Skip to main content

Full text of "USPTO Patents Application 09804625"

See other formats


WORLD INTCLLECTUAL PROPERTY ORGANIZATION 
Intenrndonal Buieau 




PCX 

INTERNATIONAL APPUCATION PUBUSHED UNDER THE PATENT COOPERATION TREATY (PCD 



(51) International Patent Classification S : 

C12N 15/12, A61K 37/02, C07K 13/00, 
C12P 21/02 // C12N 15/62 



Al 



(11) International Publication Nnmber: WO 94/26893 

(43) Internatioiial PoblkatioD Date: 24 November 1994 (24.1154) 



(21) Internatioiial Appfication Number: FCTAJS94A)5290 

(22) International FOing Date: 12 May 1994 (12.05i»4) 



(30) Priority Data: 

08A)61,695 



12 May 1993 (12.05.93) 



US 



(71) Applicant: (SENETICS INSTITUTE, INC. [US/US]; L<^ 

Affairs, 87 Cambridge Park Drive. Cambridge, MA 02140 
(US). 

(72) Inventors: CELESTE, Anthony, J.; 86 Packard Street. Hudson, 

MA 01749 (US). WOZNEY. John. M.; 59 Old BolttMJ Road, 
Hudson. MA 01749 (US). 

(74) Agent: LAZAR, Steven. R.; Genetics Institute, Inc.. Legal 
Affairs, 87 Cambridge Paric Drive, Cambridge, MA 02140 
(US). 



(81) Designated States: AU. BR, CA, H, JP, KP, KR, NL, NO. 
European patent (AT, BE. CH, DE, DK. ES. FR. GB. OR. 
IE. rr, LU, MC, NL, FT. SE). OAPI patent (BP, BJ, CF. 
CG, a CM, GA, ON. ML. MR. NE. SN.TD, TG). 



Published 

With international search report. 



03 

m 

I 

I"* 
> 

r- 

m 

a 
o 



(54) Title: BMP- 10 COMPOSITIONS 
(57) Abstract 

Purified BMP-10 proteins and processes for producing them are disclosed. DNA molecules encoding the BMP-10 proteins aie also 
disclosed. The proteins may be used in the treatment of bone and cartilage defects and in wound healing and related tissue r^>air. 



FOR THE PURPOSES OF INFORMATION ONLY 



Codes used tp idendfy States party to the PCX on the front pages of pamphlets publishing internatioiial 
applications under the FCT. 



AT 


Austria 


GB 


United Kingdom 


MR 


Manritinia 


AU 


Australia 


GE 


Gecfgia 


MW 


Malawi 


BB 


Bartndoe 


GN 


Guinea 


NE 


ingtf 


BE 


Bdgium 


GR 


Greece 


NL 


Netbcilands 


BF 


BuridiiA Fuo 


HU 


Hungvy 


NO 


Norway 


BG 


Bulgiria 


IE 


Ireland 


NZ 


New Zealand 


BJ 


Bcoin 


IT 


Italy 


PL 


Poland 


BR 


BnzU 


JP 


Japan 


FT 


Portugal 


BY 


Belnus 


KE 


Keoya 


RO 


Romania 


CA 




KG 


Kyisystan 


RU 


Rnssian Fedcntioo 


CF 


Ceotrel Afikio R^ublic 


KF 


Democntic PDople*« RqwlHic 


SD 


Sudan 


CG 


Coogo 




of Koiea 


SE 


Sweden 


CH 


SwiizertaDil 


KR 


Repobfic of Korea 


SI 


Sloveaia 


a 


Cdte d'lvDire 


KZ 


KAzal[ti8Un 


SK 


Slovakia 


CM 


CunoDoo 


U 


LiocfatcDstdn 


SN 


Senegal 


CN 


China 


LK 


SriUnka 


TD 


Chad 


CS 


Czecboalovalda 


LU 


Lnxeoibourg 


TG 


Togo 


CZ 


Czedi Republic 


LV 


Latvia 


TJ 


Tajikistan 


D£ 


Gennaiiy 


MC 


Mooaco 


TT 


Thnidad and Tobago 


DK 


Denmark 


MD 


Repidtbc of Moldovi 


UA 


Ukraine 


ES 


Spain 


MG 


Madagascar 


US 


United States of America 


n 


Pin land 


ML 


Mali 


UZ 


Uzbekittan 


FR 


France 


MN 


Mongolia 


VN 


Viet Nam 


GA 


GsboQ 











wo 94/26893 



TITLE OF THE INVENTTON 
BMP-10 COMPOSITIONS 



PCT/US94/05290 



The present invention relates to a novel family of purified 
proteins designated BMP-10, DNA encoding them, and processes for 
obtaining them. These proteins may be used to induce bone 
and/or cartilage formation and in wound healing and tissue 
repair. These proteins may also be used for augmenting the 
activity of other bone morphogenetic proteins. 

BACKGROUND OF THE INVENTION 

The search for the molecule or molecules responsible for 
the bone and cartilage-inductive activity present in bone and 
other tissue extracts has led to the discovery of a novel set of 
molecules called the Bone Morphogenetic Proteins (BMPs) . The 
structures of several proteins, designated BMP-1 through BMP-9, 
have previously been elucidated* The unique inductive 
activities of these proteins, along with their presence in bone, 
suggests that they are important regulators of bone repair 
processes, and may be involved in the normal maintenance of bone 
tissue. There is a need to identify whether additional proteins 
exist which play a role in these processes. The present 
invention relates to the identification of such a protein^ which 
the inventors have designated BMP-10. 

SUMMARY OF THE INVENTION 

Bovine BMP-10 

The bovine BMP-10 DNA sequence (SEQ ID NO: 1) and amino 
acid sequence (SEQ ID NO: 2) are set forth in the Sequence 
Listings. BMP-10 proteins are capable of inducing the formation 
of cartilage, bone or combinations thereof. BMP-10 proteins may 
be further characterized by the ability to demonstrate cartilage 
and/or bone formation activity in the rat bone formation assay 
described below. 

Bovine BMP-10 may be produced by culturing a cell 
transformed with a DNA sequence comprising nucleotide a ^DNA 
sequence encoding the mature BMP-10 polypeptide, comprising 
nucleotide #779 to nucleotide #1102 as shown in SEQ ID NO: 1, 
and recovering and purifying from the culture medium a protein 
characterized by the amino acid sequence comprising amino acids 
#1 to #108 as shown in SEQ ID NO: 2 substantially free from other 



WO P4/26893 PCT/US94/0S290 

proteinaceous materials with which |it. is co-pt-odiined . — —For 
prpduction in wammalian cells, the DNA sequence further 
comprises a DNA sequence encoding a suitable propeptide-5' to 
and linked in frame to the nucleotide Goquonoe encoding the 
5 mature BMP-IO polypeptide. The propeptide may be the native 

BMP" 10 propeptide, or may be a propeptide from another protein 
of the TGF-)3 superfamily. 

Human B>fP-lo is expected to be hotaologous to bovine BNP-lo. 
The invention, therefore, includes methods for obtaining the DNA 

10 sequences encoding hxman BMP-10, the;DNA sequences obtained by 

those methods, and the human protein encoded by those DNA 
sequences- This method entails utilizing the bovine BMP-10 
nucleotide sequence or portions thelreof to design probes to 
screen libraries for the human gene or coding sequences or 

15 fragments thereof using standard tecshniques. A DNA sequence 

encoding part of the human BMP-10 pro |e:aln < S£Q ID NO: 3) and the 
corresponding awino acid sequence (SJEQ ID NO: 4) are set forth 
herein. These sequences may also b^ i>sed in order to design 
probes to obtain the complete human BMP-IO gene or coding 

2 0 sequences through standard techniques- Human BMP-10 may be 

produced by culturing a cell transformed with the BMP-IO DNA 
sequence and recovering and purifying BMP-IO from the culture 
medium. The purified expressed protein is substantially free 
from other protexnaceous materials with which it is co-produced, 

2 5 as well as from other contaminants.- The recovered purified 

protein is contemplated to exhibit cartilage and/or bone 
formation activity. The proteins ;of the invention may be 
further characterized by the ability to demonstrate cartilage 
and/or bone formation activity in th^ rat bone formation assay 

3 0 desc;ribP.d below. 

Another aspect of the invention provides pharmaceutical 
compositions contaivning a therapeutically effective amount of a 
BMP-IO protein in a pharmaceutically acceptable vehicle or 
carrier. BMP-lo compositions of the invention may be used in 
35 the formation of cartilage. These cbmpoaitions may further be 

utilized for the formation of bone .i_BKP--i_D ^compositions may 
also be used for wound healing and tissue repair. Compositions 



wo 94/26893 PCT/US94/05290 



of the invention may further include at least one other 
therapeutically useful agent such as the BMP proteins BMP-1, 
BMP-2, BMP-3, BMP-4, BMP-5, BMP-6 and BMP-7, disclosed for 
instance in United States Patents 5,108,922; 5,013,649; 
5 5,116,738; 5,106,748; 5,187,076; and 5,141,905; BMP-8, disclosed 

in per publication WO91/18098; and BMP-9, disclosed in PCT 
publication WO93/00432. 

The compositions of the invention may comprise, in addition 
to a BMP-10 protein, other therapeutically useful agents 

10 including growth factors such as epidermal growth factor (EGF) , 

fibroblast growth factor (FGF) , transforming growth factor (TGF- 
a and TGF-i3) , and insulin-like growth factor (IGF) . The 
compositions may also include an appropriate matrix for 
instance, for supporting the composition and providing a surface 

15 for bone. and/or cartilage growth. The matrix may provide slow 

release of the osteoinductive protein and/or the appropriate 
environment for presentation thereof. 

The BMP-10 compositions may be employed in methods for 
treating a number of bone and/or cartilage defects, periodontal 

20 disease and various types of wounds. These methods, according 

to the invention, entail administering to a patient needing such 
bone and/or cartilage formation wound healing or tissue repair, 
an effective amount of a BMP-10 protein. These methods may also 
entail the administration of a protein of the invention in 

25 conjunction with at least one of the novel BMP proteins 

disclosed in the co-owned applications described above. In 
addition, these methods may also include the administration of 
a BMP-10 protein with other growth factors including EGF, FGF, 
TGF-a, TGF-/3, and IGF. 

30 Still a further aspect of the invention are DNA sequences 

coding for expression of a BMP-10 protein. Such sequences 
include the sequence of nucleotides in a 5' to 3' direction 
illustrated in SEQ ID NO: 1 or SEQ ID NO: 10, DNA sequences 
which, but for the degeneracy of the genetic code, are identical 
* 35 to the DNA secjuence SEQ ID NO: 1 or SEQ ID NO: 10, and encode 

the protein of SEQ ID NO: 2 or SEQ ID NO: 11. Further included 
in the present invention are DNA sequences which hybridize under 



3 



wo 94/26893 



PCT/US94/05290 



stringent conditions with the DNA sequence of SEQ ID NO: 1 or 
SEQ ID NO: 10 and encode a protein having the ability to induce 
the formation of cartilage and/or bone. Preferred DNA sequences 
include those which hybridize under stringent conditions [see, 
5 T. Maniatis et al, Molecular Cloning f A Laboratory Manual) , Cold 

Spring Harbor Laboratory (1982), pages 387 to 389]. Finally, 
allelic or other variations of the sequences of SEQ ID NO: 1 or 
SEQ ID NO: 10, whether such nucleotide changes result in changes 
in the peptide sequence or not, but where the peptide sequence 
10 still has BMP-ID activity, are also included in the present 

invention. 

A further aspect of the invention includes vectors 
comprising a DNA sequence as described above in operative 
association with an expression control sequence therefor. These 
15 vectors may be employed in a novel process for producing a BMP- 

10 protein of the invention in which a cell line transformed 
with a DNA sequence encoding a BMP-10 protein in operative 
association with an expression control sequence therefor, is 
cultured in a suitable culture medium and a BMP-10 protein is 
20 recovered and purified therefrom. This process may employ a 

number of )cnown cells both prolcaryotic and eu)caryotic as host 
cells for expression of the polypeptide. 

The vectors may be used in gene therapy applications. In 
such use, the vectors may be transfected into the cells of a 
25 patient iQ vitro . and the cells may be reintroduced into a 

patient. Alternatively, the vectors may be introduced into a 
patient In vivo through targeted transf ection. 
Descripton of the Sequences 

SEQ ID N0:1 is the nucleotide sequence encoding part of the 
30 bovine BMP-10, derived from clone X7r-20. 

SEQ ID NO: 2 is the amino acid sequence containing the 
mature bovine BMP-10 polypeptide. 

SEQ ID NO: 3 is a partial nucleotide sequence of human BMP- 
10. 

35 SEQ ID NO: 4 is a partial amino acid sequence for human BMP- 

10 polypeptide. 

SEQ ID NO: 5 and 6 are primers to bovine BMP-10 used to 



4 



wo 94/26893 



PCT/US94/0S290 



isolate the human BMP-10 or other BMP-10 proteins. 

SEQ ID NO: 7 is a DNA sequence that is inserted into pMT2 
CXM to add an Xhol recognition site near the SV40 origin of 
replication. 

5 SEQ ID NO: 8 is a DNA sequence inserted into pMT21 to insert 

an Xhol recognition site upstream from the DHFR gene. 

SEQ ID NO: 9 is a DNA sequence comprising a portion of the 
EMC virus leader sequence. 

SEQ ID NO: 10 is a DNA sequence encoding the complete human 
10 BMP-10 protein, including the complete propeptide at nucleotides 

# 160 to # 1107, and the mature polypeptide at nucleotides # 
1108 to # 1431, derived from the cDNA clone HFL-3 and the 
genomic clone 20GEN.3. 

SEQ ID NO: 11 is the amino acid sequence encoded by SEQ ID 
15 N0:10. 

Detailed Descripton of the Invention 
BMP-10 

The bovine BMP-10 nucleotide sequence (SEQ ID NO: 1) and 
encoded amino acid sequence (SEQ ID NO: 2) are set forth in the 
2 0 Sequence listings herein. The coding sequence of the mature 

bovine BMP-10 protein begins at nucleotide #779 and continues 
through nucleotide #1102. Purified bovine BMP-10 proteins of 
the present invention are produced by culturing a host cell 
transfoirmed wth a DNA sequence comprising the DNA coding 

2 5 sequence of SEQ ID NO: 1 from nucleotide #167 to #1102, or from 

nucleotide #779 to #1102, and recovering and purifying from the 
culture medium a protein which contains the amino acid sequence 
or a substantially homologous sequence as represented by amino 
acids #-204 to #108 or # 1 to # 108 of SEQ ID NO: 2. A host 

3 0 cell may be transformed with a coding sequence encoding a 

propeptide suitable for the secretion of proteins by the host 
cell is linked in proper reading frame to the coding sequence 
for the mature BMP-10 protein. For example, see United States 
Patent 5,168,150, the disclosure of which is hereby incorporated 
3 5 by reference, in which a DNA encoding a precursor portion of a 

mammalian protein other than BMP-2 is fused to the DNA encoding 
a mature BMP-2 protein. Thus, the present invention includes 



5 



wo 94/26893 



chimeric: ONA tnolaculfift comprising DNA sequence encoding a 
propeptide from a member of the TGF-/3 superfamily of proteins, 
other than is linked in correct reading frame to a DNA 

sequence encoding a BMP-10 polypeptide. The term "chimeric" is 
5 used to signify that the propeptide originates from a different 

polypeptide than the BMP-iO. 

The hujnan BMP-10 sequence of the present invention is 
obtained using the whole or fragments of the bovine BMP-lO DNA 
sequence, or the partial human BMP- 10 -sequence of SEQ ID N0:3, 

10 as a probe. Thus, the human BMP-10 DNA -eequsnce-comprise the 

DNA g^ggence of nucleotides #30 to #167 of SEQ ID NO: 3. This 
partial sequence of the human BMP-10 DNA sequence corresponds 
wen to nucleotides #899 to #1036 of the bovine BMP*10 PNA 
sequence shown in SEQ ID NO: 1. The human BMP-10 protein 

15 comprises the sequence of amino acids #1'- #46 of SEQ ID NO; 4. 

It is expected that BMP-lO^ as expressed iy mammalian cells 
such as CHC cells, exists as a heterogeneous population of 
active species of BHP-10 protein with varying N-termini, It is 
expected that active species will - compr-is^**" an amino acird 

2 0 sequence beginning with the cysteine residue at amino acid #7 of 

SEQ ID N0:1, or wili comprise additional amino acid sequence 
furthesr in the N-terroinal direction. ; Thuc, it is expected that 
DNA secTuences encoding active Bmp-io proteins will comprise a 
nucleotide sequence comprising nucleotides -#779 or #797 to # 
25 1102 of SEQ ID N0:1 or nucleotides #1108 or # 1126 to # 1431 Of 

SEQ ID NO: 10. 

The N-terminus of human BMP-10 has been experimentally 
determined by expression in E. coli to be as follows: 
[M]NAKGNYX7CRTPLYIDFKEI, wherein X designates an amino acid 
30 residue with no clear signal, which is consistent with a 

cysteine residue at that location. Thus, it appears that the N- 
terminus of this species of BMP-10 is-at amino acid #1 of SEQ ID 
NO;l or SEQ ID NO:10, and a DNA sequence encoding said species 
of BMP-10 would comprise nucleotides #779 to 1102 of SEQ ID N0:1 

3 5 or #1108 to 1431 of SEQ ID NO: 10. The ^ippar^snt molecular weight 

of human Activin WC monomer was determined by SDS-PAGE to be 
approximately 10-12 kd on a Novex 16% tricine gel. Molecular 



6 



wo 94/26893 



PCT/US94/OS290 



weight of monomer by electrospray ionization mass spectrometry 
is 12292.5 on a Finnigan TSQ 7000. The human BMP-10 protein 
exists as a clear, colorless solution in 0.1% trif luoroacetic 
acid. 

The BMP-10 proteins recovered from the culture medium are 
purified by isolating them from other proteinaceous materials 
from which they are co-produced and from other contaminants 
present. BMP-10 proteins may be characterized by the ability to 
induce the formation of cartilage and/or bone, for example, in 
the rat bone formation assay described below. 

The BMP-10 proteins provided herein also include factors 
encoded by the sequences similar to those of SEQ ID NO: 1, but 
into which modifications are naturally provided (e.g. allelic 
variations in the nucleotide sequence which may result in amino 
acid changes in the polypeptide) or deliberately engineered. 
For example, synthetic polypeptides may wholly or partially 
duplicate continuous sequences of the amino acid residues of SEQ 
ID NO: 2. These sequences, by virtue of sharing primary, 
secondazy, or tertiary structural and conformational 
characteristics with bone growth factor polypeptides of SEQ ID 
NO: 2 may possess bone growth factor biological properties in 
common therewith. Thus, they may be employed as biologically 
active substitutes for naturally-occurring BMP-10 and other BMP- 
10 polypeptides in therapeutic processes. 

Other specific mutations of the sequences of BMP-10 
proteins described herein involve modifications of glycosylation 
sites. These modifications may involve 0-linked or N-linked 
glycosylation sites. For instance, the absence of glycosylation 
or only partial glycosylation results from amino acid 
substitution or deletion at asparagine-linked glycosylation 
recognition sites. The asparagine-linked glycosylation 
recognition sites comprise tripeptide sequences which are 
specifically recognized by appropriate cellular glycosylation 
enzymes. These tripeptide sequences are either asparagine-X- 
threonine or asparagine-X-serine, where X is usually any amino 
acid. A variety of amino acid substitutions or deletions at one 
or both of the first or third amino acid positions of a 



wo 94/26893 



PCTAJS94/05290 



glycosylation recognition site (and/or amino acid deletion at 
the second position) results in non-glycosylation at the 
modified tripeptide sequence. Additionally, bacterial 

expression of BMP-10 protein will also result in production of 
5 a non-glycosylated protein, even if the glycosylation sites are 

left unmodified. 

The present invention also encompasses the novel DNA 
sequences, free of association with DNA sequences encoding other 
proteinaceous materials, and coding for expression of BHP«-10 

10 proteins. These DNA sequences include those depicted in S£Q ID 

NO: 1 in a 5' to 3' direction and those sequences which 
hybridize thereto under stringent hybridization conditions [for 
example, O.lX SSC, 0.1% SDS at 65**C; see, T. Maniatis et al. 
Molecular Cloning (A Laboratory Manual! , Cold Spring Harbor 

15 Laboratory (1982), pages 387 to 389] and encode a protein having 

cartilage and/or bone inducing activity. These DNA sequences 
also include those which comprise the DNA sequence of SEQ ID NO: 
3 and those which hybridize thereto under stringent 
hybridization conditions and encode a protein having cartilage 

20 and/ or bone inducing activity. 

Similarly, DNA sequences which code for BMP-10 proteins 
coded for by the sequences of SEQ ID NO: 1, or BMP-10 proteins 
which comprise the amino acid sequence of SEQ ID NO: 2, but 
which differ in codon sequence due to the degeneracies of the 

25 genetic code or allelic variations (naturally-occurring base 

changes in the species population which may or may not result in 
an amino acid change) also encode the novel factors described 
herein. Variations in the DNA sequences of SEQ ID NO: 1) or SEQ 
ID NO: 3 which are caused by point mutations or by induced 

30 modifications (including insertion, deletion, and substitution) 

to enhance the activity, half -life or production of the 
polypeptides encoded are also encompassed in the invention. 

Another aspect of the present invention provides a novel 
method for producing BMP-10 proteins. The method of the present 

35 invention involves culturing a suitable cell line, which has 

been transformed with a DNA sequence encoding a BMP-10 protein 
of the invention, under the control of known regulatory 



8 



wo 94/26893 



PCT/US94/05290 



sequences. The transformed host cells are cultured and the BMP- 
10 proteins recovered and purified from the culture medium. The 
purified proteins are substantially free from other proteins 
with which they are co-produced as well as from other 
5 contaminants . 

Suitable cells or cell lines may be mammalian cells, such 
as Chinese hamster ovary cells (CHO) . The selection of suitable 
mammalian host cells and methods for transformation, culture, 
amplification, screening, product production and purification 

10 are known in the art. See, e.g., Gething and Sambrook, Nature , 

293:620-625 (1981), or alternatively, Kaufman et al, Mol. Cell. 
Biol. , 5(7) :1750-1759 (1985) or Howley et al, U.S. Patent, 
4,419,446. Another suitable mammalian cell line, which is 
described in the accompanying examples, is the monkey COS-l cell 

15 line. The mammalian cell CV-l may also be suitable - 

Bacterial cells may also be suitable hosts. For example, 
the various strains of E. coli (e.g., HBlOl, MC1061) are 
well-known as host cells in the field of biotechnology. Various 
strains of B. subtilis . Pseudomonas . other bacilli and the like 

20 may also be employed in this method. For expression of the 

protein in bacterial cells, DNA encoding the propeptide of BMP- 
10 may not be necessary. 

Many strains of yeast cells known to those skilled in the 
art may also be available as host cells for expression of the 

25 polypeptides of the present invention. Additionally, where 

desired, insect cells may be utilized as host cells in the 
method of the present invention. See, e.g. Miller et al. 
Genetic Engineering . 8:277-298 (Plenum Press 1986) and 
references cited therein. 

30 Another aspect of the present invention provides vectors 

for use in the method of expression of these novel BMP-10 
polypeptides. Preferably the vectors contain the full novel DNA 
sequences described above which encode the novel factors of the 
invention. Additionally, the vectors contain appropriate 

35 expression control sequences permitting expression of the BMP-10 

protein sequences. Alternatively, vectors incorporating 
modified sequences as described above are also embodiments of 



9 



wo 94/2(5893 



PCTAJ594/0S290 



the present invention. Additionally, thia .sequence of SEQ ID 
NO:l or other sequences enuodins/ ptoteins could be 

manipulated to express a mature BMP-lb protein by deleting BMP- 
10 encoding propeptide sequences and replacing them with 
5 sequences encoding the complete propeptides of other BMP 

proteins or members of the TGF-3 superf amily . Thus, the present 
invention includes chimeric DNA molecules encoding a propeptide 
from ^ ifiember of the TGF-/5 supertamily linked in correct reading 
frame to ft DNA sequence cncodinq a BJ^P-10 poiypeptide- 

10 The vectors may be employed in the method of transforming 

cell lines and contain selected ^cgTpiiatori<- — Giisquences -in 
operative association with the DNA; coding — sequenooc of the 
invention which are capable of directing the replication and 
expression thereof in selected host c#lls. Regulatory sequences 

15 for such vectors are known to those skilled in the art and may 

be selected depending upon the. host icells. Such selection is 
routine and does not form part of the present invention* 

A protein of the present inventiWr whriTzh iTiduces 
cartilage and/or bone formation in circumstances where bone is 

20 not normally formed, has application in the -heailng~of bone 

fractures and cartilage defects in jhumans and other animals • 
Such a preparation employing a &MP-10 pro tein may have 
prophylactic use in closed a$ well as open fracture reduction 
and also in the improved fixation of artificial joints. De nov o 

2 5 bone formation induced by an osteogenic agent contributes to the 

repair of congenital, trauma inducejd, or oncologic resection 
induced craniofacial defects, and also is useful in cosmetic 
plastic surgery. A BMP- 10 protein may be^aed in the treatment 
of periodontal disease, and in other tooth repair processes, 

3 0 Such agents may provide an environment" to" 'attra'ct~bone"forming 

cells, stimulate growth of bone-forming cells or induce 
differentiation of progenitors of bone-forming cell«. BMP-lo 
polypeptides of the invention mayi — also be useful in the 
treatment of osteoporosis. A ;-^ariety of osteogenic, 

3 5 cartilage-indxicing and bone inducing- factors —have been 

described* See, e.g., European pa t^iiit -appl loot ions 148,155 arid 
169,016 for discue^iions thereof. 



10 



wo 94/26893 



PCT/US94/0S290 



The proteins of the invention may also be used in wound 
healing and related tissue repair. The types of wounds include, 
but are not limited to burns, incisions and ulcers. (See, e.g. 
PCT Publication W084/ 01106 for discussion of wound healing and 
related tissue repair) • 

A further aspect of the invention is a therapeutic method 
and composition for repairing fractures and other conditions 
related to cartilage and/ or bone defects or periodontal dis- 
eases. The invention further comprises therapeutic methods and 
compositions for wound healing and tissue repair. Such 
compositions comprise a therapeutically effective amount of at 
least one of the BMP-10 proteins of the invention in admixture 
with a pharmaceutically acceptable vehicle, carrier or matrix. 

It is expected that the proteins of the invention may act 
in concert with or perhaps synergistically with other related 
proteins and growth factors. Further therapeutic methods and 
compositions of the invention therefore comprise a therapeutic 
amount of at least one BMP-10 protein of the invention with a 
therapeutic amount of at least one of the other BMP proteins 
disclosed in co-owned applications described above. Such 
combinations may comprise separate molecules of the BMP proteins 
or heteromolecules comprised of different BMP moieties. For 
example, a method and composition of the invention may comprise 
a disulfide linked dimer comprising a BMP-10 protein subunit and 
a subunit from one of the "BMP" proteins described above. Thus, 
the present invention includes a purified BMP-10 polypeptide 
which is a heterodimer wherein one subunit comprises at least 
the amino acid sequence from amino acid #1 to amino acid #108 of 
SEQ ID NO: 2, and one subunit comprises an amino acid sequence 
for a bone morphogenetic protein selected from the group 
consisting of BMP-1, BMP-2, BMP-3, BMP-4, BMP-5, BMP-6, BMP-7, 
BMP-8 and BMP-9. A further embodiment may comprise a 
heterodimer of BMP-10 moieties. Further, BMP-10 proteins may be 
combined with other agents beneficial to the treatment of the 
bone and/or cartilage defect, wound, or tissue in question. 
These agents include various growth factors such as epidermal 
growth factor (EGF) , fibroblast growth factor (FGF) , platelet 

11 



wo 94/26893 



PCT/US94/05290 



derived growth factor (PDGF) , transforming growth factors (TGF-a 
and TGF-/S) , and k-f ibroblast growth factor (kFGF) , parathyroid 
hormone (PTH) , leukemia inhibitory factor (LIF/HILDA/DIA) , 
insulin-like growth factors (IGF-I and IGF-II) . Portions of 
5 these agents may also be used in compositions of the present 

invention. 

The preparation and formulation of such physiologically 
acceptable protein compositions, having due regard to pH, 
isotonicity, stability and the like, is within the skill of the 

10 art. The therapeutic compositions are also presently valuable 

for veterinary applications due to the lack of species 
specificity in BMP proteins. Particularly domestic animals and 
thoroughbred horses in addition to humans are desired patients 
for such treatment with the BMP* 10 proteins of the present 

15 invention. 

The therapeutic method includes administering the 
composition topically, systemically, or locally as an implant or 
device. When administered, the therapeutic composition for use 
in this invention is, of course, in a pyrogen-f ree, 

20 physiologically acceptable form. Further, the composition may 

desirably be encapsulated or injected in a viscous form for 
delivery to the site of bone, cartilage or tissue damage. 
Topical administration may be suitable for wound healing and 
tissue repair. Therapeutically useful agents other than the 

25 BMP-10 proteins which may also optionally be included in the 

composition as described above, may alternatively or 
additionally, be administered simultaneously or sequentially 
with the BMP composition in the methods of the invention. 

Preferably for bone and/or cartilage formation, the 

30 composition includes a matrix capable of delivering BMP-10 or 

other BMP proteins to the site of bone and/or cartilage damage, 
providing a structure for the developing bone and cartilage and 
optimally capable of being resorbed into the body. The matrix 
may provide slow release of BMP-10 and/or other bone inductive 

35 protein, as well as proper presentation and appropriate 

environment for cellular infiltration. Such matrices may be 
formed of materials presently in use for other implanted medical 



wo 94/26893 



PCTAJS94/05290 



applications. 

The choice of matrix material is based on biocompatibility , 
biodegradability, mechanical properties, cosmetic appearance and 
interface properties. The particular application of the BMP-10 
5 compositions will define the appropriate formulation. Potential 

matrices for the compositions may be biodegradable and 
chemically defined calcium sulfate, tricalciumphosphate, 
hydroxyapatite , poly lactic acid and polyanhydrides. Other 
potential materials are biodegradable and biologically well 

10 defined, such as bone or dermal collagen. Further matrices are 

comprised of pure proteins or extracellular matrix components. 
Other potential matrices are nonbiodegradable and chemically 
defined, such as sintered hydroxyapatite, bioglass, aluminates, 
or other ceramics. Matrices may be comprised of combinations of 

15 any of the above mentioned types of material, such as 

polylactic acid and hydroxyapatite or collagen and 
tricalciumphosphate. The biocer amies may be altered in 
composition, such as in calcium-aluminate-phosphate and 
processing to alter pore size, particle size, particle shape, 

2 0 and biodegradability . 

The dosage regimen will be determined by the attending 
physician considering various factors which modify the action of 
the BMP-10 protein, e.g. amount of bone weight desired to be 
formed, the site of bone damage, the condition of the damaged 
25 bone, the size of a wound, type of damaged tissue, the patient's 

age, sex, and diet, the severity of any infection, time of 
administration and other clinical factors. The dosage may vary 
with the type of matrix used in the reconstitution and the types 
of BMP proteins in the composition. The addition of other known 

3 0 growth factors, such as IGF I (insulin like growth factor I) , to 

the final composition, may also effect the dosage. 

Progress can be monitored by periodic assessment of bone 
growth and/ or repair. The progress can be monitored, for 
example, x-rays, histomorphometric determinations and 
3 5 tetracycline labeling. 

The following examples illustrate practice of the present 
invention in recovering and characterizing bovine BMP-10 protein 



13 



wo 94/26893 



Pi:TAJS94/0S290 



and employing it to recover the human an d other BMP-10 proteins, 
obtaining the human proteins and expressing the proteins via 
re.iujrtbinant techniques t 
EXAMPLE 1 
t> Bo vi ne BMP-10 

800,000 recombinants of a iinvine .jgenomic library 
constructed in the vector XEMBL3 are ptirfcHii at a-density-of 8000 
recombinant bacteriophage plaques per plate on 100 plates. 
Duplicate nitrocellulose replicas of the recombinant 

10 bacteriophage plaques are made from these plates and amplified, 

A fragment of human BMP-7 DNA corresponding to nucleotides #1081 
to #1403 (Figure 4, United States Patent 5^141^905) is "P- 
labelled by the random priming procedure of Feinberg et al. 
[Anal. Biochera. 132: 6-13 (1983)] an4 hybridized to one set of 

15 filters in standard hybidization buffer (5X ssc, 0.1% SDS, 5X 

Denhardt's, 100 /ig/ml salmon sperm DNA) fSHB) at 60*'C for 2 to 3 
days. The filters are washed urrdar- reduced stringency 
conditions (4X SSC, 0.1% SDS at 60^r:) - Multiple .^jositively 
hybridizing recombinants are noted* '52 positively hybridizing 

20 recombinant bacteriophage plaques are^ selected and replated for 

secondaries. Duplicate nitrocellulose replicas of the 
recombinant plaw^s are made from these 52 secondary plates and 
amplified. 

One set of nitrocellulose filters" is hybridized to the 
2 5 humriri BMP-7 DNA probe as described ^;bove and washed under the 

same reduced stringency conditions. The other S^t of filters is 
hybridized to a mixed BMP-5, BMP-6, and BMP-7 probe in SHB at 
e5*C overnight and washed with « 0*:1X SSC, 0.1% SDS at 65 
(stringent hybridization and wash conditions) , The mixed probe 
30 consists of relatively equal amounts- of ^^P-labelled DNA 

fre^groents comprising nucleotides #1452 to #20150 (Eigure -4, 
United States Patent 5,106,748) of the -hixman BMP-5 sequence, 
nucleotides #1395 to #1698 (Figure--4/ Unitad -States Patent 
5,187,076) Of the hum^n BMP-6 sequenc^-r-and nucleotides #1081 to 
35 #1403 (Figure 4, United Ste^tes patent 5,141,905) of the human 

BMP-7 sequence. The BMP-5, BMP-6 arid BMP*^7 DNA fragments are 
^^P-labelled by the random priming procedure and equal numbers of 

14 



wo 94/26893 



PCTAJS94/05290 



counts per minute (cpins) of each probe are combined and added to 
the SHB containing the other set of nitrocellulose filter 
replicas of the 52 secondary plates. 

Fourteen recombinants, which hybridized positively to the 
human BMP-7 probe under the reduced stringency conditions and 
exhibited weak or no hybridization to the mixed BMP-5/6/7 probe 
under high stringency conditions, are selected for further 
analysis. All 14 recombinants which exhibit these hybridization 
characteristics are plaque purified and bacteriophage DNA is 
prepared from each. The positively hybridizing region of one of 
the recombinants, designated X7r-20, is localized to a 0.5 kb 
EcoRI/Hindlll restriction fragment. This fragment is subcloned 
into a plasmid vector (pGEM-3) and DNA sequence analysis is 
performed. The partial DNA sequence (SEQ ID NO: 1) and derived 
amino acid sequence (SEQ ID NO: 2) of clone X7r-20 are shown in 
the Sequence Listings. 

The bacteriophage X7r-20 has been deposited with the 
American Type Culture Collection, 12301 Parkklawn Drive, 
Rockville, MD, 20852, on April 23, 1993 and has been given the 
accession number ATCC 75452. This deposit meets the 
requirements of the Budapest Treaty of the International 
Recognition of the Deposit of Microorganisms for the Purpose of 
Patent Procedures and regulations thereunder. 

This X7r-20 clone encodes at least a portion of the bovine 
BMP-10 protein of the present invention. The nucleotide 
sequence of clone X7r-20 contains an open reading frame of at 
least 938 bp, as defined by nucleotides #165 to #1102 of SEQ ID 
N0:1 (#165-166 being the last two thirds of a codon which is 
interrupted by an intron) . The open reading frame encodes at 
least 312 amino acids of a BMP-lO protein. The encoded 312 
amino acid BMP-10 protein includes the full mature bovine BMP-IO 
protein (amino acid #1 to #108 of SEQ ID N0:2) , as well as the 
C-terminal portion of the propeptide region of the primary 
translation product (amino acid #-204 to #-l of SEQ ID NO: 2). 
A consensus splice acceptor sequence immediately preceding the 
BMP-10 coding sequence at #165 to #1102, and an in frame stop 
codon at position #101 to #103, suggests the presence of intron 



15 



wo 94/26893 



PCTAJS94/05290 



sequences in the 5' direction of nucleotide #165. 

Based upon the knowledge of other BMP proteins and other 
proteins within the TGF-/3 family, it is predicted that the 
precursor polypeptide would be cleaved at the multibasic 
5 sequence ARG-ILE-ARG-ARG in agreement with a proposed consensus 

proteolytic processing sequence of ARG-X-X-ARG. Cleavage of the 
BMP-10 precursor polypeptide is expected to generate a 108 amino 
acid mature peptide beginning with the amino acid ASN at 
position #1. The processing of BMP-10 into the mature form is 

10 expected to involve dimerization and removal of the N-terminal 

region in a manner analogous to the processing of the related 
protein TGF-j8 [Gentry et al., Molec. & Cell. Biol. . 8:4162 
(1988); Derynck et al.. Nature . 316:701(1985)]. 

It is contemplated therefore that the mature active species 

15 of BMP-10 comprises a homodimer of two polypeptide subunits, 

each subunit comprising amino acids #1 to #108 with a predicted 
molecular weight of approximately 12,000 daltons. Further 
active species are contemplated comprising amino acids #7 to 
#108, thereby including the first conserved cysteine residue. 

20 As with other members of the BMP and TGF-/S family of proteins, 

the carboxy-terminal region of the BMP-10 protein exhibits 
greater secjuence conservation than the more amino-terminal 
portion. The percent amino acid identity of the bovine BMP-10 
protein in the cysteine-rich C-terminal domain (amino acids #7 

25 to #108) to the corresponding region of other human BMP proteins 

and other proteins within the TGF-j8 family is as follows: BMP- 
2, 56%; BMP-3, 39%; BMP-4, 54%; BMP-5, 48%, BMP-6, 48%; BMP-7, 
47%; BMP-8, 46%; BMP-9, 67%' Vgl, 50%; <3DF-1, 40%; TGF-jSl, 37%; 
TGF-/82, 37%; TGF-j33, 37%; inhibin (B) , 36%; inhibin j8(A) , 39%. 

30 EXAMPLE 2 

Human BMP-10 

Bovine and human osteoinductive factor genes are presumed 
to be significantly homologous, therefore the bovine coding 
sequence or a portion thereof is used as a probe to screen a 
35 human genomic library or as a probe to identify a human cell 

line or tissue which synthesizes the analogous human cartilage 
and/ or bone protein. A human genomic library, such as 



wo 94/26893 



PCT/US94/05290 



Stratagene catalog #944201, may be screened with such a probe, 
and presumptive positives isolated and DNA sequence obtained. 
Evidence that this recombinant encodes a portion of the human 
BMP-10 relies of the bovine/human protein and gene structure 
homologies. 

Once a recombinant bacteriophage containing DNA encoding a 
portion of the human cartilage and/or bone inductive factor 
molecule is obtained, the human coding sequence can be used as 
a probe to identify a human cell line or tissue which 
synthesizes BMP-10 mRNA. Alternatively, the bovine BMP-10 
coding sequence can be used as a probe to identify such human 
cell line or tissue. Briefly described, RNA is extracted from 
a selected cell or tissue source and either electrophoresed on 
a formaldehyde agarose gel and transferred to nitrocellulose, or 
reacted = with formaldehyde and spotted on nitrocellulose 
directly. The nitrocellulose is then hybridized to a probe 
derived from a coding sequence of the bovine or human BMP-10. 
Alternatively, the bovine BMP-10 coding sequence is used to 
design oligonucleotide primers which will specifically amplify 
a portion of the BMP-10 encoding sequence located in the region 
located between the primers utilized to perform the specific 
amplification reaction. It is contemplated that bovine and 
human BMP-10 sequences would allow orie to specifically amplify 
corresponding human BMP-10 encoding sequences from mRNA, cDNA or 
genomic DNA templates. Once a positive source has been 
identified by one of the above described methods, mRNA is 
selected by oligo (dT) cellulose chromatography and cDNA is 
synthesized and cloned in XgtlO or other X bacteriophage vectors 
known to those skilled in the art, for example, X ZAP by 
established techniques (Toole et al., supra ) . It is also 
possible to perform the oligonucleotide primer -directed 
amplification reaction, described above, directly on a pre- 
established human cDNA or genomic library which has been cloned 
into a X bacteriophage vector. In such cases, a library which 
yields a specifically amplified DNA product encoding a portion 
of human BMP-10 protein could be screened directly, utilizing 
the fragment of amplified BMP-10 encoding DNA as a probe. 



17 



W0 94/2«8?3 

Oligonucleotide prixners designed; 



-1>CT/OS94/OS290 



on the ba^s of the DNA 
.c;eq\mnce of the bovine BMP^o genomic clone X7r-20 are predicted 
to allow the specific amplif ics^tion iof hunsan BMP-IO encodinq 
sequences. The following oligonucleotide -primer is designed on 
5 the basis of nucleotides #876 to #898 of the DNA sequence set 

forth in SEQ ID NO. 1 and synthesized on an aiAtomated DNA 
synthesizer • 

Primer A: tgctctaga cctatgaaitgtcgtggtgtttgc 
The first nine nucleotides of primer A (underlined) 
10 comprise the recognition sequence for the restriction 

cndonuclease Xbal which can be utilized to facilitatf^ the 
manipulation of a specifically amplified DNA sequence encoding 
the BMP-10 protein of the invention "HHd are thus not derived 
froni the DNA sequence presented in SEQ ID NO: 1. 
15 The following oligonucleotide primer ie -designed on the 

basis of nucleotides #1060 to #1037- cf the DNA coquence set 
forth in SEQ ID NO. 1 and synthesized on an automated DNA 
synthesizer: 

Primer B: TAGGGATC CCTTGTAGGTGACGACCCCCTTATC 
20 The first nine nucleotides of primer B (underlined) 

comprise the recognition sequence for the restriction 
endonuclease BamHI which can be utilized to facilitate the 
manipulation of a specifically amplified DNA sequence encoding 
the BMP-10 protein of the invention land are thus not derived 

2 5 from the DNA sequence present in SEQ :ID"NO: 1, 

The standard nucleotide sy:nbols in the above identified 
primers are as follow^t h, adenosine; C, cytosine, G, guanine; 
and T, thymine. 

Primers A and B identified above «re utilised -as -primers to 

3 0 allow the amplification of a specific nucleotide from human 

genomic DNA* the amplification reaction is performed as 
lollowe: 

Human genomic DNA (source: peripheral blood lymphocytes) is 
denatured at i00*C for five minutesi- and then chillP^d on ice 
3 5 prior to addition to a reaction mixture containing 200 fiJA each 

deojcynucleotide triphosphates (dATP, |dGTP, dCTP and dTTP) 10 mM 
Tris-HCl pH8.3, 50 mM KCl, 1.5 mM MgCl2, 0. 001% "gelatin, 1.25 



18 



wo 94/26893 



PCT/US94/05290 



units Taq DNA polymerase, 100 pM oligonucleotide primer A and 
100 pM oligonucleotide primer B. This reaction mixture is then 
subjected to thermal cycling in the following manner: 3 minutes 
at 94**C, 1 minute at 50*»C, 1 minute at 72®C for one cycle, then 
1 minute at 94*»C, 1 minute at 50«C, 1 minute at 72*»C for thirty- 
nine cycles. 

The DNA which is specifically amplified by this reaction is 
separated from the excess oligonucleotide primers A and B 
utilized to initiate the amplification by the use of a DNA 
purification resin based protocol under the conditions suggested 
by the manufacturer. The resulting DNA product is digested with 
the restriction endonucleases Xbal and BamHI, phenol extracted, 
chloroform extracted. Buffer exchange and removal of small 
fragments of DNA resulting from the Xbal/BaHI restriction digest 
is accomplished by dilution of the digested DNA product in 10 mM 
Tris-HCl pHB.O, 1 mM EDTA followed by centrifugation through a 
centricon™ 30 microconcentrator (W.R. Grace & Co., Beverly, Ma.; 
Product #4209) . The resulting Xbal/BamHI digested amplified DNA 
product is subcloned into a plasmid vector (pBluescript) between 
the Xbal and BamHI restriction sites of the polylinker region. 
DNA sequence analysis of the resulting subclones indicates that 
the specifically amplified DNA sequence product encodes a 
portion of the human BMP-10 protein of this invention. The DNA 
sequence (SEQ ID NO. 3) and derived amino acid sequence (SEQ ID 
NO. 4) of this specifically amplified DNA fragment are set forth 
in the Sequence Listings. 

Nucleotides #1 to #29 of this sequence comprise a portion 
of oligonucleotide primer A and nucleotides #168 to #197 
comprise a portion of oligonucleotide primer B utilized to 
perform the specific amplification reaction. Due to the 
function of oligonucleotide primers A and B (designed on the 
basis of bovine BMP-10 DNA sequence) in initiating the 
amplification reaction, they may not correspond exactly to the 
actual sequence encoding a human BMP-10 and are therefore not 
translated in the above amino acid sequence derivation. The DNA 
sequence, from nucleotide #30 to #167 of SEQ ID NO: 3, or 
portions thereof, specifically amplified from the human genomic 



19 



wo 94/26893 



PCTAJS94/05290 



DNA template can be utilized as a probe to identify additional 
human BMP-10 encoding sequences from human genomic or human cDNA 
libraries by standard hybridization/screening techniques known 
to those skilled in the art. 
5 Full -length Human BMP- 10 

The full-length human BMP-IO DNA sequence (SEQ ID NO: 10) 
and encoded amino acids sequence (SEQ ID NO: 11) are described in 
the Sequence Listings. 

One million recombinants of a human fetal liver cDNA 

10 library (Clonetech catalog # HL 1064a) constructed in the vector 

XgtlO are plated at a density of 20,000 recombinant bacteriophge 
plaques per plate on 50 plates. Duplicate nitrocellulose 
replicas of the recombinant bacteriophage plaques are made from 
these plates. An oligonucleotide probe designed on the basis of 

15 nucleotides #85-#114 of SEQ ID NO: 3 is synthesized on an 

automated DNA synthesizer. This oligonucleotide probe is 
radioactively labelled with y^P-ATP and is hybridized to both 
sets of the duplicate nitrocellulose replicas in SH6 at 65°C. 
Eleven positively hybridizing recombinants are noted. One of 

20 the positively hybridizing recombinants, named HFL-3,is plaque 

purified. Bacteriophage plate stocks of the purified HFL-3 cDNA 
clone are prepared and bacteriophage DNA is isolated. A 
bacteriophage stock of this cDNA clone has been deposited with 
the ATCC, 12301 Parklawn Drive, Rockville, Maryland USA under 

25 the requirements of the Budapest Treaty and designated as ATCC 

# . A portion of the DNA sequence of clone HFL-3 is set 

forth in SEQ ID NO: 10. 

One million recombinants of a human genomic library 
(Stratagene Catalog # 944201) constructed in the vector Xfix are 

30 plated at a density of 20,000 recombinant bacteriophge plaques 

per plate on 50 plates. Duplicate nitrocellulose replicas of 
the recombinant bacteriophage plaques are made from these 
plates. An oligonucleotide probe designed on the basis of 
nucleotides #355-#384 of SEQ ID NO: 10 is synthesized on an 

35 automated DNA synthesizer. This oligonucleotide probe is 

radioactively labelled with y^P-ATP and is hybridized to both 
sets of the duplicate nitrocellulose replicas in SHB at 65^C. 



20 



wo 94/26893 



PCT/US94/05290 



Six positively hybridizing recombinants are noted. One of the 
positively hybridizing recombinants, named 20GEN.3,is plaque 
purified. Bacteriophage plate stocks of the purified 20GEN.3 
genomic clone are prepared and bacteriophage DNA is isolated. 
5 A bacteriophage stock of this genomic clone has been deposited 

with the ATCC, 12301 Parklawn Drive, Rockville, Maryland USA 
under the requirements of the Budapest Treaty and designated as 

ATCC # . A portion of the DNA sequence of clone 20GEN.3 is 

set forth in SEQ ID NO: 10. A portion of the DNA sequence of 

10 the genomic clone 2 0GEN.3 was determined to be identical to a 

portion of the DNA sequence of the cDNA clone HFL-3 . The extent 
of this overlap (nucleotides #219-#316) of SEQ ID NO: 10 were 
used as a basis to compile the complete coding sequence of the 
BMP-10 protein. This sequence is presented in SEQ ID NO: 10 and 

15 it should be noted that nucleotides #1-#218 are derived entirely 

from the DNA sequence contained in genomic clone 20GEN.3 and 
nucleotides #317-#1584 are derived entirely from the DNA 
sequence contained in cDNA clone HFL-3, while nucleotides #219- 
#316 have been determined to be present in both 20GEN.3 and HFL- 

20 3. SEQ ID NO: 10 predicts a human BMPIO precursor protein of 424 

amino acids. Based on the knowledge of other BMPs and other 
proteins within the TGF-)8 family, it is predicted that the 
precursor polypeptide would be cleaved at the multibasic 
sequence ARG-ILE-ARG-ARG (amino acids #-4 through #-1 of SEQ ID 

25 NO: 11) in agreement with the proposed consensus proteolytic 

processing sequence ARG-X-X-ARG. Cleavage of the human BMP-10 
precursor polypeptide at this location would generate a 108 
amino acid mature peptide beginning with the amino acid ASN at 
position #1 of SEQ ID NO:ll. The processing of human BMP-10 

30 into the mature form is expected to involve dimerization and 

removal of the N-terminal region in a manner analogous to the 
processing of the related protein TGF-)8 [L.E. Gentry, et al. 
Molec. & Cell. Biol. 8:4162 (1988); R.Derynck, et al. , Nature 
316:701 (1985). It is contemplated that the mature active 

35 species of human BMP-10 comprises a homodimer of two polypeptide 

subunits, each subunit comprising amino acids #1-#108 of SEQ ID 
NO: 11, with a predicted molecular weight of 12,000 daltons. 



21 



wo 94/26S93 



■FCT/US94/0529Q 



Further active species are contemplated comprising amino atjids 
#7'^#108 thereby including the first cohserved cysteine residue. 
Heterodittieric molecules comprising onTr~subunit of BMP^IO and 
another subunit of another member of the- BMP/TGF»)S— cuperf amily 
5 are also contemplated. 

Additional wethods known to those ;-G4ci lied in the art may be 
used to isolate other species' BMP-10 proteins Of the invention. 
EXAMPLE 3 
W-?.n RT OAaSAYS 

10 A. ne.ficriiDti o n of W-2Q C^lls 

Use of the \i^20 bone marrow stromal cells as an indicator 
cell line is based upon the conversioxj of these cells to 
osteoblast-like cells after treatment ivtith a BMP protein [Thies 
et al, Journal of Bo n e and Mineral Researc h. 5:305 (1990); and 

15 Thies et al, Endocrinology , 130:1318 (;rcL92)3. — Specifically, 

20 cells are a clonal bone marrow stromal cell line derived from 
adult inice by researchers in the labor-story of Dr. D- Nathan, 
Children's Hospital, Boston, MA* Treatment of W-20 cells with 
certain BMP proteins results in ; <l) increased — alkaline 

2 0 phosphatase production, (2) induction of PTH stimulated cAMP, 

and (3) induction of osteocalcin synthesis by the cells. While 
(1) and (2) represent characteristics associated with the 
osteoblast phenotype, the ability to isynthesize osteocalcin is 
a phenotypic property only displayed by mature osteoblasts. 

2 5 Furthermore^ to date we have observed conversion -of W-20 stromal 

cells to osteoblast-like cells only upon treatment wi±b BMPs. 
Jn this manner, the ij^ vitro activitieSnaisplayed by BMP treated 
W-20 oelXs correlate with the ifl viivo bone forming activity 
known for BMPo, 

3 0 Below two in vitiro assays usef ul in comp arison of BMP 

activities of novel osteoinductive mojleculoG -are described - 
B . W->20 A lkaline Ph osp hatase Assay Protocol 
W-20 cells are plated into 96 well tissue cultus^o plates at 

a density of 10,000 cells per well in: 200 ul-of—Media^DME with 
35 10% heat inactivated fetal calf seruin, 2 mM glutamine and loo 

Units/ml penicillin + 100 /xg/ml streptomycin. The -cells are 

allowed to attach overnight in a 95^ -an-, —5% COj incubator at 



wo 94/26893 



PCT/US94/0S290 



37«C, 

The 200 /il of media is removed from each veil with a 
multichannel pipettor and replaced with an equal volume of test 
sample delivered in DME with 10% heat inactivated fetal calf 
serum, 2 mM glutamine and 1% penicillin-streptomycin. Test 
substances are assayed in triplicate. 

The test samples and standards are allowed a 24 hour 
incubation period with the W-20 indicator cells. After the 24 
hours, plates are removed from the 37 incubator and the test 
media are removed from the cells. 

The W-20 cell layers are washed 3 times with 200 /xl per 
well of calciiUD/magnesium free phosphate buffered saline and 
these washes are discarded. 

50 /il of glass distilled water is added to each well and 
the assay plates are then placed on a dry ice/ethanol bath for 
quick freezing. Once frozen, the assay plates are removed from 
the dry ice/ethanol bath and thawed at 37 *C. This step is 
repeated 2 more times for a total of 3 freeze-thaw procedures. 
Once complete, the membrane bound alkaline phosphatase is 
available for measurement. 

50 /il of assay mix (50 mM glycine, 0.05% Triton X-100, 4 mM 
MgClj, 5 mM p-nitrophenol phosphate, pH = 10.3) is added to each 
assay well and the assay plates are then incubated for 30 
minutes at 37«*C in a shaking waterbath at 60 oscillations per 
minute. 

At the end of the 30 minute incubation, the reaction is 
stopped by adding 100 /il of 0.2 N NaOH to each well and placing 
the assay plates on ice. 

The spectrophotometric absorbance for each well is read at 
a wavelength of 405 nanometers. These values are then compared 
to known standards to give an estimate of the alkaline 
phosphatase activity in each sample. For example, using known 
amounts of p-nitrophenol phosphate, absorbance values are 
generated. This is shown in Table I. 



23 



wo 94/26893 



PCT/US94/05290 



Table I 



Absorbance Values for 
of P-Nitrophenol 

P-nitroohenol tJhosDhate umoles 


Known St.andards 
Phosphate 

Mean absorbance f405 nin) 


0.000 


0 


0.006 


0.261 +/- .024 


0.012 


0.521 +/- .031 


0.018 


0.797 +/- .063 


0.024 


1.074 +/- .061 


0.030 


1.305 +/- .083 



Absorbance values for known amounts of BKPs can be 
determined and converted to ^moles of p-nitrophenol phosphate 
5 cleaved per unit time as shown in Table II. 



Table II 



Alkaline Phosphatase Values for 


W-20 Cells 




Treating with BMP-2 




BMP-2 concentration 


Absorbance Reading 


umoles substrate 


na/ml 


405 nmeters 


per hour 


0 


0.645 


0.024 


1.56 


0.696 


0.026 


3.12 


0.765 


0.029 


6.25 


0.923 


0.036 


12.50 


1.121 


0.044 


25.0 


1.457 


0.058 


50.0 


1.662 


0.067 


100.0 


1.977 


0.080 



10 

These values are then used to compare the activities of 
known amounts of BMP-10 to BMP-2. 
C. Osteocalcin RIA Protocol 

W-20 cells are plated at 10^ cells per well in 24 well 

24 



wo 94/26893 



PCT/US94/0S290 



multiwell tissue culture dishes in 2 mis of DME containing 10% 
heat inactivated fetal calf serum, 2 mM glutamine. The cells 
are allowed to attach overnight in an atmosphere of 95% air 5% 
COj at 37<»C. 

5 The next day the medium is changed to DME containing 10% 

fetal calf serum, 2 mM glutamine and the test substance in a 
total volume of 2 ml. Each test substance is administered to 
triplicate wells. The test substances are incubated with the W- 
20 cells for a total of 96 hours with replacement at 48 hours by 

10 the same test roedias. 

At the end of 96 hours, 50 /zl of the test media is removed 
from each well and assayed for osteocalcin production using a 
radioimmunoassay for mouse osteocalcin. The details of the 
assay are described in the kit manufactured by Biomedical 

15 Technologies Inc., 378 Page Street, Stoughton, MA 02072. 

Reagents for the assay are found as product numbers BT-4 31 
(mouse osteocalcin standard) , BT-432 (Goat anti-mouse 
Osteocalcin), BT-431R (iodinated mouse osteocalcin), BT-415 
(normal goat serum) and BT-414 (donkey anti goat IgG) . The RIA 

20 for osteocalcin synthesized by W-20 cells in response to BMP 

treatment is carried out as described in the protocol provided 
by the manufacturer. 



25 



30 



The values obtained for the test samples are compared to 
35 values for known standards of mouse osteocalcin and to the 

amount of osteocalcin produced by W-20 cells in response to 
challenge with known amounts of BMP-2. The values for BMP-2 

25 



wo 94/26893 



prrr/uffi>4/05290 



induced osteocalcin synthesis by w-2 0 . calls - is . sHown in Table 
Til. 



TAblo III 



Osteocalcin Synthesis by-W-20 Cells 
BMP-2 Conce ntra tion ng/ml Osteocalcin Synthesis ng/weUL 



0 




2 


: — -^=0*9 


4 


... 0.8 


s 




16 


2*7 


31 


3.2 


62 


r -5.1 


125 




250 


' 8.2 


500 


9.4 


1000 


10. 0 



EXAMPLE 4 

ROSEN MODIFIED SAMPATH-REDDI ASSAY 

A modified version of the rjat bone 
described in Sampath and Reddi, Prdc. Natl. 



formation 
Acad. Sci. 



assay 
USA . 



10 80:6591-6595 (1983) is used to evaliiate bone and/or cartilage 

activity of BMP proteins. This modified assay is herein called 
the Rosen-modified sampath-Reddi ; — assay. The ethanol 

precipitation step of the sampath-Red^i procedure is replaced by 
dialyzing (if the composition is a solution) or diafiltering (if 

15 the composition is a suspension) the -fraction tor be assayed 

against water. The solution or suspension rs-t.hen- equilibrated 
to 0.1% TFA. The resulting solutioq is added'^o 20-mg-of rat 
matrix, A mock rat matrix sample not treatsd^ith the protein 
serves as a control. This loaterial j ic "frozen and lyophilized 

2 0 and the resulting powder enclosed in; #5 gelatin capsules. The 

capsules are implanted subcutaneous ly in the abdominal thoracic 
area of 21-4 9 day old male T.ong Eva^is rats. The implants are 
removed aftor 7-14 days. Half of 
alkaline phosphatase analysis [see^ 

25 Ace^d- Sci ., 69X1601 (1972)], 



•each implant is used for 
Rsddi et al, Proc. Natl. 



wo 94/26893 



PCT/US94/05290 



The other half of each implant is fixed and processed for 
histological analysis. 1 /im glycolmethacrylate sections are 
stained with Von Kossa and acid fuschin to score the amount of 
induced bone and cartilage formation present in each implant. 
5 The terms +1 through +5 represent the area of each histological 

section of an implant occupied by new bone and/or cartilage 
cells and matrix. A score of +5 indicates that greater than 50% 
of the implant is new bone and/or cartilage produced as a direct 
result of protein in the implant. A score of +4, +3^ +2, and +1 
10 would indicate that greater than 40%, 30%, 20% and 10% 

respectively of the implant contains new cartilage and/or bone. 

The BMP-10 proteins of this invention may be assessed for 
activity on this assay. 

15 EXAMPLE 5 

Expression of BMP^IO 

In order to produce bovine, human or other mammalian BMP-10 
proteins, the DNA encoding it is transferred into an 
appropriate expression vector and introduced into mammalian 

20 cells or other preferred - eukaryotic or prokaryotic hosts by 

conventional genetic engineering techniques. The preferred 
expression system for biologically active recombinant human BMP- 
10 is contemplated to be stably transformed mammalian cells. 

One skilled in the art can construct mammalian expression 

25 vectors by employing the sequence of SEQ ID NO: 1 or SEQ ID NO: 

10, or other DNA sequences encoding BMP-10 proteins or other 
modified sequences and known vectors, such as pCD [Okayama et 
alw Mol. Cell Biol. . 2:161-170 (1982)], pJL3, pJL4 [Gough et 
al., EMBO J^, 4:645-653 (1985)] and pMT2 CXM. 

30 The mammalian expression vector pMT2 CXM is a derivative of 

p91023(b) (Wong et al.. Science 228 :810-815^ 1985) differing 
from the latter in that it contains the ampicillin resistance 
gene in place of the tetracycline resistance gene and further 
contains a Xhol site for insertion of cDNA clones. The 

35 functional elements of pMT2 CXM have been described (Kaufman, 

R.J., 1985, Proc. Natl. Acad. Sci. USA 82:689-693) and include 
the adenovirus VA genes, the SV40 origin of replication 



27 



wo 94/26893 



PCT/US94/05290 



including the 72 bp enhancer, the adenovirus major late promoter 
including a 5' splice site and the majority of the adenovirus 
tripartite leader sequence present on adenovirus late mRNAs, a 
3' splice acceptor site, a DHFR insert, the SV40 early 
polyadenylation site (SV4 0) , and pBR322 sequences needed for 
propagation in coli , 

Plasmid pMT2 CXM is obtained by EcoRI digestion of pMT2- 
VWF, which has been deposited with the American Type Culture 
Collection (ATCC) , Rockville, MD (USA) under accession number 
ATCC 67122. EcoRI digestion excises the cDNA insert present in 
pMT2-VWF, yielding pMT2 in linear form which can be ligated and 
used to transform E. coli HB 101 or DH-5 to ampicillin 
resistance. Plasmid pMT2 DNA can be prepared by conventional 
methods. pMT2 CXM is then constructed using loopout/in 
mutagenesis [Morinaga, et al* , Biotechnoloav 84 ; 636 (1984) • 
This removes bases 1075 to 1145 relative to the Hind III site 
near the SV40 origin of replication and enhancer sequences of 
pMT2, In addition it inserts the following sequence: 

5' PO-CATGGGCAGCTCGAG-3 ' 
at nucleotide 1145. This sequence contains the recognition site 
for the restriction endonuclease Xho I. A derivative of 
pMT2CXM, termed pMT23, contains recognition sites for the 
restriction endonucleases PstI, Eco RI, Sail and Xhol. Plasmid 
pMT2 CXM and pMT23 DNA may be prepared by conventional methods. 

pEMC2i?l derived from pMT21 may also be suitable in practice 
of the invention. pMT2l is derived from pMT2 which is derived 
from pMT2-VWF. As described above EcoRI digestion excises the 
cDNA insert present in pMT-VWF, yielding pMT2 in linear form 
which can be ligated and used to transform Ejl. Coli HB 101 or DH- 
5 to ampicillin resistance. Plasmid pMT2 DNA can be prepared by 
conventional methods. 

pMT21 is derived from pMT2 through the following two 
modifications. First, 76 bp of the 5' untranslated region of 
the DHFR cDNA including a stretch of 19 G residues from G/C 
tailing for cDNA cloning is deleted. In this process, a Xhol 
site is inserted to obtain the following sequence iinmediately 
upstream from DHFR: 5' - CTGCAG GCGA-GCCT GAATTCCTCGAG CCATC ATG -3 ^ 



28 



wo 94/26893 



PCT/US94/05290 



PstI Eco RI Xhol 

Second, a unique Clal site is introduced by digestion with EcoRV 
and Xbal, treatment with Klenow fragment of DNA polymerase I, 
and ligation to a Clal linker (CATCGATG) . This deletes a 250 bp 
segment from the adenovirus associated RNA (VAX) region but does 
not interfere with VAI RNA gene expression or function. pMT21 
is digested with EcoRI and Xhol, and used to derive the vector 
PEMC2B1. 

A portion of the EMCV leader is obtained from pMT2-ECATl 
[S.K. Jung, et al, J, Virol 63!l65i-i66Q (1989)] by digestion 
with Eco RI and PstI, resulting in a 2752 bp fragment. This 
fragment is digested with TaqI yielding an Eco RI-TaqI fragment 
of 508 bp which is purified by electrophoresis on low melting 
agarose gel. A 68 bp adapter and its complementary strand are 
synthesized with a 5' TaqI protruding end and a 3' Xhol 
protruding end which has the following sequence: 

5 ' -CGAGGTTAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTT 
20 TaqI 

GAAAAACACGATTGC-3 ' 
Xhol 

25 This sequence matches the EMC virus leader sequence from 

nucleotide 763 to 827. It also changes the ATG at position 10 
within the EMC virus leader to an ATT and is followed by a Xhol 
site. A three way ligation of the pMT21 Eco Rl-Xhol fragment, 
the EMC virus EcoRI -TaqI fragment, and the 68 bp 

30 oligonucleotide adapter Taql-Xhol adapter resulting in the 

vector pEMC2/Sl. 

This vector contains the SV40 origin of replication and 
enhancer, the adenovirus major late promoter, a cDNA copy of the 
majority of the adenovirus tripartite leader sequence, a small 
, 35 hybrid intervening sequence, an SV40 polyadenylation signal and 

the adenovirus VA I gene, DHFR and jS-lactamase markers and an 
IMC sequence, in appropriate relationships to direct the high 
level expression of the desired cDNA in mammalian cells. 

The construction of vectors may involve modification of the 

29 



10 



15 



wo 94/26893 



PCT/US94/0S290 



BMP-10 DNA sequences. For instance, BMP-10 cDNA can be modified 
by removing the non-coding nucleotides on the 5' and 3' ends of 
the coding region. The deleted non-coding nucleotides may or 
may not be replaced by other sequences known to be beneficial 
5 for expression. These vectors are transformed into appropriate 

host cells for expression of BMP-10 proteins. Additionally, the 
sequence of SEQ ID N0:1 or SEQ ID NO: 10 or other sequences 
encoding BMP-10 proteins can be manipulated to express a mature 
BMP-10 protein by deleting BMP-10 encoding propeptide sequences 

10 and replacing them with sequences encoding the complete 

propeptides of other BMP proteins. 

One skilled in the art can manipulate the sequences of SEQ 
ID NO: 1 or SEQ ID NO: 10 by eliminating or replacing the 
mammalian regulatory sequences flanking the coding sequence with 

15 bacterial sequences to create bacterial vectors for 

intracellular or extracellular expression by bacterial cells. 
For example, the coding sequences could be further manipulated 
(e.g. ligated to other known linkers or modified by deleting 
non-coding sequences therefrom or altering nucleotides therein 

20 by other known techniques) . The modified BMP-10 coding sequence 

could then be inserted into a known bacterial vector using 
procedures such as described in T. Taniguchi et al., Proc. Natl 
Acad. Sci. USA . 77:5230-5233 (1980). This exemplary bacterial 
vector could then be transformed into bacterial host cells and 

25 a BMP-10 protein expressed thereby. For a strategy for 

producing extracellular expression of BMP-10 proteins in 
bacterial cells, see, e.g. European patent application EPA 
177,343. 

Similar manipulations can be performed for the construction 
30 of an insect vector [See, e.g. procedures described in published 

European patent application 155,476] for expression in insect 
cells. A yeast vector could also be constructed employing yeast 
regulatory sequences for intracellular or extracellular 
expression of the factors of the present invention by yeast 
35 cells. [See, e.g., procedures described in published PCT 

application WO86/00639 and European patent application EPA 
123,289]. 



30 



wo 94/26893 



PCT/US94/05290 



A method for producing high levels of a BMP-10 protein of 
the invention in mammalian cells may involve the construction of 
cells containing multiple copies of the heterologous BMP-10 
gene. The heterologous gene is linked to an amplifiable marker, 
5 e.g. the dihydrof olate reductase (DHFR) gene for which cells 

containing increased gene copies can be selected for propagation 
in increasing concentrations of methotrexate (MTX) according to 
the procedures of Kaufman and Sharp, J. Mol. Biol. , 159:601-629 
(1982). This approach can be employed with a number of 

10 different cell types. 

For example, a plasmid containing a DNA sequence for a BMP- 
10 of the invention in operative association with other plasmid 
sequences enabling expression thereof and the DHFR expression 
plasmid pAdA26SV(A)3 [Kaufman and Sharp, Mol. Cell. Biol. . 

15 2:1304 (1982)] can be co-introduced into DHFR-def icient CHO 

cells, DUKX-BII, by various methods including calcium phosphate 
coprecipitation and transf ection, electroporation or protoplast 
fusion. DHFR expressing transf ormants are selected for growth 
in alpha media with dialyzed fetal calf serum, and subsequently 

20 selected for amplification by growth in increasing 

concentrations of MTX (e.g. sequential steps in 0.02, 0.2, 1.0 
and 5uM MTX) as described in Kaufman et al., Mol Cell Biol. ^. 
5:1750 (1983). Transf ormants are cloned, and biologically 
active BMP-10 expression is monitored by the Rosen-modified 

25 Sampath-Reddi rat bone formation assay described above in 

Example 4. BMP-10 expression should increase with increasing 
levels of MTX resistance. BMP-10 polypeptides are characterized 
using standard techniques known in the art such as pulse 
labeling with [35S] methionine or cysteine and polyacrylamide 

30 gel electrophoresis. Similar procedures can be followed to 

produce other related BMP-10 proteins. 
EXAMPLE 6 

Biological Activity of Expressed BMP-IO 

To measure the biological activity of the expressed BMP-10 
35 proteins obtained in Example 5 above, the proteins are recovered 

from the cell culture and purified by isolating the BMP-1-0 
proteins from other proteinaceous materials with which they are 

31 



wo 94/26893 



PCT/US94/05290 



co-produced as well as from other contaminants • The purified 
protein may be assayed in accordance with the rat bone formation 
assay described in Example 4 • 

Purification is carried out using standard techniques known 

to those skilled in the art. 

Protein analysis is conducted using standard techniques 
such as SDS-PAGE acrylamide [Laemmli, Nature 227:680 (1970)] 

stained with silver [Oakley, et al. Anal. pjLocnem. 105:361 

(1980)] and by immunoblot [Towbin, et al. Proc. Natl. Acad. Scj. 
USA 76:4350 (1979) ] 

The foregoing descriptions detail presently preferred 
embodiments of the present invention. Numerous modifications 
and variations in practice thereof are expected to occur to 
those skilled in the art upon consideration of these descrip- 
tions. Those modifications and variations are believed to be 
encompassed within the claims appended hereto. 



32 



wo 94/26893 



PCTAJS94/05290 



SEQUENCE LISTING 



(1) GENERAL INFORMATION: 

(i) APPLICANT: 

(A) NAME: GENETICS INSTITUTE, INC. 

(B) STREET: 87 CambridgePark Drive 

(C) CITY: Cambridge 

(D) STATE: MaesachuBetts 

(E) COUNTRY I USA 

(F) POSTAL CODE (ZIP): 02140 

(G) TELEPHONE: 617 876-1170 

(H) TELEFAX: 617 876-5851 

(ii) TITLE OF INVENTION: BMP-10 COMPOSITIONS 
(iii) NUMBER OF SEQUENCES: 11 

(iv) COMPUTER READABLE FORM: 

(A) MEDIUM TYPE: Floppy disk 

(B) COMPUTER: IBM PC compatible 

(C) OPERATING SYSTEM: PC-DOS/MS-DOS 

(D) SOFTWARES Patentin Release #1.0, Version #1.25 (EPO) 



(2) INFORMATION FOR SEQ ID NO: 1: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 1442 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: double 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 

(vi) ORIGINAL SOURCE: 

(A) ORGANISM: Bo8 tauruB 

(B) STRAIN: bovine BMP-10 

(ix) FEATURE: 

(A) NAME/KEY: CDS 

(B) LOCATION: 167.. 1105 

(ix) FEATURE: 

(A) NAME/KEY: mi8C_feature 

(B) LOCATION: 165.. 778 

(D) OTHER INFORMATION: /note= "partial coding sequence for 
propeptide" 

(ix) FEATURE: 

(A) NAME/KEY: mat_peptide 

(B) LOCATION: 779.. 1102 

(D) OTHER INFORMATION: /note= "beginning of mature 
peptide- 

(ix) FEATURE: 

(A) NAME/KEY: miBC_feature 

(B) LOCATION: 163.. 164 

(D) OTHER INFORMATION: /note= "3' end of intron" 



(ix) FEATURE: 

(A) NAME/KEY: miBC feature 

(B) LOCATION: 165.7l66 



33 



wo 94/26893 



PCTAJS94/05290 



(D) OTHER INFORMATION: /note= "the last two-thirds of a 
codon which ia interrupted by an intron- 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1: 

TTCGGTACTT CCTCTTAGAG AATGCCAACA CTGTGTTTGT TTTCACTGAT TTTCCTTCAT 60 

TCTTTCTGTG TGGAGAGAAT GGACAGGCAC TCTTATTGCA TAAATAAGCA TCTGTTTTCC 120 

TCTGCTACAT GCTGCAAATC TGATTTCTTT TTTGTTTTTT CCAGAT CTG TTT TCC 175 

Leu Phe Ser 
-204 

CAA CCA GCC AGT TTT AAT GGA CTC CGA AAA TAC CCT CTC CTC TTC AAC 223 
Gin Pro Ala Ser Phe Aen Gly Leu Arg Lye Tyr Pro Leu Leu Phe Aen 
-200 -195 -190 

GTA TCC ATC CCT CAC CAT GAA GAC ATC ATC ATG OCT GAG CTC AGG TTG 271 
Val Ser He Pro His His Glu Asp He He Met Ala Glu Leu Arg Leu 
-185 -180 -175 -170 

TAC ACC CTG GTG CAA AGA GAC CGC CTT ATA TAT GAA GGA GTG GAC OGA 319 
Tyr Thr Leu Val Gin Arg Asp Arg Leu He Tyr Glu Gly Val Asp Arg 
-165 -160 -155 

AAA ATC ACC ATT TTT GAA GTA CTT GAG AGC AAA GAG GAC CAT GAA GGG 367 
Lvs He Thr He Phe Glu Val Leu Glu Ser Lys Glu Asp His Glu Gly 
-150 -145 -140 

GAA AGA AAC ATG CTG GTC TTG GTG TCA GGG GAG ATC TAC GGA ACC AAC 415 
Glu Arg Asn Met Leu Val Leu Val Ser Gly Glu He Tyr Gly Thr Asn 
-135 -130 -125 

AGT GAG TGG GAG ACT TTT GAT GTC ACT GAT GCC ATC AGG CAT TGG CAA 463 
ser Glu Trp Glu Thr Phe Asp Val Thr Asp Ala He Arg His Trp Gin 
-120 -115 -110 

AAG TCA GGC TCA TCC ACC CAC CAG CTG GAG GTC CAC ATT GAG AGC AAA 511 
Lvs Ser Gly Ser Ser Thr His Gin Leu Glu Val His He Glu Ser Lys 
-105 -100 -95 -90 

CAC GAA ATG GAG GAC ACA CTT GGC AGG GGA CAG CTG GAA ATA GAC ACT 559 
His Glu Met Glu Asp Thr Leu Gly Arg Gly Gin Leu Glu He Asp Thr 
-85 -80 -75 

AGT GCC CGG AAT AAG CAC GAT CCT TTG CTT GTC GTG TTT TCT GAT GAC 607 
Ser Ala Arg Asn Lys His Asp Pro Leu Leu Val Val Phe Ser Asp Asp 
-70 -65 -60 

CAA AGC AGT GAG AAG GAG CGG AAA GAG GAA CTG GAT GAA ATG ATC GCC 655 
Gin Ser Ser Glu Lys Glu Arg Lys Glu Glu Leu Asp Glu Met He Ala 
-55 -50 -45 

CAC GAG CAA TTC CCA GAG ATG GAC AAC CTG GAT TTG GAC GGT TAT TCC 703 
His Glu Gin Phe Pro Glu Met Asp Asn Leu Asp Leu Asp Gly Tyr Ser 
-40 -35 -30 

AAC GGA CCT GGG GAA GAG GCT TTG CTG CAG ATG AGG TCG AAT ATC ATC 751 
Asn Gly Pro Gly Glu Glu Ala Leu Leu Gin Met Arg Ser Asn He He 
-25 -20 -15 -10 

TAT GAC TCC ACT GCC CGC ATC AGA AGG AAT GCA AAA GGA AAC TAC TGC 799 
Tyr Asp Ser Thr Ala Arg He Arg Arg Asn Ala Lys Gly Asn Tyr Cys 
-5 1 5 



34 



wo 94/26893 



PCT/US94/05290 



AAG AGG ACC CCG CTC TAC ATC GAC TTC AAG GAG ATT GGC TGG GAC TCT 847 
Lys Arg Thr Pro Leu Tyr lie Asp Phe Lye Glu He Gly Trp Asp Ser 
10 15 20 

TGG ATC ATC GCT CCA CCT GGA TAT GAA GCC TAT GAA TGT CGT GGT GTT 895 
Trp He He Ala Pro Pro Gly Tyr Glu Ala Tyr Glu Cys Arg Gly Val 
25 30 35 

TGC AAC TAC CCC CTG GCA GAG CAT CTC ACC CCC ACA AAG CAT GCG ATT 943 
Cys Aen Tyr Pro Leu Ala Glu His Leu Thr Pro Thr Lys His Ala He 
40 45 50 55 

ATC CAG GCC TTG GTC CAC CTC AAG AAT TCC CAG AAG GCT TCC AAA GCC 991 
He Gin Ala Leu Val His Leu Lys Asn Ser Gin Lys Ala Ser Lye Ala 
60 65 70 

TGC TGT GTG CCC ACC AAG CTC GAG CCC ATC TCC ATC CTC TAT TTA GAT 1039 
Cys Cys Val Pro Thr Lys Leu Glu Pro He Ser He Leu Tyr Leu Asp 
75 80 85 

AAG GGC GTC GTC ACC TAC AAG TTT AAA TAT GAG GGC ATG GCT GTC TCT 1087 
Lys Gly Val Val Thr Tyr Lys Phe Lys Tyr Glu Gly Met Ala Val Ser 
90 95 100 

GAA TGT GGC TGT AGA TAGGAGAGGA ATCCTGTGGC TTATTTAATA ACTGTAAATG 1142 
Glu Cys Gly Cys Arg 
105 

TGTATATTTT GTGTTCCTAT TTAATGAGAT TATTTAATAA GGGTGTACAG ATCATAGAGG 1202 

CTTGCTGCCT TAGGGAATTT GACAGGTCGG TTTGTTGTAG GAAATCCATG TTTTACTCTA 1262 

CAGTCGAGTC CCTTCCAATC TATTTTTCTT TGGACTTACC ATGTCCTGCA ATGCCATCTC 1322 

TAACAGCAAG GCAAGCCCAC ACTACTTGCC TTCTATGTCA ATTCAAAAGG AACACCGCTA 1382 

AGCAGAAATA CAGTGTCAGG AGAGGTAGAT ATTTGTGTAT GTATATGTGT ACATAGATAA 1442 

(2) INFORMATION FOR SEQ ID NO: 2: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 312 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2: 

Leu Phe Ser Gin Pro Ala Ser Phe Asn Gly Leu Arg Lys Tyr Pro Leu 
-204 -200 -195 -190 

Leu Phe Asn Val Ser He Pro His His Glu Asp He He Met Ala Glu 
-185 -180 -175 

Leu Arg Leu Tyr Thr Leu Val Gin Arg Asp Arg Leu He Tyr Glu Gly 
-170 -165 -160 

Val Asp Arg Lys He Thr He Phe Glu Val Leu Glu Ser Lys Glu Asp 
-155 -150 -145 

His Glu Gly Glu Arg Asn Met Leu Val Leu Val Ser Gly Glu He Tyr 
-140 -135 -130 -125 

Gly Thr Asn Ser Glu Trp Glu Thr Phe Asp Val Thr Asp Ala He Arg 



35 



wo 94/26893 PCT/US94/0S290 

-120 ^115 -110 

Hie Trp Gin Lys Ser Gly Ser Ser Thr His Gin I*eu Glu Val His lie 
-105 -100 -95 

Glu Ser Lya His Glu Met Glu Asp Thr Leu Gly Arg Gly Gin Leu Glu 
-90 -85 -80 

He Asp Thr Ser Ala Arg Asn Lys His Asp Pro Leu Leu Val Val Phe 
-75 "70 -65 

Ser Asp Asp Gin Ser Ser Glu Lys Glu Arg Lys Glu Glu Leu Asp Glu 
-60 -55 -50 -45 

Met He Ala His Glu Gin Phe Pro Glu Met Asp Asn Leu Asp Leu Asp 
-40 -35 -30 

Glv Tvr Ser Asn Gly Pro Gly Glu Glu Ala Leu Leu Gin Met Arg Ser 
^ ^ -25 -20 -15 

Asn He He Tyr Asp Ser Thr Ala Arg lie Arg Arg Asn Ala Lys Gly 
-10 -5 1 

Asn Tyr Cys Lys Arg Thr Pro Leu Tyr He Asp Phe Lys Glu He Gly 
5 10 15 20 

Trp Asp Ser Trp He He Ala Pro Pro Gly Tyr Glu Ala Tyr Glu Cys 
25 30 35 

Aro Gly Val Cys Asn Tyr Pro Leu Ala Glu His Leu Thr Pro Thr Lys 
40 45 50 

His Ala He He Gin Ala Leu Val His Leu Lys Asn Ser Gin Lys Ala 
55 60 65 

Ser Lys Ala Cys Cys Val Pro Thr Lys Leu Glu Pro He Ser He Leu 
70 75 80 

Tvr Leu Asp Lys Gly Val Val Thr Tyr Lys Phe Lys Tyr Glu Gly Met 
85 90 95 100 

Ala Val Ser Glu Cys Gly Cys Arg 
105 



(2) INFORMATION FOR SEQ ID NO: 3: 

(1) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 197 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: double 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: UNA (genomic) 

(vi) ORIGINAL SOURCE: 

(A) ORGANISM: Homo sapiens 

(B) STRAIN: Human BMP-10 

(ix) FEATURE: 

(A) NAME/KEY: CDS 

(B) LOCATION: 30.. 167 



36 



wo 94/26893 



PCTAJS94/05290 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3: 

TCTAGACCTA TGAATGTCGT GGTGTTTGC AAC TAC CCC CTG GCA GAG CAT CTC 53 

Aen Tyr Pro Leu Ala Glu His Leu 
1 5 

ACA CCC ACA AAG CAT CCA ATT ATC CAG GCC TTG GTC CAC CTC AAG AAT 101 
Thr Pro Thr Lye Hie Ala He He Gin Ala Leu Val His Leu Lys Asn 
10 15 20 

TCC CAG AAA GCT TCC AAA GCC TGC T6T GT6 CCC ACA AAG CTA GAG CCC 149 
Ser Gin Lye Ala Ser Lye Ala Cys Cye Val Pro Thr Lye Leu Glu Pro 
25 30 35 40 

ATC TCC ATC CTC TAT TTA GATAAGGGCG TCGTCACCTA CAAGGGATCC 197 
He Ser He Leu Tyr Leu 
45 



(2) INFORMATION FOR SEQ ID NO: 4: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 46 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGy: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4: 

Asn Tyr Pro Leu Ala Glu Hie Leu Thr Pro Thr Lye Hie Ala He He 
15 10 15 

Gin Ala Leu Val Hie Leu Lye Aen Ser Gin Lye Ala Ser Lye Ala Cys 
20 25 30 

Cye Val Pro Thr Lye Leu Glu Pro He Ser He Leu Tyr Leu 
35 40 45 



(2) INFORMATION FOR SEQ ID NO: 5: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 32 baee paire 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 

(vi) ORIGINAL SOURCE: 

(A) ORGANISM: primer A to bovine BMP-10 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5: 
T6CTCTAGAC CTATGAATGT CGTGGTGTTT GC 32 
(2) INFORMATION FOR SEQ ID NO: 6: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 33 base paire 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 



37 



wo 94/26893 



PCT/US94/0S290 



<D) TOPOLOGY: linear 
(ii) MOLECULE TYPE? DNA (genomic) 

(vi) ORIGINAL SOURCE: 

(A) ORGANISM: primer B to BMP-10 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6: 
TAGGGATCCC TTGTA6GTGA CGACGCCCTT ATC 33 
(2) INFORMATION FOR SEQ ID NO: 7: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 15 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECtJLE TYPE: DNA (genomic) 

(vi) ORIGINAL SOURCE: 

(A) ORGANISM: DNA inserted into pMT2 CXM 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7: 

CATGGGCAGC TCGAG 15 

(2) INFORMATION FOR SEQ ID NO: 8: 

(i) SEQITENCE CHARACTERISTICS: 
<A) LENGTH: 34 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 

(vi) ORIGINAL SOURCE: 

(A) ORGANISM: DNA inserted into pMT21 

(ix) FEATURE: 

(A) NAME /KEY: misc_£eature 

(B) LOCATION: l.*6 

(D) OTHER INFORMATION: /note= "Pstl restriction site" 

(ix) FEATURE: 

(A) NAME/KEY: misc feature 

(B) LOCATION: 15.. ?6 

(D) OTHER INFORMATION: /note- "Eco RI and Xhol restriction 
sites'* 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8: 
CTGCAGGCGA GCCTGAATTC CTCGAGCCAT CATC 34 
(2) INFORMATION FOR SEQ ID NO: 9: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 68 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 



38 



wo 94/26893 



PCTAJS94/05290 



(ii) MOLECULE TYPE: DNA (genomic) 

(vi) ORIGINAL SOURCE: 

(A) ORGANISM: Portion of the EMC virus leader sequence 

(X) PUBLICATION INFORMATION: 

(A) AUTHORS: Jung, S K 

(C) JOURNAL: J. Virol. 

(D) VOLUME: 63 

(F) PAGES: 1651-1660 

(G) DATE: 1989 

<xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9: 
CGAGGTTAAA AAACGTCTAG GCCCCCCGAA CCACGGGGAC GTGGTTTTCC TTT6AAAAAC 
ACGATTGC 

<2) INFORMATION FOR SEQ ID NO: 10: 

(i) SEQUENCE CHARACTERISTICS: 

<A) LENGTH: 15B4 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 

(vi) ORIGINAL SOURCE: 

(A) ORGANISM: Human BMP- 10 



(vii) IMMEDIATE SOURCE: 

(B) CLONE: 20 GEN.3/HFL-3 

( ix ) FEATURE : 

(A) NAME/KEY: CDS 

(B) LOCATION: 160.. 1431 

( ix ) FEATURE : 

(A) NAME/KEY: sig peptide 

(B) LOCATION: 160T.1107 

( ix ) FEATURE : 

(A) NAME/KEY: mat^peptide 

(B) LOCATION: 1108.. 1431 



<xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10: 

GGGGA6A6GA AGAGTGGTAG GGGGA6GGAG AGAGAGAGGA AGAGTTTCCA AACTTGTCTC 60 

CAGTGACAGG AGACATTTAC GTTCCACAAG ATAAAACTGC CACTTAGAGC CCAGGGAAGC 120 

TAAACCTTCC TGGCTTGGCC TAGGAGCTCG AGCGGAGTC AT6 GGC TCT CTG GTC 174 

Met Gly Ser Leu Val 
-316-315 

CTG ACA CTG TGC <;CT CTT TTC TGC CTG GCA GCT TAC TTG GTT TCT GGC 222 
Leu Thr Leu Cys Ala Leu Phe Cys Leu Ala Ala Tyr Leu Val Ser Gly 
-310 -305 -300 

AGO CCC ATC ATG AAC CTA GAG CAG TCT OCT CTG GAA GAA GAT ATG TCC 270 
Ser Pro lie Met Asn Leu Glu Gin Ser Pro Leu Glu Glu Asp Met Ser 
-295 -290 -285 -280 



60 
68 



39 



wo 94/26893 



PCTAJS94/05290 



CTC TTT GGT GAT GTT TTC TCA GAG CAA GAC CGT GTC GAC TTT AAC ACA 318 
Leu Phe Gly Asp Val Phe Ser Glu Gin Asp Gly Val Asp Phe Aen Thr 
-275 -270 -265 

CTG CTC CAG AGC ATG AAG GAT GAG TTT CTT AAG ACA CTA AAC CTC TCT 366 
Leu Leu Gin Ser Met Lye Asp Glu Phe Leu Lys Thr Leu Asn Leu Ser 
-260 -255 -250 

GAC ATC CCC ACG CAG GAT TCA GCC AAG GTG GAC CCA CCA GAG TAC ATG 414 
Asp He Pro Thr Gin Asp Ser Ala Lys Val Asp Pro Pro Glu Tyr Met 
-245 -240 -235 

TTG GAA CTC TAC AAC AAA TTT GCA ACA GAT CGG ACC TCC ATG CCC TCT 462 
Leu Glu Leu Tyr Asn Lys Phe Ala Thr Asp Arg Thr Ser Met Pro Ser 
-230 -225 -220 

GCC AAC ATC ATT AGG AGT TTC AAG AAT GAA GAT CTG TTT TCC CAG CCG 510 
Ala Asn He He Arg Ser Phe Lys Asn Glu Asp Leu Phe Ser Gin Pro 
-215 -210 -205 -200 

GTC AGT TTT AAT GGG CTC CGA AAA TAC CCC CTC CTC TTC AAT GTG TCC 558 
Val Ser Phe Asn Gly Leu Arg Lys Tyr Pro Leu Leu Phe Asn Val Ser 
-195 -190 -185 

ATT CCT CAC CAT GAA GAG GTC ATC ATG 6CT GAA CTT AGG CTA TAC ACA 606 
He Pro His His Glu Glu Val He Met Ala Glu Leu Arg Leu Tyr Thr 
-180 -175 -170 

CTG GTG CAA AGG GAT CGT ATG ATA TAC GAT GGA GTA GAC CGG AAA ATT 654 
Leu Val Gin Arg Asp Arg Met He Tyr Asp Gly Val Asp Arg Lys He 
-165 -160 -155 

ACC ATT TTT GAA GTG CTC GAG AGC AAA GGG GAT AAT GAG GGA GAA AGA 702 
Thr He Phe Glu Val Leu Glu Ser Lys Gly Asp Asn Glu Gly Glu Arg 
-150 -145 -140 

AAC ATG CTG GTC TTG GTG TCT GGG GAG ATA TAT GGA ACC AAC AGT GAG 750 
Asn Met Leu Val Leu Val Ser Gly Glu He Tyr Gly Thr Asn Ser Glu 
-135 -130 -125 -120 

TGG GAG ACT TTT GAT GTC ACA GAT GCC ATC AGA CGT TGG CAA AAG TCA 798 
Trp Glu Thr Phe Asp Val Thr Asp Ala He Arg Arg Trp Gin Lys Ser 
-115 -110 -105 

GGC TCA TCC ACC CAC CAG CTG GAG GTC CAC ATT GAG AGC AAA CAC GAT 846 
Gly Ser Ser Thr His Gin I*eu Glu Val His He Glu Ser Lys His Asp 
-100 -95 -90 

GAA GCT GAG GAT GCC AGC AGT GGA CGG CTA GAA ATA GAT ACC AGT GCC 894 
Glu Ala Glu Asp Ala Ser Ser Gly Arg Leu Glu He Asp Thr Ser Ala 
-85 -80 -75 

CAG AAT AAG CAT AAC CCT TTG CTC ATC GTG TTT TCT GAT GAC CAA AGC 942 
Gin Asn Lys His Asn Pro Leu Leu He Val Phe Ser Asp Asp Gin Ser 
-70 -65 -60 

AGT GAC AAG GAG AGG AAG GAG GAA CTG AAT GAA ATG ATT TCC CAT GAG 990 
Ser ASP Lys Glu Arg Lys Glu Glu Leu Asn Glu Met He Ser His Glu 
-55 -50 -45 -40 

CAA CTT CCA GAG CTG GAC AAC TTG GGC CTG GAT AGC TTT TCC AGT GGA 1038 
Gin Leu Pro Glu Leu Asp Asn Leu Gly Leu Asp Ser Phe Ser Ser Gly 
-35 -30 -25 

CCT GGG GAA GAG GCT TTG TTG CAG ATG AGA TCA AAC ATC ATC TAT GAC 1086 
Pro Gly Glu Glu Ala Leu Leu Gin Met Arg Ser Asn He He Tyr Asp 



40 



wo 94/26893 



PCT/US94/05290 



-20 -15 -10 

TCC ACT GCC CGA ATC AGA AGO AAC GCC AAA GGA AAC TAC TGT AAG AGG 1134 
Ser Thr Ala Arg lie Arg Arg Asn Ala Lys Gly Asn Tyr Cys Lys Arg 
-5 15 

ACC CCG CTC TAC ATC GAC TTC AAG GAG ATT GGG TGG GAC TCC TGG ATC 1182 
Thr Pro Leu Tyr He Asp Phe Lys Glu He Gly Trp Asp Ser Trp He 
10 15 20 25 

ATC GCT CCG CCT GGA TAC GAA GCC TAT GAA TGC CGT GGT GTT TGT AAC 1230 
He Ala Pro Pro Gly Tyr Glu Ala Tyr Glu Cye Arg Gly Val Cys Asn 
30 35 40 

TAC CCC CTG GCA GAG CAT CTC ACA CCC ACA AAG CAT GCA ATT ATC CAG 1276 
Tyr Pro Leu Ala Glu His Leu Thr Pro Thr Lye His Ala He He Gin 
45 50 55 

GCC TTG GTC CAC CTC AAG AAT TCC CAG AAA GCT TCC AAA GCC TGC TGT 1326 
Ala Leu Val His Leu Lye Asn Ser Gin Lys Ala Ser Lys Ala Cys Cys 
60 65 70 

GTG CCC ACA AAG CTA GAG CCC ATC TCC ATC CTC TAT TTA GAC AAA GGC 1374 
Val Pro Thr Lys Leu Glu Pro He Ser He Leu Tyr Leu Asp Lys Gly 
75 60 85 

GTC GTC ACC TAC AAG TTT AAA TAC GAA GGC ATG GCC GTC TCC GAA TGT 1422 
Val Val Thr Tyr Lys Phe Lys Tyr Glu Gly Met Ala Val Ser Glu Cys 
90 95 100 105 

GGC TGT AGA TAGAAGAAGA GTCCTATGGC TTATTTAATA ACTGTAAATG 1471 
Gly Cys Arg 

TGTATATTT6 GT6TTCCTAT TTAATGAGAT TATTTAATAA GGGTGTACAG TAATAGAGGC 1531 

TTGCTGCCTT CAGGAAATGG ACAGGTCAGT TTGTTGTAGG AAATGCATAT TTT 1564 

(2) INFORMATION FOR SEQ ID NO: 11: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 424 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11: 

Met Gly Ser Leu Val Leu Thr Leu Cys Ala Leu Phe Cys Leu Ala Ala 
-316 -315 -310 -305 

Tyr Leu Val Ser Gly Ser Pro He Met Asn Leu Glu Gin Ser Pro X^u 
-300 -295 -290 -265 

Glu Glu Asp Met Ser Leu Phe Gly Asp Val Phe Ser Glu Gin Asp Gly 
-280 -275 -270 

Val Asp Phe Asn Thr Leu Leu Gin Ser Met Lys Asp Glu Phe Leu Lys 
-265 -260 -255 

Thr Leu Asn Leu Ser Asp He Pro Thr Gin Asp Ser Ala Lys Val Asp 
-250 -245 -240 



41 



wo 94/2d893 



PCT/US94/0S290 



Pro Pro Glu Tyr Met Leu Glu Leu Tyr Asn Lya Phe Ala Thr Asp Arg 
-235 -230 -225 

Thr Ser Met Pro Ser Ala Asn lie lie Arg Ser Phe Lye Asn Glu Asp 
-220 -215 -210 -205 

Leu Phe Ser Gin Pro Val Ser Phe Asn Gly Leu Arg Lys Tyr Pro Leu 
-200 -195 -190 

Leu Phe Asn Val Ser He Pro His Hie Glu Glu Val He Met Ala Glu 
-185 -180 -175 

Leu Arg Leu Tyr Thr Leu Val Gin Arg Asp Arg Met He Tyr Asp Gly 
-170 -165 -160 

Val Asp Arg Lye He Thr He Phe Glu Val Leu Glu Ser Lys Gly Asp 
-155 -150 -145 

Asn Glu Gly Glu Arg Asn Met Leu Val Leu Val Ser Gly Glu He Tyr 
-140 -135 -130 -125 

Gly Thr Asn Ser Glu Trp Glu Thr Phe Asp Val Thr Asp Ala He Arg 
-120 -115 -110 

Arg Trp Gin Lys Ser Gly Ser Ser Thr His Gin Leu Glu Val His He 
-105 -100 -95 

Glu Ser Lys His Asp Glu Ala Glu Asp Ala Ser Ser Gly Arg Leu Glu 
-90 -85 -80 

He Asp Thr Ser Ala Gin Asn Lys His Asn Pro Leu Leu He Val Phe 
-75 -70 -65 

Ser Asp Asp Gin Ser Ser Asp Lys Glu Arg Lys Glu Glu Leu Asn Glu 
-60 -55 -50 -45 

Met He Ser His Glu Gin Leu Pro Glu Leu Asp Asn Leu Gly Leu Asp 
-40 -35 -30 

Ser Phe Ser Ser Gly Pro Gly Glu Glu Ala Leu Leu Gin Met Arg Ser 
-25 -20 -15 

Asn He He Tyr Asp Ser Thr Ala Arg He Arg Arg Asn Ala Lys Gly 
-10 -5 1 



Asn Tyr Cys Lys Arg Thr Pro Leu Tyr He Asp Phe Lys Glu He Gly 
5 ao 15 20 

Trp Asp Ser Trp He He Ala Pro Pro Gly Tyr Glu Ala Tyr Glu Cys 
25 30 35 

Arg Gly Val Cys Asn Tyr Pro Leu Ala Glu His Leu Thr Pro Thr Lys 
40 45 50 

His Ala He He Gin Ala Leu Val His Leu Lys Asn Ser Cln Lys Ala 
55 60 65 

Ser Lys Ala Cys Cys Val Pro Thr Lys Leu Glu Pro He Ser He Leu 
70 75 80 

Tyr Leu Asp Lys Gly Val Val Thr Tyr Lys Phe Lye Tyr Glu Gly Met 
85 90 95 100 

Ala Val Ser Glu Cys Gly Cys Arg 
105 



42 



wo 94/26893 



PCT/US94/05290 



What is claixoed is: 

1* An isolated DNA sequence encoding BHP-10 protein. 

2. The DNA sequence of claim 1 wherein said DNA sequence 
is selected from the group consisting of: 

(a) nucleotides #779 or #797 to #1102 of SEQ ID NO: 1; 

(b) nucleotides #1108 or #1126 to #1431 of SEQ ID NO: 10; 
and (c) sequences which hybridize to (a) or (b) under 
stringent hybridization conditions and encode a protein which 
exhibits the ability to form cartilage and/or bone. 

3. The DNA sequence of claim 1 wherein said DNA sequence 
is selected from the group consisting of: 

(a) nucleotides encoding for amino acids # 1 to #108 of 
SEQ ID NO: 2; 

(b) nucleotides encoding for amino acids #1 to #108 of SEQ 
ID NO: 11; and 

(c) sec[uences which hybridize to (a) or (b) under 
stringent hybridization conditions and encode a protein which 
exhibits the ability to form cartilage and/ or bone. 

4. A host cell transformed with the DNA sequence of claim 

1. 

5. A host cell transformed with the DNA sequence of claim 

2. 

6. A host cell transformed with the DNA sequence of claim 

3. 

7. An isolated DNA molecule having a sequence encoding a 
protein which is characterized by the ability to induce the 
formation of cartilage and/or bone, said DNA molecule comprising 
a DNA sequence selected from the group consisting of: 

(a) nucleotide # 779 to # 1105 of SEQ ID NO: 1; and 

(b) nucleotide # 1108 to # 1431 of SEQ ID NO: 10; and 

(c) naturally occurring allelic sequences and equivalent 
degenerative codon sequences of (a) or (b) . 

8. A host cell transformed with the DNA molecule of claim 

7. 

9. A vector comprising a DNA molecule of claim 7 in 
operative association with an expression control sequence 

43 



SUBSTITUTE SHEET (RULE 26) 



wo 94/26893 



PCT/US94/05290 



therefor. 

10. A host cell transformed with the vector of claim 9. 

11. An isolated DNA molecule encoding a BMP-10 protein, 
said DNA molecule comprising nucleotide # 160 to # 1431 of SEQ 
ID NO: 10. 

12. An isolated DNA molecule comprising a DNA coding 
sequence encoding a BMP-10 protein, said DNA molecule comprising 
nucleotides t 1108 to # 1431 of SEQ ID NO: 10, and further 
comprising a nucleotide sequence encoding a suitable propeptide 
5' to and linke|d in frame to the DNA coding sequence. 

13. A vector comprising a DNA molecule of claim 11 in 
operative association with an expression control sequence 
therefor. 

14. A host cell transformed with the vector of claim 12. 

15. A method for producing a purified BMP-10 protein said 
method comprising the steps of: 

(a) cultxiring a host cell transformed with a DNA sequence 
according to claim 2, comprising a nucleotide sequence encoding 
a BMP-10 protein; and 

(b) recovering and purifying said BMP-10 protein from the 
culture mediiim. 

16. A method for producing a purified BMP-10 protein said 
method comprising the steps of: 

(a) culturing a host cell transformed with a DNA sequence 
according to claim 3, comprising a nucleotide sequence encoding 
a BMP-10 protein; and 

(b) recovering and purifying said BMP-10 protein from the 
cultiire medium. 

17. A method for producing a purified BMP-10 protein said 
method comprising the steps of: 

(a) culturing a host cell transformed with a DNA sequence 
according to claim 7, comprising a nucleotide sequence encoding 
a BMP-10 protein; and 

(b) recovering and pxirifying said BMP-10 protein from the 
culture medium. 

18. A purified BMP-10 polypeptide comprising the amino 
acid sequence from amino acid #1 to amino acid #108 as set forth 

44 



SUBSTITUTE SHEET (RULE 26) 



wo 94/26893 



PCT/OS94/05290 



in SEQ ID NO: 11. 

19. A pxxrified BMP-10 polypeptide of claim 18 wherein said 
polypeptide is a dimer wherein each subunit comprises at least 
the amino acid sequence from amino acid #1 to amino acid #108 of 
SEQ ID NO: 11. 

20. A purified BMP-10 polypeptide of claim 18, wherein 
said polypeptide is a dimer wherein one subunit comprises at 
least the amino acid sequence from amino acid #1 to amino acid 
#108 of SEQ ID NO: 11, and one subunit comprises an amino acid 
sec[uence for a bone morphogenetic protein selected from the 
group consisting BMP-1, BMP-2, BMP-3, BMP-4, BMP-5, BMP-6, BMP- 
7, BMP-8 and BMP-9. 

21. A piirified BMP*10 protein produced by the steps of 

(a) cultxiring a cell transformed with a DNA comprising the 
nucleotide 8ec[uence from nucleotide #1108 to #1431 as shown in 
SEQ ID NO: 10; and 

(b) recovering and purifying from said culture meditun a 
protein comprising the amino acid sequence from amino acid #1 to 
amino acid #108 as shown in SEQ ID NO: 11. 

22. The purified BMP-10 protein of claim 21, wherein the 
cell is a mammalian cell, and the DNA additionally comprises 
nucleotides #160 to #1107 of SEQ ID NO: 10. 

23. A purified BMP-10 protein characterized by the ability 
to induce the formation of cartilage and/or bone. 

24. A pharmaceutical composition comprising an effective 
amount of the BMP-10 protein of claim 23 in admixture with a 
pharmaceutically acceptable vehicle. 

25. A composition of claim 24 further comprising a matrix 
for supporting said composition and providing a surface for bone 
and/ or cartilage growth. 

26. The composition of claim 25 wherein said matrix 
comprises a material selected from the group consisting of 
hydroxyapatite, collagen, poly lactic acid and tricalcium 
phosphate. 

27. A method for inducing bone and/or cartilage formation 
in a patient in need of same comprising administering to said 
patient an effective amount of the composition of claim 25. 

45 



SUBSTITUTE SHEET (RULE 26) 



wo 94/26893 PCT/US94/05290 

28. A chimeric DNA molecule comprising a DNA sequence 
encoding a propeptide from a member of the TGF-jS super family of 
proteins linked in correct reading frame to a DNA sequence 
encoding a BMP-10 polypeptide. 



46 

SUBSTITUTE SHEET '{RLUE 26) 



INTERNATIONAL SEARCH REPORT 



InteiL JiBl AppUcation No 

PCT/US 94/05290 



IP^S Cffii/ir'"^ A61IG7/02 C07K13/00 C12P21/02 //C12N15/62 



Acconiing to International Patent Qamfication (iPQ or to both national classification and IPC 



B. FIELDS SEARCHED 



Minimum doounotauon searched (dassification system followed by dassfication symbols) 

IPC 5 C07K C12N C12P A61K 



Documentation searched other than rommuim documenution to the extent that such documents arc inchided in the fidds searched 



Bectfonc data base consulted during the intcriiauonal search (name of data base and« what practical, search terms used) 



C. DOCUMENTS CONSIDERED TO BE RELEVANT 



Category ' Qtation of document, with indication, where appropnate, of the relevant passaga 



Relevant to claim No. 



TRENDS IN GENETICS 

vol. 8, no. 3 , March 1992 , AMSTERDAM NL 
pages 97 - 102 

ROSEN, V. & THIES, S. 'The BMP proteins in 
bone formation and repair' 
see the whole document 

W0,A,91 18098 (GENETICS INSTITUTE, INC.) 

28 November 1991 

cited in the application 

W0,A,93 00432 (GENETICS INSTITUTE, INC.) 7 

January 1993 

cited in the application 



1-28 



□ 



Further documents are listed in the continuation of box C. 



m 



Patent family membcn arc listed in annex. 



* Spedal categories of dted documents : 

'A' document defining the general state of the art which is not 

considered to be of particular relevance 
'E' earlier document but published on or after the international 

filing date 

*L* document which may throw doubts on priority daim(s) or 
which is dted to establish the publication date of another 
dtation or other spedal reason (as spcafied) 

'O* dociiment referring to an oral disdosure, use, exhibition or 
other means 

'P* document published phor to the uitemational filing date but 
later than the priority date daimed 



T later documait publidied alter the international filing date 
or priority dau and not in conflict with the appiicatioo but 
dted to undcrmnd the phnnple or theory underlying the 
invention 

*X* document of particular relevance; the daimed invention 
cannot be consdertd novd or cannot be considered to 
involve an inventive step when the document is taken alone 

'Y' document of particular relevance; the daimed invention 
caiuiot be considered to involve an inventive step when the 
document is combined with one or more other such docu- 
ments, such combination being obvious to a person ildUed 
in the art. 

'&* document member of the same patmt family 



Date of die actual completion of the international search 



22 August 1994 



Date of mailing of the international search report 



31. 08 3^ 



Name and mailing address of the ISA 

European Patent OfTice. P.B. S81 8 Patendaan 2 
NL - 2280 HV Rijswiik 
Td. ( + 31-70) 340-2040. Tx, 31 651 epo nl. 
Fax: (t 31-70) 340-3016 



Authorized officer 



Andres, S 



Fom PCT/ISA/310 <i«C0Ad ttmx) (July 1993} 



IN rKRNATIONAL SEARCH REPORT 



i..,crnaiional application No. 

PCT/ US 94/ 05290 



Box I Observations where certain claims were found unsearchable (Continuation of item I of first sheet) 



This inicrnalional search rcpori has nol been established in respect of certain claims under Article 1 7(2)(a) for the following reasons: 



1. X Claims N OS.: i. • 

because they relate to subject matter not required to be searched by this Authority, namely: 

Remark: Although claim 27 1s directed to a method of treatment of 
(diagnostic method practised on) the human/animal body the search has been 
carried out and based on the alleged effects of the compound/composition 

Claims Nos.: 

because they relate to parts of the international application that do not comply with the prescribed requirements to such 
an extent thai no meaningful inicrnalional search can be carried out, specifically: 



□ 



Claims Nos.: 

because they arc dependent claims and arc not drafted in accordance with the second and third sentences of Rule 6.4(a). 



Box II Observations where unity of invention is lacking (Continuation of item 2 of first sheet) 



This International Searching Authority found multiple inventions in this international application, as follows: 



I I As all required additional search fees were timely paid by the applicant, this international search report covers 



all 



searchable claims. 



2, I I As all searchable claims could be searches without effort justifying an additional fee, this Authority did nol invite payment 
of any additional fee. 



3. As only some of the required addittonal search fees were timely paid by the applicant, this international search report 

covers only those claims for which fees were paid, specifically claims Nos.: 



4. Pj No required additional search fees were timely paid by the applicant Consequently, this international search report is 
resu-icted to the invention first mentioned in the claims; it is covered by claims Nos.: 



Remark on Protest [ [ The additional search fees were accompanied by the applicant's protesu 

j I No protest accompanied the payment of additional search fees. 



Form PCT;ISA/210 (continuation of Orst sheet < I)) < July 1992) 



INTERNATIONAL SEARCH REPORT 

Information on patent family monbcn 



Inten. nal ApjdicatiOD No 

PCT/US 94/05290 



Paunt document 
cited in search report 



Publication 
date 



Patent funity 
member(s) 



Publication 
date 



WO-A-91 18098 



WO-A-9300432 



28-11-91 
07-01-93 



EP-A- 
JP-T- 



053618$ 
6500991 



14-04-93 
27-01-94 



AU-A- 
EP-A- 



2269992 
0592562 



25-01-93 
20-04-94 



Fofin FCT/ISA/aiO (patent CmBy annex) (July 1990) 



This Page is Inserted by IFW Indexing and Scanning 
Operations and is not part of the Official Record 

BEST AVAILABLE IMAGES 

Defective images within this document are accurate representations of the original 
documents submitted by the applicant. 

Defects in the images include but are not limited to the items checked: 

□ black borders 

□ image cut off at top, bottom or sides 
C^Tfaded text or drawing 
[^blurred or illegible text or drawing 

□ skewed/slanted images 

□ color or black and white photographs 

□ gray scale documents 

□ lines or marks on original document 

□ REFERENCE(S) or EXHIBIT(S) SUBMITTED ARE POOR QUALITY 

□ OTHER: 

IMAGES ARE BEST AVAILABLE COPY. 
As rescanning these documents will not correct the image 
problems checked, please do not report these problems to 
the IFW Image Problem Mailbox.