs 



SUBSTITUTE SHiET 



wo 94/11502 



PCr/GB93/02367 



70 

(B) TYPES nucleic acid 
jc) STRANDEDNESS: unXnown 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: cDNA 

(iii) HYPOTHETICAL: NO 

(iii) ANTI-SENSE: NO 

(V) FRAGMENT TYPE: internal 

(vi) ORIGINAL SOURCE: 

(A) ORGANISM: Mouse 

(ix) FEATURE: 

(A) NAME/KEY: CDS 

(B) LOCATION: 10. .1524 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: IS: 

CGCGGTTAC ATG GCC GAG TCC GCC GGA GCC TCC TCC TTC TTC CCC CTT 48 
Met Ala Glu Ser Ala Gly Ala Ser Ser Phe Phe Pro X«eu 
1 5 10 

CTT GTC CTC CTG CTC GCC GGC AGC GGC GGG TCC GGG CCC CGG GGG ATC 96 
Val Val Leu Leu Leu Ala Gly Ser Gly Gly Ser Gly Pro Arg Gly lie 
15 20 25 

CAG OCT CTG CTG TGT GCG TGC ACC AGC TCC CTA CAC ACC AAC TAC ACC 144 
Gin Ala Leu Leu Cya Ala Cys Thr Ser Cya Leu Gin Thr Asn Tyr Thr 
30 35 40 45 

TGT GAG ACA GAT GGG GCT TGC ATG GTC TCC ATC TTT AAC CTG GAT GGC 192 
Cys Glu Thr Asp Gly Ala Cys Met Val Ser lie Phe Asn Leu Asp Gly 
50 55 60 

GTG GAG CAC CAT GTA CGT ACC TGC ATC CCC AAG CTG GAG CTG GTT CCT 240 
Val Glu His His Val Arg Thr Cys lie Pro Lys Val Glu Leu Val Pro 
65 70 75 

GCT GGA AAG CCC TTC TAC TGC CTG AGT TCA GAG GAT CTG CGC AAC ACA 288 
Ala Gly Lys Pro Phe Tyr Cys Leu Ser Ser Glu Asp Leu Arg Asn Thr 
80 85 90 

CAC TGC TGC TAT ATT GAC TTC TGC AAC AAG ATT GAC CTC AGG GTC CCC 336 
His Cya Cys Tyr He Asp Phe Cys Asn Lys He Asp Leu Arg Val Pro 
95 100 105 

AGC GGA CAC CTC AAG GAG CCT GCG CAC CCC TCC ATG TGG GGC CCT GTG 384 
Ser Gly His Leu Lys Glu Pro Ala His Pro Ser Met Trp Gly Pro Val 
110 lis 120 125 

GAG CTC CTC GGC ATC ATC GCC CGC CCC GTC TTC CTC CTC TTC CTT ATC 432 
Glu Leu Val Gly He He Ala Gly Pro Val Phe Leu Leu Phe Leu He 
130 135 140 



SUBSTTTUTE SHEET 



wo 94/1 1502 



PCr/GB93/02367 



71 

ATT ATC ATC CTC TTC CTG GTC ATC AAC TAT CAC CAC CCT CTC TAC CAT 460 
He He He Val Phe Leu Val He Aon Tyr His Gin Arg Val Tyr His 
145 150 155 

AAC CGC CAG AGG TTG GAG ATG GAG GAC CCC TCT TGC GAG ATG TGT CTC 528 
Aan Arg Gin Arg Leu Asp Met Glu Asp Pro Ser Cys Glu Met Cys Leu 
160 165 170 

TGC AAA GAC AAG ACG CTC CAG GAT CTC GTC TAC GAC CTC TCC AOC TCA 576 
Ser Lys Asp Lys Thr Leu Gin Asp Leu Val Tyr Asp Leu Ser Thr Ser 
175 180 185 

GGG TCT GGC TCA CGG TTA CCC CTT TTT CTC CAG CGC ACA GTG GCC CGA 624 
Gly Ser Gly Ser Gly Leu Pro Leu Phe Val Gin Arg Thr Val Ala Arg 
190 195 200 205 

ACC ATT GTT TTA CAA GAG ATT ATC GGC AAG GGC CGG TTC GGG GAA GTA 672 
Thr He Val Leu Gin Glu He He Gly Lya Gly Arg Phe Gly Glu Val 
210 215 220 

TGG CGT GGT CGC TGG AGG GGT GGT GAC GTG GCT GTG AAA ATC TTC TCT 720 
Trp Arg Gly Arg Trp Arg Gly Gly Asp Val Ala Val Lys He Phe Ser 
225 230 235 

TCT CGT GAA GAA CGG TCT TGG TTC CGT GAA GCA GAG ATC TAC CAG ACC 768 
Ser Arg Glu Glu Arg Ser Trp Phe Arg Glu Ala Glu He Tyr Gin Thr 
240 245 250 

GTC ATC CTG CCC CAT GAA AAC ATC CTT GGC TTT ATT CCT CCT GAC AAT 816 
Val Met Leu Arg His Glu Asn He Leu Gly Phe He Ala Ala Asp Asn 
255 260 265 

AAA GAT AAT GGC ACC TGG ACC CAG CTG TGG CTT GTC TCT GAC TAT CAC 664 
Lys Asp Asn Gly Thr Trp Thr Gin Leu Trp Leu Val Ser Asp Tyr His 
270 275 280 285 

GAG CAT GGC TCA CTG TTT CAT TAT CTG AAC CGC TAC ACA GTG ACC ATT 912 
Glu His Gly Ser Leu Phe Asp Tyr Leu Asn Arg Tyr Thr Val Thr He 
290 295 300 

GAC GCA ATG ATT AAG CTA GCC TTG TCT GCA GCC ACT GGT TTG GCA CAC 960 
Glu Gly Met He Lys Leu Ala Leu Ser Ala Ala Ser Gly Leu Ala His 
305 310 315 

CTG CAT ATG GAG ATT GTG GGC ACT CAA GCC AAG CCC GCA ATT GCT CAT 1008 
Leu His Met Glu He Val Gly Thr Gin Gly Lye Pro Gly He Ala His 
320 325 330 

CGA GAC TTG AAG TCA AAG AAC ATC CTG GTG AAA AAA AAT GGC ATG TGT 1056 
Arg Asp Leu Lys Ser Lys Asn He I^eu Val Lys Lys Asn Gly Met Cys 
335 340 345 

GCC ATT CCA CAC CTG CGC CTG GCT GTC CGT CAT GAT GOG CTC ACT GAC 1104 
Ala He Ala Asp Leu Gly Leu Ala Val Arg His Asp Ala Val Thr Asp 
350 355 360 365 

ACC ATA GAC ATT GCT CCA AAT CAG AGG GTC CGG ACC AAA CGA TAC ATG 1152 
Thr He Asp He Ala Pro Asn Gin Arg Val Gly Thr Lys Arg Tyr Met 
370 375 380 



SUBSTITUTE SHEET 



WO94/11S02 



PCT/GB93/02367 



72 

GCT CCT CAA GTC CTT GAG GAG ACA ATC AAC ATG AAG CAC TTT GAC TCC 1200 

Ala Pro Clu Val Leu Asp Glu Thr lie Aan Met Lys Hie Phe Aap Ser 
385 390 395 

TTC AAA TGT GCC CAC ATC TAT GCC CTC GGG CTT GTC TAC TGC GAG ATT 1248 
Phe Lys Cys Ala Asp lie Tyr Ala Leu Gly Leu Val Tyr Trp Glu lie 
400 405 410 

GCA CGA AGA TCC AAT TCT GCA GGA GTC CAT GAA GAC TAT CAA CTG CCC 1296 
Ala Arg Arg Cye Aen Ssr Gly Gly Val His Glu Aep Tyr Gin Leu Pro 
415 420 425 

TAT TAC GAC TTA GTG CCC TCC GAC CCT TCC ATT GAG GAC ATC CGA AAG 1344 
Tyr Tyr Asp Leu Val Pro Ser Asp Pro Ser lie Clu Glu Met Arg Lys 
430 425 440 445 

GTT GTA TGT GAC CAG AAG CTA CGG CCC AAT GTC CCC AAC TGG TGG CAG 1392 
Val Val Cys Asp Gin Lys Leu Arg Pro Asn Val Pro Asn Trp Trp Gin 
450 455 460 

ACT TAT GAG GCC TTG CGA GTG ATG GCA AAG ATG ATG CGG GAG TGC TGG 1440 
Ser Tyr Glu Ala Leu Arg Val Met Gly Lys Met Met Arg Glu Cys Trp 
465 470 475 

TAC GCC AAT GGT GCT CCC CGT CTG ACA GCT CTG CCC ATC AAG AAG ACT 1488 
Tyr Ala Asn Gly Ala Ala Arg Leu Thr Ala Leu Arg He Lys Lys Thr 
480 485 490 



CTG TCC CAG CTA AGC GTG CAG GAA GAT CTG AAG ATT TAAGCTGTTC 1534 
Leu Ser Gin Leu Ser Val Gin Glu Asp Val Lys He 



495 




500 




505 






CTCTGCCTAC 


ACAAAGAACC 


TGGGCAGTGA 


GGATGACTGC 


AGCCACCGTG 


CAAGCGTCGT 


1594 


GGAGGCCTAT 


CCTCTTGTTT 


CTGCCCGGO: 


CTCTGGCAGA 


GCCCTGGCCT 


GCAAGAGGGA 


1654 


CAGAGCCTGG 


GAGACGCGC6 


CACTCCCGTT 


GGGTTTGAGA 


CAGACACTTT 


TTATATTTAC 


1714 


CTCCTGATGG 


CATGGAGACC 


TGAGCAAATC 


ATGTAGTCAC 


TCAATGCCAC 


AACTCAAACT. 


1774 


GCTTCAGTGG 


GAAGTACAGA 


GACCCAGTGC 


ATTGCGTGTG 


CAGGAGCGTG 


AGGTGCTGGG 


1834 


CTCGCCAGGA 


GCGGCCCCCA 


TACCTTCTGG 


TCCACTGGGC 


TGCAGGTTTT 


CCTCCAGGGA 


1894 


CCAGTCAACT 


GGCATCAAGA 


TATTGAGAGG 


AACCGGAAGT 


TTCTCCCTCC 


TTCCCGTAGC 


1954 


AGTCCTGAGC 


CACACCATCC 


TTCTCATGGA 


CATCCGGAGG 


ACTGCCCCTA 


GAGACACAAC 


2014 


CTGCTGCCTC 


TCTGTCCAGC 


CAAGTGCGCA 


TGTGCCGAGG 


TGTGTCCCAC 


ATTGTGCCTG 


2074 


CTCTGTGCCA 


CGCCCGTGTG 


TGTGTGTGTG 


TGTGTGAGTG 


AGTGTGTGTG 


TGTACACTTA 


2134 


ACCTGCTTGA 


GCTTCTGTGC 


ATGTGT 








2160 



(2) INFORMATION FOR SEQ ID NO: 16: 

(i) SEQUENCE CHARACTERISTICS: 
(A) LENGTH: 505 amino acids 



SUBSTITUTE SHEET 



wo 94/1 1502 PCT/GB93/02367 

73 

(B) TTPBs amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTIONS SEQ ID NOs 16: 

Met Ala Glu Ser Ala Gly Ala Ser Ser Phe Phe Pro Leu Val Val Leu 
IS 10 IS 

Leu Leu Ala Gly Ser Gly Gly Ser Gly Pro Arg Gly lie Gin Ala Leu 
20 2S 30 

Leu Cys Ala Cys Thr Ser Cys Leu Gin Thr Asn Tyr Thr Cys Glu Thr 
35 40 45 

Asp Gly Ala eye Met Val Ser lie Phe Asn Leu Asp Gly Val Glu His 
50 55 60 

His Val Arg Thr Cys lie Pro Lys Val Glu Leu Val Pro Ala Gly Lye 
65 70 75 80 

Pro Phe Tyr Cys Leu Ser Ser Glu Asp Leu Arg Asn Thr His Cys Cys 
85 90 95 

Tyr lie Asp Phe Cys Asn Lys lie Asp Leu Arg Val Pro Ser Gly His 
100 105 110 

Leu Lye Glu Pro Ala His Pro Ser Met Trp Gly Pro Val Glu Leu Val 
115 120 125 

Gly He He Ala Gly Pro Val Phe Leu Leu Phe Leu He He He He 
130 135 140 

Val Phe Leu Val He Asn Tyr His Gin Arg Val Tyr His Asn Arg Gin 
145 150 155 160 

Arg Leu Asp Met Glu Asp Pro Ser Cys Glu Met Cys Leu Ser Lys Asp 
165 170 175 

Lys Thr Leu Gin Asp Leu Val Tyr Asp Leu Ser Thr Ser Gly Ser Gly 
180 185 190 

Ser Gly Leu Pro Leu Phe Val Gin Arg Thr Val Ala Arg Thr He Val 
195 200 205 

Leu Gin Glu He He Gly Lys Gly Arg Phe Gly Glu Val Trp Arg Gly 
210 215 220 

Arg Trp Arg Gly Gly Asp Val Ala Val Lys He Phe Ser Ser Arg Glu 
225 230 235 240 

Glu Arg Ser Trp Phe Arg Glu Ala Glu He Tyr Gin Thr Val Met Leu 
245 250 255 

Arg His Glu Asn He Leu Gly Phe He Ala Ala Asp Asn Lys Asp Asn 
260 265 270 



SUBSTITUTE SHEET 



wo 94/11502 



PCr/GB93/02367 



74 

GXy Thr Trp Thr Gin Leu Trp Leu VaX Ser Asp Tyr His Clu His Gly 
275 280 285 

ser Leu Phe Asp Tyr Leu Asn Arg Tyr Thr Val Thr lie Glu Gly Met 
290 295 300 

He Lys Leu Ala Leu Ser Ala Ala Ser Gly Leu Ala His Leu His Met 
305 310 315 320 

Glu He Val Gly Thr Gin Gly Lys Pro Gly He Ala His Arg Asp Leu 
325 330 335 

Lys Ser Lys Asn He Leu Val Lys Lys Asn Gly Met Cys Ala He Ala 
340 345 350 

Asp Leu Gly Yeu Ala Val Arg His Asp Ala Val Thr Asp Thr He Asp 
355 360 365 

He Ala Pro Asn Gin Arg Val Gly Thr Lys Arg Tyr Met Ala Pro Glu 
370 375 380 

Val Leu Asp Glu Thr He Asn Met Lys His Phe Asp Ser Phe Lys Cys 
385 390 395 400 

Ala Asp He Tyr Ala Leu Gly Leu Val Tyr Trp Glu He Ala Arg Arg 
405 410 415 

Cys Asn Ser Gly Gly Val His Glu Asp Tyr Gin Leu Pro Tyr Tyr Asp 
420 425 430 

Leu Val Pro Ser Asp Pro Ser He Glu Glu Met Arg Lys Val Val Cys 
435 440 445 

Asp Gin Lys Leu Arg Pro Asn Val Pro Asn Trp Trp Gin Ser Tyr Glu 
450 455 460 

Ala Leu Arg Val Met Gly Lys Met Met Arg Glu Cys Trp Tyr Ala Asn 
465 470 475 480 

Gly Ala Ala Arg X^u Thr Ala Leu Arg He Lys Lys Thr Leu Ser Gin 
485 490 495 

Leu Ser Val Gin Glu Asp Val Lys He 
500 505 



(2) INFOHMATION FOR SEQ 10 NO: 17: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 1952 base pairs 
(6) TYPE: nucleic acid 

(C) STRANDEDNESS : unknown 

(D) TOPOLOGY: unknown 

(ii) MOLECULE TYPE: cDNA 
(iii) HYPOTHETICAL: NO 
(iti) ANTI-SENSE: HO 



SUBSTITUTE SHEET 



wo 94/1 1502 



PCT/GB93/02367 



75 

(V) FRAGMENT TYPE: internal 

(vi) ORIGINAL SOURCE: 

(A) ORGANISM! Mouse 

(ix) FEATURE: 

(A) NAME /KEY: CDS 

(B) LOCATION: 167. .1692 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 17: 

AAGCGGCGGC AGAAGTTGCC GGCGTGGTGC TCGTAGTGAG GGCGCGGAGG ACCCGGGACC 60 

TGGGAA6CGG CGGCGGGTTA ACTTCGGCTG AATCACAACC ATTTGGCGCT GAGCTATGAC 120 

AA6AGAGCAA ACAAAAAGTT AAAGGAGCAA CCCGGCCATA AGTGAAGAGA GAAGTTTATT 180 

GATAAC ATG CTC TTA CGA AGO TCT GGA AAA TTA AAT GTC GGC ACC AAG 228 
Met Leu Leu Arg Ser Ser Gly Lye Leu Asn Val Gly Thr Lye 
15 10 

AAG GAG GAT GGA GAG AGT ACA GCC CCC ACC CCT CGG CCC AAG ATC CTA 276 
Lys Glu Asp Gly Glu Ser Thr Ala Pro Thr Pro Arg Pro Lys He Leu 
15 20 25 30 

CGT TGT AAA TCC CAC CAC CAC TGT CCG GAA CAC TCA GTC AAC AAT ATC 324 
Arg Cys Lye Cys His Hie Hie Cys Pro Glu Asp Ser Val Asn Asn He 
35 40 45 

TGC AGC ACA GAT GGG TAC TGC TTC ACG ATG ATA GAA GAA GAT GAC TCT 372 
Cys Ser Thr Asp Gly Tyr Cys Phe Thr Met He Glu Glu Aep Asp Ser 
50 55 60 

GGA ATG CCT GTT GTC ACC TCT GGA TGT CTA GGA CTA GAA GGG TCA GAT 420 
Gly Met Pro Val Val Thr Ser Gly Cys Leu Gly Leu Glu Gly Ser Asp 
65 70 75 

TTT CAA TCT CCT GAC ACT CCC ATT CCT CAT CAA AGA AGA TCA ATT GAA 468 
Phe Gin Cys Arg Asp Thr Pro He Pro His Gin Arg Arg Ser He Glu 
80 85 90 

TGC TGC ACA GAA AGG AAT GAC TGT AAT AAA GAC CTC CAC CCC ACT CT6 516 
Cys Cys Thr Glu Arg Asn Glu Cys Asn Lys Asp Leu His Pro Thr Leu 
95 100 105 110 

CCT CCT CTC AAG GAC AGA GAT TTT GTT GAT GGG CCC ATA CAC CAC AAG 564 
Pro Pro Leu Lys Aep Arg Asp Phe Val Asp Gly Pro He His Hie Lys 
115 120 125 

CCC TTG CTT ATC TCT GTC ACT GTC TGT AGT TTA CTC TTG CTC CTC ATT 612 
Ala Leu Leu He Ser Val Thr Val Cya Ser Leu Leu Leu Val Leu He 
130 135 140 

ATT , TTA TTC TGT TAC TTC AGG TAT AAA AGA CAA GAA GCC CGA CCT CGG 660 
He Leu Phe Cye Tyr Phe Arg Tyr Lye Arg Gin Glu Ala Arg Pro Arg 
145 150 155 



SUBSTITUTE SHEET 



wo 94/1 1502 



PCr/GB93/02367 



76 

TAC AGC ATT GGC CTG GAG CAG GAC GAG ACA TAC ATT CCT CCT GGA GAG 708 
Tyr Sec lie Gly Leu Glu GXn Aep Glu Thr Tyr lie Pro Pro Gly Glu 
160 165 170 

TCC CTG AGA GAC TTG ATC GAG CAG TCT CAG AGC TCC GGA AGT GGA TCA 756 
Ser Leu Arg Aep Leu lie Glu Gin Ser Gin Ser Sor Gly Ser Gly Ser 
175 180 185 190 

GGC CTC CCT CTG CTG GTC CAA AG6 ACA ATA GCT AAG CAA ATT CAG ATG 804 
Gly Leu Pro Leu Leu Val Gin Arg Thr He Ala Lys Gin He Gin Met 
195 200 205 

GTG AAG CAG ATT GGA AAA GGC CGC TAT GGC GAG GTG TGG ATG GGA AAG 852 
Val Lys Gin He Gly Lys Gly Arg Tyr Gly Glu Val Trp Met Gly Lys 
210 215 220 

TGG CGT GGA GAA AAG GTG GCT GTG AAA GTG TTC TTC ACC ACG GAG GAA 900 
Trp Arg Gly Glu Lys Val Ala Val Lys Val Phe Phe Thr Thr Glu Glu 
225 230 235 

GCC AGC TGG TTC CGA GAG ACT GAG ATA TAT CAG ACG GTC CTG ATG CGG 948 
Ala Ser Trp Phe Arg Glu Thr Glu He Tyr Gin Thr Val Leu Met Arg 
240 245 250 

CAT GAG AAT ATT CTG GGG TTC ATT GCT GCA GAT ATC AAA GGG ACT GGG 996 
His Glu Asn He Leu Gly Phe He Ala Ala Asp He Lys Gly Thr Gly 
255 260 265 270 

TCC TGG ACT CAG TTG TAC CTC ATC ACA GAC TAT CAT GAA AAC GGC TCC 1044 
Ser Trp Thr Gin Leu Tyr Leu He Thr Aep Tyr His Glu Asn Gly Ser 
275 280 285 

CTT TAT GAC TAT CTG AAA TCC ACC ACC TTA GAC GCA AAG TCC ATG CTG 1092 
Leu Tyr Asp Tyr Leu Lys Ser Thr Thr Leu Asp Ala Lys Ser Met Leu 
290 295 300 

AAG CTA GCC TAC TCC TCT GTC AGC GGC CTA TGC CAT TTA CAC ACG GAA 1140 
Lys Leu Ala Tyr Ser Ser Val Ser Gly Leu Cys His Leu His Thr Glu 
305 310 315 

ATC TTT AGC ACT CAA GGC AAG CCA GCA ATC GCC CAT CGA GAC TTG AAA 1188 
He Phe Ser Thr Gin Gly Lys Pro Ala He Ala His Arg Asp Leu Lys 
320 325 330 

AGT AAA AAC ATC CTG GTG AAG AAA AAT GGA ACT TGC TGC ATA GCA GAC 1236 
Ser Lys Asn He Leu Val Lys Lys Asn Gly Thr Cys Cys He Ala Asp 
335 340 345 350 

CTG GGC TTG GCT GTC AAG TTC ATT AGT GAC ACA AAT GAG GTT GAC ATC 1284 
Leu Gly Leu Ala Val Lys Phe He Ser Aep Thr Asn Glu Val Asp He 
355 360 365 

CCA CCC AAC ACC CGG GTT GGC ACC AAG CGC TAT ATG CCT CCA GAA GTG 1332 
Pro Pro Asn Thr Arg Val Gly Thr Lys Arg Tyr Met Pro Pro Glu Val 
370 375 380 

CTG GAC GAG AGC TTG AAT AGA AAC CAT TTC CAG TCC TAC ATT ATG GCT 1380 
Leu Asp Glu Ser Leu Asn Arg Asn His Phe Gin Ser Tyr He Met Ala 
385 390 395 



SUBSTITUTE SHEFT 



wo 94/11502 



PCT/GB93/02367 



77 

GAC ATG TAG AGC TTT GGA CTC ATC CTC TG6 GAG ATT GCA AGG AGA TGT 1428 
Asp Met Tyr Ser Phe GXy Leu lie Leu Trp Glu lie Ala Arg Arg Cye 
400 405 410 

GTT TCT GGA GOT ATA GTC GAA GAA TAC CAG CTT CCC TAT CAC GAC CTG 1476 
Val Ser Gly Gly lie Val Glu Glu Tyr Gin Leu Pro Tyr His Asp Leu 
415 420 425 430 

GTG CCC AGT GAC CCT TCT TAT GAG GAC ATG AGA GAA ATT GTG TGC ATG 1524 
Val Pro ser Asp Pro Ser Tyr Glu Asp Met Arg Glu lie Val Cys Met 
435 440 445 

AAG AAG TTA CGG CCT TCA TTC CCC AAT CGA TGG AGC AGT GAT GAG TGT 1572 
Lys Lys Leu Arg Pro Ser Phe Pro Asn Arg Trp Ser Ser Asp Glu Cys 
450 455 460 

CTC AGG CAG ATG GGG AAG CTT ATG ACA GAG TGC TGG GCG CAG AAT CCT 1620 
Leu Arg Gin Met Gly Lys Leu Met Thr Glu Cys Trp Ala Gin Asn Pro 
465 470 475 

GCC TCC AGG CTG ACG GCC CTG AGA GTT AAG AAA ACC CTT GCC AAA ATG 1668 
Ala Ser Arg Leu thr Ala Leu Arg Val Lys Lys Thr Leu Ala Lys Met 
480 485 490 

TCA GAG TCC CAG GAC ATT AAA CTC TGACGTCAGA TACTTGTGGA CAGAGCAAGA 1722 
Ser Glu Ser Gin Asp lie Lys Leu 
495 500 

ATTTCACAGA AGCATCGTTA GCCCAAGCCT TGAACGTTAG CCTACTGCCC AGTGAGTTCA 1782 

GACTTTCCTG GAAGAGAGCA CGGTGGGCAG ACACAGAGGA ACCCAGAAAC AOGGATTCAT 1842 

CATGGCTTTC TGAGGAGGAG AAACTGTTTG GGTAACTTGT TCAAGATATG ATGCATGTTG 1902 

CTTTCTAAGA AAGCCCTGTA TTTTGAATTA CCATTTTTTT ATAAAAAAAA 1952 

(2) INFORMATIOH FOR SEQ ID NO: 18s 

(i) SEQUENCE CHARACTERISTICS: 
(A) LENGTH: 502 amino acids 
<B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 18: 

Met Leu Leu Arg Ser Ser Gly Lys Leu Asn Val Gly Thr Lys Lys Glu 
1 5 10 15 

Asp Gly Glu Ser Thr Ala Pro Thr Pro Arg Pro Lys lie Leu Arg Cys 
20 25 30 

Lys Cys His His His Cys Pro Glu Asp Ser Val Asn Asn lie Cys Ser 
35 40 45 

Thr Asp Gly Tyr Cys Phe Thr Met lie Glu Glu Asp Asp Ser Gly Met 
SO 55 60 



SUBSTITUTE SHEET 



wo 94/1 1 502 PCT/GB93/02367 

78 

Pro Val Val Thr Ser Gly Cy8 Leu GXy Leu GIu Gly Ser Asp Phe Gin 
65 70 75 80 

Cya Arg Asp Thr Pro lie Pro His Gin Arg Arg Ser lie Glu Cys Cye 
85 90 95 

Thr Glu Arg Asn Glu Cye Asn Lys Asp Leu His Pro Thr Leu Pro Pro 
100 105 110 

Leu Lys Asp Arg Asp Phe Val Asp Gly Pro lie Hie His Lys Ala Leu 
115 120 125 

Leu lie Ser Val Thr Val Cys Ser Leu Leu Leu Val Leu lie lie Leu 
130 135 140 

Phe Cys Tyr Phe Arg Tyr Lye Arg Gin Glu Ala Arg Pro Arg Tyr Ser 
145 150 155 160 

He Gly Leu Glu Gin Asp Glu Thr Tyr He Pro Pro Gly Glu Ser Leu 
165 170 175 

Arg Asp Leu He Glu Gin Ser Gin Ser Ser Gly Ser Gly Ser Gly Leu 
180 185 190 

Pro Leu Leu Val Gin Arg Thr He Ala Lys Gin He Gin Met Val Lys 
195 200 205 

Gin He Gly Lys Gly Arg Tyr Gly Glu Val Trp Met Gly Lys Trp Arg 
210 215 220 

Gly Glu Lys Val Ala Val Lys Val Phe Phe Thr Thr Glu Glu Ala Ser 
225 230 235 240 

Trp Phe Arg Glu Thr Glu He Tyr Gin Thr Val Leu Met Arg Bis Glu 
245 250 255 

Asn He Leu Gly Phe He Ala Ala Asp He Lys Gly Thr Gly Ser Trp 
260 265 270 

Thr Gin Leu Tyr Leu He Thr Asp Tyr His Glu Asn Gly Ser Leu Tyr 
275 280 285 

Asp Tyr Leu Lys Ser Thr Thr Leu Asp Ala Lys Ser Met Leu Lys Leu 
290 295 300 

Ala Tyr Ser Ser Val Ser Gly Leu Cys His Leu His Thr Glu He Phe 
305 310 315 320 

Ser Thr Gin Gly Lys Pro Ala He Ala His Arg Asp Leu Lys Ser Lys 
325 330 335 

Asn He Leu Val Lys Lys Asn Gly Thr Cys Cys He Ala Asp Leu Gly 
340 345 350 

Leu Ala Val Lys Phe He Ser Asp Thr Asn Glu Val Asp He Pro Pro 
355 360 365 

Asn Thr Arg Val Gly Thr Lys Arg Tyr Met Pro Pro Glu Val Leu Asp 
370 375 380 



SUBSTITUTE SHEET 



wo 94/11502 



79 



PCr/GB93/02367 



Glu Ser Leu Aen Arg Asn His Phe Gin Ser Tyr He Met Ala Asp Met 
385 390 395 400 

Tyr Ser Phe Gly Leu He Leu Trp Glu He Ala Arg Arg Cys Val Ser 
405 410 415 

Gly Gly He Val Glu Glu Tyr Gin Leu Pro Tyr His Asp Leu Val Fro 
420 425 430 

Ser Asp Pro Ser Tyr Glu Asp Met Arg Glu He Val Cys Met Lys Lys 
435 440 445 

Leu Arg Pro Ser Phe Pro Asn Arg Trp Ser Ser Asp Glu Cys Leu Arg 
450 455 460 

Gin Met Gly Lys Leu Met Thr Glu Cys Trp Ala Gin Asn Fro Ala Ser 
465 470 475 480 

Arg Leu Thr Ala Leu Arg Val Lys Lys Thr Leu Ala Lys Met Ser Glu 
485 490 495 

Ser Gin Asp He Lys Leu 
500 

(2) INFORKATION FOR SEQ ID NO: 19: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 28 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGy: linear 

(ii) MOLECULE TYPE: cDNA 
(iii) HYPOTHETICAL! NO 
(iii) ANTI-SENSE: NO 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 19: 
GCGGATCCTG TTGTGAAGGN AATATCTG 28 



(2) INFORMATION FOR SEQ ID NO: 20: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 24 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: cDNA 
(iii) HYPOTHETICAL: NO 
( iii ) ANTI-SENSE : NO 



SUBSTTTUTE SHEET 



wo 94/11502 

80 

(xi) SEQOENCB DESCRIPTION: SEQ ID NO: 20: 
GCGATCOGTC GCACTCAAAA TTTT 



(2) INrORMATION FOR SEQ ID NO: 21: 

{L) SEQOENCE CHARACTERISTICS: 

(A) LENGTH: 26 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: cDNA 
(iii) HYPOTHETICAL: NO 
(iii) ANTI-SENSE: NO 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 21: 
GCGGATCCGC GATATATTAA AAGCAA 



(2) INFORMATION FOR SEQ ID NO: 22: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 20 base pairs 

(B) TYPE: nucleic acid 
<C) STRANDEDNESS: single 
<D) TOPOLOGY: linear 

<ii) MOLECULE TYPE: cDNA 

(iii) HYPOTHETICAL: NO 

(iii) ANTI-SENSE: YES 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 22: 
CCGAATTCTC GTCCCATATA 



(2) INFORMATION FOR SEQ ID NO: 23: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LEN(rrH: 37 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: cDNA 
(iii) HYPOTHETICAL: NO 



SUBSTTTUTE SHEET 



wo 94/11502 

81 

(iii) ANTI-SENSEj NO 

txi) SEQUENCE DESCRIPTION: SEQ ID NO: 23: 
ATTCAAGGGC ACATCAACTT CATTTGTGTC ACTCTTG 

(2) INFORMATION FOR SEQ ID NO: 24: 

(1) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 26 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: sinqla 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: cDKA 
(iii) HYPOTHETICAL: NO 
(iii) ANTI-SENSE: NO 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 24: 
GCGGATCCAC CATGG06GA6 TCGGCC 

(2) INFORMATION FOR SEQ ID NO: 25: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 20 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: cDNA 
(iii) HYPOTHETICAL: NO 
(iii) ANTI-SENSE: NO 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 25: 
AACACCGGGC CGGCGATGAT 



(2) INFORMATION FOR SEQ ID NO: 26: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 6 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: peptide 



SUBSTITUTE SHEET 



wo 94/1 1502 PCT/GB93/02367 

82 

(V) FRAGMENT TYPEt internal 

(xi) SEQUENCE DESCRIPTION: SEQ ID NOl 26: 

Gly Xaa Cly Xaa Xaa Gly 

1 5 



(2) INFORMATION TOR SEQ ID NO: 27: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 6 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: peptide 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 27: 

Asp Phe Lya Ser Arg Asn 
1 5 



<2) INFORMATION FOR SEQ ID NO: 28: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 6 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: peptide 

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 28: 

Asp Leu Lys Ser Lys Aen 
1 5 



(2) INFORMATION FOR SEQ ID NO: 29: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 6 amino acids 

(B) TYPE: amino acid 
(O) TOPOLOGY: linear 

(ii) MOLECULE TYPE: peptide 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 29: 

Gly Thr Lys Arg Tyr Met 

1 5 



SUBSTTTUTE SHEET 



wo 94/1 1502 PCr/GB93/02367 

83 

1. An isolated protein having a serine/ threonine kinase 
domain, a DFKSRN or DLKSKN sequence in subdomain VIB and/or 
a GTiCRYH sequence in subdomain VIII • 
5 2. A protein according to claim 1, which additionally 
comprises an ATP-binding secpaence that is Gly-Xaa-Gly-Xaa- 
Xaa-Gly in subdomain I, and a Lys residue in subdomain II, 

3. An isolated protein having a serine/ threonine kinase 
domain which has more than 50% identity to the kinase 

10 domain of any of the amino-acid sequences identified herein 
as SEQ ID. Nos. 2, 4, 6, 8, 10, 12, 14, 16 and 18. 

4. A protein according to claim 3, wherein the identity 
is more than 60%. 

5. A protein according to any preceding claim, having 
15 serine/ threonine kinase activity, 

6. An isolated protein having all or part of any of the 
amino-acid sequences identified herein as SEQ. ID Nos. 2, 
4, 6, 8, 10, 12, 14, 16 and 18, and activin receptor type 
I functionality. 

20 7. An isolated protein having an amino-acid sequence 
corresponding to part or all of the amino-acid sequence of 
an activin type I receptor, and wherein the protein has at 
least one of the following characteristics:- 

(i) serine/ threonine kinase activity; 
25 (ii) activin-binding activity; and 

(iii) activin type II receptor interaction. 

8. An isolated protein having all or part of any of the 
amino-acid sequences identified herein as SEQ. ID Nos. 2, 
4, 6, 8, 10, 12, 14, 16 and 18, and TGF-B-type I receptor 

30 functionality. 

9. An isolated protein having an amino-acid sequence 
corresponding to part or all of the amino-acid sequence of 
a TGF-B-type I receptor, and wherein the protein has at 
least one of the following characteristics: 

35 (i) serine/ threonine kinase activity; 

(ii) TGF-6-binding activity; and 

(iii) TGF-B-type II receptor interaction. 



wo 94/1 1502 PCr/GB93/02367 

84 

10. A protein according to any of claims 1 to 5, having 
all or part of the amino-acid sequence identified herein as 
SEQ ID No. 2. 

11* A protein according to any of claims 1 to 7, having 
5 all or part of the amino-acid sequence identified herein as 
SEQ ID No. 4. 

12. A protein according to any of claims 1 to 5, having 
serine/ threonine kinase activity and all or part of the 
amino-acid sequence identified herein as SEQ ID No. 6. 
10 13. A protein according to any of claims 1 to 7, having 
all or part of the amino-acid sequence identified herein as 
SEQ ID No. 8. 

14. A protein according to any of claims 1 to 5, 8 and 9^ 
having all or part of the amino-acid sequence identified 

15 herein as SEQ ID No. 10. 

15. A protein according to any of claims 1 to 5, having 
all or part of the amino-acid sequence identified herein as 
SEQ ID No. 12. 

16. A protein according to any of claims 1 to 5, having 
20 all or part of the amino-acid sequence identified herein as 

SEQ ID No. 14. 

17. A protein according to any of claims 1 to 7, having 
all or part of the amino-acid sequence identified herein as 
SEQ ID No. 16. 

25 18. A protein according to any of claims 1 to 5, having 
all or part of the amino-acid sequence identified herein as 
SEQ ID No. 18. 

19. A protein acording to any preceding claim, that is a 
soluble receptor. 
30 20. An antibody which binds specifically to a protein as 
defined in any of claims 1 to 19 and not to at least one 
other such protein. 

21. An isolated nucleic acid molecule which codes for, or 
is complementary to a nucleic acid molecule which codes 

35 for, a protein as defined in any of claims 1 to 19. 

22. A recombinant nucleic acid molecule comprising at 
least two heterologous sequences, one of which codes for. 



wo 94/11502 



PCr/GB93/02367 



85 

or is complenentazy to a nucleic acid molecule which codes 
for, a protein as defined in any of claims 1 to 19. 
23. A molecule according to claim 21 or claim 22, wherein 
the protein is a TGF-fl-type I receptor. 
5 24. A molecule according to claim 21 or claim 22, wherein 
the protein is an activin receptor. 

25. A DNA or RNA/mKNA molecule according to any of claims 
21 to 24. 

26. A molecule according to any of claims 20 to 24, which 
10 additionally comprises, operably associated with the coding 

sequence, a sequence adapted to allow expression of the 
protein. 

27. A host comprising a molecule according to claim 26, 
which is capable of expressing the protein. 

15 28. A host according to claim 27, which comprises PAE 
cells. 

29. A host according to claim 27 or claim 28, transfected 
with the Chim A receptor plasmid. 

30. A product according to any preceding claim, for 
20 therapeutic or diagnostic use. 

31. Use of a product according to any of claims 1 to 29, 
for the manufacture of a medicament for use in treating a 
condition associated with TGF activity. 



wo 94/1 1502 



PCr/GB93/02367 



1/11 



cons.aa G G v a K e 

hTGFBR- 1 1 lOTLVGKGRFAEVYKAKIJCOm^EOFETVAVKirPYDHYASWro 

itiACtR- 1 IB LLEIKARGRPGCVWKAOIMI DFVAVKI KPbQDKOSWOSEREI FSTPGKKHENIiLOF 

mACtR- II LLEVKARGRPGCVWKAOLLN EYVAVKIFPIQDKOSWONEYEVYSIPGMiaiEKILOF 

daf'i . LI^TIVGSGRFGNVSRGDYRG EAVAVKVHTO^IDEPAFHKEIEIFETRMIiRHPNVtjRY 

subdomains i . II III iv 



hTGFBR - II LTAEnOTTLGKOVWLITAFKAKGNLQEniTRHVI SWEDLRNVGSSLARGLSHUISDHTP - C 

mACtR- IIB IAAEKRGSNLEVEUfLITAnn)KGSLIDYIJCGNIITWNELC^^ 

mActR- 1 1 IGAEKRGTSVDVDIA^LITAFHEKGSLSDFIJCANWSWNEIXMIAETM^ 

daf • 1 IGSTOVDTGrVTELWLVIEYHPSGSWn)FIJ*EimWIET^ 

subdomains v Vi-A 



cons.aa duc N dfg 

hTGFBR- 1 1 -GRPKMPIVHRDI^SNILVKNDLTCCLCDrGLSlJlL- - -GPYSSVDDLANSGQVGTARYMAP 

mACtR- 1 1 B GEGHKPSI AHRDFKKNVIJLKSDLTAVIADFGLAVRF - - - EPGKPPGD - • THGQVGTRRYMAP 

mACCR-II -DGHKPAISHRDIKSiana4lJQmL.TACIADPGLAli^ - -EAGKSAGD- -THGQVGTRRYMAP 

daf - 1 - ESNKPAMAHRDIKSZNIMYKNDLTCAIGDtGLSLSKPEDAASDI IAN - - ENYKCGTSmYLAP 
subdomains Vl-B VII VIII 



Fig. 1 



SUBSTITUTE SHEET 



wo 94/11502 



PCr/GB93/02367 



2/11 



a. a C C E G N M C 

5' GCGGATCCTGTTGTGAAGGNAi^TATGTG 3' Fig. 2 A 
BAMHI C C 6 C 



a. a V A V K I F 

5' GCGGATCCGTCGCAGTCAAAATTTT 3' Fig. 2B 
BaaHI 6 C G G C 

T T T A 



a. a R D IK S K N 

5' GCGGATCCGCGATATTAAAAGCAA 3' Fig. 2C 

BAMHI A C C GTCT 
6 A 



a. a E P A M y 

5' CGGAATTCTGGTGCCATATA Fig. 2D 

ECORI 6 G G 
A A 



SUBSTITUTE SH€ET 



wo 94/11502 PCr/GB93/02367 

3/11 



1/1 
I 

ac a I ■ • I t * * 

4 «A z > -I < 0^> 

u m SO 

^ a a a ^ 

< « a X 

« c 

^ > 



3 



Z 



■ 

w 

O -J 



Qc oe t I I t I I * 

XX WhUtf^u/XuJ 



SluJ 



• I > « 

Z X Ui ^ 



Z < > 



ae oc a o < x o o 
' • ^ ^^^ iH x i^* 

^ 0^\A ^ I I Z ^ X 

oui»-{2* ■ [z X xj 

V9 ^ M t • • « I > 

> ui ^ I a. o < ■ ^ 
aoexM^xoo^uj 

9 > .1 z |w w w w w ^ 

O O W • z z • z 
^ w« * a. ^ * • * 

C^O^^ ^ %/i O v9 v% x 
X X O ^X Ui iU 1/1 ^ x 
0^1— z fw u> w w w ^ 
oc oc O u. ^ > >■ ^ ^ 







O'H- Z ^ ^ oc 




Ui 




>^ 








m 










X 


X 


oc 


a V 


a 








> ^ 


v9 a 




> a 


X 


X 


o o 


a X 




oc 




>• 


^ a 


> 


o 


oc a 






U. .J 


a a£ 


Ui 


a w 


«J 




^ *J 


w a 


a. 


\9 a 




w 


w < 


> w 


< 




UJ 


UI 


•J < 


a Ui 


•J 


o ^« 


croc 


<y< 


o o 










a ^ 


V9 Ui 


> 


«rt Ui 




UJ 




era 


z 


« o 



M M M 



OC OC ••*•,* * 
Ct CC ^ U ^ U 



W O^Ui ^ • • GC OC OC 

a a > * ' oc ^ oc 



* ( M OC a u« ^ ^ 

• t 3 a o ^ o ^ o 

>>^<«^kC.iOC 



O Ui 


M > 




^ cr> 








ajuk u. 




« oc 


wi a 




^ o a 


o 




< oc 


1 


%A ^ 






< o 


Ui 








o a 


oc 


UJ Ui ^ 


UI 




UJ & 


z 


>- • a 






w ^ 




> • > 










• * ^ 






W • 




lit 




o o 


O • 




« 1 1 




V >- 


z * 




1 • 1 




w w 


> • 




1 1 1 




X X 


a o 




t 1 Ui 




*^ u. 


•J M 




• < > 




o o 


W Ui 




* >- V 






a < 


X 












u. a M 


•J 


K K 


z * 


1 


» • • 


• 




SUBSTTTUTE SHEET 



wo 94/11502 



4/11 



PCT/GB93/02367 



« -I 

M M X> 

, . ^« - fvj ^ « 

QC a I i • * , • • 

5* ^ * 



1-1 >> w 

a: c • 

V w u« 



o > > < 

* .1 a< 

• B • X 

' a ui X 



- > J > ^ > 



I . t ^ * ( 2 • 

^ a I a o o^u. a > 
>a> • ^ u. X u- 

^ > «j • **UiO 

O^ui Z • & ^ & X CL 

>-[a] * ^ 'a.ivj'Qj 

> O ^ f C^O «/t .J 

g g V »- ^ ^ a > a 



V o o 



^ ^ M • ^ • t * 

U. ftk M ' > ^ * ' * 

^ a z I z X • • • 

ui w o ^ X oe O'oe m 



z z z z 



3 w Ui X «^ E ^ >- ui 
z zfoolxHzigz 

O S9 ^ ^ 

wwv/Z OO'K >- »— 



0 w(»aJw w w w w 
« * 2 * ' * * * 



M M M 

t I M M ^ <v \0 

QC ac ■ * • • , • • 

^ ec cc u ^ . ^ 



m & I o * w »- 

QC W CC • UJ Ui 2 wu 



• • o o O Ui O 

• • ^ </> >- cr su Cr 
Of XX, urf J ^aIuj} 
w ^ a > ^ -J 

Cy ,l |o O Ot lb? 

Of O uj uj cz t ui I 

yjyjZ XZ ZO«/^ 

xKa^^>^>- 
>»^H->v9 > ccaoe 
^ o ^ a QC » cr O'Q. 
> > */» X o joc g g Qg; 
az^ix^ujhAz^ 

OiOW^ujO^^XUJ 

V >- « > o^z ^ > c 
< a O'^-ocoe > g 
a o- o jg g g| w{g) « 

MkgZgi^WO^ • 
x g z x > >- X >- 
1x ^> w/Qa*@> g 
|g g g|M r{g|^ z u. 
|v >- > H -jQ**© 

Z K >> S ^ > u. «J u. 

(u> u. -J > o » 

^ M M 



^ ^ ^ ^ * ^ ^ ^ 

^ gi> >_ 



I * * * I • * 
fc«wggtfMw^v 



(ggggggggfic 



a g^M M «i w ^ 

! ! 
4 <iO O U O V7 

It k'>R > > 

^ ^ O 0^> ^ > Or> 

w^Erlil H 

a & a ^ jo^O' oCTo 
g g g) >c|g}a^ 



* 1 * 


g g g g g g{ 


w «J •« 




O %9 uJ 

o^ajx 


>>>>>>. 

-i .i^ u.j ^ ^ «i 

a & a a CL qJ 




o o o o Ol 


z 


^ */> vA 


a a z 


O O O 


a a w 


O O \J o 


a a ^ 

O S> *A 


*A ^ 



g i/t ^ w w 

& a 9c ^ ^ ^ ^ > *^ 
• gfo O O O Q O Q 



Jg a g g g| > ^Igf^ 



• ^ lu ^ \J < W O^g 

• ^ X » 0^> • • • 
■ O U4 * bu Z • * * 



SUBSTITUTE SHEET 



wo 94/1 1S02 PCr/GB93/02367 

5/11 



CO -J 

•-^ « "V 

t t *-m mm ^ ^ 

c]e ec * * • • t * * 



a a ^ 
^ 


>>>>>> 
o'.x x\crorcf 




>.>>->->->- 










oc a oe a ae oc' 








K C E K K C 





O 0[u UJ.O Q{u# I 



a a a 



E-> 

>>>>>>>>> 
i> > >>>>>> > 



»- UJ »A g ^ O W 

X ui Ui ui iu [vy | ui 
XXO^^v^v'v^^^ 
^ 2 ^ ae fx 0< V « « 
-i ^ -ijfc g K K K » 

4 « < O O V9 V7 O 

^ M w OC s cc[5)qc[z 

Jk » ft S K K 

>>>>>>> 




> 

OQ ^ 

M M M ^ 

I « h4 M »<4 r>d ^ IT «0 
at K •(**■* * 




g V 0 >- < > ^ 
< CC 0^ J *A 

»- X o^of^ xfS 

J ^ ^ ^ ^ 
rjo O O O O O 



VI vifaj t/i %A v% t/^ ^ 



MMWXX2XXX 



iO <lui Ui UI Ui ui 
Ixxxxxxxxx 

ojx x|o o a 



< < 




O UI Ui| ft K K 

> «i «J >»Jt/> i/ viQ VI 
\J 

4i/»IH x « flc 

|0 o]m O VI «a 

M w m » a a »^ » »■< 

Ui Ui ujjo O O O O 



0>[Q| O 
W ^ ^ 



Oj^pJ^ 4 4 < < 

mIJm m m m m I 





xxxzxxzx 

UI Ui UI uj(3 UI Ui Ui Ud 
X X X X X X X X X 



CD -J 

► 

;«•'•» I • • 

rW^ttfW-f-i-i-i 



^» >j1 > > > >ia> 



IK m k ^ 

!k >C K U 'il U ^ ^ 

^ wl| -I -jQ w -J -J 

ooooooooo 
xxxxxxxxx 

3-3 



a. also, a a. &. & 



GO 
> 



\J O V9 O * 



X X a 
\^ oc 
O Ui ^ 

^ ^ ^ I I I • * < 
I s ^ I I I • I • 

a a • 
« > X 
o o o 



^ ^ M ^ M ^ 

HI 





uiu^0^9«J^<^^^ 
XZUiuiX>«Ui>tf 



c 
o 
u 



Cl4 



SUBSTITUTE SHEET 



wo 94/I1S02 PCT/GB93/02367 

6/11 



1/1 

to -i 

MM •< 

M M V 

I • M M M ^ V ^0 

QC Of • * * ■ I * * 



O o t/i Ojyj ui ui ui 
u# iu UJlO O O O O 



3 



>>>>>>>>>1 

^ ^ 1^ 1^ 1^ 141 1^ 

aaaaaa&aa; 



ocaeaeecacfieacQcoel ^ 



^ > 



> > > > >>>>>< 
O^O^o tce g PC oe g 



o o X g a >- o^»» 
X X W» X X X X aej 
i-^zaxx«jaa 
• I < ^ \» o a < a 
I « ^j >M m |> >j M ^ 
[o o o o o o o o oj 

^ a «/i o o X X o X 
< a a lA o^o^%A < v% 




•J •J -J yj\ 
§o a X X X X X 

X %A X K X >iC 



in 

0 ^ 

MM 4 
M M M >^ 

< f M M M rg ^ ^ to 
Of g • I I « , I I 




•a a a a a a a a aJ 
2 a uij o ig a<| o^o^or 



>> >• ^ > > > >• 
|m uj o O O o| uj UI 
Q Q ^fui Ui UI UJ UI 
]> > >j *x]> > > X 
g g ui( ^»* M M > ^ 
(o o o o o ol 



V> sJ 



^ 4 > • I I I • * 
^ « <M>Vt^W%«A 
^><X«AM>MX> 



:W W W 
QC CX QC 
^ %/» 


2{w w w 
g ot g K g a 
g g g g oc g 


^ ^ 2 


M M > Z M M 


ix X X ft K K 



2 2 >j M M M M 

{q O O O P o o 



> MM»- 



O^O^UJ W O O X liC X 
u, u> ^ 2 > X 2 g 
|x X X x }g ojx X aij 

tl^/2|*;£E3-W-^ 



CO ^ 

MM 4 

M M M X 

• I M M M rsi ^ « 

oe K * 

«i*4ggk(K^MW 



xxxkxcksk| 



Ui Ui H> QC oc tf«/lg»* 

^« w l2 2 2 2 2 2! 



»-^^MZ.if^2«J 
UI > uiQofae 



I 



mi>2fir3>2 2 

2 0^2 > O %A ^ > 

< < of ^^A M) g g g| 

2P H-* ^-i ^-j J 



< g oQ ggjui Ui uj 
XXX o o{^a 



C^w ^ u. X 

Ik X » g^fc gj^g 

g g g|3 

OO^X X X X X z 

g jtfjg g g g pjg g 

M M M J>|^/u. 

>^uiX»-ZMXtn 



g g g g 
g g g g 



^ 2 oj^J 
^ ^ g[w 



g g g g g| 

^]^g g g g| 



^O^O'glK 



XXgui>>>02 



>>>>>>>>>! 



>>pl 

UI uj o ' 



> > > > > 
O ^ xjuifi^u^ 



O^O^^odwjg g g 
3^ T2 2 2 2 2 2 
Q UI %/% uj|o O oH I 



pry: 



ggggggggg 

O OP OO-Q 
^ |x x] %/y 
g g g g g g 



X z X 

O^O UI 
o o g 

M m|> >>>>>> 



c 
o 
o 



IT 

••1 

04 



SUBSTITUTE SHEET 



wo 94/1 1502 



7/11 



PCT/GB93/02367 



CD -i 

M M M V 

a a • I < * I * ' 



a «i 



o o z 

> > ^ 

Z Z 

o 

> > o 

2 uj 
w ^ a 

> > « 

> w 

^ w> u/ C 

ui o »/» g{ o 55 g{ X 



z z oe o u^|o O Q oj 
^ > O m g «J CK ui O' 

a cc z O^z z uj > uj 

S ^ ^ »■» »^ 2 *J 2 



> > > 
O ^ o 



^ -i «j -J <-4 



1 



o o o fz z » » » * _ 



O 
o 



2« 



g a V 



SUBSTITUTE SHEET 



WO94/11S02 



PCr/CB93/02367 



8/11 



DaM (669 a.a.) ■ \rm^i^ 



It 



ActR-li(5i3a.a.) ltg?»sa US 



'mm. 



ActR-IIB (536 a.a.) il 



11 



yy yi 



\wmMmmmmmmm 



T0R-ll(567a.a.) ■ I^M 



1 



TBR-VALK-5 (503 a.a.) Hl^^fj 



ALK-1 (503 a.a.) l^^-l ^ 



ALK-2 (509 a.a.) 



1 



ALK-3 (532 a.a.) ■ l^^^-H ^ 



ALK-4 (505 a.a.) I W^^'iA 



ALK-6 (502 a.a.) ■ piii»ii ^' 



signal sequence g insert in the kinase domain 

cysteine-rlch region ^ potential N-glycosylation site 

transmembrane domain ^ alternatively spliced region 
serine/threonine kinase domain 



Fig. 4 



SUBSTITUTE SHEET 



wo 94/11502 



PCT/GB93/02367 



9/11 



O 



o 
a 
w 
I 
I 

CO 

> 

(J 
I 

o 

I 
I 

E« 
u 
u 

H 

t 
I 

o 

I 

o 

o 

X 

o 



1 

u 



06 U _ 

o ^ oc 



tt u _ 

u ^ oc 



W CM rO V »n I I M r-4 

1 I I I t fiC OC I t 

O (A H U CO 

H O oQo- 

b3 2 O »J ti |<0 Cfi| Z 
a M fa2 Z b3 I t X I 
> M b] U H I I OC I 
0~I3m Cm > m CO S < 
>|coj Mpow] Z Z 

[>jco <]>> » oc < a 
HjuTEI^sjii- s s > >* 
fu u u cj u I I |u m 

2 I Z < *J I I > CO 
< I [O O <J| I I 

0 O Z O O I I O I 

1 O I I I H CO fiu O 
I 0(H H H < < «@ 



U U U O U U CJ U I 

I O Z I I tt iJ CO I 
I Cil Z I I K H I 

I O < Z Z jO 0| CO H 

I U I I I ^ ou z 
Cu C0[^ <fo^CJ Z b3 

g I o o ag ]o uj CO > 
0 ' \^ ^ ^ ^ ^ 

X I 

I 

•J 



0* 
(O 
CO 



o 
to 
u 
I 
I 
I 
I 
I 
I 
I 

> 
I 
I 
I 

I O CO »J 
I CO H X 
I |0 O L3| 
I 
I 
I 
I 
I 
I 
I 



I Ck« flC CO oc 

I CO U X o 

I > J OH 

t O O Z CO 

I H CO O Z 
OOO »J 

Z Z 1 IM 

t- H I CO 

ft oe I M 

O CO I o 

X I Gu 

CO U I > 

3 S I 3 

Z Z Ft O 

< < CO H 

I IM H 

I flC 

I > < 

1 o z 

I t o 

I I > 

I I to 

Z Z I flC 



I bu >« f CO 
I I n4 w X X 



u 

o 



u 

o 
o 

CO 

u 
I 

<J 

CO 

> 
I 

o 
<o 

Ou 

to 

iC 

> 
u 
I 

cu 

CO 

o 
I 
I 
I 

o 



r-i CM r> V in I I M «-l 
I 1 I I I OC flC I I 

<222<<<Ho 



L> U U OUU 
Nj"3|^>' X X 



u o q 



xfQ[z |Q Qj Z 



U U bi 



co@ 

CO X 

uouocjouuIq 



o O ct z CO 




I t 



I I O U CO (J 



U U U U U (J 



>« [C0 C0| X fa* 
X I m |H 
Zg H Z 
> < flC Ct{^ I 

Oct a > 



fa. S M 

>« fa« 3 

>|u*r 




o CO a fa] 
0 ' 1^ ^ ^ 'J 



I U O >- > I 



z ^ o 
to fS^ 

fill H 

H u z 

<gz 

Z H 
I u> 



|U O O CJ CJ u o o u| 




o ofu] p |cj u u 

t3 oc o CO f- r(o 

X X|« < OS CO ^ ^ 

bi 0O u > z ac*' 

> 0>*l-iXXj>" 

w cu > H xJm 

CO X x{w^ >|fai*" 



SUBSmUTE SHEET 



wo 94/11502 



PCr/GB93/02367 



10/11 



— CD 

c\i CO ^ iTt -r — = 

<<<< <<j_-o 



179 


60 


61 


63 


40 


40 


37 


39 


ALK-1 




63 


64 


65 


41 


39 


37 


39 


ALK-2 




63 


65 


41 


38 


37 


39 


ALK-3 






90 


41 


40 


39 


42 


ALK-4 








42 


40 


41 


43 


ALK-5 










78 


48 


35 


ActR-ll 












47 


32 


ActR-IIB 














34 


T3R-II 



Fig. 6 



SUBSTITUTE SHEET 



11/11 



PCT/GB93/02367 



ALK-3 

ALK-6 

T6R-I/ALK-5 

ALK-4 

ALK-1 

TBR-l/rsk-7L/ALK-2/SKR1 

ActR-l! 

ActR-IIB 

TBR-II 

Daf-1 



Fig. 7 



SUBSTITUTE SHEET 



This Page is Inserted by IFW Indexing and Scanning 
Operations and is not part of the Official Record 

BEST AVAILABLE IMAGES 

Defective images within this document are accurate representations of the original 
documents submitted by the applicant. 

Defects in the images include but are not limited to the items checked: 

□ BLACK BORDERS 

□ IMAGE CUT OFF AT TOP, BOTTOM OR SIDES 
□TfADED text OR DRAWING 
[^BLURRED OR ILLEGIBLE TEXT OR DRAWING 

□ SKEWED/SLANTED IMAGES 

□ COLOR OR BLACK AND WHITE PHOTOGRAPHS 

□ GRAY SCALE DOCUMENTS 

□ LINES OR MARKS ON ORIGINAL DOCUMENT 

□ REFERENCE(S) or EXHIBIT(S) SUBMITTED ARE POOR QUALITY 

□ OTHER: ' 

IMAGES ARE BEST AVAILABLE COPY. 
As rescanning these documents will not correct the image 
problems checked, please do not report these problems to 
the IFW Image Problem Mailbox.