Skip to main content

Full text of "USPTO Patents Application 09804625"

See other formats


WORLD INTELLECTUAL PROPERTY ORGANIZATION 
International Bureau 




PCT 

INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) 



(51) International Patent Classification 5 : 

C12N 15/12, C12P 21/02, C07K 13/00, 
C12N 5/10, A61K 37/02 



Al 



(11) International Publication Number: WO 94/26892 

(43) International Publication Date: 24 November 1994 (24.11.94) 



(21) International Application Number: PCT/US94A)5288 

(22) Internationa] Filing Date: 12 May 1994 (12.05.94) 



(30) Priority Data: 

08/061,464 



12 May 1993(12.0553) 



US 



(71) Applicant: GENETICS INSTITUTE, INC. [US/US]; Legal 

Affairs, 87 Cambridge Park Drive, Cambridge, MA 02140 
(US). 

(72) Inventors: CELESTE, Anthony, J.; 86 Packard Street, Hudson, 

MA 01749 (US). WOZNEY, John, M.; 59 Old Bolton Road, 
Hudson, MA 01749 (US). 

(74) Agent: LAZAR, Steven, R.; Genetics Institute, Inc., Legal 
Affairs, 87 Cambridge Park Drive, Cambridge, MA 02170 
(US). 



(81) Designated States AU, BR, CA, FI, JP, KP, KR, NL, NO, 
European patent (AT, BE, CH, DE, DK, ES, FR, GB, GR, 
IE, IT, LU, MC, NL, FT, SE), OAPI patent (BF, BJ, CF, 
CG, 0, CM, GA, GN, ML, MR, NE, SN, TD, TG). 



Published 

With international search report. 

Before the expiration of the time limit for amending the 
claims and to be republished in the event of the receipt of 
amendments. 



(54) Title: BMP- 11 COMPOSITIONS 
(57) Abstract 

Purified BMP- 11 proteins and processes for producing them are disclosed. Recombinant DNA molecules encoding the BMP- 11 
proteins are also disclosed. The proteins may be useful in regulating follicle stimulating hormone, such as for contraception. In addition, 
the proteins may be useful for the induction of bone, cartilage and/or other connective tissue. 



FOR THE PURPOSES OF INFORMATION ONLY 



Codes used to identify States party to the PCT od die front pages of pamphlets publishing international 
applications under the PCT. 



AT 


Austria 


GB 


United Kingdom 


MR 


Mauritania 


AU 


Australia 


GE 


Georgia 


MW 


Malawi 


BB 


Barbados 


GN 


Guinea 


NB 


Niger 


BE 


Belgium 


GR 


Greece 


NL 


Nemertands 


BF 


Burkina Faso 


BV 


Hungary 


NO 


Norway 


BG 


Bulgaria 


IE 


Ireland 


NZ 


New Zealand 


BJ 


Benin 


IT 


Italy 


PL 


Poland 


BR 


Brazil 


JP 


Japan 


FT 


Portugal 


BY 


Belarus 


KE 


Kenya 


RO 


Romania 


CA 


Cauda 


KG 


Kyrgystan 


RU 


Russian Federation 


CF 


Ceotral African Republic 


KP 


Democratic People's Republic 


SD 


Sudan 


C6 


Congo 




of Korea 


SE 


Sweden 


CH 


Switzerland 


KR 


Republic of Korea 


SI 


Slovenia 


a 


Cote d'lvoire 


KZ 


Kazakhstan 


SK 


Slovakia 


CM 


Cameroon 


U 


Liechtenstein 


SN 


Senegal 


CN 


China 


LK 


Sri Lanka 


TD 


Chad 


CS 


Czechoslovakia 


LU 


Luxembourg 


TG 


Togo 


CZ 


Czech Republic 


LV 


Latvia 


TJ 


Tajikistan 


DE 


Germany 


MC 


Monaco 


IT 


lYimdad and Tobago 


DK 


Denmark 


MD 


Republic of Moldova 


UA 


Ukraine 


ES 


Spain 


MG 


Madagascar 


US 


United States of America 


n 


Finland 


ML 


Mali 


UZ 


Uzbekistan 


FR 


France 


MN 


Mongolia 


VN 


Viet Nam 


GA 


Gabon 











WO 94/26892 



FCT/US94/05288 



TITLE OF THE INVENTION 

5 

BMP-11 COMPOSITIONS 



BACKGROUND OF THE INVENTION 

10 

The present invention relates to a novel family of purified 
proteins designated BMP-11, DNA molecules encoding them, and 
processes for obtaining them. The inventors have previously 
designated the BMP-11 proteins as Activin WC. The BMP-11 

15 proteins may be useful to induce bone and/or cartilage formation 

and in wound healing and tissue repair, or for augmenting the 
activity of other bone morphogenetic proteins. The BMP-11 
proteins may also be useful to regulate the production of 
follicle stimulating hormone, for contraception, to promote 

20 neuronal cell survival, to stimulate hematopoiesis, and to 

suppress the development of gonadal tumors. 

United States Patent 4,798,885 disclosed DNA encoding the 
prepro inhibin a and /S chains. United States Patent 5,071,834 
discloses pharmaceutical compositions of activin with two beta B 

25 chains formulated in a pharmaceutically acceptable carrier. 

United States Patent 5,102,807 discloses a purified inhibin 
protein which suppresses production of FSH without suppressing 
production of luteinizing hormone. 

30 SUMMARY OF THE INVENTION 

BMP-11 protein is a member of the TGF-0 superfamily of 
proteins. The TGF-0 superfamily includes the family of proteins 
known as bone morphogenetic proteins (BMPs) , as well as a group 
of proteins that are termed inhibin-j8. As discussed further 

35 herein, when dimerized with another BMP-11 (homodimer) , BMP-11 

protein is expected to demonstrate BMP-11 activity, as further 
described herein, as may be measured in accordance with the 
assays described in the examples herein. When dimerized as a 
heterodimer with inhibin-a proteins or with other inhibin-0 
te 40 proteins, the inhibin-j8/BMP-ll heterodimer is expected to 

demonstrate effects on the production of follicle stimulating 
hormone (FSH), as described further herein. It is further 
expected that, in homodimer ic form or in heterodimer ic form with 
another member of the bone morphogenetic protein family, BMP-11 



WO 94/26892 



PCT/US94/05288 



will exhibit BMP activity, i.e., the ability to induce the 
formation of bone, cartilage and/ or other connective tissue. 
Thus, depending upon the environment of BMP-11, it may form 
dimers which will demonstrate either activin or inhibin 
5 activity, or bone, cartilage and/or other connective tissue- 

inducing activity • Accordingly, BMP-11 activity is defined as 
the ability to regulate the production of FSH in the assay 
described at Example 8 herein, or the ability to induce the 
formation of bone, cartilage and/or other connective tissue in 

10 the assays described at Examples 5 to 7 herein* 

Proteins termed inhibins and activins are produced in the 
gonad and exist naturally in follicular fluid. These proteins 
act at the level of the anterior pituitary gland to inhibit 
(inhibins) or stimulate (activins) the release of follicle- 

15 stimulating hormone (FSH) [for reviews see, e.g., Ying, S.-Y., 

Endocr. Rev., 9:267-293 (1988) or Ling, N. et al, Vitamins and 
Hormones, £4:1-46 (Academic Press 1988)]. Briefly, dimeric 
proteins comprised of one chain of inhibin a and one chain of 
inhibin /3 (£ A or 0 B ) are termed inhibins and are characterized 

20 by their ability to inhibit the release of follicle stimulating 

hormone (FSH) , while other dimeric proteins comprised of two 
chains of inhibin jS (0 A or 0 B ) are termed activins and are 
characterized by their ability to stimulate the release of 
follicle stimulating hormone (FSH) [see, e.g., Ling et al., 

25 Nature, 321 :779-782 (1986) or Vale, et al., Nature, 321 :776-779 

(1986) or Mason et al., Nature, 318 :659-663 (1985) or Forage et 
al., Proc. Natl. Acad. Sci. USA, 83:3091-3095 (1986)]. 

It is recognized that FSH stimulates the development of ova 
in mammalian ovaries (Ross et al., in Textbook of Endocrinology, 

30 ed. Williams, p. 355 (1981) and that excessive stimulation of 

the ovaries with FSH will lead to multiple ovulations. FSH is 
also important in testicular function. Thus, BMP-ll, in 
heterodimers with a member of the inhibin a family, may be 
useful as a contraceptive based on the ability of inhibins to 

35 decrease fertility in female mammals and decrease 

spermatogenesis in male mammals. Administration of sufficient 
amounts of other inhibins can induce infertility these mammals. 



2 



WO 94/26892 



PCT/US94/05288 



BMP-11, as a homodimer or as a heterodimer with other protein 
subunits of the inhibin-j8 group, may be useful as a fertility 
inducing therapeutic, based upon the ability of activin 
molecules in stimulating FSH release from cells of the anterior 
pituitary. See, for example, United States Patent 4,798,885. 
BMP-11 may also be useful for advancement of the onset of 
fertility in sexually immature mammals, so as to increase the 
lifetime reproductive performance of domestic animals such as 
cows, sheep and pigs. It is further contemplated that BMP-11 
may be useful in promoting neuronal cell survival [see, e.g., 
Schubert et al., Nature, 344 :868-870 (1990)], modulating 
hematopoiesis by inducing the differentiation of erythroid cells 
[see, e.g., Broxmeyer et al, Proc. Natl. Acad, Sci. USA, 
85:9052-9056 (1988) or Eto et al, Biochejn. Biophys. Res. Comm., 
142:1095-1103 (1987)], for suppressing the development of 
gonadal tumors [see, e.g., Matzuk et al., Nature, 360 :313-319 
(1992)] or for augmenting the activity of bone morphogenetic 
proteins [see, e.g., Ogawa et al., J. Biol. Chem., 267:14233- 
14237 (1992)]. 

BMP-11 proteins may be further characterized by their 
ability to modulate the release of follicle stimulating hormone 
(FSH) in established in vitro bioassays using rat anterior 
pituitary cells as described [see, e.g., Vale et al, 
Endocrinology, 91:562-572 (1972); Ling et al., Nature, 321 :779- 
782 (1986) or Vale et al.. Nature, 22JL:776-779 (1986)]. It is 
contemplated that the BMP-11 protein of the invention, when 
composed as a homodimer or a heterodimer with other inhibin fi 
chains will exhibit stimulatory effects on the release of 
follicle stimulating hormone (FSH) from anterior pituitary cells 
as described [Ling et al., Nature, 321 :779-782 (1986) or Vale 
et al., Nature, 121:776-779 (1986)]. Additionally, it is 
contemplated that the BMP-11 protein of the invention, when 
composed as a heterodimer with the inhibin a chain, will inhibit 
the release of follicle stimulating hormone (FSH) from anterior 
pituitary cells as described [see, e.g., Vale et al, 
Endocrinology, 91:562-572 (1972). Therefore, depending on the 
particular composition, it is expected that the BMP-11 protein 



WO 94/26892 



PCT/US94/0S288 



of the invention may have contrasting and opposite effects on 
the release of follicle stimulating hormone (FSH) from the 
anterior pituitary. 

Activin A (the homodimeric composition of inhibin $ A ) has 
5 been shown to have erythropoietic-stimulating activity [see e.g. 

Eto et al., Biochem. Biophys. Res. Commun., 142 ; 1095-1103 (1987) 
and Murata et al., Proc. Natl. Acad. Sci. U.S.A., 85:2434-2438 
(1988) and Yu et al., Nature, 130:765-767 (1987)]. It is 
contemplated that the BMP-11 protein of the invention has a 

10 similar erythropoietic-stimulating activity. This activity of 

the BMP-11 protein may be further characterized by the ability 
of the BMP-11 protein to demonstrate erythropoietin activity in 
the biological assay performed using the human K-562 cell line 
as described by [Lozzio et al., Blood, 45:321-334 (1975) and 

15 U.S. Pat. No. 5,071,834]. 

The structures of several proteins, designated BMP-1 
through BMP-9, have previously been elucidated. The unique 
inductive activities of these proteins, along with their 
presence in bone, suggests that they are important regulators of 

20 bone repair processes, and may be involved in the normal 

maintenance of bone tissue. The BMP-11 protein of the present 
invention is related to the above BMP proteins, and is expected 
to share BMP activities such as the ability to induce bone, 
cartilage and/or other connective tissue, such as tendon or 

25 ligament, and wound healing activities of the BMPs. In 

addition, it is expected that the proteins of the invention may 
act in concert with or perhaps synergistically with other 
related proteins and growth factors. Further therapeutic 
methods and compositions of the invention therefore comprise a 

30 therapeutic amount of at least one BMP-11 protein of the 

invention with a therapeutic amount of at least one of the other 
BMP proteins disclosed in co-owned patents and applications 
described below. Such combinations may comprise separate 
molecules of the BMP proteins or heteromolecules comprised of 

35 different BMP moieties. Further, BMP-11 proteins may be 

combined with other agents beneficial to the treatment of the 
bone and/or cartilage defect, wound, or tissue in question. 



4 



WO 94/26892 



PCT/US94/05288 



These agents include various growth factors such as epidermal 
growth factor (EGF) , fibroblast growth factor (FGF) , platelet 
derived growth factor (PDGF) , transforming growth factors (TGF-a 
and TGF-0) , and k-f ibroblast growth factor (kFGF) , parathyroid 
5 hormone (PTH) , leukemia inhibitory factor (LIF/HILDA/DIA) , 

insulin-like growth factors (IGF-I and IGF-II) . Portions of 
these agents may also be used in compositions of the present 
invention. 

The bovine BMP-11 DNA sequence (SEQ ID NO: 1) and amino 

10 acid sequence (SEQ ID: 2) and human BMP- 11 DNA sequence (SEQ ID 

NO: 10) and amino acid sequence (SEQ ID NO: 11) are set forth in 
the Sequence Listings herein. Activin proteins are capable of 
regulating the production of follicle-stimulating hormone (FSH) , 
and thus BMP-11 may be useful as a contraceptive or a fertility 

15 inducing therapeutic. In homodimeric form or in heterodimers 

with proteins of the inhibin-0 group, purified BMP-11 protein is 
expected to demonstrate activin activity, and may be used to 
stimulate FSH. In addition, it is expected that the purified 
BMP-11 protein may be useful for the induction of bone, 

20 cartilage and/or other connective tissue. 

Bovine BMP-11 may be produced by culturing a cell 
transformed with a DNA sequence comprising nucleotide #375 to 
nucleotide #704 as shown in SEQ ID NO: 1 and recovering and 
purifying from the culture medium a protein characterized by the 

25 amino acid sequence comprising amino acid # 1 to # 109 as shown 

in SEQ ID NO: 2 substantially free from other proteinaceous 
materials with which it is co-produced. 

Human BMP-11 is expected to be homologous to bovine BMP-11. 
The invention, therefore, includes methods for obtaining the DNA 

30 sequences encoding human BMP-li, the DNA sequences obtained by 

these methods, and the human protein encoded by these DNA 
sequences. This method entails utilizing the bovine BMP-11 
nucleotide sequence or portions thereof to design probes to 
screen libraries for the human gene or fragments thereof using 

35 standard techniques. A DNA sequence encoding part of the human 

BMP-11 protein (SEQ ID NO: 3) and the corresponding amino acid 
sequence (SEQ ID NO: 4) are set forth in the Sequence Listing. 



5 



WO 94/26892 PCT/US94/05288 

These sequences may also be used in order to design probes to 
obtain the complete human BMP-11 gene through standard 
techniques. Human BMP-11 may be produced by culturing a cell 
transformed with the BMP-11 DNA sequence and recovering and 
5 purifying BMP-11 from the culture medium. The purified 

expressed protein is substantially free from other proteinaceous 
materials with which it is co-produced, as well as from other 
contaminants . 

The recovered purified protein is contemplated to 

10 demonstrate the ability to regulate the production of FSH. The 

proteins of the invention may be further characterized by the 
ability to regulate the production of follicle stimulating 
hormone (FSH) in established in vitro bioassays using rat 
anterior pituitary cells. BMP-11 proteins may also be 

15 characterized by the ability to induce the formation of bone, 

cartilage and/or other connective tissue, for example, in the 
rat bone formation assay described below. 

Another aspect of the invention provides pharmaceutical 
compositions containing a therapeutically effective amount of a 

20 BMP-11 protein in a pharmaceutical ly acceptable vehicle or 

carrier. BMP-11 compositions of the invention may be useful for 
the regulation of follicle stimulating hormone, and may be 
useful in contraception. Compositions of the invention may 
further include at least one other therapeutically useful agent 

25 such as the BMP proteins BMP-1, BMP-2, BMP-3, BMP-4, BMP-5, BMP- 

6 and BMP-7, disclosed for instance in United States Patents 
5,108,922; 5,013,649; 5,116,738; 5,106,748; 5,187,076; and 
5,141,905; BMP-8, disclosed in PCT publication WO91/18098; and 
BMP-9, disclosed in PCT publication WO93/00432, and BMP-10, 

30 disclosed in co-pending patent application serial number 

08/061,695, filed on May 12, 1993. The BMP-11 compositions may 
also be useful for a number of uses involving regulation of the 
production of follicle stimulating hormone, including 
contraception. These methods, according to the invention, 

35 entail administering to a patient needing such treatment, an 

effective amount of BMP-11. 

The compositions of the invention may comprise, in addition 



6 



WO 54/26892 



PCT/US94/0S288 



to a BMP-11 protein, other members of the inhibin-# group of 
proteins or inhibin-or proteins, as well as other therapeutically 
useful agents including growth factors such as epidermal growth 
factor (EGF) , fibroblast growth factor (FGF) , transforming 
5 growth factor (TGF-a and TGF-0) , and insulin-like growth factor 

(IGF). 

The BMP-11 compositions of the present invention may also 
be useful for treating a number of bone and/or cartilage 
defects, periodontal disease and various types of wounds. These 

10 methods, according to the invention, entail administering to a 

patient needing such bone and/or cartilage formation wound 
healing or tissue repair, an effective amount of a BMP-11 
protein. These methods may also entail the administration of a 
protein of the invention in conjunction with at least one of the 

15 novel BMP proteins disclosed in the co-owned patents and 

applications described above. In addition, these methods may 
also include the administration of a BMP-11 protein with other 
growth factors including EGF, FGF, TGF-cr, TGF-0, and IGF. 

Still a further aspect of the invention are DNA seguences 

20 coding for expression of a BMP-11 protein. Such seguences 

include the seguence of nucleotides in a 5' to 3' direction 
illustrated in SEQ ID NO: 1 or DNA seguences which hybridize 
under stringent conditions with the DNA seguence of SEQ ID NO: 
1 and encode a protein having BMP-11 activity. Finally, allelic 

25 or other variations of the sequences of SEQ ID NO: 1, whether 

such nucleotide changes result in changes in the peptide 
sequence or not, are also included in the present invention. 

Still a further aspect of the invention are DNA sequences 
coding for expression of a BMP-11 protein. Such sequences 

30 include the sequence of nucleotides in a 5' to 3' direction 

illustrated in SEQ ID NO: 1 or SEQ ID NO: 10, and DNA sequences 
which, but for the degeneracy of the genetic code, are identical 
to the DNA sequence of SEQ ID NO: 1 or SEQ ID NO: 10, and encode 
the protein of SEQ ID NO: 2 or SEQ ID NO: 11. Further included 
• 35 in the present invention are DNA sequences which hybridize under 

stringent conditions with the DNA sequence of SEQ ID NO: 1 or 
SEQ ID NO: 10 and encode a protein having BMP-11 activity. 



7 



WO 94/26892 



PCTAJS94/05288 



Finally, allelic or other variations of the sequences of SEQ ID 
NO: 1 or SEQ ID NO: 10, whether such nucleotide changes result 
in changes in the peptide sequence or not, but where the peptide 
sequence still has BMP-11 activity, are also included in the 
present invention. 

A further aspect of the invention includes vectors 
comprising a DNA sequence as described above in operative 
association with an expression control sequence therefor. 

These vectors may be employed in a novel process for 
producing a BMP-11 protein of the invention in which a cell line 
transformed with a DNA sequence encoding a BMP-11 protein in 
operative association with an expression control sequence 
therefor, is cultured in a suitable culture medium and a BMP-11 
protein is recovered and purified therefrom. This process may 
employ a number of known cells both prokaryotic and eukaryotic 
as host cells for expression of the polypeptide. 

The present invention also includes the use of the DNA 
sequences and vectors of the invention in gene therapy 
applications. In such use, the vectors may be transfected into 
the cells of a patient in vitro , and the cells may be re- 
introduced into a patient. Alternatively, the vectors may be 
introduced into a patient jln vivo through targeted transf ection. 

Other aspects and advantages of the present invention will 
be apparent upon consideration of the following detailed 
description and preferred embodiments thereof. 

Description of the Sequences 

SEQ ID NO: 1 is a partial nucleotide sequence of the bovine 
BMP-11 encoding the mature bovine BMP-11 polypeptide. 

SEQ ID NO: 2 is the amino acid sequence of a partial 
propeptide and the complete mature bovine BMP-11 polypeptide, 
encoded by SEQ ID N0:1. 

SEQ ID NO: 3 is a partial nucleotide sequence of human BMP- 
11. 

SEQ ID NO: 4 is a partial amino acid sequence for human BMP- 
11 polypeptide encoded by SEQ ID NO: 3. 



8 



WO 94/26892 



PCT/US94/05288 



SEQ ID NO: 5 and 6 are primers to bovine BMP-11 used to 
isolate the human BMP- 11 or other BMP- 11 proteins. 

SEQ ID NO: 7 is a DNA sequence that is inserted into pMT2 
CXM to add an Xhol recognition site near the SV40 origin of 
5 replication. 

SEQ ID NO: 8 is a DNA sequence inserted into pMT21 to insert 
an Xhol recognition site upstream from the DHFR gene. 

SEQ ID NO: 9 is a DNA sequence comprising a portion of the 
EMC virus leader sequence. 
10 SEQ ID NO: 10 is a DNA sequence encoding a partial 

propeptide and the complete mature human BMP-11 protein. 

SEQ ID NO: 11 is the amino acid sequence of a partial 
propeptide and the complete mature human BMP-11 protein encoded 
? by SEQ ID NO: 10. 
15 Detailed Description of the Invention 

BMP-11 

The bovine BMP-11 nucleotide sequence (SEQ ID NO: 1) and 
encoded amino acid sequence (SEQ ID NO: 2) and human BMP-11 
nucleotide sequence (SEQ ID NO: 10) and encoded amino acid 

20 sequence (SEQ ID NO: 11) are depicted in the Sequence Listings 

herein. Purified bovine BMP-ll proteins of the present 
invention are produced by culturing a host cell transformed with 
a DNA sequence comprising the DNA coding sequence of SEQ ID NO: 
1 from nucleotide #375 to #704 or the DNA coding sequence of SEQ 

25 ID NO: 10 from nucleotide #760 to #1086 and recovering and 

purifying from the culture medium a protein which contains the 
amino acid sequence or a substantially homologous sequence as 
represented by amino acids # 1 to # 109 of SEQ ID NO: 2 or amino 
acids 1 to 109 of SEQ ID NO: 11. For production of BMP-11 

30 proteins in mammalian cells, the DNA sequence further comprises 

a suitable propeptide linked in frame with the above DNA coding 
sequences for BMP-11. The propeptide may be the native 
propeptide of BMP-11 or a propeptide from another member of the 
TGF-0 super family 

* 35 The human BMP-11 sequence of the present invention is 

obtained using the whole or fragments of the bovine BMP-11 DNA 
sequence, or the partial human BMP-ll sequence of SEQ ID NO: 3 



9 



WO 94/26892 



PCT/US94/05288 



as a probe. Thus, the human BMP-11 DNA sequence comprise the 
DNA sequence of nucleotides #28 to #185 of SEQ ID NO: 3. The 
human BMP- 11 protein comprise the amino acid sequence of amino 
acids #1 to #52 of SEQ ID NO: 4. 

It is expected that BMP-11, as expressed by mammalian cells 
such as CHO cells, exists as a heterogeneous population of 
active species of BMP-11 protein with varying N-termini. It is 
expected that active species will comprise an amino acid 
sequence beginning at least with the cysteine residue at amino 
acid #6 of SEQ ID N0:1 or SEQ ID NO: 10, or further in the N- 
terminal direction. Thus, it is expected that DNA sequences 
encoding active BMP-11 proteins will comprise nucleotides #375 
or #390 to 701 of SEQ ID N0:1 or nucleotides #760 or #775 to 
#1086 of SEQ ID NO: 10, and may comprise additional nucleotide 
sequence in the 5' direction of SEQ ID N0:1 or SEQ ID NO: 10. 

The N-terminus of human BMP-11 has been experimentally 
determined by expression in E. coli to be as follows: 
[ M ] NLGLDXDEHSSE , wherein X designates an amino acid residue with 
no clear signal, consistent with a location of cysteine at that 
position. Thus, it is expected that this species of BMP-11 will 
have an N-terminus at amino acid # 1 of SEQ ID NO:l or SEQ ID 
NO: 10, and DNA sequences encoding this species will comprise 
nucleotides # 375 to # 701 of SEQ ID NO:l (bovine) or 
nucleotides # 760 to 1086 of SEQ ID NO: 10 (human) . The apparent 
molecular weight of human BMP-11 monomer was determined by SDS- 
PAGE to be approximately 12 kd. The human BMP-11 protein exists 
as a clear, colorless solution in 0.1% trif luoroacetic acid. 

The BMP-11 proteins recovered from the culture medium are 
purified by isolating them from other proteinaceous materials 
from which they are co-produced and from other contaminants 
present. 

BMP-11 proteins may be characterized by the ability to 
regulate the production of FSH. BMP-ll proteins may further be 
characterized by the ability to modulate the release of follicle 
stimulating hormone (FSH) in established in vitro bioassays 
using rat anterior pituitary cells as described [see, e.g., Vale 
et al, Endocrinology, 91*562-572 (1972); Ling et al., Nature, 



10 



WO 94/26892 



PCT/US94/05288 



121:779-782 (1986) or Vale et al., Nature, 121:776-779 (1986)]. 

BMP-11 proteins may also be characterized by the ability to 
induce the formation of bone, cartilage and/or other connective 
tissue. Such tissue-inducing activity of BMP-11 may further be 
characterized by the ability to induce the formation of bone, 
cartilage and/or other connective tissue in the assays described 
in the examples below. 

The BMP-11 proteins provided herein also include factors 
encoded by the sequences similar to those of SEQ ID NO: 1 or SEQ 
ID NO: 10, but into which modifications are naturally provided 
(e.g. allelic variations in the nucleotide sequence which may 
result in amino acid changes in the polypeptide) or deliberately 
engineered. For example, synthetic polypeptides may wholly or 
partially duplicate continuous sequences of the amino acid 
residues of SEQ ID NO: 2 or SEQ ID NO: 11. These sequences, by 
virtue of sharing primary, secondary, or tertiary structural and 
conformational characteristics with inhibin-j8 polypeptides of 
SEQ ID NO: 2 or SEQ ID NO: 11 may possess BMP-11 activity in 
common therewith. Thus, they may be employed as biologically 
active substitutes for naturally-occurring BMP-11 polypeptides 
in therapeutic processes. 

Other specific mutations of the sequences of BMP-11 
proteins described herein involve modifications of glycosylation 
sites. These modifications may involve O-linked or N-linked 
glycosylation sites. For instance, the absence of glycosylation 
or only partial glycosylation results from amino acid 
substitution or deletion at asparagine-linked glycosylation 
recognition sites. The asparagine-linked glycosylation 
recognition sites comprise tripeptide sequences which are 
specifically recognized by appropriate cellular glycosylation 
enzymes. These tripeptide sequences are either asparagine-X- 
threonine or asparagine-X-serine, where X is usually any amino 
acid. A variety of amino acid substitutions or deletions at one 
or both of the first or third amino acid positions of a 
glycosylation recognition site (and/ or amino acid deletion at 
the second position) results in non-glycosylation at the 
modified tripeptide sequence. In addition, expression of the 



11 



WO 94/26892 



PCT/US94/0S288 



BMP-ll protein in bacterial cells results in non-glycosylated 
protein, without altering the glycosylation recognition sites. 

The present invention also encompasses the novel DNA 
sequences, free of association with DNA sequences encoding other 
proteinaceous materials, and coding for expression of BMP-ll 
proteins. These DNA sequences include those depicted in SEQ ID 
N0:1 or SEQ ID NO: 10 in a 5' to 3' direction and those sequences 
which hybridize thereto under stringent hybridization 
conditions, for example 0.1X SSC, 0.1% SDS at 65°C [see, 
Maniatis et al, Molecular Cloning (A Laboratory Manual! . Cold 
Spring Harbor Laboratory (1982), pages 387 to 389] and encode a 
protein having BMP-ll activity. These DNA sequences also 
include those which comprise the DNA sequence of SEQ ID NO: 3 and 
those which hybridize thereto under stringent hybridization 
conditions and encode a protein having BMP-ll activity. 

Similarly, DNA sequences which code for BMP-ll proteins 
coded for by the sequences of SEQ ID NO:l or SEQ ID NO:10, but 
which differ in codon sequence due to the degeneracies of the 
genetic code or allelic variations (naturally-occurring base 
changes in the species population which may or may not result in 
an amino acid change) also encode the novel factors described 
herein. Variations in the DNA sequences of SEQ ID NO:l or SEQ 
ID NO: 10 which are caused by point mutations or by induced 
modifications (including insertion, deletion, and substitution) 
to enhance the activity, half -life or production of the 
polypeptides encoded are also encompassed in the invention. 

Another aspect of the present invention provides a novel 
method for producing BMP-ll proteins. The method of the present 
invention involves culturing a suitable cell line, which has 
been transformed with a DNA sequence encoding a BMP-ll protein 
of the invention, under the control of known regulatory 
sequences. The transformed host cells are cultured and the BMP- 
ll proteins recovered and purified from the culture medium. The 
verified proteins are substantially free from other proteins 
with which they are co-produced as well as from other contaminants. 

Suitable cells or cell lines may be mammalian cells, such 
as Chinese hamster ovary cells (CHO) . The selection of suitable 



12 



WO 94/26892 



PCT/US94/05288 



mammalian host cells and methods for transformation, culture, 
amplification, screening, product production and purification 
are known in the art. See, e.g., Gething and Sambrook, Nature P 
121:620-625 (1981), or alternatively, Kaufman et al, Mol. Cell. 
Biol. . 5(7) : 1750-1759 (1985) or Howley et al, U.S. Patent 
4,419,446. Another suitable mammalian cell line, which is 
described in the accompanying examples, is the monkey COS-1 cell 
line. The mammalian cell CV-1 may also be suitable. 

Bacterial cells may also be suitable hosts. For example, 
the various strains of E. coli (e.g., HB101, MC1061) are 
well-known as host cells in the field of biotechnology. Various 
strains of g. subtilis . Pseudomonas, other bacilli and the like 
may also be employed in this method. 

Many strains of yeast cells known to those skilled in the 
art may also be available as host cells for expression of the 
polypeptides of the present invention. Additionally, where 
desired, insect cells may be utilized as host cells in the 
method of the present invention. See, e.g. Miller et al, 
Genetic Engineering . £: 277-298 (Plenum Press 1986) and 
references cited therein. 

Another aspect of the present invention provides vectors 
for use in the method of expression of these novel BMP-11 
polypeptides. Preferably the vectors contain the full novel DNA 
sequences described above which encode the novel factors of the 
invention. Additionally, the vectors contain appropriate 
expression control sequences permitting expression of the BMP-11 
protein sequences. Alternatively, vectors incorporating 
modified sequences as described above are also embodiments of 
the present invention. Additionally, the sequence of SEQ ID 
N0:1 or SEQ ID NO: 10 or other sequences encoding BMP-11 proteins 
could be manipulated to express a mature BMP-11 by deleting BMP- 
11 encoding propeptide sequences and replacing them with 
sequences encoding the complete propeptides of other BMP 
proteins, activin proteins or other members of the TGF-0 
superfamily. 

The vectors may be employed in the method of transforming 
cell lines and contain selected regulatory sequences in 



13 



WO 94/26892 



PCT/US94/0S288 



operative association with the DNA coding sequences of the 
invention which are capable of directing the replication and 
expression thereof in selected host cells. Regulatory sequences 
for such vectors are known to those skilled in the art and may 
be selected depending upon the host cells. Such selection is 
routine and does not form part of the present invention. 

For expression in mammalian host cells, the vector may 
comprise a coding sequence encoding a propeptide suitable for 
secretion of proteins by the host cell linked in proper reading 
frame to the coding sequence for mature BMP-11 protein. 
Suitable propeptide encoding sequences may be obtained from DNA 
encoding proteins of the TGF-0 superfamily of proteins, for 
example, including BMP-2 through BMP-9. For example, see United 
States Patent 5,168,150, the disclosure of which is hereby 
incorporated by reference, in which a DNA encoding a precursor 
portion of a mammalian protein other than BMP-2 is fused to the 
DNA encoding a mature BMP-2 protein. Thus, the present 
invention includes chimeric DNA molecules comprising a DNA 
sequence encoding a propeptide from a member of the TGF-/3 
superfamily of proteins linked in correct reading frame to a DNA 
sequence encoding a BMP-11 polypeptide. The term "chimeric" is 
used to signify that the propeptide originates from a different 
polypeptide than BMP-ll. 

A protein of the present invention, which regulates the 
production of FSH, has possible application in increasing 
fertility, when expressed in a composition as a homodimer or as 
a heterodimer with other proteins of the inhibin-£ family. The 
proteins of the present invention may also be useful for 
contraception, when expressed in a composition as a heterodimer 
with proteins of the inhibin-ot family. 

A protein of the present invention, which induces 
cartilage and/or bone formation in circumstances where bone is 
not normally formed, has application in the healing of bone 
fractures and cartilage defects in humans and other animals. 
Such a preparation employing a BMP-ll protein may have 
prophylactic use in closed as well as open fracture reduction 
and also in the improved fixation of artificial joints. De novo 



14 



WO 94/26892 



PCT/US94/05288 



bone formation induced by an osteogenic agent contributes to the 
repair of congenital, trauma induced, or oncologic resection 
induced craniofacial defects, and also is useful in cosmetic 
plastic surgery. A BMP-ll protein may be used in the treatment 
of periodontal disease, and in other tooth repair processes. 
Such agents may provide an environment to attract bone-forming 
cells, stimulate growth of bone-forming cells or induce 
differentiation of progenitors of bone-forming cells. BMP-ll 
polypeptides of the invention may also be useful in the 
treatment of osteoporosis. A variety of osteogenic, 
cartilage-inducing and bone inducing factors have been 
described. See, e.g., European patent applications 148,155 and 
169,016 for discussions thereof. 

The proteins of the invention may also be used in wound 
healing and related tissue repair. The types of wounds include, 
but are not limited to burns, incisions and ulcers. (See, e.g. 
PCT Publication WO84/01106 for discussion of wound healing and 
related tissue repair) . 

A further aspect of the invention is a therapeutic method 
and composition for repairing fractures and other conditions 
related to cartilage and/or bone defects or periodontal dis- 
eases. The invention further comprises therapeutic methods and 
compositions for wound healing and tissue repair. Such 
compositions comprise a therapeutically effective amount of at 
least one of the BMP-ll proteins of the invention in admixture 
with a pharmaceutically acceptable vehicle, carrier or matrix. 

Such a preparation employing a BMP-ll protein may also 
increase neuronal survival and therefore be useful in 
transplantation and treatment of conditions exhibiting a 
decrease in neuronal survival. 

It is expected that the BMP-ll proteins of the invention 
may act in concert with or perhaps synergistically with other 
related proteins and growth factors. Further therapeutic 
methods and compositions of the invention therefore comprise a 
therapeutic amount of at least one BMP-ll protein of the 
invention with a therapeutic amount of at least one of the BMP 
proteins or other growth factors disclosed in co-owned patents 



15 



WO 94/26892 



PCT/US94/0S288 



and applications described above. Such combinations may 
comprise separate molecules or heteromolecules comprised of 
different moieties. For example, a method and composition of 
the invention may comprise a disulfide linked dimer comprising 
a BMP-11 protein subunit and a subunit from an inhibin-a 
protein, an inhibin-0 protein or a BMP protein, such as BMP-1 
through BMP-10. The agents useful with BMP-11 may include 
various growth factors such as epidermal growth factor (EGF) , 
platelet derived growth factor (PDGF) , transforming growth 
factors (TGF-a and TGF-0) , and insulin- like growth factor (IGF) . 
Further therapeutic methods and compositions of the invention 
comprise a therapeutic amount of at least one BMP-11 protein of 
the invention with a therapeutic amount of at least one of the 
BMP proteins disclosed in co-owned patents and applications 
described above. Such combinations may comprise separate 
molecules of the BMP proteins or heteromolecules comprised of 
different BMP moieties. For example, a method and composition 
of the invention may comprise a disulfide linked dimer 
comprising a BMP-11 protein subunit and a subunit from one of 
the "BMP" proteins described above. Thus, the present invention 
includes a purified BMP-11 polypeptide which is a heterodimer 
wherein one subunit comprises at least the amino acid sequence 
from amino acid #1 to amino acid #109 of SEQ ID NO: 2 or SEQ ID 
NO: 11, and one subunit comprises an amino acid sequence for a 
bone morphogenetic protein selected from the group consisting of 
BMP-1, BMP- 2, BMP- 3, BMP-4, BMP- 5, BMP- 6, BMP-7, BMP- 8 and BMP- 
9. A further embodiment may comprise a heterodimer of BMP-11 
moieties. Further, BMP-11 proteins may be combined with other 
agents beneficial to the treatment of the bone and/or cartilage 
defect, wound, or tissue in question. These agents include 
various growth factors such as epidermal growth factor (EGF) , 
fibroblast growth factor (FGF), platelet derived growth factor 
(PDGF) , transforming growth factors (TGF-a and TGF-jS) , and k- 
f ibroblast growth factor (kFGF) , parathyroid hormone (PTH) , 
leukemia inhibitory factor (LIF/HILDA/DIA) , insulin-like growth 
factors (IGF-I and IGF-II) . Portions of these agents may also 
be used in compositions of the present invention. 



16 



WO 94/26892 



PCT/US94/05288 



The BMP-11 proteins of the present invention may also be 
used in compositions combined with bone morphogenetic proteins. 
See for example, Ogawa et al., WO 92/14481 (1992); Ogawa et al., 
J. Biol. Chem., 2^2:14233-14237 (1992). The bone morphogenetic 
proteins useful in such compositions include BMP-1, BMP-2, BMP- 
3, BMP-4, BMP-5, BMP-6 and BMP-7, disclosed for instance in 
United States Patents 5,108,922; 5,013,649; 5,116,738; 
5,106,748; 5,187,076; and 5,141,905; BMP-8, disclosed in PCT 
publication W091/ 18098; and BMP-9, disclosed in PCT publication 
WO93/00432; and BMP-10 disclosed in co-pending patent 
application serial number 08/061,695, filed on May 12, 1993. 

The preparation and formulation of such physiologically 
acceptable protein compositions, having due regard to pH, 
isotonicity, stability and the like, is within 1 the skill of the 
art. The therapeutic compositions are also presently valuable 
for veterinary applications due to the lack of species 
specificity in BMP and TGF proteins. Particularly domestic 
animals and thoroughbred horses in addition to humans are 
desired patients for such treatment with BMP-11 of the present 
invention. 

The therapeutic method includes administering the 
composition topically, systemically, or locally as an implant or 
device. When administered, the therapeutic composition for use 
in this invention is, of course, in a pyrogen-free, 
physiologically acceptable form. Further, the composition may 
desirably be encapsulated or injected in a viscous form for 
delivery to the site of bone, cartilage or tissue damage. 
Topical administration may be suitable for wound healing and 
tissue repair. Therapeutically useful agents other than the 
BMP-11 proteins which may also optionally be included in the 
composition as described above, may alternatively or 
additionally , be administered simultaneously or sequentially 
with the BMP-11 composition in the methods of the invention. 

Preferably for bone, cartilage or other connective tissue 
formation, the composition includes a matrix capable of 
delivering BMP-11 or other BMP proteins to the site of tissue 



17 



WO 94/26892 



PCT/US94/0S288 



damage in need of repair, providing a structure for the 
developing bone and cartilage and optimally capable of being 
resorbed into the body* The matrix may provide slow release of 
BMP-ll and/or other bone inductive protein, as well as proper 
presentation and appropriate environment for cellular 
infiltration. Such matrices may be formed of materials 
presently in use for other implanted medical applications. 

The choice of matrix material is based on biocompatibility, 
biodegradability, mechanical properties, cosmetic appearance and 
interface properties. The particular application of the BMP-11 
compositions will define the appropriate formulation. Potential 
matrices for the compositions may be biodegradable and 
chemically defined calcium sulfate, tricalciumphosphate, 
hydroxyapatite, poly lactic acid and polyanhydrides. Other 
potential materials are biodegradable and biologically well 
defined, such as bone, tendon or dermal collagen. Further 
matrices are comprised of pure proteins or extracellular matrix 
components. Other potential matrices are nonbiodegradable and 
chemically defined, such as sintered hydroxyapatite, bioglass, 
aluminates, or other ceramics. Matrices may be comprised of 
combinations of any of the above mentioned types of material, 
such as polylactic acid and hydroxyapatite or collagen and 
tricalciumphosphate. The bioceramics may be altered in 
composition, such as in calcium-aluminate-phosphate and 
processing to alter pore size, particle size, particle shape, 
and biodegradability. 

Progress can be monitored by periodic assessment of bone 
growth and/or repair. The progress can be monitored, for 
example, x-rays, histomorphometric determinations and 
tetracycline labeling. 

The dosage regimen will be determined by the attending 
physician considering various factors which modify the action of 
the BMP-11 protein, e.g. the patient's age, sex, and diet, the 
severity of any infection, time of administration and other 
clinical factors. The dosage may vary with the type of BMP 
protein or growth factor present in the composition. The dosage 
may also vary with the type of matrix used. 



18 



WO 94/26892 



PCT/US94/05288 



The following examples illustrate practice of the present 
invention in recovering and characterizing bovine BMP-11 protein 
and employing it to recover the human and other BMP-11 proteins, 
obtaining the human proteins and expressing the proteins via 
recombinant techniques . 
EXAMPLE 1 
Bovine BMP-11 

800,000 recombinants of a bovine genomic library 
constructed in the vector XEMBL3 are plated at a density of 8000 
recombinant bacteriophage plaques per plate on 100 plates. 
Duplicate nitrocellulose replicas of the recombinant 
bacteriophage plaques are made from these plates and amplified. 
A fragment of human BMP-7 DNA corresponding to nucleotides #1081 
to #1403 (Figure 4, United States Patent 5,141,905) is 32 P- 
labelled by the random priming procedure of Feinberg et al. 
[Anal. Biochem. 132: 6-13 (1983)] and hybridized to one set of 
filters in standard hybridization buffer (SHB) (5x SSC, 0.170 
SDS, 5x Denhardt's, 100 jig/ml Salmon sperm DNA) at 60°C for 2 to 
3 days. The filters are washed under reduced stringency 
conditions (4X SSC, 0.1% SDS at 60°C) . Multiple positively 
hybridizing recombinants are noted. 52 positively hybridizing 
recombinant bacteriophage plaques are selected and replated for 
secondaries. Duplicate nitrocellulose replicas of the 
recombinant plaques are made from these 52 secondary plates and 
amplified. One set of nitrocellulose filters is hybridized to 
the human BMP-7 DNA probe as described above and washed under 
the same reduced stringency conditions. The other set of 
filters is hybridized to a mixed BMP-5, BMP-6, and BMP-7 probe 
in SHB at 65°C overnight and washed with a 0.1X SSC, 0.1% SDS at 
65 °C (stringent hybridization and wash conditions). The mixed 
probe consists of relatively equal amounts of 32 P-labelled DNA 
fragments comprising nucleotides #1452 to #2060 (Figure 4, 
United States Patent 5,106,748) of the human BMP-5 sequence, 
nucleotides #1395 to #1698 (Figure 4, United States Patent 
5,187,076) of the human BMP-6 sequence, and nucleotides #1081 to 
#14 03 (Figure 4, United States Patent 5,141,905) of the human 
BMP-7 sequence. The BMP-5, BMP-6 and BMP-7 DNA fragments are 



19 



WO 94/26892 



PCT/US94/05288 



^P-labelled by the random priming procedure and equal numbers of 
counts per minute (cpms) of each probe are combined and added to 
the SHB containing the other set of nitrocellulose filter 
replicas of the 52 secondary plates. 14 recombinants, which 
hybridized positively to the human BMP-7 probe under the reduced 
stringency conditions and exhibited weak or no hybridization to 
the mixed BMP-5/6/7 probe under high stringency conditions, are 
selected for further analysis. All 14 recombinants which 
exhibit these hybridization characteristics are plaque purified 
and bacteriophage DNA is prepared from each. The positively 
hybridizing region of one of : ie 14 recombinants exhibiting the 
hybridization characteristics described above, designated \7r- 
30, is localized to a 0.5 kb SacI restriction fragment. This 
fragment is subcloned into a plasmid vector (pGEM-3) and DNA 
sequence analysis is performed. The partial DNA sequence 
(SEQUENCE ID NO. 1) and derived amino acid sequence (SEQUENCE ID 
NO. 2) of clone \7r-30 are shown in the Sequence Listings. 

The bacteriophage \7r-30 has been deposited with the ATCC 
on April 7, 1993, and accorded the accession number ATCC 75439. 
This deposit meets the requirements of the Budapest Treaty of 
the International Recognition of the Deposit of Microorganisms 
for the Purpose of Patent Procedures and regulations thereunder. 

This \7r-30 clone encodes at least a portion of the bovine 
BMP-11 protein of the present invention. The nucleotide 
sequence of clone X7r-30 contains an open reading frame of 456 
nucleotides #246-701 of SEQ ID NO:l. The nucleotide sequence of 
#324 to #701 of SEQ ID N0:1 defines an open reading frame of 378 
nucleotides, encoding at least 126 amino acids of the C-terminal 
portion of a bovine BMP-11 protein, as determined by alignment 
to other BMP proteins and other proteins within the TGF-j8 
family. The nucleotide sequence #24 6 to #323 defines an open 
reading frame contiguous with the sequence encoding the 
predicted 126 amino acid BMP-11 peptide, however a reduced 
degree of amino acid identity of the peptide deduced from this 
region of DNA sequence (#246 to #323) to other BMP proteins and 
other proteins of the TGF-0 family and the presence of multiple 
potential splice acceptor consensus sequences make it difficult 



20 



WO 94/26892 



PCI7US94/05288 



to define the 5' limit of this exon of the bovine BMP-11 gene. 
The presence of an in-frame stop codon at nucleotide positions 
#243 to #245 indicates that nucleotide sequence of clone X7r-30 
contains at least one exon/intron boundary of the bovine BMP-11 
gene. 

Based upon the knowledge of other proteins within the TGF-0 
family, it is predicted that the BMP-ll precursor polypeptide 
would be cleaved at the multibasic sequence ARG-SER-ARG-ARG in 
agreement with a proposed consensus proteolytic processing 
sequence of ARG-X-X-ARG. Cleavage of the BMP-11 precursor 
polypeptide is expected to generate a 109 amino acid mature 
peptide beginning with the amino acid ASN at position #1. The 
processing of BMP-11 into the mature form is expected to involve 
dimerization and removal of the N-terminal region in a manner 
analogous to the processing of the related protein TGF-0 [Gentry 
et al., Molec. & Cell. Biol. . 8:4162 (1988); Derynck et al., 
Nature . 316:701(1985)]. 

It is contemplated therefore that the mature active species 
of BMP-11 comprises a homodimer of two polypeptide subunits, 
each subunit comprising amino acids # 1 to # 109 with a 
predicted molecular weight of approximately 12,000 daltons. 
Further active species are contemplated comprising amino acids 
#6 to #109, thereby including the first conserved cysteine 
residue. As with other members of the TGF-0 family of proteins, 
the carboxy-terminal region of the BMP-ll .protein exhibits 
greater sequence conservation than the more amino-terminal 
portion. The percent amino acid identity of the BMP-ll protein 
in the cysteine-rich C-terminal domain (amino acids #6 to #109) 
to the corresponding region of other proteins within the TGF-jS 
family is as follows: BMP-2, 39%; BMP-3, 37%; BMP-4, 37%; BMP- 
5, 42%, BMP- 6, 45%; BMP-7, 42%; BMP-8, 39%; BMP-9, 40%; Vgl, 
39%; GDF-1, 34%; TGF-01, 36%; TGF-02, 38%; TGF-03, 38%; inhibin 
0(B), 41%; inhibin j8(A), 39%. 

EXAMPLE 2 

Human BMP-ll 

Bovine and human BMP-ll genes are presumed to be 



WO 94/26892 



PCT/US94/05288 



significantly homologous, therefore the bovine coding sequence 
or a portion thereof is used as a probe to screen a human 
genomic library or as a probe to identify a human cell line or 
tissue which synthesizes the analogous human protein. A human 
5 genomic library, such as Stratagene catalog #944201, may be 

screened with such a probe, and presumptive positives isolated 
and DNA sequence obtained. Evidence that this recombinant 
encodes a portion of the human BMP-11 relies on the bovine/human 
protein and gene structure homologies. 

10 Once a recombinant bacteriophage containing DNA encoding a 

portion of the human BMP-11 molecule is obtained, the human 
coding sequence can be used as a probe to identify a human cell 
line or tissue which synthesizes BMP-11 mRNA. Alternatively, 
the bovine BMP-11 coding sequence can be used as a probe to 

15 identify such human cell line or tissue. Briefly described, RNA 

is extracted from a selected cell or tissue source and either 
electrophoresed on a formaldehyde agarose gel and transferred to 
nitrocellulose, or reacted with formaldehyde and spotted on 
nitrocellulose directly. The nitrocellulose is then hybridized 

20 to a probe derived from a coding sequence of the bovine or human 

BMP-11. Alternatively, the bovine BMP-11 coding sequence is 
used to design oligonucleotide primers which will specifically 
amplify a portion of the BMP-11 encoding sequence located in the 
region located between the primers utilized to perform the 

25 specific amplification reaction. It is contemplated that bovine 

and human BMP-11 sequences would allow one to specifically 
amplify corresponding human BMP-11 encoding sequences from mRNA, 
cDNA or genomic DNA templates. Once a positive source has been 
identified by one of the above described methods, mRNA is 

30 selected by oligo (dT) cellulose chromatography and cDNA is 

synthesized and cloned in XgtlO or other X bacteriophage vectors 
known to those skilled in the art. (i.e. XZAP) by established 
techniques (Toole et al., supra ) . It is also possible to 
perform the oligonucleotide primer directed amplification 

35 reaction, described above, directly on a pre-established human 

cDNA or genomic library which has been cloned into a X 
bacteriophage vector. In such cases, a library which yields a 



22 



WO 94/26892 



PCT/US94/05288 



specifically amplified DNA product encoding a portion of human 
BMP-ll protein could be screened directly, utilizing the 
fragment of amplified BMP-ll encoding DNA as a probe. 

Oligonucleotide primers designed on the basis of the DNA 
sequence of the bovine BMP-ll genomic clone \7r-30 are predicted 
to allow the specific amplification of human BMP-ll encoding 
sequences. The following oligonucleotide primer is designed on 
the basis of nucleotides #501 to #521 of the DNA sequence set 
forth in SEQ ID NO. 1 and synthesized on an automated DNA 
synthesizer. 

Primer C: TAGTCTAGATGCTCCGGCCAGTGCGAGTAC 

The first nine nucleotides of primer C (underlined) 
comprise the recognition sequence for the restriction 
endonuclease Xbal which can be utilized to facilitate the 
manipulation of a specifically amplified DNA sequence encoding 
the BMP-ll protein of the invention and are thus not derived 
from the DNA sequence presented in SEQ ID NO: 1. 

The following oligonucleotide primer is designed on the 
basis of nucleotides # 701 to # 678 of the DNA sequence set 
forth in SEQ ID NO. 1 and synthesized on an automated DNA 
synthesizer: 

Primer D: TGCGGATCCGGAGCAGCCACAGCGATCCAC 

The first nine nucleotides of primer D (underlined) 
comprise the recognition sequence for the restriction 
endonuclease BamHI which can be utilized to facilitate the 
manipulation of a specifically amplified DNA sequence encoding 
the BMP-ll protein of the invention and are thus not derived 
from the DNA sequence present in SEQ ID NO:l. 

The standard nucleotide symbols in the above identified 
primers are as follows: A, adenosine; C, cytosine, G, guanine; 
and T, thymine. 

Primers C and D identified above are utilized as primers to 
allow the amplification of a specific nucleotide from human 
genomic DNA. The amplification reaction is performed as 
follows: 

Human genomic DNA (source: peripheral blood lymphocytes) is 
denatured at 100°C for five minutes and then chilled on ice 



WO 94/26892 



PCT/US94/05288 



prior to addition to a reaction mixture containing 200 /iM each 
deoxynucleotide triphosphates (dATP, dGTP, dCTP and dTTP) 10 mM 
Tris-HCl pH8.3, 50 mM KC1, 1.5 mM MgCl 2 , 0.001% gelatin, 1.25 
units Taq DNA polymerase, 100 pM oligonucleotide primer C and 
5 100 pM oligonucleotide primer D. This reaction mixture is then 

subjected to thermal cycling in the following manner: 3 minutes 
at 94 d C, 1 minute at 50°C, 1 minute at 72 °C for one cycle, then 
1 minute at 94 °C, 1 minute at 50 °C, 1 minute at 72 °C for thirty- 
nine cycles. 

10 The DNA which is specifically amplified by this reaction is 

separated from the excess oligonucleotide primers C and D 
utilized to initiate the amplification by the use of a DNA 
purification resin based protocol under the conditions suggested 
by the manufacturer. The resulting DNA product is digested with 

15 the restriction endonucleases Xbal and BamHI, phenol extracted, 

chloroform extracted. Buffer exchange and removal of small 
fragments of DNA resulting from the Xbal/BaHI restriction digest 
is accomplished fcy dilution of the digested DNA product in 10 Mm 
Tris-Hcl pH8.0, : Mm EDTA followed by centrif ugation through a 

20 centricon™ 30 microconcentrator (W.R. Grace & Co., Beverly, Ma.; 

Product #4209) . The resulting Xbal /BamHI digested amplified DNA 
product is subcloned into a plasmid vector (pBluescript) between 
the Xbal and BamHI restriction sites of the poly linker region. 
DNA sequence analysis of the resulting subclones indicates that 

25 the specifically amplified DNA sequence product encodes a 

portion of the human BMP-11 protein of this invention. The DNA 
sequence (SEQ ID NO: 3) and derived amino acid sequence (SEQ ID 
NO: 4) of this specifically amplified DNA fragment are set forth 
in the Sequence Listings. 

30 Nucleotides #1 to #27 of this sequence comprise a portion 

of oligonucleotide primer C and nucleotides #186 to #213 
comprise a portion of oligonucleotide primer D utilized to 
perform the specific amplification reaction. Due to the 
function of oligonucleotide primers C and D (designed on the 

35 basis of bovine BMP-11 DNA sequence) in initiating the 

amplification reaction, they may not correspond exactly to the 
actual sequence encoding a human BMP-ll and are therefore not 



24 



WO 94/26892 



PCT/US94/05288 



translated in the above amino acid sequence derivation. The DNA 
sequence, from nucleotide #28 to #185 of SEQ ID NO: 3, or 
portions thereof, specifically amplified from the human genomic 
DNA template can be utilized as a probe to identify additional 
human BMP-11 encoding sequences from human genomic or human cDNA 
libraries by standard hybridization/ screening techniques known 
to those skilled in the art. 

One million, two hundred thousand recombinants of a human 
fetal brain cDNA libtary (Stratagene catalog # 936206) 
constructed in the vector XZAPII are plated at a density of 
24,000 recombinant bacteriophge plaques per plate on 50 plates. 
Duplicate nitrocellulose replicas of the recombinant 
bacteriophage plaques are made from these plates. An 
oligonucleotide probe designed on the basis of nucleotides #53- 
#82 of SEQ ID NO: 3 is synthesized on an automated DNA 
synthesizer. This oligonucleotide probe is radioactively 
labelled with t^P-ATP and is hybridized to both sets of the 
duplicate nitrocellulose replicas in SHB at 65°C. Nine 
positively hybridizing recombinants are noted. One of the 
positively hybridizing recombinants, named XFB30.5,is plaque 
purified. Bacteriophage plate stocks of the purified XFB30.5 
cDNA clone are prepared and bacteriophage DNA is isolated. A 
bacterial plasmid named FB30.5, generated by the in vivo 
excision protocol described by the supplier (Stratagene) and 
containing the entire insert of the XFB30.5 bacteriophage cDNA 
clone, has been deposited with the ATCC, 12301 Parklawn Drive, 
Rockville, Maryland USA under the requirements of the Budapest 

Treaty and designated as ATCC # . A portion of the DNA 

sequence of clone FB30.5 is set forth in SEQ ID NO: 10. 

One million recombinants of a human genomic library 
(Stratagene Catalog # 944201) constructed in the vector XFIX are 
plated at a density of 20,000 recombinant bacteriophge plaques 
per plate on 50 plates. Duplicate nitrocellulose replicas of 
the recombinant bacteriophage plaques are made from these 
plates. An oligonucleotide probe designed on the basis of 
nucloetides #57-#86 of SEQ ID NO: 10, with the exception of an 
inadvertent substitution of CAC for GCG at nucleotides #59-#61 



25 



WO 94/26892 



PCT/US94/05288 



of SEQ ID NO: 10 , is synthesized on an automated DNA synthesizer. 
This oligonucleotide probe is radioactively labelled with y 32 ?- 
ATP and is hybridized to both sets of the duplicate 
nitrocellulose replicas in SHB at 65°C. Five positively 
hybridizing recombinants are noted. One of the positively 
hybridizing recombinants, named 30GEN.4,is plague purified. 
Bacteriophage plate stocks of the purified 30GEN.4 genomic clone 
are prepared and bacteriophage DNA is isolated. A bacteriophage 
stock of this genomic clone has been deposited with the ATCC, 
12301 Parklawn Drive, Rockville, Maryland USA under the 
requirements of the Budapest Treaty and designated as ATCC # 

. A portion of the DNA sequence of clone 30GEN.4 is set 

forth in SEQ ID NO: 10. A portion of the DNA sequence of the 
genomic clone 30GEN.4 was determined to be identical to a 
portion of the DNA sequence of the cDNA clone FB30.5. The 
extent of this overlap (nucleotides #1-#198) of SEQ ID NO: 10 
were used as a basis to compile the partial coding sequence of 
the BMP-10 protein. The genomic clone 30GEN.4 is expected to 
contain additional 5' coding sequences of the human BMP-11 
protein which are expected to encode the remainder of the BMP-11 
precursor polypeptide, including the initiator methionine. The 
partial sequence of human BMP-11 is presented in SEQ ID NO: 10 
and it should be noted that nucleotides #1-198 have been 
determined to be present in both the 30GEN.4 genomic clone and 
the FB30.5 cDNA clone while nucleotides #199-#1270 are derived 
entirely from the cDNA clone FB30.5. SEQ ID NO: 10 predicts a 
human BMP11 precursor protein of at least 362 amino acids. 
Based on the knowledge of other BMPs and other proteins within 
the TGF-0 family, it is predicted that the precursor polypeptide 
would be cleaved at the multibasic sequence ARG-SER-ARG-ARG 
(amino acids #-4 through #-1 of SEQ ID NO: 11) in agreement with 
the proposed consensus proteolytic processing sequence ARG-X-X- 
ARG. Cleavage of the human BMP-11 precursor polypeptide at this 
location would generate a 109 amino acid mature peptide 
beginning with the amino acid ASN at position #1 of SEQ ID 
NO: 11. The processing of human BMP-11 into the mature form is 
expected to involve dimerization and removal of the N-terminal 



26 



WO 94/26892 



PCT/US94/0S288 



region in a manner analogous to the procesing of the related 
protein TGF-/3 [L.E. Gentry, et al. Molec. & Cell. Biol. 8:4162 
(1988); R.Derynck, et al., Nature 316:701 (1985). It is 
contemplated that the mature active species of human BMP-ll 
5 comprises a homodimer of two polypeptide subunits, each subunit 

comprising amino acids #1-#108 of SEQ ID NO: 11, with a predicted 
molecular weight of 12,000 daltons. Further active species are 
contemplated comprising amino acids #7-#l08 of SEQ ID NO: 11, 
thereby including the first conserved cysteine residue. 
10 Heterodimeric molecules comprising one subunit of BMP-ll and 

another subunit of another member of the BMP/TGF-/8 super family 
are also contemplated. 
EXAMPLE 3 

Expression of BMP-ll 

15 In order to produce bovine, human or other mammalian BMP-ll 

proteins, the DNA encoding it is transferred into an appropriate 
expression vector and introduced into mammalian cells or other 
preferred eukaryotic or prokaryotic hosts by conventional 
genetic engineering techniques. The preferred expression system 

20 for biologically active recombinant human BMP-ll is contemplated 

to be stably transformed mammalian cells. 

One skilled in the art can construct mammalian expression 
vectors by employing the sequence of SEQ ID NO:l or SEQ ID 
NO M0, or other DNA sequences encoding BMP-ll proteins or other 

25 modified sequences and known vectors, such as pCD [Okayama et 

al., Mol. Cell Biol. . 2:161-170 (1982)], pJL3, pJL4 [<3ough et 
al., EMBO 4:645-653 (1985)] and pMT2 CXM. 

The mammalian expression vector pMT2 CXM is a derivative of 
p91023(b) (Wong et al., Science 228 :810-815, 1985) differing 

30 from the latter in that it contains the ampicillin resistance 

gene in place of the tetracycline resistance gene and further 
contains a Xhol site for insertion of cDNA clones. The 
functional elements of pMT2 CXM have been described (Kaufman, 
R.J., 1985, Proc. Natl. Acad. Sci. USA 82:689-693) and include 

35 the adenovirus VA genes, the SV40 origin of replication 

including the 72 bp enhancer, the adenovirus major late promoter 
including a 5' splice site and the majority of the adenovirus 



27 



WO 94/26892 



PCT/US94/0S288 



tripartite leader sequence present on adenovirus late mRNAs, a 
3' splice acceptor site, a DHFR insert, the SV40 early 
polyadenylation site (SV40) , and pBR322 sequences needed for 
propagation in JU. coli. 

Plasmid pMT2 CXM is obtained by EcoRI digestion of pMT2- 
VWF, which has been deposited with the American Type Culture 
Collection (ATCC) , Rockville, MD (USA) under accession number 
ATCC 67122. EcoRI digestion excises the cDNA insert present in 
pMT2-VWF, yielding pMT2 in linear form which can be ligated and 
used to transform coli HB 101 or DH-5 to ampicillin 

resistance. Plasmid pMT2 DNA can be prepared by conventional 
methods. pMT2 CXM is then constructed using loopout/in 
mutagenesis [Morinaga, et al., Biotechnology 84 ; 636 (1984). 
This removes bases 1075 to 1145 relative to the Hind III site 
near the SV40 origin of replication and enhancer sequences of 
pMT2. In addition it inserts the following sequence: 

5' PO-CATGGGCAGCTCGAG-3 9 
at nucleotide 1145. This sequence contains the recognition site 
for the restriction endonuclease Xho I. A derivative of 
PMT2CXM, termed pMT23, contains recognition sites for the 
restriction endonucleases PstI, Eco RI, Sail and Xhol. Plasmid 
pMT2 CXM and pMT23 DNA may be prepared by conventional methods. 

PEMC201 derived from pMT21 may also be suitable in practice 
of the invention. pMT21 is derived from pMT2 which is derived 
from pMT2-VWF. As described above EcoRI digestion excises the 
cDNA insert present in pMT-VWF, yielding pMT2 in linear form 
which can be ligated and used to transform JjL. Coli HB 101 or DH- 
5 to ampicillin resistance. Plasmid pMT2 DNA can be prepared by 
conventional methods. 

pMT21 is derived from pMT2 through the following two 

modifications. First, 76 bp of the 5' untranslated region of 

the DHFR cDNA including a stretch of 19 G residues from G/C 

tailing for cDNA cloning is deleted. In this process, a Xhol 

site is inserted to obtain the following sequence immediately 

upstream from DHFR: 5' - CTGCAG GCGAGCCT GAATTCCTCGAG CCAT CATG -3 9 

PstI Eco RI Xhol 

Second, a unique Clal site is introduced by digestion with 

28 



WO 94/26892 



PCT/US94/05288 



EcoRV and Xbal, treatment with Klenow fragment of DNA polymerase 
I # and ligation to a Clal linker (CATCGATG) . This deletes a 250 
bp segment from the adenovirus associated RNA (VAI) region but 
does not interfere with VAI RNA gene expression or function. 
pMT21 is digested with EcoRI and Xhol, and used to derive the 
vector pEMC2Bl. 

A portion of the EMCV leader is obtained from pMT2-ECATl 
[S.K. Jung, et al, J, Virol £3:1651-1660 (1989)] by digestion 
with Eco RI and PstI, resulting in a 2752 bp fragment. This 
fragment is digested with TaqI yielding an Eco RI-TaqI fragment 
of 508 bp which is purified by electrophoresis on low melting 
agarose gel. A 68 bp adapter and its complementary strand are 
synthesized with a 5' TaqI protruding end and a 3' Xhol 
protruding end which has the following sequence: 

5 ' -£^GGTTAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGT<K5TTTTCCTTT 
TaqI 

GAAAAACACGATTGC- 3 ' 
Xhol 

This sequence matches the EMC virus leader sequence from 
nucleotide 763 to 827. It also changes the ATG at position 10 
within the EMC virus leader to an ATT and is followed by a Xhol 
site. A three way ligation of the pMT21 Eco Rl-Xhol fragment, 
the EMC virus EcoRI -TaqI fragment, and the 68 bp 
oligonucleotide adapter Taql-Xhol adapter resulting in the 
vector pEMC201. 

This vector contains the SV4 0 origin of replication and 
enhancer, the adenovirus major late promoter, a cDNA copy of the 
majority of the adenovirus tripartite leader sequence, a small 
hybrid intervening sequence, an SV4 0 polyadenylation signal and 
the adenovirus VA I gene, DHFR and ^-lactamase markers and an 
EMC sequence, in appropriate relationships to direct the high 
level expression of the desired cDNA in mammalian cells. 

The construction of vectors may involve modification of the 
BMP-11 DNA sequences. For instance, BMP- 11 cDNA can be modified 
by removing the non-coding nucleotides on the 5' and 3 ' ends of 
the coding region. The deleted non-coding nucleotides may or 



29 



WO 94/26892 



PCT/US94/05288 



may not be replaced by other sequences known to be beneficial 
for expression. These vectors are transformed into appropriate 
host cells for expression of BMP-11 proteins. Additionally, the 
sequence of SEQ ID N0:1 or SEQ ID NO: 10 or other sequences 
encoding BMP-11 proteins could be manipulated to express a 
mature BMP-11 by deleting BMP-11 encoding propeptide sequences 
and replacing them with sequences encoding the complete 
propeptides of other BMP proteins, activin proteins or other 
members of the TGF-0 superfamily. 

One skilled in the art can manipulate the sequences of SEQ 
ID N0:1 or SEQ ID NO: 10 by eliminating or replacing the 
mammalian regulatory sequences flanking the coding sequence with 
bacterial sequences to create bacterial vectors for 
intracellular or extracellular expression by bacterial cells. 
For example, the coding sequences could be further manipulated 
(e.g. ligated to other known linkers or modified by deleting 
non-coding sequences therefrom or altering nucleotides therein 
by other known techniques) . The modified BMP-11 coding sequence 
could then be inserted into a known bacterial vector using 
procedures such as described in T. Taniguchi et al., Proc. Natl 
Acad. Sci. USA . 77:5230-5233 (1980). This exemplary bacterial 
vector could then be transformed into bacterial host cells and 
a BMP-11 protein expressed thereby. For a strategy for 
producing extracellular expression of BMP-11 proteins in 
bacterial cells, see, e.g. European patent application EPA 
177,343. 

Similar manipulations can be performed for the construction 
of an insect vector [See, e.g. procedures described in published 
European patent application 155,476] for expression in insect 
cells. A yeast vector could also be constructed employing yeast 
regulatory sequences for intracellular or extracellular 
expression of the factors of the present invention by yeast 
cells. [See, e.g., procedures described in published PCT 
application W086/00639 and European patent application EPA 
123,289]. 

A method for producing high levels of a BMP-11 protein of 
the invention in mammalian cells may involve the construction of 



30 



WO 94/26892 



PCT/US94/05288 



cells containing multiple copies of the heterologous BMP-li 
gene. The heterologous gene is linked to an amplifiable marker, 
e.g. the dihydrof olate reductase (DHFR) gene for which cells 
containing increased gene copies can be selected for propagation 
in increasing concentrations of methotrexate (MTX) according to 
the procedures of Kaufman and Sharp, J. Mol. Biol. . 159:601-629 
(1982). This approach can be employed with a number of 
different cell types.* 

For example, a plasmid containing a DNA sequence for a BMP- 
11 of the invention in operative association with other plasmid 
sequences enabling expression thereof and the DHFR expression 
plasmid pAdA26SV(A) 3 [Kaufman and Sharp, Mol. Cell. Biol. . 
2:1304 (1982)] can be co-introduced into DHFR-def icient CHO 
cells, DUKX-BII, by various methods including calcium phosphate 
coprecipitation and transfection, electroporation or protoplast 
fusion. DHFR expressing transf ormants are selected for growth 
in alpha media with dialyzed fetal calf serum, and subsequently 
selected for amplification by growth in increasing 
concentrations of MTX (e.g. sequential steps in 0.02, 0.2, 1.0 
and 5uM MTX) as described in Kaufman et al., Mol Cell Biol. . 
5:1750 (1983). Transf ormants are cloned, and biologically 
active BMP-11 expression is monitored by one or more of the BMP- 
11 activity assays described in Examples 5 to 8 below. BMP-11 
expression should increase with increasing levels of MTX 
resistance. BMP-11 polypeptides are characterized using 
standard techniques known in the art such as pulse labeling with 
[35S] methionine or cysteine and polyacrylamide gel 
electrophoresis. Similar procedures can be followed to produce 
other related BMP-11 proteins. 
EXAMPLE 4 

Biological Activity of Expressed BMP-11 

To measure the biological activity of the expressed BMP-11 
proteins obtained in Example 3 above, the proteins are recovered 
from the cell culture and purified by isolating the BMP-11 
proteins from other proteinaceous materials with which they are 
co-produced as well as from other contaminants. The purified 
protein may be assayed in accordance with the assays for BMP-11 



WO 94/26892 



PCT/US94/05288 



activity described in Examples 5 to 8 below. 
EXAMPLE 5 
W-20 BIOASSAYS 

A. Description of W-20 cells 

Use of the W-20 bone marrow stromal cells as an indicator 
cell line is based upon the conversion of these cells to 
osteoblast-like cells after treatment with a BMP protein [Thies 
et al, Journal of Bone and Mineral Research , *S:305 (1990); and 
Thies et al, Endocrinology . 130:1318 (1992) ]. Specifically, W- 
20 cells are a clonal bone marrow stromal cell line derived from 
adult mice by researchers in the laboratory of Dr. D. Nathan, 
Children's Hospital, Boston, MA. Treatment of W-20 cells with 
certain BMP proteins results in (1) increased alkaline 
phosphatase production, (2) induction of PTH stimulated cAMP, 
and (3) induction of osteocalcin synthesis by the cells. While 
(1) and (2) represent characteristics associated with the 
osteoblast phenotype, the ability to synthesize osteocalcin is 
a phenotypic property only displayed by mature osteoblasts. 
Furthermore, to date we have observed conversion of W-20 stromal 
cells to osteoblast-like cells only upon treatment with BMPs. 
In this manner, the in vitro activities displayed by BMP treated 
W-20 cells correlate with the in vivo bone forming activity 
known for BMPs. 

Below two In vitro assays useful in comparison of BMP 
activities of novel osteoinductive molecules are described. 

B. W-20 Alkaline Phosphatase Assay Protocol 

W-20 cells are plated into 96 well tissue culture plates at 
a density of 10,000 cells per well in 200 /xl of media (DME with 
10% heat inactivated fetal calf serum, 2 mM glutamine and 100 
Units/ml penicillin + 100 fig/J&l streptomycin. The cells are 
allowed to attach overnight in a 95% air, 5% C0 2 incubator at 
37°C. 

The 200 /xl of media is removed from each well with a 
multichannel pipettor and replaced with an equal volume of test 
sample delivered in DME with 10% heat inactivated fetal calf 
serum, 2 mM glutamine and 1% penicillin-streptomycin. Test 
substances are assayed in triplicate. 



32 



WO 94/26892 



PCT/US94/05288 



The test samples and standards are allowed a 24 hour 
incubation period with the W-20 indicator cells. After the 24 
hours, plates are removed from the 37 °C incubator and the test 
media are removed from the cells. 

The W-20 cell layers are washed 3 times with 200 /il per 
well of calcium/magnesium free phosphate buffered saline and 
these washes are discarded. 

50 /il of glass distilled water is added to each well and 
the assay plates are then placed on a dry ice/ethanol bath for 
quick freezing. Once frozen, the assay plates are removed from 
the dry ice/ethanol bath and thawed at 37°C. This step is 
repeated 2 more times for a total of 3 freeze-thaw procedures. 
Once complete, the membrane bound alkaline phosphatase is 
available for measurement. 

50 /il of assay mix (50 mM glycine, 0.05% Triton X-100, 4 mM 
MgCl 2 , 5 mM p-nitrophenol phosphate, pH = 10.3) is added to each 
assay well and the assay plates are then incubated for 30 
minutes at 37 °C in a shaking waterbath at 60 oscillations per 
minute. 

At the end of the 30 minute incubation, the reaction is 
stopped by adding 100 /il of 0.2 H NaOH to each well and placing 
the assay plates on ice. 

The spectrophotometric absorbance for each well is read at 
a wavelength of 405 nanometers. These values are then compared 
to known standards to give an estimate of the alkaline 
phosphatase activity in each sample. For example, using known 
amounts of p-nitrophenol phosphate, absorbance values are 
generated. This is shown in Table I. 



33 



WO 94/26892 



PCT/US94/05288 



Table I 



Absorbance Values for 
of P-Nitrophenol 

P-nitroDhenol DhosDhate umoles 


Known Standards 
Phosphate 

Mean absorbance f405 nmV 


0.000 


0 


0.006 


0.261 +/- .024 


0.012 


0.521 +/- .031 


0.018 


0.797 +/- .063 


0.024 


1.074 +/- .061 


0.030 


1.305 +/- «083 



Absorbance values for known amounts of BMPs can be 
determined and converted to jzmble's of p-nitrophenol phosphate 
cleaved per unit time as shown in Table II. 



Table II 



Alkaline Phosphatase Values for 


W-20 Cells 




Treating with BMP-2 




BMP-2 concentration 


Absorbance Reading 


umoles substrate 


na/ml 


405 nmeters 


oer hour 


0 


0.645 


0.024 


1.56 


0.696 


0.026 


3.12 


0.765 


0.029 


6.25 


0.923 


0.036 


12.50 


1.121 


0.044 


25.0 


1.457 


0.058 


50.0 


1.662 


0.067 


100.0 


1.977 


0.080 



These values are then used to compare the activities of 
known amounts of BMP-11 to BMP-2. 
C. Osteocalcin RIA Protocol 

W-20 cells are plated at 10 6 cells per well in 24 well 



34 



WO 94/26892 



PCT/US94/05288 



multiwell tissue culture dishes in 2 rols of DME containing 10% 
heat inactivated fetal calf serum, 2 mM glutamine. The cells 
are allowed to attach overnight in an atmosphere of 95% air 5% 
C0 2 at 37°C. 

The next day the medium is changed to DME containing 10% 
fetal calf serum, 2 mM glutamine and the test substance in a 
total volume of 2 ml. Each test substance is administered to 
triplicate wells. The test substances are incubated with the W- 
20 cells for a total of 96 hours with replacement at 48 hours by 
the same test medias. 

At the end of 96 hours, 50 m! of the test media is removed 
from each well and assayed for osteocalcin production using a 
radioimmunoassay for mouse osteocalcin. The details of the 
assay are described in the kit manufactured by Biomedical 
Technologies Inc., 378 Page Street, Stoughton, MA 02072. 
Reagents for the assay are found as product numbers BT-431 
(mouse osteocalcin standard) , BT-432 (Goat anti-mouse 
Osteocalcin), BT-431R (iodinated mouse osteocalcin), BT-415 
(normal goat serum) and BT-414 (donkey anti goat IgG) . The RIA 
for osteocalcin synthesized by W-20 cells in response to BMP 
treatment is carried out as described in the protocol provided 
by the manufacturer. 

The values obtained for the test samples are compared to 
values for known standards of mouse osteocalcin and to the 
amount of osteocalcin produced by W-20 cells in response to 
challenge with known amounts of BMP-2. The values for BMP-2 
induced osteocalcin synthesis by W-20 cells is shown in Table 
III. 



WO 94/26892 



PCT/US94/05288 



Table XII 



Osteocalcin Synthesis by W-20 Cells 
BMP-2 Concentration na/ml Osteocalcin Synthesis na/vell 



0 


0.8 


2 


0.9 


4 


0.8 


8 


2.2 


16 


2.7 


31 


3.2 


62 


5.1 


125 


6.5 


250 


8.2 


500 


9.4 


1000 


10.0 



36 



WO 94/26892 



PCI7US94/05288 



EXAMPLE 6 

Rosen-Modified Samoa th-Reddi Assay. 

A modified version of the rat bone formation assay 
described in Sampath and Reddi, Proc. Natl. Acad. Sci. USA . 
5 80:6591-6595 (1983) is used to evaluate bone, cartilage and/or 

other connective tissue inductive activity of BMP-11 proteins. 
This modified assay is herein called the Rosen-modified Sampath- 
Reddi assay. The ethanol precipitation step of the Sampath- 
Reddi procedure is replaced by dialyzing (if the composition is 

10 a solution) or diafiltering (if the composition is a suspension) 

the fraction to be assayed against water. The solution or 
suspension is then equilibrated to 0.1% TFA. The resulting 
solution is added to 20 mg of rat matrix. A mock rat matrix 
sample not treated with the protein serves as a control. This 

15 material is frozen and lyophilized and the resulting powder 

enclosed in #5 gelatin capsules. The capsules are implanted 
subcutaneously in the abdominal thoracic area of 21-49 day old 
male Long Evans rats. The implants are removed after 7-14 days. 
Half of each implant is used for alkaline phosphatase analysis 

20 [see, Reddi et al, Proc. Natl. Acad, Sci . r 69:1601 (1972)]. 

The other half of each implant is fixed and processed for 
histological analysis. 1 pm glycolmethacrylate sections are 
stained with Von Kossa and acid fuschin to score the amount of 
induced bone and cartilage formation present in each implant. 

25 The terms +1 through +5 represent the area of each histological 

section of an implant occupied by new bone and/or cartilage 
cells and matrix. A score of +5 indicates that greater than 50% 
of the implant is new bone and/ or cartilage produced as a direct 
result of protein in the implant. A score of +4, +3, +2, and +1 

30 would indicate that greater than 40% , 30%, 20% and 10% 

respectively of the implant contains new cartilage and/or bone. 

The BMP-11 proteins of this invention may be assessed for 
activity on this assay. 



37 



WO 94/26892 



PCT7US94/0S288 



EXAMPLE 7 

Biological Activity of Expressed BMP-11 

To measure the biological activity of the expressed BMP-11 
proteins obtained in Example 3 above, the proteins are recovered 
from the cell culture and purified by isolating the BMP-11 
proteins from other proteinaceous materials with which they are 
co-produced as well as from other contaminants. The purified 
protein may be assayed in accordance with the rat bone formation 
assay described in Example 6. 

Purification is carried out using standard techniques known 
to those skilled in the art. 

Protein analysis is conducted using standard techniques 
such as SDS-PAGE acrylamide [Laemmli, Nature 222:680 (1970)] 
stained with silver [Oakley, et al. Anal. Biochem. 2fi£:361 
(1980)) and by immunoblot [Towbin, et al. Proc. Natl. Acad. Sci. 
USA 76:4350 (1979) ). 

The foregoing descriptions detail presently preferred 
embodiments of the present invention. Numerous modifications 
and variations in practice thereof are expected to occur to 
those skilled in the art upon consideration of these descrip- 
tions. Those modifications and variations are believed to be 
encompassed within the claims appended hereto. 
EXAMPLE 8 

Tests to determine activin activity of BMP- 11 

Purification is carried out using standard techniques known 
to these skilled in the art. It is contemplated, as with other 
proteins of the TGF-/5 superfamily, that purification may include 
the use of Heparin sepharose. 

Protein analysis is conducted using standard techniques 
such as SDS-PAGE acrylamide [Laemmli, Nature 227 :680 (1970)) 
stained with silver [Oakley, et al. Anal. Biochem. 105:361 
(1980)] and by immunoblot [Towbin, et al. Proc. Natl. Acad. Sci. 
USA 76:4350 (1S79) ] . 

BMP-11 proteins may be further characterized by their 
ability to modulate the release of follicle stimulating hormone 
(FSH) in established in vitro bioassays using rat anterior 
pituitary cells as described in, for example, Vale et al, 



38 



WO 94/26892 



PCT/US94/0S288 



Endocrinology, £1:562-572 (1972); Ling et al., Nature, 221:779- 
782 (1986) or Vale et al., Nature, 321:776-779 (1986), the 
disclosures of which are hereby incorporated by reference. 

Alternatively, BMP-11 may be characterized by their ability 
to stimulate erythropoietin activity in the human K-562 cell 
line, as described by Lozzio et al., Blood . 45:321-334 (1975) 
and United States Patent No. 5,071,834, at column 15, the 
disclosures of which are hereby incorporated by reference. 

In addition, BMP-11 may be characterized by their activity 
in cell survival assays, as described in Schubert, Nature . 
344:868-870 (1990), the disclosure of which is incorporated by 
reference. 

The foregoing descriptions, detail presently preferred 
embodiments of the present invention. Numerous modifications 
and variations in practice thereof are expected to occur to 
those skilled in the art upon consideration of these descrip- 
tions. Those modifications and variations are believed to be 
encompassed within the claims appended hereto. 



39 



WO 94/26892 



PCT/US94/05288 



SEQUENCE LISTING 



(1) GENERAL INFORMATION: 

(i) APPLICANT: 

(A) NAME: GENETICS INSTITUTE, INC. 

(B) STREET: 87 CambridgePark Drive 

(C) CITY: Cambridge 

(D) STATE: Massachusetts 

(E) COUNTRY: USA 

(F) POSTAL CODE (ZIP): 02140 

(G) TELEPHONE: 617 876-1170 

(H) TELEFAX: 617-876-5851 

(ii) TITLE OF INVENTION: BMP-11 COMPOSITIONS 
(iii) NUMBER OF SEQUENCES: 11 



(iv) COMPUTER READABLE FORM: 

(A) MEDIUM TYPE: Floppy disk 

(B) COMPUTER: IBM PC compatible 

(C) OPERATING SYSTEM: PC-DOS/MS-DOS 

(D) SOFTWARE: Patentln Release #1.0, Version #1.25 (EPO) 

<2) INFORMATION FOR SEQ ID NO: 1: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 789 baee pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: double 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 

(vi) ORIGINAL SOURCE: 

(A) ORGANISM: Boe Taurue 

(B) STRAIN: Bovine Activin WC 

(ix) FEATURE: 

(A) NAME /KEY: CDS 

(B) LOCATION: 324.. 704 

(ix) FEATURE: 

(A) NAME/ KEY : miec feature 

(B) LOCATION: 322.7323 

(D) OTHER INFORMATION: /note= "putative 3' end of intron" 

(ix) FEATURE: 

(A) NAME /KEY: mat peptide 

(B) LOCATION: 3757.701 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1: 

AAACTGTATT TTGGGGTGAA GGTGTGAGTT AATAGATTCA CGGGACAACA AAGATGGGCT 60 

GTTGTTGAGA CCTTGGGCCA AGGGGCTGAT GAGGGTCAGG TTGCCAAGAG AGAGAGAATT 120 

AGGGAAGGTG AGTTTAGGGA GACATGGCTA GCTGGCAAGA AAAGTGGGTA GAAAACAGGG 180 

GTTGGGGAGG GGAGCACTGG AGAAGCTCAG AAATCACTTG GTCTCTGTTC TCCTGCCCCT 240 

ACTGAGGGGC AGGTGAGAAG AAACAGGGAG TAGGAGCTCC TCGAGGCTCT ATTACATCTC 300 



40 



WO 94/26892 



PCT/US94/05288 



TTTCTCCTCT CCCTCACCCC CAG CAT CCT TTT ATG GAG CTT CGA GTC CTA 350 

His Pro Phe Met Glu Leu Arg Val Leu 
-17 -15 -10 

GAG AAC ACA AAA CGG TCC CGG CGG AAC CTG GGC CTG GAC TGC GAT GAA 398 
Glu Aen Thr Lye Arg Ser Arg Arg Asn Leu Gly Leu Aap Cye Asp Glu 
-5 15 

CAT TCA AGT GAG TCC CGC TGT TGC CGC TAC CCC CTC ACT GTG GAC TTT 446 
His Ser Ser Glu Ser Arg Cys Cys Arg Tyr Pro Leu Thr Val Asp Phe 
10 15 20 

GAG GCT TTT GGC TGG GAC TGG ATC ATC GCT CCT AAA CGC TAC AAG GCC 494 
Glu Ala Phe Gly Trp Asp Trp lie lie Ala Pro Lys Arg Tyr Lys Ala 
25 30 35 40 

AAC TAC TGC TCC GGC CAG TGC GAG TAC ATG TTT ATG CAA AAG TAT CCG 542 
Asn Tyr Cys Ser Gly Gin Cys Glu Tyr Met Phe Met Gin Lys Tyr Pro 
45 50 55 

CAC ACC CAC TTG GTG CAA CAG GCT AAC CCA AGA GGC TCT GCG GGG CCC 590 
His Thr His Leu Val Gin Gin Ala Asn Pro Arg Gly Ser Ala Gly Pro 
60 65 70 

TGC TGC ACA CCC ACC AAG ATG TCC CCA ATC AAC ATG CTC TAC TTC AAT 636 
Cys Cys Thr Pro Thr Lys Met Ser Pro lie Asn Met Leu Tyr Phe Asn 
75 80 85 

GAC AAG CAG CAG ATT ATC TAC GGC AAG ATC CCT GGC ATG GTG GTG GAT 686 
Asp Lys Gin Gin lie He Tyr Gly Lys He Pro Gly Met Val Val Asp 
90 95 100 

CGC TGT GGC TGC TCC TAAGGTGGGG GACAGCGGAT GCCTCCCCAA CAGACCCTGC 741 
Arg Cys Gly Cys Ser 
105 110 

CCCTAGACTC CCCCAGCCCT GACCCCCTGC TCCCCGGCCC TAG AG CTC 789 



(2) INFORMATION FOR SEQ ID NO: 2: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 126 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY : linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2: 

His Pro Phe Met Glu Leu Arg Val Leu Glu Asn Thr 
-17 -15 -10 

Arg Asn Leu Gly Leu Asp Cys Asp Glu His Ser Ser 
1 5 10 

Cys Arg Tyr Pro Leu Thr Val Asp Phe Glu Ala Phe 
20 25 

He He Ala Pro Lys Arg Tyr Lys Ala Asn Tyr Cys 
35 40 

Glu Tyr Met Phe Met Gin Lys Tyr Pro His Thr His 
50 55 

Ala Asn Pro Arg Gly Ser Ala Gly Pro Cys Cys Thr 



41 



Lys Arg Ser Arg 
-5 

Glu Ser Arg Cys 
15 

Gly Trp Asp Trp 
30 

Ser Gly Gin Cys 
45 

Leu Val Gin Gin 
60 

Pro Thr Lye Met 



WO 94/26892 



PCT/US94/05288 



65 70 75 

Ser Pro He Asn Met Leu Tyr Phe Asn Asp Lye Gin Gin He He Tyr 
80 85 90 95 

Gly Lys He Pro Gly Met Val Val Asp Arg Cys Gly Cys Ser 
100 105 



(2) INFORMATION FOR SEQ ID NO: 3: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 213 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: double 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE : DNA (genomic) 

<vi) ORIGINAL SOURCE: 

(A) ORGANISM: Homo Sapiens 

(B) STRAIN: Human Activin WC 

(ix) FEATURE: 

(A) NAME /KEY: CDS 

(B) LOCATION: 28.. 183 

(ix) FEATURE: 

(A) NAME /KEY: misc_feature 
<fi) LOCATION: 184.. 185 

(D) OTHER INFORMATION: /note= "two-thirds of codon at end 
of partial clone** 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3: 

TCTAGATGCT CCGGCCAGTG CGAGTAC ATG TTC ATG CAA AAA TAT CCG CAT 51 

Met Phe Met Gin Lys Tyr Pro His 
1 5 

ACC CAT TTG GTG CAG CAG GCC AAT CCA AG A GGC TCT GCT GGG CCC TGT 99 
Thr His Leu Val Gin Gin Ala Asn Pro Arg Gly Ser Ala Gly Pro Cys 
10 15 20 

TGT ACC CCC ACC AAG ATG TCC CCA ATC AAC ATG CTC TAC TTC AAT GAC 147 
Cys Thr Pro Thr Lys Met Ser Pro He Asn Met Leu Tyr Phe Asn Asp 
25 30 35 40 

AAG CAG CAG ATT ATC TAC GGC AAG ATC OCT GGC ATG GTGGTGGATC 193 
Lys Gin Gin He He Tyr Gly Lys He Pro Gly Met 
45 50 

GCTGTGGCTG CTCCGGATCC 213 



(2) INFORMATION FOR SEQ ID NO: 4: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 52 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4: 



42 



WO 94/26892 



PCT/US94/05288 



Met 
1 



Phe Met Gin Lys Tyr Pro His Thr His Leu.Val Gin Gin Ala ABn 
5 10 15 



Pro 



Arg Gly Ser Ala Gly Pro Cys Cys Thr Pro Thr Lys Met Ser Pro 
20 25 30 



lie Asn Met Leu Tyr Phe Asn Asp Lys Gin Gin lie lie Tyr Gly Lys 
35 40 45 

lie Pro Gly Met 
50 

(2) INFORMATION FOR SEQ ID NO: 5: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 30 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY : linear 

(ii) MOLECULE TYPE: DNA (genomic) 

(vi) ORIGINAL SOURCE: 

(A) ORGANISM: primer C to Bovine Activin WC 
(ix) FEATURE: 

(A) NAME /KEY : misc_feature 

(B) LOCATION: 1..9 

(D) OTHER INFORMATION: /note= "Restriction site for Xbal" 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5: 
TAGTCTAGAT GCTCCGGCCA GTGCGAGTAC 30 
(2) INFORMATION FOR SEQ ID NO: 6: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 30 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 

(vi) ORIGINAL SOURCE: 

(A) ORGANISM: Primer D to Bovine Activin WC 

(ix) FEATURE: 

(A) NAME/KEY: misc_feature 

(B) LOCATION: 1..9 

(D) OTHER INFORMATION: /note= "Restriction site for BamHI" 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6: 
TGCGGATCCG GAGCAGCCAC AGCGATCCAC 30 
(2) INFORMATION FOR SEQ ID NO: 7: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 15 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 



43 



WO 94/26892 



PCT/US94/05288 



(vi) ORIGINAL SOURCE: 

(A) ORGANISM: DNA inserted into pMT2 CXM 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7: 



CATGGGCAGC TCGAG 



15 



(2) INFORMATION FOR SEQ ID NO: 8: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 34 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 

(vi) ORIGINAL SOURCE: 

(A) ORGANISM: DNA inserted into pMT21 

(ix) FEATURE: 

(A) NAME/KEY z misc feature 

(B) LOCATION: 1*.6~ 

(D) OTHER INFORMATION: /note= "Pst restriction site" 

(ix) FEATURE: 

(A) NAME /KEY: misc feature 

(B) LOCATION: 15.. 26 

(D) OTHER INFORMATION: /note= "Eco RI and Xhol restriction 



(2) INFORMATION FOR SEQ ID NO: 9: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 68 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 

(vi) ORIGINAL SOURCE: 

(A) ORGANISM: Portion of the EMC virus leader sequence 

(X) PUBLICATION INFORMATION: 
(A) AUTHORS: Jung, S K 

(C) JOURNAL: J. Virol. 

(D) VOLUME: 63 

(F) PAGES: 1651-1660 

(G) DATE: 1989 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9: 
CGAGGTTAAA AAACGTCTAG GCCCCCCGAA CCACGGGGAC GTGGTTTTCC TTTGAAAAAC 60 
ACGATTGC 68 
(2) INFORMATION FOR SEQ ID NO: 10: 
(i) SEQUENCE CHARACTERISTICS: 



sites" 



(xi) 



SEQUENCE DESCRIPTION: SEQ ID NO: 8: 



CTGCAGGCGA GCCTGAATTC CTCGAGCCAT CATG 



34 



44 



WO 94/26892 



PCT/US94/0S288 



(A) LENGTH: 1270 base pairs 

(8) TYPE: nucleic acid 

(C) STRANDEDNESS : single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 

(vi) ORIGINAL SOURCE: 

(A) ORGANISM: Human BMP- 11 

(vii) IMMEDIATE SOURCE: 

(B) CLONE: FB30.5 

(ix) FEATURE: 

(A) NAME /KEY: CDS 
<B) LOCATION: 1..1086 

(ix) FEATURE: 

(A) NAME/KEY: mat peptide 

(B) LOCATION: 7607.1086 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10: 

GAG CGC TCC AGC CGG CCA GCC CCG TCC GTG GCG CCC GAG CCG GAC GGC 48 
Glu Arg Ser Ser Arg Pro Ala Pro Ser Val Ala Pro Glu Pro Asp Gly 
-253 -250 -245 -240 

TGC CCC GTG TGC GTT TGG CGG CAG CAC AGC CGC GAG CTG CGC CTA GAG 96 
Cys Pro Val Cye Val Trp Arg Gin His Ser Arg Glu Leu Arg Leu Glu 
-235 -230 -225 

AGC ATC AAG TCG CAG ATC TTG AGC AAA CTG CGG CTC AAG GAG GCG CCC 144 
Ser lie Lye Ser Gin lie Leu Ser Lys Leu Arg Leu Lye Glu Ala Pro 
-220 -215 -210 

AAC ATC AGC CGC GAG GTG GTG AAG CAG CTG CTG CCC AAG GCG CCG CCG 192 
Asn He Ser Arg Glu Val Val Lys Gin Leu Leu Pro Lye Ala Pro Pro 
-205 -200 -195 -190 

CTG CAG CAG ATC CTG GAC CTA CAC GAC TTC CAG GGC GAC GCG CTG CAG 240 
Leu Gin Gin He Leu Asp Leu His Asp Phe Gin Gly Asp Ala Leu Gin 
-185 -180 -175 

CCC GAG GAC TTC CTG GAG GAG GAC GAG TAC CAC GCC ACC ACC GAG ACC 288 
Pro Glu Asp Phe Leu Glu Glu Asp Glu Tyr His Ala Thr Thr Glu Thr 
-170 -165 -160 

GTC ATT AGC ATG GCC CAG GAG ACG GAC CCA GCA GTA CAG ACA GAT GGC 336 
Val He Ser Met Ala Gin Glu Thr Asp Pro Ala Val Gin Thr Asp Gly 
-155 -150 -145 

AGC CCT CTC TGC TGC CAT TTT CAC TTC AGC CCC AAG GTG ATG TTC ACA 384 
Ser Pro Leu Cys Cys His Phe His Phe Ser Pro Lys Val Met Phe Thr 
-140 -135 -130 

AAG GTA CTG AAG GCC CAG CTG TGG GTG TAC CTA CGG CCT GTA CCC CGC 432 
Lys Val Leu Lye Ala Gin Leu Trp Val Tyr Leu Arg Pro Val Pro Arg 
-125 -120 -115 -110 

CCA GCC ACA GTC TAC CTG CAG ATC TTG CGA CTA AAA CCC CTA ACT GGG 480 
Pro Ala Thr Val Tyr Leu Gin He Leu Arg Leu Lys Pro Leu Thr Gly 
-105 -100 -95 

GAA GGG ACC GCA GGG GGA GGG GGC GGA GGC CGG CGT CAC ATC CGT ATC 528 
Glu Gly Thr Ala Gly Gly Gly Gly Gly Gly Arg Arg His He Arg He 



45 



WO 94/26892 



PCT/US94/0S288 



-90 -85 -80 

CGC TCA CTG AAG ATT GAG CTG CAC TCA CGC TCA GGC CAT TGG CAG AGC 576 
Arg Ser Leu Lye He Glu Leu His Ser Arg Ser Gly His Trp Gin Ser 
-75 -70 -65 

ATC GAC TTC AAG CAA GTG CTA CAC AGC TGG TTC CGC CAG CCA CAG AGC 624 
He Aep Phe Lys Gin Val Leu His Ser Trp Phe Arg Gin Pro Gin Ser 
-60 -55 -50 

AAC TGG GGC ATC GAG ATC AAC GCC TTT GAT CCC AGT GGC ACA GAC CTG 672 
Asn Trp Gly He Glu He Asn Ala Phe Asp Pro Ser Gly Thr Asp Leu 
-45 -40 -35 -30 

GCT GTC ACC TCC CTG GGG CCG GGA GCC GAG GGG CTG CAT CCA TTC ATG 720 
Ala Val Thr Ser Leu Gly Pro Gly Ala Glu Gly Leu His Pro Phe Met 
-25 -20 -15 

GAG CTT CGA GTC CTA GAG AAC ACA AAA CGT TCC CGG CGG AAC CTG GGT 768 
Glu Leu Arg Val Leu Glu Asn Thr Lys Arg Ser Arg Arg Asn Leu Gly 
-10 -5 1 

CTG GAC TGC GAC GAG CAC TCA AGC GAG TCC CGC TGC TGC 2GA TAT CCC 816 
Leu Asp Cys Asp Glu His Ser Ser Glu Ser Arg Cys Cys Arg Tyr Pro 
5 10 15 

CTC ACA GTG GAC TTT GAG GCT TTC GGC TGG GAC TGG ATC ATC GCA CCT 864 
Leu Thr Val Asp Phe Glu Ala Phe Gly Trp Asp Trp He He Ala Pro 
20 25 30 35 

AAG CGC TAC AAG GCC AAC TAC TGC TCC GGC CAG TGC GAG TAC ATG TTC 912 
Lys Arg Tyr Lys Ala Asn Tyr Cys Ser Gly Gin Cys Glu Tyr Met Phe 
40 45 50 

ATG CAA AAA TAT CCG CAT ACC CAT TTG GTG CAG CAG GCC AAT CCA AGA 960 
Met Gin Lys Tyr Pro His Thr His Leu Val Gin Gin Ala Asn Pro Arg 
55 60 65 



GGC TCT GCT GGG CCC TGT TGT ACC CCC ACC AAG ATG TCC CCA ATC AAC 1008 
Gly Ser Ala Gly Pro Cys Cys Thr Pro Thr Lys Met Ser Pro He Asn 
70 75 80 

ATG CTC TAC TTC AAT GAC AAG CAG CAG ATT ATC TAC GGC AAG ATC CCT 1056 
Met Leu Tyr Phe Asn Asp Lys Gin Gin lie lie Tyr Gly Lys He Pro 
85 90 95 

GGC ATG GTG GTG GAT CGC TGT GGC TGC TCT TAAGGTGGGG GATAGAGGAT 1106 
Gly Met Val Val Asp Arg Cys Gly Cys Ser 
100 105 

GCCTCCCCCA CAGACCCTAC CCCAAGACCC CTAGCCCTGC CCCCATCCCC CCAAGCCCTA 1166 

GAGCTCCCTC CACTCTTCCC GCGAACATCA CACCGTTCCC CGACCAAGCC GTGTGCAATA 1226 

CAACAGAGGG AGGCAGGTGG GAATTGAGGG TGAGGGGTTT GGGG 1270 

(2) INFORMATION FOR SEQ ID NO: 11: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 362 amino acids 

(B) TYPE j amino acid 
(D) TOPOLOGY: linear 



46 



WO 94/26892 



PCT/US94/0S288 



(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: II: 

Glu Arg Ser Ser Arg Pro Ala Pro Ser Val Ala Pro Glu Pro Asp Gly 
-253 -250 -245 -240 

Cye Pro Val Cys Val Trp Arg Gin His Ser Arg Glu Leu Arg Leu Glu 
-235 -230 -225 

Ser He Lys Ser Gin He Leu Ser Lye Leu Arg Leu Lys Glu Ala Pro 
-220 -215 -210 

Asn He Ser Arg Glu Val Val Lys Gin Leu Leu Pro Lys Ala Pro Pro 
-205 -200 -195 -190 

Leu Gin Gin He Leu Asp Leu His Asp Phe Gin Gly Asp Ala Leu Gin 
-185 -180 -175 

Pro Glu Asp Phe Leu Glu Glu Asp Glu Tyr His Ala Thr Thr Glu Thr 
-170 -165 -160 

Val He Ser Met Ala Gin Glu Thr Asp Pro Ala Val Gin Thr Asp Gly 
-155 -150 -145 

Ser Pro Leu Cys Cys His Phe His Phe Ser Pro Lys Val Met Phe Thr 
-140 -135 -130 

Lys Val Leu Lys Ala Gin Leu Trp Val Tyr Leu Arg Pro Val Pro Arg 
-125 -120 -115 -110 

Pro Ala Thr Val Tyr Leu Gin He Leu Arg Leu Lys Pro Leu Thr Gly 
-105 -100 -95 

Glu Gly Thr Ala Gly Gly Gly Gly Gly Gly Arg Arg His He Arg He 
-90 -85 -80 

Arg Ser Leu Lys He Glu Leu His Ser Arg Ser Gly His Trp Gin Ser 
-75 -70 -65 

He Asp Phe Lys Gin Val Leu His Ser Trp Phe Arg Gin Pro Gin Ser 
-60 -55 -50 

Asn Trp Gly He Glu He Asn Ala Phe Asp Pro Ser Gly Thr Asp Leu 
-45 -40. -35 -30 

Ala Val Thr Ser Leu Gly Pro Gly Ala Glu Gly Leu His Pro Phe Met 
-25 -20 -15 

Glu Leu Arg Val Leu Glu Asn Thr Lys Arg Ser Arg Arg Asn Leu Gly 
-10 -5 1 

Leu Asp Cys Asp Glu Hid Ser Ser Glu Ser Arg Cys Cys Arg Tyr Pro 
5 10 15 

Leu Thr Val Asp Phe Glu Ala Phe Gly Trp Asp Trp He He Ala Pro 
20 25 30 35 

Lys Arg Tyr Lys Ala Asn Tyr Cys Ser Gly Gin Cys Glu Tyr Met Phe 
40 45 50 

Met Gin Lys Tyr Pro His Thr His Leu Val Gin Gin Ala Asn Pro Arg 
55 60 65 

Gly Ser Ala Gly Pro Cys Cys Thr Pro Thr Lys Met Ser Pro He Asn 
70 75 80 



47 



WO 94/26892 PCT/US94/05288 

Met Leu Tyr Phe Aon Asp Lys Gin Gin He He Tyr Gly Lye He Pro 
85 90 95 

Gly Met Val Val Asp Arg Cye Gly Cye Ser 
100 105 



48 



WO 94/26892 



PCT/US94/05288 



What is claimed is: 

1. An isolated DNA sequence encoding a BMP- 11 protein. 

2. The DNA sequence of claim 1 wherein said DNA is selected from 
the group consisting of: 

(a) nucleotide #375 or 390 to #704 of SEQ ID N0:1; 

(b) nucleotides #760 or 775 to # 1086 of SEQ ID NO: 10; and 

(c) sequences which hybridize thereto under stringent 
hybridization conditions and encode a protein which 
exhibits BMP-11 activity. 

3. The DNA sequence of claim 1 wherein said DNA is selected from 
the group consisting of: 

(a) nucleotides encoding for amino acids 1 or 6 to 109 of 
SEQ ID NO: 2; 

(b) nucleotides encoding for amino acids 1 or 6 to 109 of 
SEQ ID NO: 11; and 

(c) sequences which hybridize thereto under stringent 
hybridization conditions and encode a protein which 
exhibits BMP- 11 activity. 

4. A host cell transformed with the DNA sequence of claim 1. 

5. An isolated DNA molecule having a sequence encoding an BMP- 11 
protein which exhibits BMP-11 activity, said DNA molecule 
comprising the DNA sequence selected from the group consisting 
of: 

(a) nucleotide # 375 to # 704 of SEQ ID NO:l; 

(b) nucleotide # 760 to # 1086 of SEQ ID NO: 10; and 

(c) naturally occurring allelic sequences and equivalent 
degenerative codon sequences of (a) or (b) . 

6. A host cell transformed with the DNA molecule of claim 5. 

7. A vector comprising a DNA molecule of claim 5 in operative 
association with an expression control sequence therefor. 

8. A host cell transformed with the vector of claim 7. 

9. An isolated DNA molecule encoding a BMP-11 protein, said DNA 
molecule comprising nucleotide # 375 to # 704 of SEQ ID NO:l or 
nucleotides # 760 to # 1086 of SEQ ID NO: 10. 

10. A vector comprising a DNA molecule of claim 9 in operative 
association with an expression control sequence therefor. 

11. A host cell transformed with the vector of claim 10. 



49 



WO 94/26892 



PCT/US94/05288 



12. A method for producing a purified BMP-11, protein said 
method comprising the steps of: 

(a) culturing a host cell transformed with a DNA molecule 
comprising the nucleotide sequence encoding a BMP-11 protein; and 

(b) recovering and purifying said BMP-11 protein from the 
culture medium. 

13. The method of claim 12, wherein said host cell is a 
transformed with a DNA molecule comprising a DNA coding sequence 
selected from the group consisting of: 

(a) nucleotide f 375 to # 704 of SEQ ID NO: 1; 

(b) nucleotide # 760 to # 1086 of SEQ ID NO: 10; and 

(c) naturally occurring allelic sequences and equivalent 
degenerative codon sequences of (a) and (b) . 

14. The method of claim 13, wherein said host cell is a 
mammalian cell and the DNA molecule further comprises a DNA 
sequence encoding a suitable propeptide 5' and linked in frame 
to the DNA coding sequence. 

15. A purified BMP-11 polypeptide comprising the amino acid 
sequence from amino acid # 1 to # 109 as set forth in SEQ ID NO: 
2. 

16. A purified BMP-11 polypeptide comprising the amino acid 
sequence from amino acid # 1 to #109 as set forth in SEQ ID NO: 
11. 

17. A purified BMP-11 polypeptide of claim 16 wherein said 
polypeptide is a dimer wherein each subunit comprises at least 
the amino acid sequence from amino acid # 1 to # 109 of SEQ ID 
NO: 11. 

18. A purified BMP-11 protein produced by the steps of 

(a) culturing a cell transformed with a DNA molecule 
comprising the nucleotide sequence from nucleotide # 375 to 

# 704 as shown in SEQ ID NO: 1; and 

(b) recovering and purifying from said culture medium a 
protein comprising the amino acid sequence from amino acid 

# 1 to amino acid # 109 of SEQ ID NO: 2. 

19. A purified BMP-11 protein produced by the steps of 

(a) culturing a cell transformed with a DNA molecule 
comprising the nucleotide sequence from nucleotide # 760 to 



50 



WO 94/26892 



PCT/US94/0S288 



# 1086 as shown in SEQ ID NO: 10; and 

(b) recovering and purifying from said culture medium a 
protein comprising the amino acid sequence from amino acid # 
1 to amino acid # 109 as shown in SEQ ID NO: 11. 

20. A purified BMP-11 polypeptide according to claim 16, wherein 
said polypeptide is a dimer wherein one subunit comprises at 
least the amino acid sequence from amino acid #1 to amino acid 
#109 of SEQ ID NO: 11, and one subunit comprises and amino acid 
sequence for a bone morphogenetic protein selected from the group 
consisting of BMP-1, BMP-2, BMP-3, BMP-4, BMP-5, BMP-6, BMP-7 , 
BMP-8, BMP-9 and BMP-10. 

21. A pharmaceutical composition comprising an effective amount 
of the BMP-11 polypeptide of claim 15 in admixture with a 
pharmaceutical ly acceptable vehicle. 

22. A pharmaceutical composition comprising an effective amount 
of the BMP-11 polypeptide of claim 16 in admixture with a 
pharmaceutically acceptable vehicle. 

23. A pharmaceutical composition comprising an effective amount 
of a BMP-11 protein in dimeric form with another inhibin-0 
protein, in admixture with a pharmaceutically acceptable vehicle. 

24. A pharmaceutical composition comprising an effective amount 
of a BMP-11 protein in dimeric form with an inhibin-a protein, 
in admixture with a pharmaceutically acceptable vehicle. 

25. A pharmaceutical composition comprising an effective amount 
of a BMP-11 protein in dimeric form with a BMP protein, in 
admixture with a pharmaceutically acceptable vehicle. 

26. A pharmaceutical composition comprising an effective amount 
of a BMP-11 protein in dimeric form, wherein said composition 
further comprises at least one bone morphogenetic protein. 

27. A chimeric DNA molecule comprising a DNA sequence encoding 
a propeptide from a member of the TGF-jS superf amily of proteins 
linked in frame to a DNA sequence encoding an BMP-11 polypeptide. 



51 



INTERNATIONAL SEARCH REPORT 



(. Atiocul Application No 

PCT/US 94/05288 



A. CLASSIFICATION OF SUBJECT MATTER 



C 12 N 15/12, C 12 P 21/02, C 07 K 13/00, C 12 N 5/10, 
A 61 K 37/02 

According to International latent QarnficaDon (IPC) or to both national classification and IPC 5 



0. FIELDS SEARCHED 



Minimum documentation searched (classification system followed by class ficaoon symbols) 

C 12 N.C 12 P.C 07 K.A 61 K 



Documentation searched other than minimum documcnution to the extent that such documents axe included in the fields searched 



Electronic data base consulted during the international search (name of data base and, where practical, search terms used) 



C DOCUMENTS CONSIDERED TO BE RELEVANT 



Category * Gub on of document, with indication, where appropriate, of the relevant passages 



Relevant to claim No. 



P,A 



WO, Al, 92/09 697 

(CELTRIX LABORATORIES) 
11 June 1992 (11.06.92) , 
claims . 

WO, Al, 93/09 229 

(GENETICS INSTITUTE) 

13 May 1993 (13.05.93) , 
claims . 

WO, Al, 88/00 205 

(GENETICS INSTITUTE) 

14 January 1988 (14.01.88), 
pages 61-73. 

US, A, 5 166 058 
(WANG et al. ) 

24 November 1992 (24.11.92), 
claims . 



1-27 



1-27 



1-16 



1-16 



Further documents axe listed in the continuation of box C 



□ 



Patent family members are listed tn annex. 



' Special categories of atcd documents : 

'A* document defining the general state of the an which is not 
considered to be of particular relevance 

*H" earlier document but published on or after the international 
filing date 

L* document which may throw doubts on priority ctaimfs) or 
which is a ted to establish the publication dale of another 
Q tac on or other special reason (as specified) 
'O* document referring to an oral disclosure, use, exhibition or 
other means 

P* document published pnor to the international filing date but 
later than the priority date claimed 



*T" later document published after the ihtemaoonaJ filing date 
or pnonty date and not in conflict with the application but 
atcd to understand the principle or theory underlying the 
invention 

*X* document of particular relevance; the claimed invention 
cannot be considered novel or cannot be considered to 
involve an inventive step when the document is taken alone 

*Y" document of particular relevance; the claimed invention 
cannot be considered to involve an inventive step when the 
document is combined with one or more other such docu- 
ments, such combination bang obvious to a person stalled 
m the an 

*<t" document member of the same patent family 



Date of the actual completion of the international search 

01 September 1994 



Date of mailing of the interna uonaJ search report 



1 3 -10- 1994 



Name and mailing address of the ISA 

European Patent Office, P.I). 58 U I'atentiaan 2 
NL - 2280 HV Rijswijk 
Tel. ( ♦ 31-70) 340-2040. Tx. 31 651 cpo nl. 
Fax 31-70) 340-3016 



Authorized officer 



WOLF e.h. 



form PCT.I5A-2I0 (second thect) <July 1993} 



INTERNATIONAL SEARCH REPORT 



-2- 



Intc orul Application No 

PCT/US 94/05288 



C(Continu*uon) DOCUMENTS CONSIDUREO TO »t£ RELEVANT 



Category * Guoon of document, with indication, where appropriate, of the relevant pasages 



Relevant to claim No. 



WO, Al, 92/05 199 

(GENETICS INSTITUTE) 

02 April 1992 (02.04.92) , 

claims. 

US , A, 5 187 076 

(WOZNEY et al. ) 

16 February 1993 (16.02.93) 

claims. 

WO, Al. 91/18 098 

(GENETICS INSTITUTE) 

28 November 1991 (28.11.91) 

claims . 

WO, Al, 93/00 432 

(GENETICS INSTITUTE) 

07 January 1993 (07.01.93), 

claims. 



1-16, 
21,22 



1-16 



1-16, 
21,22 



1-16, 
21,22 



Form PCT ISA/310 (coAUnusbon of second sheet) (July >"3) 



zum internationalen Recherchen- 
bericht uber die Internationale 
Pat entanmel dung Nr. 



to the International Search 
Report to the International 
Application No. 



Patent 



au rapport de recherche inter- 
national relatif 4 ia demande de brevet 
international n € 



PCT/US 94/05288 SAE 91095 



In diesem Anhana sind die Hitglieder 
der Patentfanilien der iat ob^nge- 
nanriten internationalen Recherchenbericht 
angefuhrten Patentdokuiuente angegeben. 
Diese Angaben dienen nur zur Ihter- 
richtung und erfoigen ohne Gewahr, 



This Annex lists the patent family 
members relating to the patent documents 
cited in the above-mentioned inter- 
national search report. The Office is 
in no way liable for these particulars 
which are Given merely for the purpose 
of information. 



La prteente annexe indique les 
(Restores de la famille de brevets 
relatifs aux documents de brevets citte 
dans le rapport de recherche inter- 
national viste ci-dessus. Les reseigne- 
flients fournis sent donnas d titre indica- 
*** ^ft n'engagent pas ia responsibility 
de 2 'Office. 



1m Recherchenbericht 
angefiihrtes Pa tentdokument 
Patent document cited 
in search report 
Document de brevet cit£ 
dans le rapport de recherche 



Datum der 
Veroffentlichuno 
Publication 
date 
Date de 
publication 



Mitglied(er) der 
Patent f ami lie 
Patent family 
member (s) 
tlerobre(s) de la 
f ami lie de brevets 



Datum der 
Veroffentli chung 
Publication 

date 
Date de 
publication 



WO Al 9209697 



-06-92 



AU Al 
AU B2 
CA AA 
EP Al 
EP A4 
JP T2 



91419/91 
651421 

2071912 
513334 
513334 

5505404 



WD Al 9309229 



13-05-93 



AU Al 30622/92 
EP Al 612348 
MX Al 9206315 



25-06-92 
21-07-94 
31-05-92 
19-11-92 
04-08-93 
12-08-93 

07-06-93 
31-08-94 
29-07-93 



WO Al 880020J 



14-01-88 



AU Al 
AU B2 
DK AO 
DK A 
EP Al 
EP A4 
ES AF 
<3R A 
IL AO 
JP T2 
NO A 
NO AO 



N2 
PT 
PT 
US 
US 

us 
us 
us 
us 
us 
us 



A 
A 
B 
A 
A 
A 
A 
A 
A 
A 
A 



ZA A 
AU Al 
AU B2 
EP Al 
EP A4 
JP T2 
WO Al 
AU Al 
AU B2 
CA AA 
EP Al 
JP T2 
WO Al 



77835/87 
613314 
1062/88 
1062/88 
313578 
313578 
2007625 
971028 
83003 
2500241 
880701 
880701 
220894 
85225 
e5225 
4877864 
5106748 
5141905 
5187076 
5013649 
5116738 
5166058 
5108922 
8704681 
34487/89 
645244* 
408649 
408649 
3503649 
8910409 
53577/90 
624940 
2030518 
429570 
3505098 
9011366 



29-01-88 
01-08-91 

29- 02-88 
28-C4-e8 

03- 05-89 
03-10-90 
01-07-89 
1 1-01-88 

20- 12-87 
01-02-90 
17-02-88 
17-02-88 
28-05-90 

01- 08-87 

30- 03-90 

31- 10-89 

21- 04-92 

25- 08-92 
16-02-93 
07-05-91 

26- 05-92 
24-11-92 

28- 04-92 

27- 04-88 

24- 11-89 
13-01-94 
23-01-91 
27-11-91 
15-08-91 

02- 11-89 

22- 10-90 

25- 06-92 

29- 09-90 
05-06-91 
07-11-91 

04- 10-90 



US A 5166058 



24-11-92 



AU Al 
AU B2 
DK AO 
DK A 
EP Al 
EP A4 
ES AF 
GR A 
IL AO 
JP 12 
NO A 
NO AO 



PT 



PT B 
WO Al 



77835/87 
613314 
1062/88 
1062/88 
313578 
313578 
2007625 
871028 
83003 
2500241 
880701 
880701 
220894 
"5225 



8800205 



29-01-88 
01-08-91 

29- 02-88 
28-04-88 
03-05-89 
03-10-90 
01-07-89 
11-01-88 
20-12-87 
01-02-90 
17-02-88 

17-02-SG 
28-05-90 
01-08-87 

30- 03-90 
14-01-88 



ZA A 8704681 27-04-88 

US A 5013649 07-05-91 

US A 5106748 21-04-92 

US A 5108922 28-04-92 

US A 511673B 26-05-92 

US A 5141905 25-08-92 

US A 5187076 16-02-93 

US A 4877864 31-10-89 

AU Al 34487/89 24-1 l-8 r ' 

AU B2 645244 13-01-94 

EP Al 408649 23-01-91 

EP A4 408649 27-11-91 

JP T2 3503649 15-08-91 

WO Al 89 10409 02-11-89 

AU Al 53577/90 22-10-90 

AU B2 624940 25-06-92 

CA AA 2030518 29-09-90 

EP Al 429570 05-06-93 

JP T2 3505098 07-11-91 

WO Al 9011366 04-10-90 



WO Al 9205199 02-04-92 EP Al 550625 14-07-93 

US A 5187076 16-02-93 AU Al 77835/87 2^~1-Gb' 

AU E2 613314 qi_o8-91 

DK AO 1062/88 29-02-88 

DK A 1062/88 28-04-88 

EP Al 313578 03-05-89 

EP A4 313578 03-10-90 

ES AF 2007625 01-07-89 

GR A 871028 11-01-88 

IL AO 83003 20-12-87 

JP T2 2500241 01-02-90 

NO A 880701 17-02-8B 

NO AO 880701 17-02-BS 

N2 A 220894 28-05-90 

PT A 85225 o 1-08-87 

PT B 85225 30-03-90 

WO Al 8800205 14-01-88 

2A A 8704681 27-04-88 

US A 5013649 07-05-91 

US A 5106748 21-04-92 

US A 5108922 28-04-92 

US A 5116738 26-05-92 

US A 5141905 25-08-92 

US A 5166058 24-11-92 

US A 4B77B64 31-10-89 

AU Al 34487/89 24-1 1-8* 

AU B2 645244 13-01-94 

EP Al 40B649 23-01-91 

EP A4 408649 27-11-91 

JP T2 3503649 15-08-91 

WO Al 8910409 02-1 1-8* 

AU Al 53577/90 22-10-90 

AU B2 624940 25-06-92 

CA AA 2030516 29-09-90 

EP Al 429570 05-06-91 

JP T2 3505098 07-11-91 

_ WO Al 9011366 O4-10-90 

WO Al 911B098 28-11-91 CA AA 2082941 

EP Al 536186 



17-11-91 

14-04-93 

JP T2 6500991 27-01-94 



WO Al 9300432 07-01-93 AU Al 22699/92 25-01-9"^ 

AU B2 652472 25-08-94 



CA AA 2108770 26-12-92 
EP Al 592562 20-04-94 



This Page is Inserted by IFW Indexing and Scanning 
Operations and is not part of the Official Record 

BEST AVAILABLE IMAGES 

Defective images within this document are accurate representations of the original 
documents submitted by the applicant. 

Defects in the images include but are not limited to the items checked: 

□ BLACK BORDERS 

□ IMAGE CUT OFF AT TOP, BOTTOM OR SIDES 
□fFADED TEXT OR DRAWING 
[^BLURRED OR ILLEGIBLE TEXT OR DRAWING 

□ SKEWED/SLANTED IMAGES 

□ COLOR OR BLACK AND WHITE PHOTOGRAPHS 

□ GRAY SCALE DOCUMENTS 

□ LINES OR MARKS ON ORIGINAL DOCUMENT 

□ REFERENCE(S) OR EXHIBIT(S) SUBMITTED ARE POOR QUALITY 

□ OTHER: 

IMAGES ARE BEST AVAILABLE COPY. 
As rescanning these documents will not correct the image 
problems checked, please do not report these problems to 
the IFW Image Problem Mailbox.