Skip to main content

Full text of "USPTO Patents Application 09804625"

See other formats


WORLD INTELLECTUAL PROPERTY ORGANIZATION 
International Bureau 




PCT 

INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) 



(51) International Patent Classification 5 : 

C07K 3/00, 13/00, 15/28, 17/00, C07H 
15/12, 17/00, C12N 15/70, 15/79, 15/00, 
7/00, 1/20, 5/16, 1/21 



Al 



(11) International Publication Number: 
(43) International Publication Date: 



WO 94/15949 

21 July 1994 (21.07.94) 



(21) International Application Number: PCT/US94/00657 

(22) International Filing Date: 12 January 1994 (12.01.94) 



(30) Priority Data: 
08/003,144 



12 January 1993 (12.01.93) 



US 



(60) Parent Application or Grant 
(63) Related by Continuation 
US 

Filed on 



08/003,144 (OP) 
12 January 1993 (12.01.93) 



(71) Applicant (for all designated States except US): JOHNS HOP- 

KINS UNIVERSITY SCHOOL OF MEDICINE [US/US]; 
720 Rutland Avenue, Baltimore, MD 21205 (US). 

(72) Inventors; and 

(75) Inventors/Applicants (for US only): LEE, Se-Jin [US/US]; 
6711 Cbokebeiry Road, Baltimore, MD 21209 (US). 
HUYNH, Thanh [US/US]; 5510 South Bend Road, 
Baltimore, MD 21209 (US). 



(74) Agent: WETHERELL, John, R., Jr.; Spensley Horn Jubas & 
Lubitz, 5th floor, 1 880 Century Park East, Los Angeles, C A 
90067 (US). 



(81) Designated States: CA, JP, US, European patent (AT, BE, CH, 
DE, DK, ES, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE). 



Published 

With international search report. 



(54) Title: GROWTH DIFFERENTIATION FACTOR-5 



(57) Abstract 



Growth differentiation factor- 5 (GDF-5) is disclosed along with its polynucleotide sequence and amino acid sequence. Also disclosed 
are diagnostic and therapeutic methods of using the GDF-5 polypeptide and polynucleotide sequences. 



FOR THE PURPOSES OF INFORMATION ONLY 



Codes used to identify States party to the PCT on the front pages of pamphlets publishing international 
applications under the PCT. 



AT 


Austria 


GB 


United Kingdom 


MS 


Mauritania 


AU 


Australia 


GE 


Georgia 


MW 


Malawi 


BB 


Barbados 


GN 


Guinea 


NE 


Niger 


BE 


Belgium 


GR 


Greece 


NL 


Netherlands 


BF 


Burkina Faso 


HU 


Hungary 


NO 


Norway 


BG 


Bulgaria 


IE 


Ireland 


NZ 


New Zealand 


BJ 


Benin 


IT 


Italy 


PL 


Poland 


BR 


Brazil 


JP 


Japan 


FT 


Portugal 


BY 


Belarus 


KE 


Kenya 


RO 


Romania 


CA 




KG 


Kyrgystan 


RU 


Russian Federation 


CF 


Central African Republic 


KP 


Democratic People's Republic 


SD 


Sudan 


CG 


Congo 




of Korea 


SE 


Sweden 


CH 


Switzerland 


KR 


Republic of Korea 


SI 


Slovenia 


a 


Cote d'lvoire 


KZ 


Kazakhstan 


SK 


Slovakia 


CM 


Cameroon 


U 


Liechtenstein 


SN 


Senegal 


CN 


China 


LK 


Sri Lanka 


TD 


Chad 


CS 


Czechoslovakia 


LU 


Luxembourg 


TG 


Togo 


CZ 


Czech Republic 


LV 


Latvia 


TJ 


Tajikistan 


DE 


Germany 


MC 


Monaco 


TT 


Trinidad and Tobago 


DK 


Denmark 


MD 


Republic of Moldova 


UA 


Ukraine 


ES 


Spain 


MG 


Madagascar 


US 


United States of America 


FI 


Finland 


ML 


Mali 


HZ 


Uzbekistan 


FR 


France 


MN 


Mongolia 


VN 


Viet Nam 


GA 


Gabon 











WO 94/15949 



PCT/US94/006S7 



-1- 

GROWTH DIFFERENTIATION FACTOR-5 

This application is a continuation-in-part application of U.S. Serial No. 
08/003,144, filed January 12, 1993. 

BACKGROUND OF THE INVENTION 

5 1. Field of the Invention 

The invention relates generally to growth factors and specifically to a new 
member of the transforming growth factor beta (TGF-p) superfamily, which is 
denoted, growth differentiation factor-5 (GDF-5). 

2. Description of Related Art 

10 The transforming growth factor p (TGF-0) superfamily encompasses a group 
of structurally-related proteins which affect a wide range of differentiation 
processes during embryonic development. The family includes. Mullerian 
inhibiting substance (MIS), which is required for normal male sex development 
(Behringer ef a/.. Nature 345:167, 1990), Drosophila decapentaplegic (DPP) 

15 gene product, which is required for dorsal-ventral axis formation and 
morphogenesis of the imaginal disks (Padgett, era/., Nature, 325:81-84, 1987). 
the Xenopus Vg-1 gene product, which localizes to the vegetal pole of «ggs 
((Weeks, ef a/., Cell, 51:861-867, 1987), the activins (Mason, ef a/., Biochem, 
Biophys. Res. Commun., 125:957-964, 1986), which can induce the formation 

20 of mesoderm and anterior structures in Xenopus embryos (Thomsen ef al, Cell 
63:485, 1990), and the bone morphogenetic proteins (BMPs, osteogenin, OP-1) 
which can induce de novo cartilage and bone formation (Sampath, ef al., J. 
Biol. Chem. 2§5:13198, 1990). The TGF-^s can influence a variety of 
differentiation processes, including adipogenesis, myogenesis, chondrogenesis, 



WO 94/15949 



PCT/US94/00657 



-2- 

hematopoiesis, and epithelial cell differentiation (for review, see Massague, Cell 
42:437, 1987). 

The proteins of the TGF-£ family are initially synthesized as a large precursor 
protein which subsequently undergoes proteolytic cleavage at a cluster of basic 

5 residues approximately 110-140 amino acids from the C-terminus. The C- 
terminal regions of the proteins are all structurally related and the different 
family members can be classified into distinct subgroups based on the extent 
of their homology. Although the homologies within particular subgroups range 
from 70% to 90% amino acid sequence identity, the homologies between 

10 subgroups are significantly lower, generally ranging from only 20% to 50%. In 
each case, the active species appears to be a disulfide-linked dimer of C- 
terminal fragments. For most of the family members that have been studied, 
the homodimeric species has been found to be biologically active, but for other 
family members, like the inhibins (Ung, et a/., Nature 321:779, 1986) and the 

15 TGF-£s (Cheifetz, ef a/., Cell, 43:409, 1987), heterodimers have also been 
detected, and these appear to have different biological properties than the 
respective homodimers. 

Identification of new factors that are tissue-specific in their expression pattern 
will provide a greater understanding of that tissue's development and function. 



WO 94/15949 



PCT/US94/00657 



-3- 

SUMMARY OF THE INVENTION 

The present invention provides a cell growth and differentiation factor, GDF-5, 
a polynucleotide sequence which encodes the factor and antibodies which are 
immunoreactive with the factor. This factor appears to relate to various cell 
5 proliferative disorders, especially those involving the uterus, such as endometri- 
osis and uterine tumors, and those involving skeletal tissues. 

Thus, in one embodiment, the invention provides a method for detecting a cell 
proliferative disorder of uterine origin and which is associated with GDF-5. In 
another embodiment, the invention provides a method of treating a cell 
10 proliferative disorder associated with expression of GDF-5. by suppressing or 
enhancing GDF-5 activity. 



WO 94/15949 



PCT/US94/00657 



-4- 

BRIEF DESCRIPTION OF THE DRAWINGS 

FIGURE 1A shows expression of GDF-5 mRNA in adult tissues. 

FIGURE 1B shows expression of GDF-5 mRNA in embryonic tissues. 

FIGURE 2 shows nucleotide and predicted amino acid sequence of GDF-5. 
5 The putative tetrabasic processing sites are denoted by stippled boxes. 

FIGURE 3A shows the alignment of the C-terminal sequences of GDF-5 with 
other members of the IGF-fi family. The conserved cysteine residues are 
shaded. Dashes denote gaps introduced in order to maximize alignment. 

FIGURE 3B shows alignment of GDF-5, GDF-6 and GDF-7 C-terminal amino 
10 acids. 

FIGURE 4 shows amino acid homologies among the different members of the 
TGF-0 superfamily. Numbers represent percent amino acid identities between 
each pair calculated from the first conserved cysteine to the C-terminus. Boxes 
represent homologies among highly-related members within particular 
15 subgroups. 

FIGURE 5 shows shows the expression of GDF-5 in limb mesenchyme of day 
12.5 p.c. mouse embryos. Bright field {FIGURE 5a, 5d) and dark field -(FIGURE 
5b, 5c, 5e, 5f) photomicrographs of transverse (FIGURE 5a-c) and sagittal 
(FIGURE 5d-f) sections, showing views through forelimb and posterior end of 
20 embryo, respectively, after hybridization with ^S-labelled GDF-5 antisense 
strand (FIGURE 5a,b,d,e) or sense strand control (FIGURE 5c, 5f) probes. 
Anterior (A), posterior (P), dorsal (D) and ventral (V) orientations are indicated. 



WO 94/15949 



PCT/US94/00657 



DETAILED DESCRIPTION OF THE INVENTION 

The present invention provides a growth and differentiation factor, GDF-5 and 
a polynucleotide sequence encoding GDF-5. Unlike other members of the 
TGF-£ superfamily, GDF-5 expression is highly tissue specific, being expressed 

5 in cells primarily in uterine tissue and skeletal tissue. In one embodiment, the 
invention provides a method for detection of a cell proliferative disorder of the 
uterus or skeletal tissue such as bone or cartilage, which is associated with 
GDF-5 expression. In another embodiment, the invention provides a method 
for treating a cell proliferative disorder associated with expression of GDF-5 by 

10 using an agent which suppresses or enhances GDF-5 activity. 

The TGF-£ superfamily consists of multifunctionally polypeptides that control 
proliferation, differentiation, and other functions in many cell types. Many of the 
peptides have regulatory effects, both positive and negative, on other peptide 
growth factors. The structural homology between the GDF-5 protein of this 
15 invention and the members of the TGF-0 family, indicates that GDF-5 is a new 
member of the family of growth and differentiation factors. Based on the 
known activities of many of the other members, it can be expected that GDF-5 
will also possess biological activities that will make it useful as a diagnostic and 
therapeutic reagent. 

20 The expression of GDF-5 in the uterus suggests a variety of applications using 
the polypeptide, polynucleotide, and antibodies of the invention, related to 
contraception, fertility, pregnancy, and cell proliferative diseases. Abnormally 
low levels of the factor may be indicative of impaired function in the uterus 
while abnormally high levels may be indicative of hypertrophy, hyperplasia, or 

25 the presence of ectopic tissue. Hence, GDF-5 may be useful in detecting not 
only primary and metastatic neoplasms of uterine origin but in detecting 



WO 94/15949 



PCT/US94/00657 



-6- 

diseases such as endometriosis as well. In addition, GDF-5 may also be useful 
as an indicator of developmental anomalies in prenatal screening procedures. 

The expression of GDF-5 during embryogenesis and specifically in the 
precartiiaginous mesenchyme associated with early bone formation in the 
5 limbs, suggests a variety of applications using the polypeptide, polynucleotide, 
and antibodies of the invention, related to skeletal development, cartilage 
differentiation, and cell proliferative diseases. Abnormally low or high levels of 
GDF-5 may be indicative of various bone dysplasias such as epiphyseal, 
physeal (growth plate), metaphyseal and diaphyseal hypo- and hyperplasias. 

10 Examples of such diseases which may be diagnosed and/or treated rising 
GDF-5 polynucleotides and antibodies include: spondyloepithyseal dysplasia, 
dysplasia epiphysitis hemimelica, achondroplasia, metaphyseal dysostosis, 
hyperchondroplasia, enchondromatosis, hypophosphatasia, osteopetrosis, 
craniometaphyseal dysplasia, osteogenesis imperfecta, idiopathic osteoporosis, 

15 Engelman's disease and hyperphosphatasia (See Harrison's Principles of 
Internal Medicine, McGraw-Hill Book Co., N.Y., 1987, Chpt. 339). 

Several members of the TGF-£ superfamily possess activities suggesting 
possible applications for the treatment of cell proliferative disorders, such as 
cancer. In particular, TGF-0 has been shown to be potent growth inhibitor for 

20 a variety of cell types (Massague, Cell 49:437, 1987), MIS has been shown to 
inhibit the growth of human endometrial carcinoma tumors in nude mice 
(Donahoe, et aL, Ann. Surg. 194*472, 1981), and inhibin a has been shown to 
suppress the development of tumors both in the ovary and in the testis 
(Matzuk, et aL, Nature, 3SQ'313, 1992). GDF-5 may have a similar activity and 

25 may therefore be useful as an antiproliferative agent, such as for the treatment 
of endometrial cancer or endometriosis. 



WO 94/15949 



PCT/US94/00657 



-7- 

Many of the members of the TGF-p family are also important mediators of 
tissue repair. TGF-0 has been shown to have marked effects on the formation 
of collagen and causes of striking angiogenic response in the newborn mouse 
(Roberts, ef ai, Proc. Natl. Acad. Sci., USA 23:4167, 1986). The BMP's can 

5 induce new bone growth and are effective for the treatment of fractures and 
other skeletal defects (Glowacki, ef ai., Lancet, 1:959, 1981; Ferguson, et al., 
Clin. Orthoped. Relat Res., 227:265, 1988; Johnson, ef a/., Clin Orthoped. 
Relat. Res., 222:257. 1988). Sequence homology and expression data 
together suggest that GDF-5 may have similar activities and may be useful in 

10 repair of tissue injury caused by trauma or burns for example. 

GDF-5 may play a role in regulation of the menstrual cycle or regulation of 
uterine function during pregnancy, and therefore, GDF-5. anti-GDF-5 antibodies, 
or antisense polynucleotides may be useful either in contraceptive regimens, 
in enhancing the success of in vitro fertilization procedures, or in preventing 
15 premature labor. 

The term "substantially pure" as used herein refers to GDF-5 which is 
substantially free of other proteins, lipids, carbohydrates or other materials with 
which it is naturally associated. One skilled in the art can purify GDF-5 using 
standard techniques for protein purification. The substantially pure polypeptide 
20 will yield a single major band on a non-reducing polyacrylamide gel. The purity 
of the GDF-5 polypeptide can also be determined by amino-terminal amino 
acid sequence analysis. GDF-5 polypeptide includes functional fragments of 
the polypeptide, as long as the activity of GDF-5 remains. Smaller peptides 
containing the biological activity of GDF-5 are included in the invention. 

25 The invention provides polynucleotides encoding the GDF-5 protein. These 
polynucleotides include DNA, cDNA and RNA sequences which encode GDF-5. 
It is understood that all polynucleotides encoding all or a portion of GDF-5 are 



WO 94/15949 



PCT/US94/00657 



also included herein, as long as they encode a polypeptide with GDF-5 activity. 
Such polynucleotides include naturally occurring, synthetic, and intentionally 
manipulated polynucleotides. For example, GDF-5 polynucleotide may be 
subjected to site-directed mutagenesis. The polynucleotide sequence for GDF- 

5 5 also includes antisense sequences. The polynucleotides of the invention 
include sequences that are degenerate as a result of the genetic code. There 
are 20 natural amino acids, most of which are specified by more than one 
codon. Therefore, all degenerate nucleotide sequences are included in the 
invention as long as the amino acid sequence of GDF-5 polypeptide encoded 

10 by the nucleotide sequence is functionally unchanged. 

Specifically disclosed herein is a cDNA sequence for GDF-5 which is 2329 base 
pairs in length and contains an open reading frame beginning with a 
methionine codon at nucleotide 322. The encoded polypeptide is 495 amino 
acids in length with a molecular weight of about 54.9 K, as determined by 

15 nucleotide sequence analysis. The GDF-5 sequence contains a core of 
hydrophobic amino acids near the N-terminus. suggestive of a signal sequence 
for secretion. GDF-5 contains one potential N-glycosylation sites at amino acid 
183 and two putative tetrabasic proteolytic processing sites RRKRR and KR-at 
amino acids 371-375 and amino acids 384-385. Cleavage of the precursor at 

20 these sites would generate mature C-terminal fragments of 120 or 110 amino 
acids in length with predicted molecular weights of 13.6K and 12.5K, 
respectively. 

GDF-5 contains all of the highly conserved residues present in other family 
members, including the seven cysteine residues with their characteristic 
25 spacing. Among the known family members, GDF-5 is most highly related to 
BMP-2 and BMP-4 in the C-terminal portion of the molecule (57% amino acid 
sequence Identity calculated from the first conserved cysteine). 



WO 94/15949 



PCT/US94/00657 



-9- 

Minor modifications of the recombinant GDF-5 primary amino acid sequence 
may result in proteins which have substantially equivalent activity as compared 
to the GDF-5 polypeptide described herein. Such modifications may be 
deliberate, as by site-directed mutagenesis, or may be spontaneous. All of the 
5 polypeptides produced by these modifications are included herein as long as 
the biological activity of GDF-5 still exists. Further, deletion of one or more 
amino acids can also result in a modification of the structure of the resultant 
molecule without significantly altering its biological activity. This can lead to the 
development of a smaller active molecule which would have broader utility. For 
10 example, one can remove amino or carboxy terminal amino acids which are 
not required for GDF-5 biological activity. 

The nucleotide sequence encoding the GDF-5 polypeptide of the invention 
includes the disclosed sequence and conservative variations thereof. The term 
"conservative variation" as used herein denotes the replacement of an amino 
acid residue by another, biologically similar residue. Examples of conservative 
variations include the substitution of one hydrophobic residue such as 
isoleucine, valine, leucine or methionine for another, or the substitution of one 
polar residue for another, such as the substitution of arginine for lysine, 
glutamic for aspartic acids, or glutamine for asparagine, and the like. The term 
"conservative variation" also includes the use of a substituted amino acid in 
place of an unsubstituted parent amino acid provided that antibodies raised to 
the substituted polypeptide also immunoreact with the unsubstituted polypep- 
tide. 

DNA sequences of the invention can be obtained by several methods. For 
25 example, the DNA can be isolated using hybridization techniques which are 
well known in the art. These include, but are not limited to: 1) hybridization of 
genomic or cDNA libraries with probes to detect homologous nucleotide 



15 



20 



WO 94/15949 



PCT/US94/00S57 



-10- 

sequences and 2) antibody screening of expression libraries to detect cloned 
DNA fragments with shared structural features. 

Preferably the GDF-5 polynucleotide of the invention is derived from a 
mammalian organism, and most preferably from a mouse, rat, or human. 

5 Screening procedures which rely on nucleic acid hybridization make it possible 
to isolate any gene sequence from any organism, provided the appropriate 
probe is available. Oligonucleotide probes, which correspond to a part of the 
sequence encoding the protein in question, can be synthesized chemically. 
This requires that short, oligopeptide stretches of amino acid sequence must 

10 be known. The DNA sequence encoding the protein can be deduced from the 
genetic code, however, the degeneracy of the code must be taken into 
account. It is possible to perform a mixed addition reaction when the 
sequence is degenerate. This includes a heterogeneous mixture of denatured 
double-stranded DNA. For such screening, hybridization is preferably 

15 performed on either single-stranded DNA or denatured double-stranded DNA. 
Hybridization is particularly useful in the detection of cDNA clones derived from 
sources where an extremely low amount of mRNA sequences relating to the 
polypeptide of interest are present. In other words, by using stringent 
hybridization conditions directed to avoid non-specific binding, it is possible, 

20 for example, to allow the autoradiographic visualization of a specific cDNA 
clone by the hybridization of the target DNA to that single probe in the mixture 
which is its complete complement (Wallace, et al., NucL Acid Res., 9:879, 
1981). 

The development of specific DNA sequences encoding GDF-5 can also be 
25 obtained by: 1 ) isolation of double-stranded DNA sequences from the genomic 
DNA; 2) chemical manufacture of a DNA sequence to provide the necessary 
codons for the polypeptide of interest; and 3) in vitro synthesis of a double- 
stranded DNA sequence by reverse transcription of mRNA isolated from a 



WO 94/15949 



PCT/US94/00657 



-11- 

eukaryotic donor cell. In the latter case, a double-stranded DNA complement 
of mRNA is eventually formed which is generally referred to as cDNA. 

Of the three above-noted methods for developing specific DNA sequences for 
use in recombinant procedures, the isolation of genomic DNA isolates is the 
5 least common. This is especially true when it is desirable to obtain the 
microbial expression of mammalian polypeptides due to the presence of 
introns. 

The synthesis of DNA sequences is frequently the method of choice when the 
entire sequence of amino acid residues of the desired polypeptide product is 

10 known. When the entire sequence of amino acid residues of the desired 
polypeptide is not known, the direct synthesis of DNA sequences is not 
possible and the method of choice is the synthesis of cDNA sequences. 
Among the standard procedures for isolating cDNA sequences of interest is the 
formation of plasmid- or phage-carrying cDNA libraries which are derived from 

15 reverse transcription of mRNA which is abundant in donor cells that have a 
high level of genetic expression. When used in combination with polymerase 
chain reaction technology, even rare expression products can be cloned. In 
those cases where significant portions of the amino acid sequence of the 
polypeptide are known, the production of labeled single or double-stranded 

20 DNA or RNA probe sequences duplicating a sequence putatively present in the 
target cDNA may be employed in DNA/DNA hybridization procedures which are 
carried out on cloned copies of the cDNA which have been denatured into a 
single-stranded form (Jay et a/., NucL Acid Res. 11:2325, 1983). 

A cDNA expression library, such as lambda gt11, can be screened indirectly 
25 for GDF-5 peptides having at least one epitope, using antibodies specific for 
GDF-5. Such antibodies can be either polyclonally or monoclonally derived 



WO 94/15949 



PCT/US94/00657 



-12- 

and used to detect expression product indicative of the presence of GDF-5 
cDNA. 

DNA sequences encoding GDF-5 can be expressed in vitro by DNA transfer 
into a suitable host cell. "Host cells" are cells in which a vector can be 

5 propagated and its DNA expressed. The term also includes any progeny of 
the subject host cell. It is understood that all progeny may not be identical to 
the parental cell since there may be mutations that occur during replication. 
However, such progeny are included when the term "host cell" is used. 
Methods of stable transfer, meaning that the foreign DNA is continuously 

10 maintained in the host, are known in the art. 

In the present invention, the GDF-5 polynucleotide sequences may be inserted 
into a recombinant expression vector. The term "recombinant expression 
vector 41 refers to a plasmid, virus or other vehicle known in the art that has 
been manipulated by insertion or incorporation of the GDF-5 genetic sequenc- 

1 5 es. Such expression vectors contain a promoter sequence which facilitates the 
efficient transcription of the inserted genetic sequence of the host. The 
expression vector typically contains an origin of replication, a promoter, as well 
as specific genes which allow phenotypic selection of the transformed cells. 
Vectors suitable for use in the present invention include, but are not limited to 

20 the T7-based expression vector for expression in bacteria (Rosenberg et al., 
Gene 56:125, 1987), the pMSXND expression vector for expression in 
mammalian cells (Lee and Nathans, J. Biol. Chem. 263:3521, 1988) and 
baculovirus-derived vectors for expression in insect cells. The DNA segment 
can be present in the vector operably linked to regulatory elements, for 

25 example, a promoter (e.g., T7, metallothionein I, or polyhedrin promoters). 



WO 94/15949 



PCT/US94/00657 



Polynucleotide sequences encoding GDF-5 can be expressed in either 
prokaryotes or eukaryotes. Hosts can include microbial, yeast, insect and 
mammalian organisms. Methods of expressing DNA sequences having 
eukaryotic or viral sequences in prokaryotes are well known in the art. 
5 Biologically functional viral and plasmid DNA vectors capable of expression and 
replication in a host are known in the art. Such vectors are used to incorp- 
orate DNA sequences of the invention. 

Transformation of a host cell with recombinant DNA may be carried out by 
conventional techniques as are well known to those skilled in the art. Where 
10 the host is prokaryotic, such as E coli, competent cells which are capable of 
DNA uptake can be prepared from cells harvested after exponential growth 
phase and subsequently treated by the CaCI 2 method using procedures well 
known in the art. Alternatively, MgCL, or RbCI can be used. Transformation 
can also be performed after forming a protoplast of the host cell if desired. 

1 5 When the host is a eukaryote, such methods of transfection of DNA as calcium 
phosphate co-precipitates, conventional mechanical procedures such as 
microinjection, electroporation, insertion of a plasmid encased in liposomes, or 
virus vectors may be used. Eukaryotic cells can also be cotransformed with 
DNA sequences encoding the GDF-5 of the invention, and a second foreign 

20 DNA molecule encoding a selectable phenotype, such as the herpes simplex 
thymidine kinase gene. Another method is to use a eukaryotic viral vector, 
such as simian virus 40 (SV40) or bovine papilloma virus, to transiently infect 
or transform eukaryotic cells and express the protein, (see for example, 
Eukaryotic Viral Vectors, Cold Spring Harbor Laboratory, Gluzman ed M 1982). 



WO 94/15949 



PCT/US94/00657 



Isolation and purification of microbial expressed polypeptide, or fragments 
thereof, provided by the invention, may be carried out by conventional means 
including preparative chromatography and immunological separations involving 
monoclonal or polyclonal antibodies. 

5 The invention includes antibodies immunoreactive with GDF-5 polypeptide or 
functional fragments thereof. Antibody which consists essentially of pooled 
monoclonal antibodies with different epitopic specificities, as well as distinct 
monoclonal antibody preparations are provided. Monoclonal antibodies are 
made from antigen containing fragments of the protein by methods well known 

10 to those skilled in the art (Kohler, et al. t Nature, 256:495, 1975). The term 
antibody as used in this invention is meant to include intact molecules as well 
as fragments thereof, such as Fab and F(ab') 2 , which are capable of binding 
an epitopic determinant on GDF-5. 

The term "cell-proliferative disorder 1 ' denotes malignant as well as non-malignant 
15 cell populations which often appear to differ from the surrounding tissue both 
morphologically and genotypically. The GDF-5 polynucleotide that is an 
antisense molecule is useful in treating cell proliferative disorders of the various 
organ systems, particularly, for example, the uterus or skeletal system. Cell 
proliferative disorders of the skeletal system include those disorders of bone 
20 cells and cartilage as described above. Essentially, any disorder involving cells 
that are normally responsive to GDF-5 could be considered susceptible to 
treatment with a GDF-5 suppressing reagent. 

The invention provides a method for detecting a cell proliferative disorder of the 
uterus or skeletal system (e.g., bone, cartilage) which comprises contacting an 
25 anti-GDF-5 antibody with a cell suspected of having a GDF-5 associated 
disorder and detecting binding to the antibody. The antibody reactive with 
GDF-5 is labeled with a compound which allows detection of binding to GDF-5. 



WO 94/15949 



PCT/US94/006S7 



-15- 

For purposes of the invention, an antibody specific for GDF-5 polypeptide may 
be used to detect the level of GDF-5 in biological fluids and tissues. Any 
specimen containing a detectable amount of antigen can be used. A preferred 
sample of this invention is tissue of uterine origin, specifically endometrial tissue 
5 or skeletal tissue such as bone and cartilage. The level of GDF-5 in the 
suspect cell can be compared with the level in a normal cell to determine 
whether the subject has a GDF-5-associated cell proliferative disorder. 
Preferably the subject is human. 

The antibodies of the invention can be used in any subject in which it is 
10 desirable to administer in vitro or in vivo immunodiagnosis or immunotherapy. 
The antibodies of the invention are suited for use, for example, in immuno- 
assays in which they can be utilized in liquid phase or bound to a solid phase 
carrier. In addition, the antibodies in these immunoassays can be detectably 
labeled in various ways. Examples of types of immunoassays which can utilize 
1 5 antibodies of the invention are competitive and non-competitive immunoassays 
in either a direct or indirect format. Examples of such immunoassays are the 
radioimmunoassay (RIA) and the sandwich (immunometric) assay. Detection 
of the antigens using the antibodies of the invention can be done utilizing 
immunoassays which are run in either the forward, reverse, or simultaneous 
20 modes, including immunohistochemical assays on physiological samples. 
Those of skill in the art will know, or can readily discern, other immunoassay 
formats without undue experimentation. 

The antibodies of the invention can be bound to many different carriers and 
used to detect the presence of an antigen comprising the polypeptide of the 
25 invention. Examples of well-known carriers include glass, polystyrene, 
polypropylene, polyethylene, dextran, nylon, amylases, natural and modified 
celluloses, polyacrylamides, agaroses and magnetite. The nature of the carrier 
can be either soluble or insoluble for purposes of the invention. Those skilled 



WO 94/15949 



PCT/US94/00657 



-16- 

in the art will know of other suitable carriers for binding antibodies, or will be 
able to ascertain such, using routine experimentation. 

There are many different labels and methods of labeling known to those of 
ordinary skill in the art. Examples of the types of labels which can be used in 
5 the present invention include enzymes, radioisotopes, fluorescent compounds, 
colloidal metals, chemiluminescent compounds, phosphorescent compounds, 
and bioluminescent compounds. Those of ordinary skill in the art will know of 
other suitable labels for binding to the antibody, or will be able to ascertain 
such, using routine experimentation. 

10 Another technique which may also result in greater sensitivity consists of 
coupling the antibodies to low molecular weight haptens. These haptens can 
then be specifically detected by means of a second reaction. For example, it 
is common to use such haptens as biotin, which reacts with avidin, or 
dinitrophenyl, puridoxal, and fluorescein, which can react with specific anti- 

15 hapten antibodies. 

In using the monoclonal antibodies of the invention for the in vivo detection of 
antigen, the detectably labeled antibody is given a dose which is diagnostically 
effective. The term "diagnostically effective" means that the amount of 
detectably labeled monoclonal antibody is administered in sufficient quantity to 
20 enable detection of the site having the antigen comprising a polypeptide of the 
invention for which the monoclonal antibodies are specific. 

The concentration of detectably labeled monoclonal antibody which is 
adminstered should be sufficient such that the binding to those cells having the 
polypeptide is detectable compared to the background. Further, it is desirable 
25 that the detectably labeled monoclonal antibody be rapidly cleared from the 
circulatory system in order to give the best target-to-background signal ratio. 



WO 94/15949 



PCT/US94/006S7 



As a rule, the dosage of detectably labeled monoclonal antibody for in vivo 
diagnosis will vary depending on such factors as age, sex, and extent of 
disease of the individual. Such dosages may vary, for example, depending on 
whether multiple injections are given, antigenic burden, and other factors 
5 known to those of skill in the art. 

For in vivo diagnostic imaging, the type of detection instrument available is a 
major factor in selecting a given radioisotope. The radioisotope chosen must 
have a type of decay which is detectable for a given type of instrument. Still 
another important factor in selecting a radioisotope for in vivo diagnosis is that 
10 deleterious radiation with respect to the host is minimized. Ideally, a radio- 
isotope used for in vivo imaging will lack a particle emission, but produce a 
large number of photons in the 140-250 keV range, which may readily be 
detected by conventional gamma cameras. 

For in vivo diagnosis radioisotopes may be bound to immunoglobulin either 
15 directly or indirectly by using an intermediate functional group. Intermediate 
functional groups which often are used to bind radioisotopes which exist as 
metallic ions to immunoglobulins are the Afunctional chelating agents such as 
diethylenetriaminepentacetic acid (DTPA) and ethylenediaminetetraacetic acid 
(EDTA) and similar molecules. Typical examples of metallic ions which can be 
20 bound to the monoclonal antibodies of the invention are 111 In, 97 Ru, 67 Ga, ^Ga, 
^As,. 89 *, and ^Tl. 

The monoclonal antibodies of the invention can also be labeled with a 
paramagnetic isotope for purposes of in vivo diagnosis, as in magnetic 
resonance imaging (MRI) or electron spin resonance (ESR). In general, any 
25 conventional method for visualizing diagnostic imaging can be utilized. Usually 
gamma and positron emitting radioisotopes are used for camera imaging and 



WO 94/15949 



PCT7US94/00657 



-18- 

paramagnetic isotopes for MRI. Elements which are particularly useful in such 
techniques include 157 Gd, K Mn, 162 Dy. ^Cr, and ^Fe. 

The monoclonal antibodies of the invention can be used in vitro and in vivo to 
monitor the course of amelioration of a GDF-5-associated disease in a subject. 

5 Thus, for example, by measuring the increase or decrease in the number of 
cells expressing antigen comprising a polypeptide of the invention or changes 
in the concentration of such antigen present in various body fluids and tissues, 
it would be possible to determine whether a particular therapeutic regimen 
aimed at ameliorating the GDF-5-associated disease is effective. The term 

10 "ameliorate" denotes a lessening of the detrimental effect of the GDF-5- 
associated disease in the subject receiving therapy. 

The present invention identifies a nucleotide sequence that can be expressed 
in an altered manner as compared to expression in a normal cell, therefore it 
is possible to design appropriate therapeutic or diagnostic techniques directed 

15 to this sequence. Thus, where a cell-proliferative disorder is associated with 
the expression of GDF-5, nucleic acid sequences that interfere with GDF-5 
expression at the translational level can be used. This approach utilizes, for 
example, antisense nucleic acid and ribozymes to block translation of a specific 
GDF-5 mRNA, either by masking that mRNA with an antisense nucleic acid or 

20 by cleaving it with a ribozyme. 

Antisense nucleic acids are DNA or RNA molecules that are complementary to 
at least a portion of a specific mRNA molecule (Weintraub, Scientific American, 
2gg:40, 1990). In the cell, the antisense nucleic acids hybridize to the 
corresponding mRNA, forming a double-stranded molecule. The antisense 
25 nucleic acids interfere with the translation of the mRNA, since the cell will not 
translate a mRNA that is double-stranded. Antisense oligomers of about 15 
nucleotides are preferred, since they are easily synthesized and are less likely 



WO 94/15949 



PCT/US94/00657 



-19- 

to cause problems than larger molecules when introduced into the target GDF- 
5-producing cell. The use of antisense methods to inhibit the in vitro 
translation of genes is well known in the art (Marcus-Sakura, Anal.Biochem., 
172:289. 1988). 

5 Ribozymes are RNA molecules possessing the ability to specifically cleave 
other single-stranded RNA in a manner analogous to DNA restriction 
endonudeases. Through the modification of nucleotide sequences which 
encode these RNAs, it is possible to engineer molecules that recognize specific 
nucleotide sequences in an RNA molecule and cleave it (Cech, JAmer.Med. 

10 Assn., 2fiQ:3030, 1988). A major advantage of this approach is that, because 
they are sequence-specific, only mRNAs with particular sequences are 
inactivated. 

There are two basic types of ribozymes namely, tetrahymena-type (Hasselhoff, 
Nature, 224:585, 1988) and "hammerhead"-type. Tetra/jymena-type ribozymes 
recognize sequences which are four bases in length, while "hammerhead"-type 
ribozymes recognize base sequences 11-18 bases in length. The longer the 
recognition sequence, the greater the likelihood that the sequence will occur 
exclusively in the target mRNA species. Consequently, hammerhead-type 
ribozymes are preferable to tetrahymena-type ribozymes for inactivating a 
specific mRNA species and 18-based recognition sequences are preferable to 
shorter recognition sequences. 

The present invention also provides gene therapy for the treatment of cell 
proliferative disorders which are mediated by GDF-5 protein. Such therapy 
would achieve its therapeutic effect by introduction of the GDF-5 antisense 
25 polynucleotide into cells having the proliferative disorder. Delivery of antisense 
GDF-5 polynucleotide can be achieved using a recombinant expression vector 
such as a chimeric virus or a colloidal dispersion system. Especially preferred 



15 



20 



WO 94/15949 



PCT7US94/006S7 



-20- 

for therapeutic delivery of antisense sequences is the use of targeted 
liposomes. 

Various viral vectors which can be utilized for gene therapy as taught herein 
include adenovirus, herpes virus, vaccinia, or. preferably, an RNA virus such 

5 as a retrovirus. Preferably, the retroviral vector is a derivative of a murine or 
avian retrovirus. Examples of retroviral vectors in which a single foreign gene 
can be inserted include, but are not limited to: Moloney murine leukemia virus 
(MoMuLV), Harvey murine sarcoma virus (HaMuSV), murine mammary tumor 
virus (MuMTV), and Rous Sarcoma Virus (RSV). A number of additional 

10 retroviral vectors can incorporate multiple genes. All of these vectors can 
transfer or incorporate a gene for a selectable marker so that transduced cells 
can be identified and generated. By inserting a GDF-5 sequence of interest 
into the viral vector, along with another gene which encodes the ligand for a 
receptor on a specific target cell, for example, the vector is now target specific. 

15 Retroviral vectors can be made target specific by inserting, for example, a 
polynucleotide encoding a sugar, a glycolipid, or a protein. Preferred targeting 
is accomplished by using an antibody to target the retroviral vector. Those of 
skill in the art will know of, or can readily ascertain without undue experimenta- 
tion, specific polynucleotide sequences which can be inserted into the retroviral 

20 genome to allow target specific delivery of the retroviral vector containing the 
GDF-5 antisense polynucleotide. 

Since recombinant retroviruses are defective, they require assistance in order 
to produce infectious vector particles. This assistance can be provided, for 
example, by using helper cell lines that contain plasmids encoding all of the 
25 structural genes of the retrovirus under the control of regulatory sequences 
within the LTR. These plasmids are missing a nucleotide sequence which 
enables the packaging mechanism to recognize an RNA transcript for 
encapsidation. Helper cell lines which have deletions of the packaging signal 



WO 94/15949 PCT/US94/00657 



-21- 

include, but are not limited to *2. PA317 and PA12. for example. These cell 
lines produce empty virions, since no genome is packaged. If a retroviral 
vector is introduced into such cells in which the packaging signal is intact, but 
the structural genes are replaced by other genes of interest, the vector can be 
5 packaged and vector virion produced. 

Alternatively, NIH 3T3 or other tissue culture cells can be directly transfected 
with plasmids encoding the retroviral structural genes gag, pol and env, by 
conventional calcium phosphate transfection. These cells are then transfected 
with the vector plasmid containing the genes of interest. The resulting cells 
10 release the retroviral vector into the culture medium. 

Another targeted delivery system for GDF-5 antisense polynucleotides is a 
colloidal dispersion system. Colloidal dispersion systems include macromole- 
cule complexes, nanocapsules, microspheres, beads, and lipid-based systems 
including oil-in-water emulsions, micelles, mixed micelles, and liposomes. The 

15 preferred colloidal system of this invention is a liposome. Liposomes are 
artificial membrane vesicles which are useful as delivery vehicles in vitro and 
in vivo. It has been shown that large unilamellar vesicles (LUV), which range 
in size from 0.2-4.0 can encapsulate a substantial percentage of an 
aqueous buffer containing large macromoiecuies. RNA, DNA and intact virions 

20 can be encapsulated within the aqueous interior and be delivered to cells in a 
biologically active form (Fraley, ef a/., Trends Biochem. Sc/., 6:77, 1981). In 
addition to mammalian cells, liposomes have been used for delivery of 
polynucleotides in plant, yeast and bacterial cells. In order for a liposome to 
be an efficient gene transfer vehicle, the following characteristics should be 

25 present: (1) encapsulation of the genes of interest at high efficiency while not 
compromising their biological activity; (2) preferential and substantial binding 
to a target cell in comparison to non-target cells; (3) delivery of the aqueous 
contents of the vesicle to the target cell cytoplasm at high efficiency; and <4) 



WO 94/15949 



PCT/US94/00657 



-22- 

accurate and effective expression of genetic information (Mannino, et a/., 
Biotechniques, g:682, 1988). 

The composition of the liposome is usually a combination of phospholipids, 
particularly high-phase-transition-temperature phospholipids, usually in 
5 combination with steroids, especially cholesterol. Other phospholipids or other 
lipids may also be used. The physical characteristics of liposomes depend on 
pH, ionic strength, and the presence of divalent cations. 

Examples of lipids useful in liposome production include phosphatidyl 
compounds, such as phosphatidylglycerol, phosphatidylcholine, phos- 
10 phatidylserine, phosphatidylethanolamine, sphingolipids, cerebrosides, and 
gangliosides. Particularly useful are diacylphosphatidylglycerols, where the lipid 
moiety contains from 14-18 carbon atoms, particularly from 16-18 carbon 
atoms, and is saturated. Illustrative phospholipids include egg phosphatidyl- 
choline, dipalmitoylphosphatidylcholine and distearoylphosphatidylcholine. 

15 The targeting of liposomes can be classified based on anatomical and 
mechanistic factors. Anatomical classification is based on the level of 
selectivity, for example, organ-specific, cell-specific, and organelle-specific. 
Mechanistic targeting can be distinguished based upon whether it is passive 
or active. Passive targeting utilizes the natural tendency of liposomes to 

20 distribute to cells of the reticuloendothelial system (RES) in organs which 
contain sinusoidal capillaries. Active targeting, on the other hand, involves 
alteration of the liposome by coupling the liposome to a specific ligand such 
as a monoclonal antibody, sugar, glycolipid, or protein, or by changing the 
composition or size of the liposome in order to achieve targeting to organs and 

25 cell types other than the naturally occurring sites of localization. 



WO 94/15949 



PCT/US94/006S7 



-23- 



The surface of the targeted delivery system may be modified in a variety of 
ways. In the case of a liposomal targeted delivery system, lipid groups can be 
incorporated into the lipid bilayer of the liposome in order to maintain the 
targeting ligand in stable association with the liposomal bilayer. Various linking 
5 groups can be used for joining the lipid chains to the targeting ligand. 

The following examples are intended to illustrate but not limit the invention. 
While they are typical of those that might be used, other procedures known to 
those skilled in the art may alternatively be used. 



EXAMPLE 1 

10 IDENTIFICATION AND ISOLATION OF A NOVEL 

TGF-fl FAMILY MEMBER 



To identify a new member of the TGF-0 superfamily, degenerate oligonucleoti- 
des were designed which corresponded to two conserved regions among the 
known family members: one region spanning the two tryptophan residues 

15 conserved in all family members except MIS and the other region spanning the 
invariant cysteine residues near the C-terminus. These primers were used for 
polymerase chain reactions on mouse genomic DNA followed by subcloning 
the PCR products using restriction sites placed at the 5' ends of the primers, 
picking individual £. coli colonies carrying these subcloned inserts, and using 

20 a combination of random sequencing and hybridization analysis to eliminate 
known members of the superfamily. 

GDF-5 was identified by polymerase chain reaction (PCR) using mouse 
genomic DNA with the following primers: 
SJL136:5XCGGMTTCGG(G/AAVC)T^^ 
25 (G/AfT/C)(G/A)T-3' (SEQUENCE ID NO. 1) 



WO 94/15949 



PCTAJS94/006S7 



-24- 

SJL121:5'-CCGGAATTC(G/A)CAICC(G/A)CA(T/C)TC(G/A)TCIACIACCAT{G/A) 
TC(T/C)TC(G/A)TA-3' (SEQUENCE ID NO. 2) 

SJL 136 corresponds to the amino acid sequence GWE(R/S)W(V/I/M)(V/I/M), 
(SEQUENCE ID NO. 3) and the complement of SJL 121 corresponds to the 
5 amino acid sequence YEDMWDECGC (SEQUENCE ID NO. 4). Both 
oligonucleotide sets were designed to contain an EcoRI restriction site at the 
5'end to facillitate subcloning. PCR was carried out for 40 cycles at 94'C for 
1\ 50 °C for 2' and 72 °C for 3.5". 

Human GDF-5 was isolated by PCR using human genomic DNA with the 

10 following primers: 

SJL 141: 5 , -CCGGAATTCGGITGG(G/C/A)A(G/A/T/C)(A/G)A(T/C)TGG(A/G) 

TI(A/G)TI(T/G)CICC-3 , (SEQUENCE ID NO. 5) 
SJL145:5 , -CCGGAATTC(G/A)CAI(G/C)C(G/A)CAIG(C/A)(G/A/T/C)TCIACI(G/A) 

(T/C)CAT-3' (SEQUENCE ID NO. 6) 

1 5 SSJL 1 41 corresponds to the amino acid sequence GW(H/Q/N/K/D/E)(D/N)W- 
(V/I/M)(V/I/M)(A/S)P (SEQUENCE ID NO. 7) and the complement of SJL 145 
corresponds to the amino acid sequence M(V/I/!WT/A)V(D/E)(A/S)C(G/A)C 
(SEQUENCE ID NO. 8). Both the oligonucleotide sets were designed to 
contain an EcoRI restriction site at the 5" end.to facilitate subcloning. PCR was 

20 carried out for 40 cycles at 94°C for 1 min., 50° C for 2 min.. and 72° C for 2 
min. Partial sequence analysis of the human PCR product revealed no 
predicted amino acid differences between mouse and human GDF-5. 

PCR products of approximately 280 bp were gel-purified, digested with Eco Rl, 
gel-purified again, and subcloned in the Bluescript vector (Stratagene, San 
25 Diego, CA). Bacterial colonies carrying individual subclones were picked into 
96 well microtiter plates, and multiple replicas were prepared by plating the 
cells onto nitrocellulose. The replicate filters were hybridized to probes 



WO 94/15949 



PCT/US94/00657 



-25- 

representing known members of the family, and DNA was prepared from non- 
hybridizing colonies for sequence analysis. 

RNA isolation and Northern analysis were carried out as described previously 
(Lee.S.J., Mol. Endocrinol. 4:1034, 1990). An oligo dT-primed cDNA library 

5 was prepared from 2.5-3 M g of 12.5 day gestation CD-1 mouse embryo poly 
A-selected RNA in the lambda ZAP II vector according to the instructions 
provided by Stratagene. The library was amplified prior to screening. Filters 
were hybridized as described previously (Lee, S.-J., Proc. Natl. Acad. Sci. 
USA., fiS:4250-4254, 1991). DNA sequencing of both strands was carried out 

10 using the dideoxy chain termination method (Sanger, ef ai, Proc. Natl. Acad. 
Sci., USA 74:5463-5467, 1977) and a combination of the S1 nuclease- 
/exonuclease III strategy (Henikoff, S., Gene, 28:351-359. 1984) and synthetic 
oligonucleotide primers. 

EXAMPLE 2 

FVPRESSION PATTERN AND SE QUENCE OF GDF-5 

To determine the expression pattern of GDF-5. RNA samples prepared from 
a variety of adult tissues were screened by Northern analysis. RNA isolation 
and Northern analysis were carried out as described previously (Lee, S.J., Mol. 
Endocrinol., 4:1034, 1990). Five micrograms of twice polyA-setected RNA 
prepared from each tissue were electrophoresed on formaldehyde gels, blotted 
and probed with GDF-5. As shown in Figure 1A, the GDF-5 probe detected 
an approximately 2.5 kb mRNA expressed primarily in the uterus and at lower 
levels in other adult tissues in the mouse, including placenta, brain, thymus, 
lung, kidney, and adrenal gland. The GDF-5 probe also detected a larger 
mRNA in the oviduct. High levels of GDF-5 transcripts were also detected in 
mouse embryos, particularly at day 12.5 of gestation (FIGURE 1B). 



20 



25 



WO 94/15949 



PCT/US94/00657 



-26- 



A CD-1 day 12.5 whole mouse embryo cDNA library was constructed in 
lambda ZAP II and screened with a probe derived from the GDF-5 PCR 
product. The nucleotide sequence of the longest hybridizing clone is shown 
in Figure 2. The in-frame termination codons upstream of the putative initiating 

5 ATG and the consensus polyadenylation signals are underlined. The poly A 
tails are not shown. Numbers indicate nucleotide position relative to the 5* 
end. The 2329 bp sequence contains a long open reading frame beginning 
with a methionine codon at nucleotide 322 and potentially encoding a protein 
495 amino acids in length with a molecular weight of 54.9 K. Like other TGF-0 

10 family members, the GDF-5 sequence contains a core of hydrophobic amino 
acids near the N-terminus suggestive of a signal sequence for secretion. GDF- 
5 contains a single potential N-glycosylation sites at asparagine residue 183 
(denoted by the plain box) and two putative tetrabasic proteolytic processing 
sites at amino acids 371-375 (denoted by the stippled box) and amino acids 

15 384-385. GDF-5 contains all of the highly conserved residues present in other 
family members (Figures 3 and 4), including the seven cysteine residues with 
their characteristic spacing. Among the known mammalian family members, 
GDF-5 is most highly related to BMP-2 and BMP-4 in the C-terminal portion of 
the molecule (57% amino acid sequence identity calculated from the first 

20 conserved cysteine). 

Although the C-terminal portion of GDF-5 clearly shows homology with the 
other family members, the sequence of GDF-5 is significantly diverged from 
those of the other family members (Figures 3 and 4). Figure 3 shows the 
alignment of the C-terminal sequences of <3DF-5 with the corresponding 
25 regions of human GDF-1 (Lee, Proc. Natl. Acad. Sci. USA 88:4250-4254, 1991), 
human Vgr-1 (Celeste, etal., Proc. Natl. Acad. Sci. USA 87:9843-9847, 1990), 
human OP-1 (Ozkaynak, et a/., EMBO J. 9:2085-2093, 1990), human BMP-5 
(Celeste, etal., Proc. Natl. Acad. ScL USA t 87:9843-9847, 1990), human BMP-3 
(Wozney, et a/., Science, 242:1528-1534, 1988), human MIS {Cafe, et at. Cell, 



WO 94/15949 



PCT/US94/00657 



•27- 

45:685-698, 1986), human inhibin o, £A, and (Mason, et aL, Biochem, 
Biophys. Res. Commun., 135:957-964, 1986), human TGF-/M (Derynck, et aL, 
Nature, 212:701-705, 1985), humanTGF-02 (deMartin, et aL, EMBO J., £.3673- 
3677, 1987), human TGF-^3 (ten Dijke, et aL, Proc. Natl. Acad. ScL USA, 
5 25:4715-4719, 1988), chicken TGF-^4 (Jakowlew, et aL, MoL Endocrinol. 
2:1186-1195, 1988), and Xenopus TGF-^5 (Kondaiah, et aL, J. Biol. Chem. 
225:1089-1093,1990). The conserved cysteine residues are boxed. Dashes 
denote gaps introduced in order to maximize the alignment. 

Figure 4 shows the amino acid homologies among the different members of 
10 the TGF-0 superfamily. Numbers represent percent amino acid identities 
between each pair calculated from the first conserved cysteine to the C- 
terminus. Boxes represent homologies among highly-related members within 
particular subgroups. 

The degree of sequence identify with known family members ranges from a 
15 minimum of 24% with inhibin alpha to a maximum of 57% with BMP-2 and 
BMP-4. GDF-5 shows no significant sequence homology to other family 
members in the pro-region of the molecule. 



EXAMPLE 3 

The results in Example 2 show that during the development of the mouse 
20 embryo, the expression of GDF-5 begins at approximately day 1 0.Spost coitum 
(p.c.) and peaks at day 12.5 p.c., as indicated by the presence of a 2.5 
kilobase (kb) major transcript (FIGURE 1B). Of the adult mouse tissues 
examined, uterus contained the highest level of the 2.5 kb transcript, while low 
levels were detected in placenta (day 10.5 p.c.) t oviduct, brain, thymus, heart, 
25 lung, kidney and adrenal gland (FIGURE 1A). In oviduct tissue, the GDF-5 



WO 94/15949 



PCT/US94/00657 



-28- 

probe also detected a larger transcript of approximately 3.6 kb. GDF-5 
transcripts were also detected by Northern blot analysis in femur and calvaria 
of newborn mice. 

In order to characterize in more detail, the expression of GDF-5 in embryonic 
tissues, ^S-labelled probes synthesized from a portion of the cDNA clone 
encoding the relatively nonconserved prepro-region were hybridized in situ to 
serial sections of day 12.5 p.c. embryos. Day 12.5 p.c. female CD-1 mouse 
embryos were fixed and embedded in paraffin as described {Jones, CM., et 
a/., Development, 111:531-542, 1991). ^S-labelled antisense or sense strand 
RNA probes were synthesized by in vitro transcription from a template 
containing nucleotides 308 through 1446 of the GDF-5 cDNA clone (FIGURE 
2). Eight micron sections were hybridized with antisense or sense strand 
probe at 4 x 10 5 counts per minute/^l essentially as described (Jones, CM., et 
a/., supra) except that the proteinase K and acetic anhydride treatments were 
omitted, washes in 50% formamide, 2 x SSC, 0.1 M DTT were carried out at 
65°C, and the final wash in 0.1 x SSC was carried out at 37°C. Slides were 
developed after a 4-6 week exposure time with Kodak NTB3 emulsion and 
were stained with hematoxylin and eosin. 

FIGURE 5 shows shows the expression of GDF-5 in limb mesenchyme of day 
20 12.5 p.c. mouse embryos. Bright field (FIGURE 5a, 5d) and dark field (FIGURE 
5b, 5c, 5e, 5f) photomicrographs of transverse (FIGURE 5a-c) and sagittal 
(FIGURE 5d-f) sections, showing views through forelimb and posterior end of 
embryo, respectively, after hybridization with ^S-labelled GDF-5 antisense 
strand (FIGURE 5a t b,d,e) or sense strand control (FIGURE 5c, 5f) probes. 
25 Serial sections revealed hybridization to be localized to proximal (closed 
arrows) and distal (open arrows) mesenchyme in the forelimb (FIGURE 5a-c) 
and hindlimb (FIGURE 5d-f). Anterior (A), posterior (P), dorsal (D) and ventral 
(V) orientations are indicated. 



10 



WO 94/15949 



PCT/US94/006S7 



-29- 

GDF-5 transcripts were detected in both proximal and distal precartilaginous 
mesenchyme of the forelimbs and hindlimbs (FIGURE 5). No other major sites 
of hybridization in the embryo were detected. The development of the long 
bones of the limbs begins with the condensation of mesenchyme, which 

5 differentiates into cartilage-forming cells. Osteogenic cells eventually invade the 
cartilage matrix and produce a bone matrix which becomes ossified (Rosen, 
V., ef aL, Trends Genet, 3:97-102, 1992). In the mouse embryo at 12.5 days 
p.c., cartilage formation is just beginning in the long bones, and no sign of 
ossification is yet seen (Kaufman, M.H., The Atlas of Mouse Development, 

10 Academic Press, Inc., 1992). The peak of GDF-5 expression at this stage 
(FIGURE 1 B) and its primary location in the precartilaginous limb mesenchyme 
suggest that GDF-5 may affect the production, proliferation, and/or differentia- 
tion of the mesenchyme cells. 

In addition to GDF-5, two other members of the TGF-£ superfamily have been 
15 suggested to play a role in limb development. In particular, BMP-2 and BMP-4 
are known to be expressed in the apical ectodermal ridge (AER) during mid- 
gestation at day 10.5 p.c. (Lyons, K.M., etal., Development, 109:833-844, 1990; 
Jones, CM., ef a/., Development, 111:531-542, 1991). BMP-2 has been shown 
to inhibit the proliferation of mesenchyme cells in cultured limbs of mid- 
20 gestational embryos from which the AER had been removed (Niswander, L, 
etaL, Nature, 261:68-71, 1993). Because BMP-2 and BMP-4 are also known 
to be expressed in limb mesenchyme at day 12.5 p.c. and because the active 
form of growth factors in this family is -generally a disulfied-linked dimer, the 
possibility exists that homodimers or heterodimers of GDF-5, BMP-2 and BMP-4 
25 may have distinct roles in limb development. 

So far, the only bone morphogenetic protein for which mutants have been 
found is BMP-5, encoded by the mouse short -ear locus (Kingsley, D.M. ( et a/., 
Cell, 71:399-419, 1992). Mice homozygous for the short ear mutation, which 



WO 94/15949 



PCT/US94/00657 



-30- 



causes a range of skeletal defects, have alterations in the size and shape of 
precartilaginous condensations of mesenchyme (Green, E.L, et al., J. MorphoL, 
7Q:1-19, 1942). Skeletal defects of the limbs and digits may be caused by 
mutations in the mouse gene encoding GDF-5. Like BMP-5, GDF-5 controls 
5 particular aspects of skeletal morphology during development. 



WO 94/15949 PCT/US94/00657 



-31- 

SUMMARY OF SEQUENCES 

SEQUENCE ID NO 1 is the nucleotide sequence for the GDF-5 primer, SJ.L136. 
SEQUENCE ID NO 2 is the nucleotide sequence for the GDF-5 primer, SJL121 . 
SEQUENCE ID NO 3 is the amino acid sequence for the GDF-5 primer, 
5 SJL136. 

SEQUENCE ID NO 4 is the amino acid sequence for the GDF-5 primer, 
SJL121. 

SEQUENCE ID NO 5 is the nucleotide sequence for the GDF-5 primer, SJL141 . 
SEQUENCE ID NO 6 is the nucleotide sequence for the GDF-5 primer, SJL145. 
10 SEQUENCE ID NO 7 is the amino acid sequence for the GDF-5 primer, 
SJL141. 

SEQUENCE ID NO 8 is the amino acid sequence for the GDF-5 primer, 
SJL145. 

SEQUENCE ID NO 9 is the nucleotide and deduced amino acid sequence for 
15 GDF-5. 

SEQUENCE ID NO 10 is the deduced amino acid sequence for GDF-5. 

SEQUENCE ID NO 11 is the amino acid sequence for GDF-1. 

SEQUENCE ID NO 12 is the amino acid sequence for GDF-3. 

SEQUENCE ID NO 13 is the amino acid sequence for GDF-5. 
20 SEQUENCE ID NO 14 is the amino acid sequence for GDF-9. 

SEQUENCE ID NO 15 is the amino acid sequence for BMP-2. 

SEQUENCE ID NO 16 is the amino acid sequence for GDF-4. 

SEQUENCE ID NO 17 is the amino acid sequence for Vgr-1. 

SEQUENCE ID NO 18 is the amino acid sequence for Op-1. 
25 SEQUENCE ID NO 19 is the amino acid sequence for BMP-5. 

SEQUENCE ID NO 20 is the amino acid sequence for BMP-3. 

SEQUENCE ID NO 21 is the amino acid sequence for MIS. 

SEQUENCE ID NO 22 is the amino acid sequence for inhibin-a. 

SEQUENCE ID NO 23 is the amino acid sequence for inhibin-^a. 



WO 94/15949 



PCT/US94/00657 



-32- 

SEQUENCE ID NO 24 is the amino acid sequence for inhibin-^. 
SEQUENCE ID NO 25 is the amino acid sequence for TGF-^1 . 
SEQUENCE ID NO 26 is the amino acid sequence for TGF-^2. 
SEQUENCE ID NO 27 is the amino acid sequence for TGF-^3. 



WO 94/15949 



PCT/US94/006S7 



-33- 

SEQUENCE LISTING 

(1) GENERAL INFORMATION : 

(i) APPLICANT: SE-JIN LEE 

HUYNH, THANH 

5 (ii) TITLE OF INVENTION: GROWTH DIFFERENTIATION FACTOR-5 

(iii) NUMBER OF SEQUENCES: 27 

(iv) CORRESPONDENCE ADDRESS: 

(A) ADDRESSEE: S PENS LEY HORN JUBAS & LUBITZ 

10 (B) STREET: 1880 CENTURY PARK EAST, FIFTH FLOOR 

(C) CITY: LOS ANGELES 

(D) STATE: CALIFORNIA 

(E) COUNTRY: US 

(F) ZIP: 90067 

15 (v) COMPUTER READABLE FORM: 

(A) MEDIUM TYPE: Floppy disk 

(B) COMPUTER: IBM PC compatible 

(C) OPERATING SYSTEM: PC-DOS/MS-DOS 

(D) SOFTWARE: Patentln Release #1.0, Version #1.25 

20 (vi) CURRENT APPLICATION DATA: 

(A) APPLICATION NUMBER: PCT 

(B) FILING DATE: 1/12/94 

(C) CLASSIFICATION : 

(viii) ATTORNEY/ AGENT INFORMATION: 
25 (A) NAME: WETHERELL, JR. PH.D., JOHN R. 

(B) REGISTRATION NUMBER: 31,678 

<C) REFERENCE/DOCKET NUMBER: FD3256 £IP OF PD2280 

(ix) TELECOMMUNICATION INFORMATION: 
(A) TELEPHONE: 619/455-5100 
30 (B) TELEFAX: 619-455-5110 



(2) INFORMATION FOR SEQ ID NO:l: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 28 base pairs 

(B) TYPE: nucleic acid 



WO 94/15949 



PCT/US94/00657 



-34- 



(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 



(vii) IMMEDIATE SOURCE: 
5 (B) CLONE: 136 

(ix) FEATURE: 

(A) NAME/KEY: CDS 

(B) LOCATION: 1..28 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l: 
10 CCGGAATTCG GNTGGGARMG NTGGRTNR 28 

(2) INFORMATION FOR SEQ ID NO: 2: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 42 base pairs 

(B) TYPE: nucleic acid 
15 (C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 



(vii) IMMEDIATE SOURCE: 
(B) CLONE: 121 



20 (ix) FEATURE: 

(A) NAME/KEY: CDS 

(B) LOCATION: 1..42 

(D) OTHER INFORMATION: /note- "WHERE M B W OCCURS, B - 
INOSINE" 



25 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2: 
CCGGAATTCR CABCCRCAYT CRTCBACBAC CATRTCYTCR TA 
(2) INFORMATION FOR SEQ ID NO: 3: 



42 



WO 94/15949 



PCT/US94/00657 



-35- 



(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 7 amino acids 

(B) TYPE: amino acid 

(C) STRANDEDNESS : single 
5 (D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: peptide 



(vii) IMMEDIATE SOURCE: 
(B) CLONE: 136 

(ix) FEATURE: 
10 (A) NAME/KEY: Peptide 

(B) LOCATION: 1. .7 

(D) OTHER INFORMATION: /note- "R - Arg, Ser; V - Val, 
lieu, Met." 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3: 

15 Gly Trp Glu Arg Trp Val Val 

1 5 

(2) INFORMATION FOR SEQ ID N0:4: 

<i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 11 amino acids 
20 (B) TYPE: amino acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: peptide 



(vii) IMMEDIATE SOURCE: 
25 (B) CLONE: 121 

(ix) FEATURE: 

(A) NAME/KEY: Peptide 

(B) LOCATION: 1..11 

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:4: 



WO 94/15949 



PCT/US94/00657 



-36- 



Tyr Glu Asp Met Val Val Asp Glu Cys Gly Cys 
1 5 10 

(2) INFORMATION FOR SEQ ID NO: 5: 

(I) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 35 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 
CD) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 



10 (vii) IMMEDIATE SOURCE: 

(A) LIBRARY: 141 

(ix) FEATURE: 

(A) NAME/KEY: CDS 

(B) LOCATION: 1. .35 

15 (D) OTHER INFORMATION: /note- "WHERE n B" OCCURS, B 

INOSINE" 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5: 
CCGGAATTCG GBTGGVANRA YTGGRTBRTB KCBCC 
(2) INFORMATION FOR SEQ ID NO: 6: 

20 (i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 33 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

25 (ii) MOLECULE TYPE: DNA (genomic) 



(vii) IMMEDIATE SOURCE: 
(B) CLONE: 145 



30 



(ix) . FEATURE: 

(A) NAME/KEY: CDS 

(B) LOCATION: 1..33 



WO 94/15949 



PCT/US94/00657 



-37- 



(D) OTHER INFORMATION: /note- "WHERE M B B OCCURS, B - 
INOSINE" 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6: 
CCGGAATTCR CABSCRCABG MNTCBACBRY CAT 
5 (2) INFORMATION FOR SEQ ID NO: 7: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 9 amino acids 

(B) TYPE: amino acid 

(C) STRANDEDNESS: single 
10 (D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: peptide 



(vii) IMMEDIATE SOURCE: 
(B) CLONE: 141 

(ix) FEATURE: 
15 (A) NAME/KEY: Peptide 

(B) LOCATION: 1..9 

(D) OTHER INFORMATION: /note- "H - His, Gin, Asn, Lys , 
Glu, Asp; D - Asp, Asn; V - Val , lie, Met; A - 
Glu, Ser. - 



20 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7: 

Gly Trp His Asp Trp Val Val Ala Pro 
1 5 

(2) INFORMATION FOR SEQ ID NO: 8: 

(i) SEQUENCE CHARACTERISTICS: 
25 (A) LENGTH: 8 amino acids 

(B) TYPE: amino acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: peptide 



WO 94/15949 



PCT/US94/006S7 



-38- 



(vii) IMMEDIATE SOURCE: 
(B) CLONE: 145 

(ix) FEATURE: 

(A) NAME/KEY: Peptide 

(B) LOCATION: 1..8 

(D) OTHER INFORMATION: /note- "V - Val, Ile f Met, Thr, 
Ala; D - Asp, Glu; A - Ala, Ser; G - Gly, ..." 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8: 

Met Val Val Asp Ala Cys Gly Cys 
10 1 5 

(2) INFORMATION FOR SEQ ID NO: 9: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 2329 base pairs 

(B) TYPE: nucleic acid 
15 (C) STRAND EDNESS : single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 



(vii) IMMEDIATE SOURCE: 
(B) CLONE: GDF-5 

20 (ix) FEATURE: 

(A) NAME/KEY: CDS 

(B) LOCATION: 322.. 1807 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9: 

TTCAAGCCCT CAGTCAGTTG TGCGGGAGAA AGGGGGCGGT CGGCTTTCTC CTTTCAAGAA 60 

25 CGAGTTATTT TCAGCTGCTG ACTGGAGACG STGCACGTCT GGACACGGGA CCACTTCCAC 120 

TATGGGACTG GATACAGACA CACGCCCGGC GGACTTCAAG ACACTCAGAC TGAGGAGAAA 180 

GCCCTGCCTG CTGCTGCTGC TGCTCCTGCT GCCACCGCTG CCTCTGAAGA CCCACTCCTT 240 

TCATGGTTTT TCCTGCCAAG CCAGAGGCAC CTTCGCTGCT ACGGCCTTTC TCTGTGGTGT 300 



WO 94/15949 



PCT/US94/00657 



-39- 



CATTCAGCGG CTGGCCAGAG G ATG AGA CTC CCC AAA CTC CTC ACT CTT TTG 351 

Met Arg Leu Pro Lys Leu Leu Thr Leu Leu 
1 5 10 

CTG TGG CAC CTG GCT TGG CTG GAC CTG GAA CTC ATC TGC ACT GTG CTG 399 
5 Leu Trp His Leu Ala Trp Leu Asp Leu Glu Leu He Cys Thr Val Leu 

15 20 25 

GGT GCC CCT GAC TTA GGA CAG AGA ACC CCA GGG GCC AAG CCA GGG TTG 447 
Gly Ala Pro Asp Leu Gly Gin Arg Thr Pro Gly Ala Lys Pro Gly Leu 
30 35 AO 

10 ACC AAA GCG GAG GCC AAG GAG AGG CCA CCC CTG GCC AGG AAT GTC TTT 495 

Thr Lys Ala Glu Ala Lys Glu Arg Pro Pro Leu Ala Arg Asn Val Phe 
45 50 55 

AGG CCA GGG GGT CAT ATC TAT GGT GTG GGG GCC ACC AAT GCC AGG GCC 543 
Arg Pro Gly Gly His He Tyr Gly Val Gly Ala Thr Asn Ala Arg Ala 
15 60 65 70 

AAG GGA AGC TCT GGG CAG ACA CAG GCC AAG AAG GAT GAA CCC AGA AAG 591 
Lys Gly Ser Ser Gly Gin Thr Gin Ala Lys Lys Asp Glu Pro Arg Lys 
75 80 85 90 

ATG CCC CCC AGA TCC GGT GGC TCT GAA ACC AAG CCA GGA CCC TCT TCC 639 
20 Met Pro Pro Arg Ser Gly Gly Ser Glu Thr Lys Pro Gly Pro Ser Ser 

95 100 105 

CAG ACT AGA CAG GCT GCA GCC CGG ACT GTA ACC CCA AAA GGA CAG CTT 687 
Gin Thr Arg Gin Ala Ala Ala Arg Thr Val Thr Pro Lys Gly Gin Leu 
110 115 120 

25 CCT GGG GGC AAA GCA TCT TCA AAA GCA GGA TCT <5CC CCC AGC TCC TTC 735 

Pro Gly Gly Lys Ala Ser Ser Lys Ala Gly Ser Ala Pro Ser Ser Phe 
. 125 130 135 

CTG CTG AAG AAG ACC AGG GAG CCT GGG ACC CCT CGA GAG -CCC AAG GAG 783 
Leu Leu Lys Lys Thr Arg Glu Pro Gly Thr Pro Arg Glu Pro Lys Glu 
30 140 145 150 

CCG TTC CGC CCG CCC CCC ATC ACA CCC CAC GAA TAC ATG CTC TCC CTG 831 
Pro Phe Arg Pro Pro Pro He Thr Pro His Glu Tyr Met Leu Ser Leu 
155 160 165 170 

TAC AGG AGG CTG TCC GAT GCT GAC AGA AAG GGA GGT AAC AGC AGC GTG 879 



WO 94/15949 



PCT/US94/00657 



-40- 



Tyr Arg Thr Leu Ser Asp Ala Asp Arg Lys Gly Gly Asn Ser Ser Val 
175 180 185 

AAG TTG GAG GOT GGC CTG GCC AAC ACC ATC ACC AGC TTT ATT GAG AAA 927 
Lys Leu Glu Ala Gly Leu Ala Asn Thr He Thr Ser Phe He Asp Lys 
5 190 195 200 

GGG CAA GAT GAC CGA GGC CCT GCG GTC AGG AAG CAG AGG TAG GTG TTT 975 
Gly Gin Asp Asp Arg Gly Pro Ala Val Arg Lys Gin Arg Tyr Val Phe 
205 210 215 

GAC ATC AGT GCC TTG GAG AAG GAT GGG CTG TTG GGG GCT GAA CTG CGG 1023 
10 Asp He Ser Ala Leu Glu Lys Asp Gly Leu Leu Gly Ala Glu Leu Arg 
220 225 230 

ATC TTA CGG AAG AAG CCC TTG GAC GTG GCC AAG CCA GCG GTC CCC AGT 1071 
He Leu Arg Lys Lys Pro Leu Asp Val Ala Lys Pro Ala Val Pro Ser 
235 240 245 250 

15 AGC GGG CGG GTT GCC CAA CTG AAG CTG TCC AGC TGC CCC AGC GGC CGG 1119 

Ser Gly Arg Val Ala Gin Leu Lys Leu Ser Ser Cys Pro Ser Gly Arg 
255 260 265 

CAG CCG GCA GCC TTG CTG GAT GTG CGC TCC GTG CCA GGC CTG GAT GGA 1167 
Gin Pro Ala Ala Leu Leu Asp Val Arg Ser Val Pro Gly Leu Asp Gly 
20 270 275 280 

TCT GGC TGG GAG GTG TTC GAC ATC TGG AAG CTC TTC CCA AAT TTT AAG 1215 
Ser Gly Trp Glu Val Phe Asp He Trp Lys Leu Phe Arg Asn Phe Lys 
285 290 295 

AAC TCA GCG CAG CTG TGC CTG GAG CTG GAG GCC TGG CAA CCG CGC CGG 1263 
25 ■ Asn Ser Ala Gin Leu Cys Leu Glu Leu Glu Ala Trp Glu Arg Gly Arg 
300 305 310 

GCC GTG GAC CTC CGT GGC CTG GGC TTT GAA CGC ACT GCC CGA CAG GTC 1311 
Ala Val Asp Leu Arg Gly Leu Gly Phe Glu Arg Thr Ala Arg Gin Val 
315 320 325 330 

30 CAC GAG AAA GCC TTG TTC CTA GTG TTT GGT CGT ACC AAG AAA CCG GAC 1359 

His Glu Lys Ala Leu Phe Leu Val Phe Cly Arg Thr Lys Lys Arg Asp 
335 340 345 



WO 94/15949 



PCT/US94/00657 



-41- 



CTG TTC TTT AAT GAG ATT AAG GCC CGC TCT GGC CAG GAT GAC AAG ACT 1407 
Leu Phe Phe Asn Glu He Lys Ala Arg Ser Gly Gin Asp Asp Lys Thr 
350 355 360 

GTG TAT GAA TAT TTG TTC AGC CAG CGG CGG AAA CGC CGG GCC CCA TTG 1455 
5 Val Tyr Glu Tyr Leu Phe Ser Gin Arg Arg Lys Arg Arg Ala Pro Leu 
365 370 375 

GCC AAT CGC CAG GGC AAG CGA CCC AGC AAG AAC CTC AAG GCT CGC TGC 1503 
Ala Asn Arg Gin Gly Lys Arg Pro Ser Lys Asn Leu Lys Ala Arg Cys 
380 385 390 

10 AGT CGC AAG GCC TTG CAT GTC AAC TTC AAG GAC ATG GGC TGG GAC GAC 1551 

Ser Arg Lys Ala Leu His Val Asn Phe Lys Asp Met Gly Trp Asp Asp 
395 400 405 410 

TGG ATC ATC GCA CCT CTT GAG TAT GAG CCC TTC CAC TGC GAA GGA CTG 1599 
Trp He He Ala Pro Leu Glu Tyr Glu Ala Phe His Cys Glu Gly Leu 
15 415 420 425 

TGT GAG TTC CCC TTG CGC TCC CAC TTG GAG CCC ACA AAC CAC GCA GTC 1647 
Cys Glu Phe Pro Leu Arg Ser His Leu Glu Pro Thr Asn His Ala Val 
430 435 440 

ATT CAG ACC CTA ATG AAC TCT ATG GAC CCT GAA TCC ACA CCA CCC ACT 1695 
20 He Gin Thr Leu Met Asn Ser Met Asp Pro Glu Ser Thr Pro Pro Thr 

445 450 455 

TGT TGT GTG CCT ACA CGG CTG AGT CCT ATT AGC ATC CTC TTC ATC GAC 1743 
Cys Cys Val Pro Thr Arg Leu Ser Pro He Ser He Leu Phe He Asp 
460 465 470 

25 TCT GCC AAC AAC GTG GTG TAT AAA CAG TAC GAG GAC ATG GTC GTG CAA 1791 

Ser Ala Asn Asn Val Val Tyr Lys Gin Tyr Glu Asp Met Val Val Glu 
475 480 485 490 

TCT TGT GGC TGC AGG T AC CAG CAC CG GCCCACCTGT CTTCCACGGT GGCACATCCA 1847 
Ser Cys Gly Cys Arg 
30 495 ' 

GAGACTACCC CCTCTACAGG TTCCTGGAGT AACAGAGAGC CTGTGAAGCT GCTGCCCCAA 1907 
GTTTCCTGGC AG C CTG C AGG AAAGAGTTCT CAGCAGGCTT ACTCTCTGGA TGTGATCTGG 1967 
ACTAAAGAGA TCACCTTCTG AAGATTCCTG CCCAAGGAAC AGACTCTGAG TGGGCCTGGG 2027 



WO 94/15949 



PCT/US94/006S7 



-42- 

GCTCAGGAAA GGTGTTCTTA ATGAGATTCA GTTCACCATC TCTCCTGCCG GGGCCGGAGA 2087 

CCTTCATTTC TCTCCAGACT CTCCAGAGAA GTTGTAGCTA TATCCTAAGC TCTTTAAGGG 2147 

AGAGCTGTCT CCTCCTTGAA TCACCTTTGT GCCTGGTGAC TTTCTGCCAC GAGATGTTCA 2207 

TTACAGGGGC TGGGCAAAGA AGGGGAAAGG GCTTGGGCAG GGGTGAAGAG AAGAGTATGA 2267 

5 GCCTAATTAG ACTGTTAGAT TAAAATGTAC ATCGATGACA TAAAAGCTGA ATCTTCATGG 2327 

CT 2329 

(2) INFORMATION FOR SEQ ID NO: 10: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 495 amino acids 
10 (B) TYPE: amino acid 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10: 

Met Arg Leu Pro Lys Leu Leu Thr Leu Leu Leu Trp His Leu Ala Trp 
15 1 5 10 15 

Leu Asp Leu Glu Leu He Cys Thr Val Leu Gly Ala Pro Asp Leu Gly 
20 25 30 

Gin Arg Thr Pro Gly Ala Lys Pro Gly Leu Thr Lys Ala Glu Ala Lys 
35 40 45 

20 Glu Arg Pro Pro Leu Ala Arg Asn Val Phe Arg Pro Gly Gly His He 
50 55 60 

Tyr Gly Val Gly Ala Thr Asn Ala Arg Ala Lys Gly Ser Ser Gly Gin 
65 70 75 80 

Thr Gin Ala Lys Lys Asp Glu Pro Arg Lys Met Pro Pro Arg Ser Gly 
25 85 90 95 

Gly Ser Glu Thr Lys Pro Gly Pro Ser Ser Gin Thr Arg Gin Ala Ala 
10a 105 110 



WO 94/15949 



PCT/US94/00657 



-43- 



Ala Arg Thr Val Thr Pro Lys Gly Gin Leu Pro Gly Gly Lys Ala Ser 
115 120 125 

Ser Lys Ala Gly Ser Ala Pro Ser Ser Phe Leu Leu Lys Lys Thr Arg 
130 135 1*0 

5 Glu Pro Gly Thr Pro Arg Glu Pro Lys Glu Pro Phe Arg Pro Pro Pro 
145 150 155 160 

lie Thr Pro His Glu Tyr Met Leu Ser Leu Tyr Arg Thr Leu Ser Asp 
165 170 175 

Ala Asp Arg Lys Gly Gly Asn Ser Ser Val Lys Leu Glu Ala Gly Leu 
10 180 185 190 

Ala Asn Thr He Thr Ser Phe He Asp Lys Gly Gin Asp Asp Arg Gly 
195 200 205 

Pro Ala Val Arg Lys Gin Arg Tyr Val Phe Asp He Ser Ala Leu Glu 
210 215 220 

15 Lys Asp Gly Leu Leu Gly Ala Glu Leu Arg lie Leu Arg Lys Lys Pro 

225 230 235 240 

Leu Asp Val Ala Lys Pro Ala Val Pro Ser Ser Gly Arg Val Ala Gin 
245 250 255 

Leu Lys Leu Ser Ser Cys Pro Ser Gly Arg Gin Pro Ala Ala Leu Leu 
20 260 265 270 

Asp Val Arg Ser Val Pro Gly Leu Asp Gly Ser Gly Trp Glu Val Phe 
275 280 285 

Asp He Trp Lys Leu Phe Arg Asn Phe Lys Asn Ser Ala Gin Leu Cys 
290 295 300 

25 Leu Glu Leu Glu Ala Trp Glu Arg Gly Arg Ala Val Asp Leu Arg Gly 
305 310 315 320 

Leu Gly Phe Glu Arg Thr Ala Arg Gin Val His Glu Lys Ala Leu Phe 
325 330 335 

Leu Val Phe Gly Arg Thr Lys Lys Arg Asp Leu Phe Phe Asn Glu He 
30 340 345 350 



WO 94/15949 



PCT/US94/00657 



-44- 



Lys Ala Arg Ser Gly Gin Asp Asp Lys Thr Val Tyr Glu Tyr Leu Phe 
355 360 365 

Ser Gin Arg Arg Lys Arg Arg Ala Pro Leu Ala Asn Arg Gin Gly Lys 
370 375 380 

Arg Pro Ser Lys Asn Leu Lys Ala Arg Cys Ser Arg Lys Ala Leu His 
385 390 395 400 

Val Asn Phe Lys Asp Met Gly Trp Asp Asp Trp He He Ala Pro Leu 
405 410 415 



10 



Glu Tyr Glu Ala Phe His Cys Glu Gly Leu Cys Glu Phe Pro Leu Arg 
420 425 ^30 



Ser His Leu Glu Pro Thr Asn His Ala Val He Gin Thr Leu Met Asn 
435 440 445 



Ser Met Asp Pro Glu Ser Thr Pro 
450 455 

15 Leu Ser Pro He Ser He Leu Phe 
465 470 

Tyr Lys Gin Tyr Glu Asp Met Val 
485 



Pro Thr Cys Cys Val Pro Thr Arg 
460 

He Asp Ser Ala Asn Asn Val Val 
475 480 

Val Glu Ser Cys Gly Cys Arg 
490 495 



(2) INFORMATION FOR SEQ ID NO: 11: 



20. (i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 124 amino acids 

(B) TYPE: amino acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 



25 (ii) MOLECULE TYPE: peptide 



(vii) IMMEDIATE SOURCE : 
(B) CLONE: GDF-1 



30 



(ix) FEATURE: 

(A) NAME/KEY: Protein 
<B) LOCATION: 1..124 



WO 94/15949 



PCT/US94/006S7 



-45- 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11: 

Arg Leu Arg Arg His Thr Clu Pro Arg Val Glu Val Gly Pro Val Gly 
15 10 15 

Thr Cys Arg Thr Arg Arg Leu His Val Ser Phe Arg Glu Val Gly Trp 
5 20 25 30 

His Arg Trp Val He Ala Pro Arg Gly Phe Leu Ala Asn Phe Cys Gin 
35 40 45 

Gly Thr Cys Ala Leu Pro Glu Thr Leu Arg Gly Pro Gly Gly Pro Pro 
50 55 60 

10 Ala Leu Asn His Ala Val Leu Arg Ala Leu Met His Ala Ala Ala Pro 

65 70 75 80 

Thr Pro Gly Ala Gly Ser Pro Cys Cys Val Pro Glu Arg Leu Ser Pro 
85 90 95 

He Ser Val Leu Phe Phe Asp Asn Glu Asp Asn Val Val Leu Arg His 
15 100 105 110 

Tyr Glu Asp Met Val Val Asp Glu Cys Gly Cys Arg 
115 120 

(2) INFORMATION FOR SEQ ID NO: 12: 

(i) SEQUENCE CHARACTERISTICS: 
20 (A) LENGTH: 118 amino acids 

(B) TYPE: amino acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 



25 (vii) IMMEDIATE SOURCE: 

(B) CLONE: GDF-3 

(ix) FEATURE: 

(A) NAME/KEY: Protein 

(B) LOCATION: 1. .118 



WO 94/15949 



PCT/US94/00657 



-46- 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 12: 

Arg Lys Arg Arg Ala Ala He Ser Val Pro Lys Gly Phe Cys Arg Asn 
1 5 10 15 

Phe Cys His Arg His Gin Leu Phe He Asn Phe Gin Asp Leu Gly Trp 
5 20 25 30 

His Lys Trp Val He Ala Pro Lys Gly Phe Met Ala Asn Tyr Cys His 
35 40 45 

Gly Glu Cys Pro Phe Ser Met Thr Thr Tyr Leu Asn Ser Ser Asn Tyr 
50 55 60 

10 Ala Phe Met Gin Ala Leu Met His Met Ala Asp Pro Lys Val Pro Lys 

65 70 75 80 

Ala Val Cys Val Pro Thr Lys Leu Ser Pro He Ser Met Leu Tyr Gin 
85 90 95 

Asp Ser Asp Lys Asn Val He Leu Arg His Tyr Glu Asp Met Val Val 
15 100 105 HO 

Asp Glu Cys Gly Cys Gly 
115 

(2) INFORMATION FOR SEQ ID NO: 13: 

(i) SEQUENCE CHARACTERISTICS: 
20 (A) LENGTH: 119 amino acids 

(B) TYPE: amino acid 

(C) STRANDEDNESS : single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 



25 (vii) IMMEDIATE SOURCE: 

(B) CLONE: GDF-5 



(ix) FEATURE: 

(A) NAME/KEY: Protein 

(B) LOCATION: 1..119 



WO 94/15949 PCT/US94/00657 



-47- 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 13: 

Pro Leu Ala Asn Arg Gin Gly Lys Arg Pro Ser Lys Asn Leu Lys Ala 
15 10 15 

Arg Cys Ser Arg Lys Ala Leu His Val Asn Phe Lys Asp Met Gly Trp 
5 20 25 30 

Asp Asp Trp He He Ala Pro Leu Glu Tyr Glu Ala Phe His Cys Glu 
35 40 45 

Gly Leu Cys Glu Phe Pro Leu Arg Ser His Leu Glu Pro Thr Asn His 
50 55 60 

10 Ala Val He Gin Thr Leu Met Asn Ser Met Asp Pro Glu Ser Thr Pro 

65 70 75 80 

Pro Thr Cys Cys Val Pro Thr Arg Leu Ser Pro He Ser He Leu Phe 
85 90 95 

He Asp Ser Ala Asn Asn Val Val Tyr Lys Gin Tyr Glu Asp Met Val 
15 100 105 HO 

Val Glu Ser Cys Gly Cys Arg 
115 

(2) INFORMATION FOR SEQ ID NO: 14: 

(i) SEQUENCE CHARACTERISTICS: 
20 (A) LENGTH: 119 amino acids 

(B) TYPE: amino acid 

(C) STRAND EDNESS : single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 



25 (vii) IMMEDIATE SOURCE: 

(B) CLONE: GDF-9 



(ix) FEATURE: 

(A) NAME/KEY: Protein 

(B) LOCATION: 1. .119 



WO 94/15949 



PCT/US94/006S7 



-48- 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 14: 

Ser Phe Asn Leu Ser Glu Tyr Phe Lys Gin Phe Leu Phe Pro Gin Asn 
1 5 10 15 

Glu Cys Glu Leu His Asp Phe Arg Leu Ser Phe Ser Gin Leu Lys Trp 
5 20 25 30 

Asp Asn Trp He Val Ala Pro His Arg Tyr Asn Pro Arg Tyr Cys Lys 
35 40 45 

Gly Asp Cys Pro Arg Ala Val Arg His Arg Tyr Gly Ser Pro Val His 
50 55 60 

10 Thr Met Val Gin Asn He He Tyr Glu Lys Leu Asp Pro Ser Val Pro 

65 70 75 80 

Arg Pro Ser Cys Val Pro Gly Lys Tyr Ser Pro Leu Ser Val Leu Thr 
85 90 95 

He Glu Pro Asp Gly Ser He Ala Tyr Lys Glu Tyr Glu Asp Met He 
15 100 105 110 

Ala Thr Arg Cys Thr Cys Arg 
115 

(2) INFORMATION FOR SEQ ID NO: 15: 

(i) SEQUENCE CHARACTERISTICS: 
20 (A) LENGTH: 118 amino acids 

(B) TYPE: amino acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 



25 (vii) IMMEDIATE SOURCE: 

(B) CLONE: BMP- 2 



(ix) FEATURE: 

(A) NAME/KEY: Protein 

(B) LOCATION: 1..118 



WO 94/15949 



PCT/US94/006S7 



-49- 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 15: 

Arg Glu Lys Arg Gin Ala Lys His Lys Gin Arg Lys Arg Leu Lys Ser 
15 10 15 

Ser Cys Lys Arg His Pro Leu Tyr Val Asp Phe Ser Asp Val Gly Trp 
5 20 25 30 

Asn Asp Trp He Val Ala Pro Pro Gly Tyr His Ala Phe Tyr Cys His 
35 40 45 

Gly Glu Cys Pro Phe Pro Leu Ala Asp His Leu Asn Ser Thr Asn His 
50 ' 55 60 

10 Ala He Val Gin Thr Leu Val Asn Ser Val Asn Ser Lys He Pro Lys 

65 70 75 80 

Ala Cys Cys Val Pro Thr Glu Leu Ser Ala He Ser Met Leu Tyr Leu 
85 90 95 

Asp Glu Asn Glu Lys Val Val Leu Lys Asn Tyr Gin Asp Met Val Val 
15 100 105 110 

Glu Gly Cys Gly Cys Arg 
115 

(2) INFORMATION FOR SEQ ID NO: 16: 

(i) SEQUENCE CHARACTERISTICS: 
20 (A) LENGTH: 118 amino acids 

(B) TYPE: amino acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 



25 (vii) IMMEDIATE SOURCE: 

(B) CLONE: BMP-4 



(ix) FEATURE: 

<A) NAME/KEY: Protein 
(B) LOCATION: 1..118 



WO 94/15949 



PCT/US94/00657 



-50- 



(xi) SEQUENCE DESCRIPTION: SEQ ID N0:16: 

Lys Arg Ser Pro Lys His His Ser Gin Arg Ala Arg Lys Lys Asn Lys 
15 10 15 

Asn Cys Arg Arg His Ser Leu Tyr Val Asp Phe Ser Asp Val Gly Trp 
5 20 25 30 

Asn Asp Trp He Val Ala Pro Pro Gly Tyr Gin Ala Phe Tyr Cys His 
35 40 45 

Gly Asp Cys Pro Phe Pro Leu Ala Asp His Leu Asn Ser Thr Asn His 
50 55 60 

10 Ala He Val Gin Thr Leu Val Asn Ser Val Asn Ser Ser He Pro Lys 

65 70 75 80 

Ala Cys Cys Val Pro Thr Glu Leu Ser Ala He Ser Met Leu Tyr Leu 
85 90 95 

Asp Glu Tyr Asp Lys Val Val Leu Lys Asn Tyr Gin Glu Met Val Val 
15 100 105 HO 

Glu Gly Cys Gly Cys Arg 
115 

(2) INFORMATION FOR SEQ ID NO: 17: 

(i) SEQUENCE CHARACTERISTICS: 
20 (A) LENGTH: 119 amino acids 

(B) TYPE: amino acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 



25 (vii) IMMEDIATE SOURCE: 

(B) CLONE: Vgr-1 



(ix) FEATURE: 

(A) NAME/KEY: Protein 

(B) LOCATION: 1..119 



WO 94/15949 



PCT/US94/00657 



-51- 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 17: 

Ser Arg Gly Ser Gly Ser Ser Asp Tyr Asn Gly Ser Glu Leu Lys Thr 
15 10 15 

Ala Cys Lys Lys His Glu Leu Tyr Val Ser Phe Gin Asp Leu Gly Trp 
5 20 25 30 

Gin Asp Trp He He Ala Pro Lys Gly Tyr Ala Ala Asn Tyr Cys Asp 
35 40 45 

Gly Glu Cys Ser Phe Pro Leu Asn Ala His Met Asn Ala Thr Asn His 
50 55 60 

10 Ala He Val Gin Thr Leu Val His Leu Met Asn Pro Glu Tyr Val Pro 

65 70 75 80 

Lys Pro Cys Cys Ala Pro Thr Lys Leu Asn Ala He Ser Val Leu Tyr 
85 90 95 

Phe Asp Asp Asn Ser Asn Val He Leu Lys Lys Tyr Arg Asn Met Val 
15 100 105 110 

Val Arg Ala Cys Gly Cys His 
115 

(2) INFORMATION FOR SEQ ID NO: 18: 

(i) SEQUENCE CHARACTERISTICS: 
20 (A) LENGTH: 119 amino acids 

(B) TYPE: amino acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 



25 (vii) IMMEDIATE SOURCE: 

<B) CLONE:: OP-1 



(ix) FEATURE: 

(A) NAME/KEY: Protein 

(B) LOCATION: 1..119 



WO 94/15949 



PCT/US94/00657 



-52- 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 18: 

Leu Arg Met Ala Asn Val Ala Glu Asn Ser Ser Ser Asp Gin Arg Gin 
1 5 10 15 

Ala Cys Lys Lys His Glu Leu Tyr Val Ser Phe Arg Asp Leu Gly Trp 
5 20 25 30 

Gin Asp Trp He He Ala Pro Glu Gly Tyr Ala Ala Tyr Tyr Cys Glu 
35 40 45 

Gly Glu Cys Ala Phe Pro Leu Asn Ser Tyr Met Asn Ala Thr Asn His 
50 55 60 

10 Ala He Val Gin Thr Leu Val His Phe He Asn Pro Glu Thr Val Pro 

65 70 75 80 

Lys Pro Cys Cys Ala Pro Thr Gin Leu Asn Ala He Ser Val Leu Tyr 
85 90 95 

Phe Asp Asp Ser Ser Asn Val He Leu Lys Lys Tyr Arg Asn Met Val 
15 100 105 110 

Val Arg Ala Cys Gly Cys His 
115 

(2) INFORMATION FOR SEQ ID NO: 19: 

(i) SEQUENCE -CHARACTERISTICS: 
20 (A) LENGTH: 119 amino acids 

(B) TYPE: amino acid 

(C) STRANDEDNESS : single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 



25 (vii) IMMEDIATE SOURCE: 

(B) CLONE: BMP- 5 



(ix) FEATURE: 

(A) NAME/KEY: Protein 

(B) LOCATION: 1..119 



WO 94/15949 



PCT/US94/00657 



-53- 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 19: 

Ser Arg Met Ser Ser Val Gly Asp Tyr Asn Thr Ser Glu Gin Lys Gin 
15 10 15 

Ala Cys Lys Lys His Glu Leu Tyr Val Ser Phe Arg Asp Leu Gly Trp 
5 20 25 30 

Gin Asp Trp He He Ala Pro Glu Gly Tyr Ala Ala Phe Tyr Cys Asp 
35 40 45 

Gly Glu Cys Ser Phe Pro Leu Asn Ala His Met Asn Ala Thr Asn His 
50 55 60 

10 Ala He Val Gin Thr Leu Val His Leu Met Phe Pro Asp His Val Pro 

65 70 75 80 

Lys Pro Cys Cys Ala Pro Thr Lys Leu Asn Ala He Ser Val Leu Tyr 
85 90 95 

Phe Asp Asp Ser Ser Asn Val He Leu Lys Lys Tyr Arg Asn Met Val 
15 100 105 110 

Val Arg Ser Cys Gly Cys His 
115 

(2) INFORMATION FOR SEQ ID NO: 20: 

(i) SEQUENCE CHARACTERISTICS: 
20 (A) LENGTH: 120 amino acids 

(B) TYPE: amino acid 

(C) STRANDEDNESS : single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 



25 (vii) IMMEDIATE SOURCE: 

(B) CLONE: BMP- 3 



(ix) FEATURE: 

(A) NAME/KEY: Protein 

(B) LOCATION: 1..120 



WO 94/15949 



PCT/US94/00657 



-54- 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 20: 

Glu Gin Thr Leu Lys Lys Ala Arg Arg Lys Gin Trp He Glu Pro Arg 
1 5 10 15 

Asn Cys Ala Arg Arg Tyr Leu Lys Val Asp Phe Ala Asp He Gly Trp 
5 20 25 30 

Ser Glu Trp He He Ser Pro Lys Ser Phe Asp Ala Tyr Tyr Cys Ser 
35 40 45 

Gly Ala Cys Gin Phe Pro Met Pro Lys Ser Leu Lys Pro Ser Asn His 
50 55 60 

10 Ala Thr He Gin Ser lie Val Arg Ala Val Gly Val Val Pro Gly He 

65 70 75 80 

Pro Glu Pro Cys Cys Val Pro Glu Lys Met Ser Ser Leu Ser He Leu 
85 90 95 

Phe Phe Asp Glu Asn Lys Asn Val Val Leu Lys Val Tyr Pro Asn Met 
15 100 105 110 

Thr Val Glu Ser Cys Ala Cys Arg 
115 120 

(2) INFORMATION FOR SEQ ID NO: 21: 

(i) SEQUENCE CHARACTERISTICS: 
20 (A) LENGTH: 116 amino acids 

(B) TYPE: amino acid 

(C) STRANDEDNESS : single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 



25 (vii) IMMEDIATE SOURCE: 

(B) CLONE: MIS 



(ix) FEATURE: 

(A) NAME/KEY: Protein 

(B) LOCATION: 1..116 



WO 94/15949 



PCT/US94/006S7 



-55- 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 21: 

Gly Pro Gly Arg Ala Gin Arg Ser Ala Gly Ala Thr Ala Ala Asp Gly 
15 10 15 

Pro Cys Ala Leu Arg Glu Leu Ser Val Asp Leu Arg Ala Glu Arg Ser 
5 20 25 30 

Val Leu He Pro Glu Thr Tyr Gin Ala Asn Asn Cys Gin Gly Val Cys 
35 AO 45 

Gly Trp Pro Gin Ser Asp Arg Asn Pro Arg Tyr Gly Asn His Val Val 
50 55 60 

10 Leu Leu Leu Lys Met Gin Ala Arg Gly Ala Ala Leu Ala Arg Pro Pro 

65 70 75 80 

Cys Cys Val Pro Thr Ala Tyr Ala Gly Lys Leu Leu He Ser Leu Ser 
85 90 95 

Glu Glu Arg He Ser Ala His His Val Pro Asn Met Val Ala Thr Glu 
15 100 105 110 

Cys Gly Cys Arg 
115 

(2) INFORMATION FOR SEQ ID NO: 22: 

(i) SEQUENCE CHARACTERISTICS: 
20 (A) LENGTH: 122 amino acids 

(B) TYPE: amino acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 



25 (vii) IMMEDIATE SOURCE: 

(B) CLONE: Inhibit-alpha 



(ix) FEATURE: 

(A) NAME/KEY: Protein 

(B) LOCATION: 1..122 



WO 94/15949 



PCT/US94/00657 



-56- 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 22: 

Ala Leu Arg Leu Leu Gin Arg Pro Pro Glu Glu Pro Ala Ala His Ala 
15 10 15 

Asn Cys His Arg Val Ala Leu Asn He Ser Phe Gin Glu Leu Gly Trp 
5 20 25 30 

Glu Arg Trp He Val Tyr Pro Pro Ser Phe He Phe His Tyr Cys His 
35 40 45 

Gly Gly Cys Gly Leu His He Pro Pro Asn Leu Ser Leu Pro Val Pro 
50 55 60 

10 Gly Ala Pro Pro Thr Pro Ala Gin Pro Tyr Ser Leu Leu Pro Gly Ala 

65 70 75 80 

Gin Pro Cys Cys Ala Ala Leu Pro Gly Thr Met Arg Pro Leu His Val 
85 90 95 

Arg Thr Thr Ser Asp Gly Gly Tyr Ser Phe Lys Tyr Glu Thr Val Pro 
15 100 105 110 

Asn Leu Leu Thr Gin His Cys Ala Cys He 
115 120 

(2) INFORMATION FOR SEQ ID NO: 23: 

(i) SEQUENCE CHARACTERISTICS: 
20 (A) LENGTH: 122 amino acids 

(B) TYPE: amino acid 

(C) STRAND EDNESS : single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 



25 (vii) IMMEDIATE SOURCE: 

(B) CLONE: Inhibin-beta- alpha 



(ix) FEATURE: 

(A) NAME/KEY: Protein 

(B) LOCATION: 1. .122 



WO 94/15949 



PCT/US94/006S7 



-57- 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 23: 

His Arg Arg Arg Arg Arg Gly Leu Glu Cys Asp Gly Lys Val Asn He 
15 10 15 

Cys Cys Lys Lys Gin Phe Phe Val Ser Phe Lys Asp He Gly Trp Asn 
5 20 25 30 

Asp Trp He He Ala Pro Ser Gly Tyr His Ala Asn Tyr Cys Glu Gly 
35 40 45 

Glu Cys Pro Ser His He Ala Gly Thr Ser Gly Ser Ser Leu Ser Phe 
50 55 60 

10 His Ser Thr Val He Asn His Tyr Arg Met Arg Gly His Ser Pro Phe 

65 70 75 80 

Ala Asn Leu Lys Ser Cys Cys Val Pro Thr Lys Leu Arg Pro Met Ser 
85 90 95 

Met Leu Tyr Tyr Asp Asp Gly Gin Asn He He Lys Lys Asp He Gin 
15 100 105 110 

Asn Met He Val Glu Glu Cys Gly Cys Ser 
115 120 

(2) INFORMATION FOR SEQ ID NO: 24: 

(i) SEQUENCE CHARACTERISTICS: 
20 (A) LENGTH: 121 amino acids 

(B) TYPE: amino acid 

(C) STRANDEDNESS : single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 



25 (vii) IMMEDIATE SOURCE: 

(B) CLONE: Inhibin-beta-beta 

(ix) FEATURE: 

(A) NAME/KEY: Protein 

(B) LOCATION: 1..121 



WO 94/15949 



PCT/US94/00657 



-58- 



(xi) SEQUENCE DESCRIPTION : SEQ ID NO: 24: 

His Arg lie Arg Lys Arg Gly Leu Glu Cys Asp Gly Arg Thr Asn Leu 
15 10 15 

Cys Cys Arg Gin Gin Phe Phe lie Asp Phe Arg Leu lie Gly Trp Asn 
5 20 25 30 

Asp Trp lie He Ala Pro Thr Gly Tyr Tyr Gly Asn Tyr Cys Glu Gly 
35 40 45 

Ser Cys Pro Ala Tyr Leu Ala Gly Val Pro Gly Ser Ala Ser Ser Phe 
50 55 60 

10 His Thr Ala Val Val Asn Gin Tyr Arg Met Arg Gly Leu Asn Pro Gly 

65 70 75 80 

Thr Val Asn Ser Cys Cys He Pro Thr Lys Leu Ser Thr Met Ser Met 
85 90 95 

Leu Tyr Phe Asp Asp Glu Tyr Asn He Val Lys Arg Asp Val Pro Asn 
15 100 105 110 

Met He Val Glu Glu Cys Gly Cys Ala 
115 120 

(2) INFORMATION FOR SEQ ID NO: 25: 

(i) SEQUENCE CHARACTERISTICS: 
20 (A) LENGTH : 115 amino acids 

(B) TYPE: amino acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 



25 (vii) IMMEDIATE SOURCE: 

(B) CLONE: TGF-beta-1 



(ix) 



FEATURE: 

(A) NAME/KEY: Protein 

(B) LOCATION: 1..115 



WO 94/15949 



PCT/US94/00657 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 25: 

His Arg Arg Ala Leu Asp Thr Asn Tyr Cys Phe Ser Ser Thr Glu Lys 
1 5 10 15 

Asn Cys Cys Val Arg Gin Leu Tyr He Asp Phe Arg Lys Asp Leu Gly 
5 20 25 30 

Trp Lys Trp He His Glu Pro Lys Gly Tyr His Ala Asn Phe Cys Leu 
35 40 45 

Gly Pro Cys Pro Tyr He Trp Ser Leu Asp Thr Gin Tyr Ser Lys Val 
50 55 60 

10 Leu Ala Leu Tyr Asn Gin His Asn Pro Gly Ala Ser Ala Ala Pro Cys 

65 70 75 80 

Cys Val Pro Gin Ala Leu Glu Pro Leu Pro He Val Tyr Tyr Val Gly 
85 90 95 

Arg Lys Pro Lys Val Glu Gin Leu Ser Asn Met He Val Arg Ser Cys 
15 100 105 HO 

Lys Cys Ser 
115 

(2) INFORMATION FOR SEQ ID NO: 26: 

(i) SEQUENCE CHARACTERISTICS: 
20 (A) LENGTH: 115 amino acids 

(B) TYPE: amino acid 

(C) STRANDEDNESS : single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 



25 (vii) IMMEDIATE SOURCE: 

(B) CLONE: TGF-beta-2 



(ix) FEATURE: 

(A) NAME/KEY: Protein 

(B) LOCATION: 1..115 



WO 94/15949 



PCT/US94/00657 



-60- 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 26: 

Lys Lys Arg Ala Leu Asp Ala Ala Tyr Cys Phe Arg Asn Val Gin Asp 
1 5 10 15 . 

Asn Cys Cys Leu Arg Pro Leu Tyr He Asp Phe Lys Arg Asp Leu Gly 
5 20 25 30 

Trp Lys Trp He His Glu Pro Lys Gly Tyr Asn Ala Asn Phe Cys Ala 
35 40 45 

Gly Ala Cys Pro Tyr Leu Trp Ser Ser Asp Thr Gin His Ser Arg Val 
50 55 60 

10 Leu Ser Leu Tyr Asn Thr He Asn Pro Glu Ala Ser Ala Ser Pro Cys 

65 70 75 80 

Cys Val Ser Gin Asp Leu Glu Pro Leu Thr He Leu Tyr Tyr He Gly 
85 90 95 

Lys Thr Pro Lys He Glu Gin Leu Ser Asn Met He Val Lys Ser Cys 
15 100 105 110 

Lys Cys Ser 
115 

(2) INFORMATION FOR SEQ ID NO:27: 

(i) SEQUENCE CHARACTERISTICS: 
20 (A) LENGTH: 115 amino acids 

<B) TYPE: amino acid 

(C) STRANDEDNESS : single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 



25 (vii) IMMEDIATE SOURCE: 

(B) CLONE: TGF-beta-3 



(ix) FEATURE: 

(A) NAME/KEY: Protein 

(B) LOCATION: 1. .115 



WO 94/1S949 



PCT/US94/006S7 



-61- 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 27: 

Lys Lys Arg Ala Leu Asp Thr Asn Tyr Cys Phe Arg Asn Leu Glu Glu 
15 10 15 

Asn Cys Cys Val Arg Pro Leu Tyr He Asp Phe Arg Gin Asp Leu Gly 
5 20 25 30 

Trp Lys Trp Val His Glu Pro Lys Gly Tyr Tyr Ala Asn Phe Cys Ser 
35' 40 45 

Gly Pro Cys Pro Tyr Leu Arg Ser Ala Asp Thr Thr His Ser Thr Val 
50 55 60 

10 Leu Gly Leu Tyr Asn Thr Leu Asn Pro Glu Ala Ser Ala Ser Pro Cys 

65 70 75 80 

Cys Val Pro Gin Asp Leu Glu Pro Leu Thr He Leu Tyr Tyr Val Gly 
85 90 95 

Arg Thr Pro Lys Val Glu Gin Leu Ser Asn Met Val Val Lys Ser Cys 
15 100 - 105 HO 



Lys Cys Ser 
115 



WO 94/15949 



PCTKJS94/00657 



-62- 

Although the invention has been described with reference to the 
presently preferred embodiment, it should be understood that various 
modifications can be made without departing from the spirit of the 
invention. Accordingly, the invention is limited only by the following 
5 claims. 



WO 94/15949 



PCT/US94/006S7 



-63- 

CLAIMS 

1 . Substantially pure growth differentiation factor-5 (GDF-5) and functional 
fragments thereof. 

2. An isolated polynucleotide sequence encoding the GDF-5 polypeptide 
of claim 1 . 

3. The polynucleotide sequence of claim 2, wherein the polynucleotide is 
isolated from a mammalian cell. 

4. The polynucleotide of claim 3, wherein the mammalian cell is selected 
from the group consisting of mouse, rat, and human cell. 

5. An expression vector including the polynucleotide of claim 2. 

6. The vector of claim 5, wherein the vector is a plasmid. 

7. The vector of claim 5, wherein the vector is a virus. 

8. A host cell stably transformed with the vector of claim 5. 

9. The host cell of claim 8, wherein the cell is prokaryotic. 

10. The host cell of claim 8, wherein the cell is sukaryotic. 

1 1 . Antibodies reactive with the polypeptide of claim 1 or fragments thereof. 

12. The antibodies of claim 1 1 , wherein the antibodies are polyclonal. 



WO 94/15949 



PCT/US94/00657 



-64- 



13. The antibodies of claim 11, wherein the antibodies are monoclonal. 

1 4. A method of detecting a cell proliferative disorder comprising 
contacting the antibody of claim 11 with a specimen of a subject, 
suspected of having a GDF-5 associated disorder and detecting binding 
of the antibody. 

15. The method of claim 14, wherein the cell proliferative disorder is a 
uterine neoplasm or endometriosis. 

16. The method of claim 14, wherein the cell proliferative disorder is a 
skeletal disorder. 

17. The method of claim 14, wherein the detecting is in vivo. 

18. The method of claim 17, wherein the antibody is detectably labeled. 

19. The method of claim 18, wherein the detectable label is selected from 
the group consisting of a radioisotope, a fluorescent compound, a 
bioluminescent compound and a chemiluminescent compound. 

20. The method of claim 14, wherein the detection is in vitro. 

21 . The method of claim 20, wherein the antibody is detectably labeled. 

22. The method of claim 21, wherein the label is selected from the group 
consisting of a radioisotope, a fluorescent compound, a bioluminescent 
compound; a chemoluminescent compound and an enzyme. 



WO 94/15949 



PCT/US94/00657 



-65- 

23. A method of treating a cell proliferative disorder associated with 
expression of GDF-5, comprising contacting the cells with a reagent 
which suppresses the GDF-5 activity. 

24. The method of claim 23, wherein the reagent is an anti-GDF-5 antibody. 

25. The method of claim 23, wherein the reagent is a GDF-5 antisense 
sequence. 

26. The method of claim 23, wherein the cell proliferative disorder is a 
uterine neoplasm or endometriosis. 

27. The method of claim 23, wherein the cell proliferative disorder is a 
skeletal disorder. 

28. The method of claim 23, wherein the reagent which suppresses GDF-5 
activity is introduced to a cell using a vector. 

29. The method of claim 28, wherein the vector is a colloidal dispersion 
system. 

30. The method of claim 29, wherein the colloidal dispersion system is a 
liposome. 

31. The method of claim 30, wherein the liposome is essentially target 
specific. 

32. The method of claim 31 , wherein the liposome is anatomically targeted. 



WO 94/15949 PCT/US94/00657 

-66- 

33. The method of claim 31, wherein the liposome is mechanistically 
targeted. 

34. The method of claim 33, wherein the mechanistic targeting is passive. 

35. The method of claim 33, wherein the mechanistic targeting is active. 

36. The method of claim 35, wherein the liposome is actively targeted toy 
coupling with a moiety selected from the group consisting of a sugar, 
a glycolipid, and a protein. 

37. The method of claim 36, wherein the protein moiety is an antibody. 

38. The method of claim 37, wherein the vector is a virus. 

39. The method of claim 38, wherein the virus is an RNA virus. 

40. The method of claim 39, wherein the RNA virus is a retrovirus. 

41. The method of claim 40, wherein the retrovirus is essentially target 
specific. 



WO 94/15949 



PCT/US94/006S7 



1/7 



. 1 



3 ill Mil! 1 1 1 1 



11 £ 



OT « w in « OT 

o cv 
Ca ^ *— 



^ B CD 



* * * **\ 




ft ** M 



FIGURE 1 



WO 94/15949 



PCT7US94/00657 



1 
61 
121 
181 
241 
301 

361 

421 

481 

541 

601 

661 

721 

781 

841 

901 

961 

1021 

1081 

1141 

1201 

1261 

1321 

1381 

1441 

1501 

1561 

1621 

1681 

1741 

1801 

1861 
1921 
1981 
2041 
2101 
2161 
2221 
2281 



2/7 

TTCAAGCCCTCAGTCAGTTGTGCGGGAGAAAGGGGGCGGTCGGCTTTCTCCTTTCAAGAA 
CGAGTTATTTTCAGCTG CTGA CTGGAGACGGTGCACGTCTGGACACGGGAGCACTTCCAC 
TATGGGACTGGATACAGACACACGCCCGGCGGACTTCAAGACACTCAGACTGAGGAGAAA 
GCCCTGCCTGCTGCTGCTGCTGCTGCTGCTGCCACCGCTGCCTCTGAAGACCCACTCCTT 
TCATGGTTTTTCCTGCCAAGCCAGAGGCACCTTCGCTGCTACGGCCTTTCTCTGTGGTGT 
CATTCAGCGGCTGGCCAGAGGATGAGACTCCCCAAACTCCTCACTCTTTTGCTGTGGCAC 

MRLPKLLTLLLWH 
CTGGCTIX^CTGGACCTGGAACTCATCTGCACTGTGCTGGGTGCCCCTGACTTAGGACAG 
LAWLDLELICTVLGAPDLGQ 
AGAACCCCAGGGGCCAAGCCAGGGTTGACCAAAGCGGAGGCCAAGGAGAGGCCACCCCTG 
RTPGAKPGLTKAEAKERPPL 
GCCAGGAATGTCTTTAGGCCAGGGGGTCATATCTATGGTGTGGGGGCCACCAATGCCAGG 
ARNVFRPGGH IYGVGATNAR 
GCCAAGGGAAGCTCTGGGCAGACACAGGCCAAGAAGGATGAACCCAGAAAGATGCCCCCC 
AKGS SGQTQAKKDE PRKMP P 
AGATCCGGTGGCTCTGAAACCAAGCCAGGACCCTCTTCCCAGACTAGACAGGCTGCAGCC 
RSGGSETKPGPSSQTRQAAA 
CGGACTGTAACCCCAAAAGGACAGCTTCCTGGGGGCAAAGCATCTTCAAAAGCAGGATCT 
RTVT PKGQL PGGKASSKAGS 
GCCCCCAGCTCCTTCCTGCTGAAGAAGACCAGGGAGCCTGGGACCCCTCGAGAGCCCAAG 
APSSFLLKKTREPGTPREPK 
GAGCCGTTCCGCCCGCCCCCCATCACACCCCACGAATACATGCTCTCCCTGTACAGGACG 
EPFRPPPITPHEYMLSLYRT 
CTGTCCGATGCTGACAGAAAGGGAGG TAACAGCAG CGTGAAGTTGGAGGCTGGCCTGGCC 
LSDADRKGG Fn S 7~ 



L E A G L 



AACACCATCACCAGCTTTATTGACAAAGGGCAAGATGACCGAGGCCCTGCGGTCAGGAAG 

NTITSFIDKGQDDRGPA VRK 

CAGAGGTACGTGTTTGACATCAGTGCCTTGGAGAAGGATGGGCTGTTGGGGGCTGAACTG 

QRYVFDISALEKDGLLGAEL 

CGGATCTTACGGAAGAAGCCCTTGGACGTGGCCAAGCCAGCGGTCCCCAGTAGCGGGCGG 

RILRKKPLDVAKPAVPSSGR 

GTTGCCCAACTGAAGCTGTCCAGCTGCCCCAGCGGCCGGCAGCCGGCAGCCTTGCTGGAT 

VAQLKLSSCPSGRQ PAALLD 

GTGCGCTCCGTGCCAGGCCTGGATGGATCTGGCTGGGAGGTGTTCGACATCTGGAAGCTC 

VRSVPGLDGSGWEVFDIWKL 

TTCCGAAATTTTAAGAACTCAGCGCAGCTGTGCCTGGAGCTGGAGGCCTGGGAACGGGGC 

FRNFKNSAQLCLELEAWERG 

CGGGCCGTGGACCTCCGTGGCCTGGGCTTTGAACGCACTGCCCGACAGGTCCACGAGAAA 

RAVDLRGLGFERTARQVHEK 

GCCTTGTTCCTAGTGTTTGGTCGTACCAAGAAACG^ 

ALFLVF GRTKKRDLFFNEIK 
GCCCGCTCTGGCCAGGATGACAAGACTGTGTATGAATATTTGTTCAGCCA GCGGCGGAA A 
ARSGQDDKTVYEYLFSQ l-R.'^^K^ 
CGCCGtG GCCCCATTGGCCAATCGCCAGGGCAAGCGACCCAGCAACAACCTCAAGGCTCGC 
R ciR 1 APLANRQGKRPSKNLKAR 



TGCAGTCGCAAGGCCTTGCATGTCAACTTCAAGGACATGGGCTCGGACGACTGGATCATC 

CSRKALHVNFKDMGWDDWI I 

GCACCTCTTGAGTATGAGGCCTTCCACTGCGAAGGACTCTGTGAGTTCCCCTTGCGCTCC 

APLEYEAFHCEGLCEFPLRS 

CACTTGGAGCCCACAAACCACGCAGTCATTCAGACCCTAATGAACTCTATGGACCCTGAA 

HLEPTNHAVIQTLMNSMDPE 

TCCACACCACCCACTTGTTGTGTCCCTACACGGCTGAGTCCTATTAGCATCCTCTTCATC 

STPPTCCVPTRLSPISILFI 

GACTCTGCCAACAACGTGGTGTATAAACAGTACGAGGACATGGTCGTGGAATCTTCTCGC 

DSANNVVYKQYEDMVVES CG 

TGCAGGTAGCAGCACCGGCCCACCTGTCTTCCAGGGTGGCACATCCAGAGACTACCCCCT 

C R * 

CTACAGGTTCCTGGAGTAACAGAGAGCCTGTGAAGCTGCTGCCCGAAGTTTGCTGGCAGC 

CTGCAGGAAAGAGTTCTCAGCAGGCTTA.CTCTCTGGATGTGATCTGGACTAAAGAGATCA 

CCTTCTGAAGATTCCTGCCCAAGGAACAGACTCTGAGTGGGCCTGGGGCTCAGGAAAGGT 

GTTCTTAATGAGATTCAGTTCACCATCTCTCCTGCCGGGGCCGGAGACCTTCATTTCTCT 

CCAGACTCTCCAGAGAAGTTGTAGCTATATCCTAAGCTCTTTAAGGGAGAGCTGTCTCCT 

CCTTGAATCACCTTTGTCCCTGGTGACTTTCTGCCACGAGATCTTCAT^ 

GCAAAGAAGGGGAAAGGGCTTGGGCAGGGGTGAAGAGAAGAGTATCAGCCTAATTAGACT 

GTTAGATTAAAATCTACATCGATGACATAAAAGCTCAATCTTCATGGCT 2329 

FIGURE 2 



60 

120 

180 

240 

300 

360 

420 

480 

540 

600 

660 

720 

780 

840 

900 

960 

1020 

1080 

1140 

1200 

1260 

1320 

1380 

1440 

1500 

1560 

1620 

1680 

1740 

1800 

1860 

1920 
1980 
2040 
2100 
2160 
2220 
2280 



WO 94/15949 



3/7 



PCT/US94/006S7 



GBT-l 

cur- J - 
cor-s 
cbf-* . 



BHF-4^ 
Vcr-1 ^ 

3XP-5 

BMP-3.- 
MIS S 
ra&iSin a . 
Xnhibin £A 
Inhibln SB 

1UF-6I ^ * 
TQP-03 ^ 



car s 
aar-9 

BtP-4 

V«r-l 

SMP-3 
HIS 

Inhi^tn a 

Inhibit R» 
TCF-il 



IVCPVCTCJl* 



Jl 0 



RXJUlAAISV?KCrCJWn5*MCL7ZNT-C£L^ 

xrs pxhhscr a a *v>jjcmmh5 l yvdf - cdvwnewtyap PGTQArsmcajk' r fuadhl.hs 

«K^cssDY>JcsELXT;«XH£Lr/sr^^ 

XJUtAfWAC&SSOQRCAf^UCXZLYYS?- RCL3WC2VI IAPEGYAAY^32C33i~PT.N.cy>Q*A- — 
CTK:3VODYNT3 CCKOQaUiXL t VS K - HDLZXCDJT I APECYUJ»yfTV. ft grpf^iuywi 

CPCRAORSACATAADGJt^UUELSVDr aA=^XIPC?YQAMM33a%a3WPC3DRN?RT — 

HRRALrTTOCrSSTZX>Crr/P0LY:::7RO 

JCKRAL3AAYCFRKVQDNXLRPLY I2FXRDLSW-WIH2PK(rfWWt3^C»Yt.wsso. 
OTUUJTrrrCJKNL£I>CEVHPLYICrRQDL^^ 



u 



n 



ALNKAVLRAL.MHA - AAJTPGACSTCrV- - PEHL£7:SVL5T. 

-snyxfmcalxkm — ADPSvpicwa/-- pticlspisklyc- 

-PVXTXVCNZIYX- -BMPSVFRFBO/--PCrrsPUSVLTX- 

VKaX2P!UCO/--P?rLJ£AlSMLYL- 

-THHAIVQTLVHS VNS5XPKAC3S-- P?SL£A1SMLYT*- 

-TSKXr^C^VHL— MNPrr/PKK3;« PTKUar.WLYF, 

-cHHAivvrv/HF-- i^prr/?KS»— ptslnaxsvlyf- 
-T«JLr/ctt.vHi.--Krroirvp!CHr3\-- P-nujiAXSVLYF- 

- -KHATTCS TVB A- VCWPCIPCJCCV- - CSQtSCLS HJF - 
-CHHW^UXMQA - - RCAALARP f»' « PTiY AOCU.XSU 

-FCAPPTPAQPYS U.PCAQrC3ULrC^£RPL3VRTT! 

-SPHTT/TNHYTtJiRCMSPFAWL^SCO/-- P7XLR JMSMLYY' 
-SrSTXWMGYRMRCLSrCT VW3XS - - PT30-3TX5K.YF- 
-TOTS JCVLALYNO- - KKPCOiC X X 7*TV - - PCAL23LP 7WY 

- TTXSTVWLY^r- - LNPEAS AS ^QT - - P^TLS ? 1 1 ZVTi « 



CHC3WVLJUZY5KV 1 

csANrnrvrxcYrcHWEsrai 

' SPDCS IAYX£Y"ESMIA~ 

CZYDKWXJCft \30fVv iE3333t 
CnSSNVrLXXYTOCWTUOTK 

ccssNvruacYX*«wRs33a 

xss— lixaKvprwvATsnx 
:sr7CYST/pni:.?o>ccn 
coccn: mzTQNMr/ssrcs 

vcnxpxv- »51-SNKrrR33^» 
ICXTPXX - ZCLSWrfT UUO, 



WO 94/15949 



4/7 



PCT/US94/00657 




nHqEW5p@- — Q 

s fl H 3E HC m 

C T rBaqc^c gggggggggggggggggggagrghgr Regs 



395 



KL K A I 

ksHli 



g: 





396 




GDF- 


5 


RR 


I A 


GDP- 




RK 


P 


GDF- 


7 


RR 


Is 



446 



447 



GDP-5 
GDP- 6 
GDP -7 




LHVNFR^5cWDDWIIAPI.EYEA3HCBc2c0FPLRSHLEPTtIH AfllQTL 
LHVMFKELCWDDWIIAPLEYEA?HCECVCDPPLRSKLEPTHHAIIQTL 
L H vflp KELCWDDWIIAP L^YERYH CECVCPFPLRSHLEPTNHMXQTL 



STF pjjc CVPTRLSPIS X lQx DQANN VVVKQ TEDMVVESCCC R 
STPPSCC VPTQliflpiSILYXDA^NNVVYKQ YEDMVVESCGCR, 
^QpflsC C Vpflfl I«S PXS X Ii YXD AAMN VV YKQ YEDH WeQc CC R 



FIGURE 3b 



WO 94/15949 



5/7 



PCT/US94/006S7 




2 9 



^ n n is 'c > o c\ « 

i tii i i t i t 



cu ^ i a. c* cq ^ <s £ 
rn > o o m SB 1 1 



i 

to 



i 



S € S 



FIGURE 4 



WO 94/15949 



7/7 



PCT/US94/00G57 



FIGURE 5d 



FIGURE 5e 



FIGURE 5f 




INTERNATIONAL SEARCH REPORT 



Int. attonal application No. 
PCI7US94/00657 



A. CLASSIHCATION OF SUBJECT MATTER 

IPC(5) :PIea*e Sec Extra Sheet. 

US CL :Please Sec Extra Sheet. 
According to International Patent Classification (IPC) or to both national classification and IPC 



FIELDS SEARCHED 



Minimum documentation searched (classification system followed by classification symbols) 
U.S. : Please See Extra Sheet. 



Documentation searched other than minimum documentation to the extent that such documents are included in the fields searched 



Electronic data base consulted during the international search (name of data base and, where practicable, search terms used) 
Please See Extra Sheet. 



C. DOCUMENTS CONSIDERED TO BE RELEVANT 



Category* 



Citation of document, with indication, where appropriate, of the relevant passages 



Relevant to claim No. 



Molecular Endocrinology, Vol. 4, issued 1990, Lee, S.-J., 
"Identification Of A Novel Member (GDF-1) Of The 
Transforming Growth Factor-S Superfamily", pages 1034- 
1040, see entire document. 

Proc. Natl. Acad. ScL, USA, Vol. 88, Issued May 1991, Lee, 
S.-J., "Expression Of Growth/Differentiation Factor 1 In The 
Nervous System: Conservation Of A Bicistronic Structure", 
pages 4250-4254, see entire document. 

Meth. Enzymol., Vol. 100, issued 1983, Beltz et al.., 
""Isolation of Multigene Families And Determination Of 
Homologies By Filter Hybridization Methods", pages 266- 
285, see entire document. 



2-6, 8, 9 



1-13 



1-13 



1-13 



"x) Further documents are listed in the continuation of Box C. | | See patent family annex. 



Special categories of cited document*: 

document defining the general date of the art which it not considered 
to be part of particular relevance 

earlier document published on or after the international filing date 

document which may throw doubts on priority clahnfc) or which ia 
cited to establish the publication date of another citation or other 
special reason (as specified) 

document referring to an oral disclosure, use, exhibition or other 



later document published after the international filing date or priority 
dote and not in conflict with the application but cited to understand the 
principle or theory underlying the invention 

document of particular relevance: the churned invention cannot be 
considered novel or cannot be considered to involve an inventive step 
when the document is taken alone 

document of particular relevance; the claimed invention 1 
considered to involve an inventive step when the ■' 
combined with one or more other such documents, such combi n a t ion 
being obvious to a person skilled in the art 



document published prior to the international filing date but later than 
the priority date claimed 



document member of the ■ 



family 



Date of the actual completion of the international search 
05 APRIL 1994 



Date of mailing of the international search report 

APR 1 5 W4 



Name and mailing address of the ISA/US 
Commissioner of Patents and Trademarks 
Box PCT 

Washington, D.C. 20231 
Facsimile No. NOT APPLICABLE 



Authorized officer Q^^^^ 1^ 

CHRISTOPHER S. FMw IJ 
Telephone No. (703) 308-0196 



Form PCT/ISA/210 (second sheet)(July 1992)* 



INTERNATIONAL SEARCH REPORT 



Intc. .tonal application No. 
PCT/US94/00657 



C (Continuation). DOCUMENTS CONSIDERED TO BE RELEVANT 


Category* 


Citation of document, with indication, where appropriate, of the relevant passages 


Relevant to claim No. 


Y 


Sambrook et aL, "Molecular Cloning, A Laboratory Manual", 
Second Edition, published 1989 by Cold Spring Harbor 
Laboratory Press, Cold Spring Harbor, NY, pages 11.2-11.11, 
11.17-11.19, see all cited pages. 


1-13 


Y 


US, A, 4,675,285 (CLARK et al.) 23 June 1987, see entire 
document. 


1-13 



Form PCT/ISA/210 (continuation of second sheet)(July 1992)* 



INTERNATIONAL SEARCH REPORT 



Int tional application No. 
PCT/US94/00657 



Box I Observations where certain claims were found unsearchable (Continuation of item 1 of first sheet) 



This international report has not been established in respect of certain claims under Article 17(2)(a) for the following reasons: 
Claims Nos.: 

because they relate to subject matter not required to be searched by this Authority, namely: 



Claims Nos.: 

because they relate to parts of the international application that do not comply with the prescribed requirements to such 
an extent that no meaningful international search can be carried out, specifically: 



Claims Nos.: 

because they are dependent claims and are not drafted in accordance with the second and third sentences of Rule 6.4(a). 



Box II Observations where unity of invention is lacking (Continuation of item 2 of first sheet) 
This International Searching Authority found multiple inventions in this international application, as follows: 
Please Sec Extra Sheet. 



2 - □ 

3 - □ 



1 . | | As all required additional search fees were timely paid by the applicant, this international search report covers all searchable 

claims. 

2. | | As all searchable claims could be searched without effort justifying an additional fee, this Authority did not invite payment 
of any additional fee. 

3. | x| As only some of the required additional search fees were timely paid by the applicant, this international search report covers 
only those claims for which fees were paid, specifically claims Nos.: 

1-13 



4. | | No required additional search fees were timely paid by the applicant. Consequently, this international search report is 
restricted to the invention first mentioned in the claims; it is covered by claims Nos.: 



Remark on Protest | | The additional search fees were accompanied by the applicant's protest. 

| | No protest accompanied the payment of additional search fees. 



Form PCT/ISA/210 (continuation of first sheet(l))(July 1992)* 



INTERNATIONAL SEARCH REPORT 



Int jonal application No. 
PCT/US94/00657 



A. CLASSIFICATION OF SUBJECT MATTER: 
IPC (5): 

C07K 3/00, 13/00, 15/28. 17/00; C07H 15/12, 17/00; C12N 15/70, 15/79, 15/00, 7/00. 1/20, 5/16, 1/21 

A. CLASSIFICATION OF SUBJECT MATTER: 
USCL : 

530 / 350, 399, 387.1; 536 / 23.1, 23.51; 435 / 320.1, 235.1, 252.3, 240.2, 172.3 

B. FIELDS SEARCHED 
Minimum documentation searched 
Classification System: U.S. 

530 / 350, 399, 387.1; 536 / 23.1, 23.51; 435 / 320.1, 235.1, 252.3, 240.2, 172.3 
B. FIELDS SEARCHED 

Electronic data bases consulted (Name of data base and where practicable terms used): 

Automated Patent System - USPAT, JPOABS 
Dialog one search files: 5 , 265, 266 

EMBL-NEW, GenBank 80, GenBank-NEW, N-GeneSeq 13, UEMBL 37 80, A-GeneSeq 13, PIR 38, and Swiss-PRot 
27 

Search terms: growth, differentiation, factor 5, vector, viral, virus, plasmid 

BOX II. OBSERVATIONS WHERE UNITY OF INVENTION WAS LACKING 
This ISA found multiple inventions as follows: 

This international application contains the following inventions or groups of inventions which are not so linked by the 
identical special technical feature so as to form a single inventive concept under the criteria of PCT Rule 13.2. 

I. Claims 1, drawn to growth differentiation factorS (GDF-5) are for example, classified in Class 530, subclasses 350 
and 399. 

II. Claims 2*10, drawn to polynucleotides encoding growth differentiation factor5 as well as vectors and host cells 
containing same are for example, classified in Class 536, subclass 23.1 and 23.51 and Class 435 subclasses 320.1, 
235.1,252.3, and 240.2. 

III. Claims 11-13, drawn to antibodies to growth differentiation factor-5 are for example, classified in at least Class 530, 
subclass 387.1. 

IV. Claims 14-22, drawn to a method of detecting a cell proliferative disorder by binding an antibody to the sample 
specimen arc for example, classified in Class 435, subclass 7.1. 

V. Claims 23-41, drawn to a method of treating a cell proliferative disorder by binding an antibody to the sample 
specimen are for example, classified in at least Class 424, subclass 85. 8. Note that in Group IV, claim 14 is generic 
toaplurality of recited species which are: species (A) a neoplasm or (B) endometriosis (claim 15); species (C) a skeletal 
disorder (claim 16) determined by in vivo measurement (claim 17) using labeled (claim 18) compounds which are 
(claim 19) radioisotopes (Class 435, subclass 504); species (D) a skeletal disorder (claim 16) determined by in vivo 
measurement (claim 17) using labeled (claim 18) compounds which are (claim 19) luminescent compounds (Class 435, 
subclass 8); species (E) where the measurement is in vitro (claim 20) and the antibody is labeled (claim 21) with 
radioisotopes (Class 436, subclass 504); species (F) where the measurement is in vitro (claim 20) and the antibody is 
labeled (claim 21) with luminescent compounds such as in Class 435, subclass 8. Species A of Group IV will be 
examined with Group IV should applicant pay the additional fee for searching Group IV where species B through F 
constitute five additional species which will be searched upon payment of the requisite additional fees for each species. 

In Group V, claim 23 is generic to a plurality of recited species of reagent and cell proliferative disorder which consist 
of species (A, claim 24) anti-GDF-5 antibody (Class 424; subclass 85. 8); species (B, claim 25) GDF-5 antisense 
polynucleotide (Class 536, subclass 23.1); species (C, claim 28)where the reagent is avector which is a colloidal 
dispersion (claim 29) is a liposome (claim 30) which is targeted (claims 31-37); species (D, claim 28) where the reagent 



Form PCT/ISA/210 (extra sheet)(July 1992)* 



INTERNATIONAL SEARCH REPORT 



Intt ional application No. 
PCT/US94/00657 



is a vector which isa (claims 38-41) virus (Class 435, subclass 235.1); species(E)wherein the disorder is a neoplasm or 
(F)endometriosis (claim 26); species (G) wherein the disorder is a skeletal disorder (claim 27). Species A of Group V 
will be examined with Group IV should applicant pay the additional fee for searching Group IV where species B 
through G constitute six additional species which will be searched upon payment of the requisite additional fees for each 
species. 



Form PCT/ISA/210 (extra sheet)(July 1992)* 



This Page is Inserted by IFW Indexing and Scanning 
Operations and is not part of the Official Record 

BEST AVAILABLE IMAGES 

Defective images within this document are accurate representations of the original 
documents submitted by the applicant. 

Defects in the images include but are not limited to the items checked: 

□ BLACK BORDERS 

□ IMAGE CUT OFF AT TOP, BOTTOM OR SIDES 
□TfADED TEXT OR DRAWING 
[^BLURRED OR ILLEGIBLE TEXT OR DRAWING 

□ SKEWED/SLANTED IMAGES 

□ COLOR OR BLACK AND WHITE PHOTOGRAPHS 

□ GRAY SCALE DOCUMENTS 

□ LINES OR MARKS ON ORIGINAL DOCUMENT 

□ REFERENCE(S) OR EXHIBIT(S) SUBMITTED ARE POOR QUALITY 

□ OTHER: . 

IMAGES ARE BEST AVAILABLE COPY. 
As rescanning these documents will not correct the image 
problems checked, please do not report these problems to 
the IFW Image Problem Mailbox.