Skip to main content

Full text of "USPTO Patents Application 09804625"

See other formats


per 



WORLD INTELLECTUAL PROPERTY ORGANIZATION 
International Bureau 




INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PGT) 



(51) Internationa] Patent Gassification ^ : 
C12N 15/12, 1/00, 15/63 
C07K 13/00, 17/02, C12Q 1/68 
C12Q 1/00 



Al 



(II) International Publication Number: WO 93/19177 

(43) International Publication Date: 30 September 1993 (30.09.93) 



(21) Internationa! Application Number: PCT/US93/02387 

(22) Internationa! Filing Date: 15 March 1993 (15.03.93) 



(30) Priority data: 

853.396 
08/029,673 



18 March 1992 (18.03.92) US 
11 March 1993(11.03.93) US 



(71) Applicant: THE GENERAL HOSPITAL CORPORA- 

TION [US/US]; 55 Fruit Street, Boston, MA 021 14 (US). 

(72) Inventors: DONAHOE, Patricia. K. ; 48 Ash Street, Wes- 

ton, MA 02193 (US). GUSTAFSON. Michael ; 109 
Chestnut Street, Apt. 2, Boston. MA 02108 (US). HE, 
Wei, Wu ; 20729-0 Crystal Hill Circle. Germantown, 
MD 20874 (US). 



(74) Agent: CLARK, Paul. T.; Fish and Richardson, 225 Fran- 
klin Street, Boston, MA 02110-2804 (US). 

(81) Designated States: AU. CA, JP, European patent (AT, BE, 
CH, DE. DK, ES, FR, GB. GR, IE, IT, LU, MC, NL, 
FT, SE). 



Published 

With international search report. 



(54) Title: FOUR NOVEL RECEPTORS OF THE TGF-P RECEPTOR FAMaY 



(57) Abstract 

Isolated DNAs (e.g., cDNAs or genomic fragments) encoding MIS receptors, inhibin receptors, bone morphogenic protein 
receptors, or other novel members of the TGF-P family of receptors, or soluble, Kgand-binding fragments thereof; vectors or cells 
which contain such DNAs; and substantially pure polypeptides encoded by such DNAs, whether produced by expression of the 
isolated DNAs, by isolation from natural sources, or by chemical synthesis. 



FOR THE PURPOSES OF INFORMATION ONLY 

Codes used to identify States party to the PCTon the front pages of pamphlets publishing international 
applications under the PCX. 



AT 


Atairia 


FR 


France 


MR 


Mauritania 


AU 


Australta 


CA 


Gabon 


MW 


Malawi 


BB 


Bartiados 


GB 


United Kingdom 


NL 


Netherlands 


BE 


Belgium 


GN 


Guinea 


NO 


Norway 


BF 


Burkina Foso 


CR 


Greece 


NZ 


New Zcalatui 


BC 


Bulgaria 


HU 


Hungary 


PL 


Poland 


BJ 


Bunin 


IE 


Ireland 


PT 


Portugal 


BR 


Bra/H 


IT 


Italy 


RO 


Romania 


CA 


Canada 


JP 


Japan 


RU 


Russian Federation 


CF 


(junirul ATricaii Republic 


KP 


Democratic Peopled Republic 


SO 


Sudan 


CC 






of Korea 


SE 


Sweden 


CH 


Swiucrtanii 


KR 


Republic or Korea 


SK 


Slovak Republic 


a 


('die d*tvoirc 


KZ 


Ka/iikhstan 


SN 


Senegal 


CM 


ranieroon 


LI 


Liechtcnsiein 


su 


Soviet Union 


CS 


Ojrchusluvakia 


LK 


Sn lanka 


TO 


Chad 


C2 


C^jxh RcpuhiiL- 


I.U 


tojxembourg 


TC 


Togo 


OE 


Ucrmany 


MC 


Muiiaco 


UA 


Ukroine 


OK 


Denmark 


MC 


MadagaMXir 


us 


United Stales of America 


ES 


Spain 


Ml. 


Mali 


VN 


Viet Nam 


PI 


Finland 


MN 


Mongolia 







wo 93/19177 



PCr/US93/02387 



- 1 - 

FOUR NOVEL RECEPTORS OF THE TGF-0 RECEPTOR FAMILY 
Background of the Invention 
The field of the invention is mammalian receptor 
5 proteins, and nucleic acids encoding same. 

Miillerian Inhibiting Substance (MIS) plays a 
critical role in normal sexual dimorphism as one of the 
early manifestations of the SRY genetic switch (Gubbay et 
al., Nature 346:245-250, 1990; Sinclear et al,. Nature 

10 346:240-244, 1990; Berta et al.. Nature 348:448-350, 
1990; Haqq et al., Proc. Natl. Acad. Sci. USA 90:1097- 
1101, 1993) . MIS subsequently causes regression of the 
Miillerian duct, inhibition of aromatase activity which 
leads to increased synthesis of testosterone, and 

15 probably morphological differentiation of the sex cords 
as seminiferous tubules, thus assuring the male 
phenotype. Jost's seminal observations in the late 1940s 
first defined a "Mullerian Inhibitor" responsible for 
regression of the Mullerian ducts in the male mammalian 

20 embryo (Jost, Arch. Anat. Micro. Morphol. Exp. 36:271- 
315, 1947). MIS was found to be a 140 kDa protein 
produced by the Sertoli cell (Blanchard and Josso, 
Pediatr. Res. 8:968-971, 1974); it was subsequently 
purified to homogeneity (Budzik et al.. Cell 21:909-915, 

25 1980, Cell 34:307-314, 1983; Picard et al., Mol. Cell. 

Endocrinol. 34:23, 1984), using the bioassay of Miillerian 
duct regression devised by Picon (Arch. Anat. Microsc. 
Morphol. Exp. 58:1-19, 1969) as a monitor. The bovine 
and human genes were cloned (Cate et al., Cell 45:^85- 

30 698, 1986a) and subsequently expressed and produced in 
mammalian cell cultures (Cate et al.. Cold Spring Harbor 
Symposium 51:641-647, 1986b; Epstein et al.. In Vitro 
Cellular and Developmental Biol. 25:213-216, 1989); more 
recently, the rat (Haqq et al.. Genomics 12:665-9, 1992) 

35 and mouse (Munsterberg and Lovell-Badge, Development 



wo 93/19177 PCr/US93/02387 



" 2 - 

13:613-624, 1991) genes have also been cloned. 
Overexpression of MIS in transgenic female mice caused 
regression of Mxillerian ducts and seminiferous tubular 
differentiation (Behringer et al.. Nature 345:167-70, 
5 1991) • Several patients with Retained MUllerian Duct 
Syndrome were found to have point mutations in the MIS 
gene (Knebelman et al«, Proc. Natl. Acad. Sci. 88:3767- 
3771, 1991) , which has been localized to the short arm of 
chromosome 19 (Cohen-Hagenaur et al., Cytogenet. Cell. 
10 Genet. 44:2-6, 1987). In mice, the MIS gene is located 
on chromosome 10 (King et al.. Genomics 11:273-283, 
1991) . 

MIS is a member of the large TGF-J3 family, which 
includes, besides TGF-jS (Derynck et al.. Nature 316:701- 

15 5, 1985), activin (Ling et al.. Nature 321:779-82, 1986; 
Vale et al.. Nature 321:776-779, 1986); inhibin (Mason et 
al., Nature 318:659-63, 1985); decapentaplegia complex 
(Padgett et al.. Nature 325:81-4, 1987); Vg-1 (Weeks and 
Melton, Cell 51:861-7, 1987); and bone morphogenesis 

20 factors (Wozney et al.. Science 242:1528-34, 1988). A 
common feature of some members of this gene family is 
that latent precursor can be activated by plasmin 
cleavage and release of 25 kDa carboxyl terminal dimers. 
Al though originally defined and named by its 

25 ability to cause regression of the Mxillerian duct, other 
functions have emerged for MIS. Its localization to the 
preantral and smaller antral follicles by 
immtinocytochemical techniques (Takahashi et al. , Biol. 
Reprod. 35:447-53, 1986a; Bezard et al., J. Reprod. 

30 Fertil. 80-509-16, 1987; Ueno et al., Endocrinol. 
125:1060-1066, 1989a; Ueno ^t al. , Endocrinology 
124:1000-1006, 1989b) and its ability to inhibit germinal 
vesicle breakdown (Takahashi et al., Mol-Cell-Endocrinol. 
47:225-34, 1986b; Ueno et al.. Endocrinology 123:1^52- 

35 1659, 1988) led to the hypothesis that it was involved in 



wo 93/19177 



PCT/US93/02387 



meiotic inhibition in the ovary. Developmental and 
experimental correlations support such a function in the 
testis (Taketo, et al,, Devel. Biol. 146:386-395, 1991), 
where analysis of timing of expression suggests that MIS 
5 may be responsible for inhibition of germ cell division. 
Hutson and Donahoe (Endocrine Reviews 7:270-283, 1986) 
speculated that MIS may also play role in the 
transabdominal portion of testicular descent, and Vigier 
et al. (Development 100:43-55, 1987; Proc. Natl. Acad. 

10 Sci. USA 86:3684-8, 1989) have provided evidence that it 
functions as an inhibitor of aromatase in developing 
ovaries. Catlin et al. (Am. J. of Obstet. and Gynecol. 
159:1299-1303, 1988; Am. Rev. Resp. Dis. 141:466-470, 
1990) showed that MIS decreases surfactant accumulation 

15 in fetal lungs, thus contributing to the male 

preponderance in newborn infants of Respiratory Distress 
Syndrome. The development of a specific serum MIS ELISA 
(Hudson et al., J. Clin, and Metab. 70:16-22, 1990; Josso 
et al., J. Clin. Endocrinol. Metab. 70:23-7, 1990) has 

20 led to its experimental use as a diagnostic tool for the 
elucidation of the pathophysiology of ambiguous genitalia 
in the newborn, and for the use of serum MIS as a marker 
of granulosa and sex cord tumors in the adult female. 
Furthermore, the extraordinarily high MIS level observed 

25 by Gustafson et al. (New Eng. J. Med. 326:466-71, 1992) 
in a patient with a sex cord tumor (3200 ng/ml, compared 
to a normal level of 2-3 ng/ml) provides evidence that 
MIS is not toxic at these levels. 

The role of MIS as a fetal inhibitor has led to 

30 the hypothesis that it might act as a tumor inhibitor, 

particularly of tumors emanating from the Miillerian ducts 
(Donahoe et al.. Science 205:913-915, 1979; Donahoe et 
al. , Ann. Surg. 194:472-480, 1981; Fuller et al., J. 
Clin. Endocrin. Metab. 54:1051-1055, 1982; Fuller et al., 

35 Gynecol. Oncol. 17:124-132, 1984; Fuller et al., Gynecol. 



wo 93/19177 



PCr/US93/02387 



- 4 - 

Oncol. 22:135-148, 1985). Experimental evidence has 
accumulated supporting the ability of recombinant human 
MIS to exert an antiproliferative effect against genital 
tract tumors in colony inhibition assays, subrenal 
5 capsule assays (Chin, et al.. Cancer Research, 51:2101-6, 
1991) , and now metastases assays, and more recent 
evidence has shown an antiproliferative effect against a 
series of human ocular melanomas (Parry et al, , Cancer 
Research 51:1182-6, 1992). MIS has been shown to block 

10 tyrosine autophosphorylation of EGF receptors (Coughlin 
et al., Mol. and Cell. Endocrin. 49:75-86, 1987; Cigarroa 
et al.. Growth Factors 1:179-191, 1989). 

Inhibin, another member of the TGF-beta family 
described above, is primarily secreted by Sertoli and 

15 granulosa cells of the male and female gonad. This 

nonsteroidal regulatory hormone, first described in 1932 
(McCullagh, Science 76:19-20), acts specifically to 
inhibit FSH release from the pituitary (Vale et al.. 
Recent Prog. Horm. Res. 44:1-34, 1988). Biologically 

20 active inhibin, however, was not purified and 

characterized well until the successful cloning of its 
genes in 1985-86 (Mason et al.. Nature 318:659, 1985; 
Forage et al. , Proc. Natl. Acad. Sci. USA 83:3091, 1986; 
Mayo et al., Proc. Natl. Acad. Sci. USA 83:5849, 1986; 

25 Esch et al., Mol. Endocrinol. 1:388, 1987). Inhibin was 
shown at that time to be a glycoprotein heterodimer 
composed of an alpha-chain and one of two distinct beta- 
chains (beta-A, beta-B) (Mason et al., Biochem. Biophys. 
Res. Comun. 135:957, 1986). The alpha chain is processed 

30 from an initial species of 57 kDa to form an 18 kDa 

carboxyl-terminal peptide, while the mature beta chain of 
14 kDa is cleaved from the carboxyl-terminus of a 62 kDa 
precursor, which would then account for the biologically 
active 32 kDa species which predominates in serum 

35 (DeKretser and Robertson, Biol. Reprod. 40:3347, 1989). 



wo 93/19177 



PCr/US93/02387 



- 5 - 

Many oth'^r forms of bioactive inhibin with MS's of 32-120 
kDa, however, have been isolated as well (Miyamoto et 
al., Biochem, Biophys. Res. Commun. 136:1:03-9, 1986). 
In addition, beta-chain dimers (beta-A/beta-A or beta- 
5 A/beta-B) which selectively stimulate FSH secretion from 
the pituitary have been identified and are called activin 
A and activin AB, respectively (Vale et al.. Nature 
321:776, 1986; Ling et al.. Nature 321:779, 1986). 

As is the case with MIS, many additional functions 

10 have been postulated for inhibin and its subunits besides 
FSH regulation. Inhibin alpha, beta-A, and beta-B 
subunit RNAs have been shown to be expressed in a variety 
of rat tissues, including the testis, ovary, placenta, 
pituitary, adrenal gland, bone marrow, kidney, spinal 

15 cord, and brain (Meunier et al., Proc. Natl. Acad, Sci. 
USA 85:247-51, 1988). The pattern of testicular inhibin 
secretion appears to be developmentally regulated. In 
the rat, inhibin increases during maturation until 30-40 
days after birth, after which values rapidly return to 

20 juvenile levels (Au et al., Biol. Reprod. 35:37, 1986). 
Inhibin subunits also seem to have a paracrine effect on 
Leydig and theca interna cell androgen synthesis (Hsueh 
et al., Proc. Natl. acad. Sci. USA 84:5082-6, 1987). 
Many studies have demonstrated the changes in inhibin 

25 which occur throughout the estrus cycle, and therefore, 
its role in modulating FSH in adult females (Hasegawa et 
al., J. Endocrinology 121:91-100, 1989; McLachlan et al., 
J. Clin. Endo. Metab. 65:954-61, 1987). Furthermore, 
changes in local inhibin concentrations may be involved 

30 in the regulation of ovarian folliculogenesis (Woodruff 
et al., science 239:1296-9, 1988; Woodruff et al., 
Endocrinology 127:3196-205, 1990). Bioactive inhibin has 
been shown to be produced by human placental cells in 
culture and to be involved in a short-loop feedback 

35 between gonadotropin-releasing hormone and human 



wo 93/19177 



FCT/US93/02387 



- 6 - 

chorionic gonadotropin (Petraglia ct al. , Science 
237:187-9, 1987). Finally, a nxmber of patients with 
ovarian granulosa cell tumors have been described who had 
markedly elevated serum inhibin levels secondary to tumor 
5 production of this hormone (Lappohn et al., NEJM 321:790- 
3, 1989). 

Most of the data that exists concerning serum 
inhibin levels in humans has been obtained using a 
heterologous radioimmunoassay comprised of a polyclonal 

10 antibody to purified, intact bovine inhibin and 

radiolabeled 32 kDa bovine inhibin (McLachlan et al., 
Mol. Cell. Endocrinol. 46:175-85, 1986). Such studies 
have evaluated normal cycling females and adult males 
(McLachlan et al., J. Clin. Endo. Metab. 65:954-61, 1987; 

15 McLachlan et al. , J. Clin. Invest. 82:880-4, 1988), 
pubertal males (Burger et al., J. Clin. Endo. Metab. 
67:689-694, 1988), normal pregnant women (Abe et al., J. 
Clin. Endocrinol. Metab. 71:133-7, 1990), and a variety 
of reproductive disorders (Scheckter et al., J. Clin. 

20 Endocrinol. Metab. 67:1221-4, 1988; DeKretser et al., J. 
Endocrinol. 120:517-23, 1989). However, recent work has 
shown that this assay detects inhibin alpha-subxinits as 
well as intact dimeric hormone, and, therefore, these 
results should be interpreted with caution (Schneyer et 

25 al., J. Clin. Endocrinol. Metab. 70:1208-12, 1990). 

Svimmarv of the Invention 
The invention features novel isolated DNAs of the 
TGF-^ receptor family, which isolated DNAs encode ,^ for 
example, MIS receptors, inhibin receptors, and bone 
30 morphogenesis protein (BMP) receptors; these receptors 
are, e.g., those of a mammal such as a rat, mouse, 
rabbit, guinea pig, hamster, cow, pig, horse, goat, 
sheep, or human. The invention also includes vectors 
(e.g., plasmids, phage, or viral nucleic acid) or cells 



wo 93/19177 



PCr/US93/02387 



- 7 - 

(prokaryotic or eukaryotic) which contain such DNAs, and 
the polypeptides produced by expression of such DNAs (for 
example, by a cell transformed with and capable of 
expressing a polypeptide from the DNA) . By "isolated 
5 DNA" is meant a DNA that is not immediately contiguous 
with both of the coding sequences with which it is 
immediately contiguous (i.e., one at the 5' and one at 
the 3' end) in the naturally-occurring genome of the 
organism from which the DNA of the invention is derived. 

10 The term thus encompasses, for example, a cDNA or a 
genomic DNA fragment produced by PGR or restriction 
endonuclease treatment, whether such cDNA or genomic DNA 
fragment is incorporated into a vector, integrated into 
the genome of the same or a different species than the 

15 organism from which it was originally derived, linked to 
an additional coding sequence to form a hybrid gene 
encoding a chimeric polypeptide, or independent of any 
other DNA sequences. The DNA may be double-stranded or 
single-stranded, sense or antisense. Examples of 

20 isolated DNAs of the invention include those which encode 
amino acid sequences substantially the same as those 
shown in Fig. 1 (SEQ ID NO: 14), Fig. 2 (SEQ ID NO: 15), 
Fig. 3 (SEQ ID NO: 16), and Fig. 4 (SEQ ID NO: 16); and 
those having sequences which hybridize under conditions 

25 of high or moderate stringency to the coding sequence of 
one of the plasmids included in the ATCC deposit 
designated No. 75213: misrl, misr2A, misr2B, misr3, or 
misr4. High stringency conditions are herein defined as 
the following: hybridizing with 50% deionized formamide, 

30 800 mM NaCl; 20 mM Pipes, pH 6.5, 0.5% SDS, 100 ftg/ml 
denatured, sonicated salmon sperm DNA at 42*»C for 12-20 
hours, washing with 30 mM NaCl/3.p mM sodium citrate (0.2 
X SSC)/0.1% SDS at 55*=^C, while moderate stringency 
conditions are as follows: hybridizing with 50% 

35 deionized formamide, 800 mM NaCl; 20 mM Pipes, pH 6.5, 



wo 93/19177 



PCr/US93/02387 



- 8 - 

0.5% SDS, 100 /ig/ml denatured, sonicated salmon sperm DNA 
at 42*»C for 12-20 hours, washing with 75 mM NaCl/7.5 mM 
sodium citrate (0.5 X SSC)/0.1% SDS at 55°C. 

The isolated DNA of the invention may be under the 
5 transcriptional control of a heterologous promoter (i.e., 
a promoter other than one naturally associated with the 
given receptor gene of the invention), which promoter, 
for example, may direct the expression of the DNA of the 
invention in a particular tissue or at a particular stage 

10 of development. 

Also within the invention is a substantially pure 
preparation of an MIS receptor or inhibin receptor 
protein, or another of the receptor proteins of the 
invention, prepared, for example, from a natural source, 

15 from an expression system expressing the isolated DNA of 
the invention, or by synthetic means. This protein may, 
for example, have a sequence the same as, or 
substantially identical to, that shown in Fig. 1 (SEQ ID 
NO: 14), Fig. 2 (SEQ ID NO: 15) , Fig. 3 (SEQ ID NO: 16), 

20 or Fig. 4 (SEQ ID NO: 17) , or that encoded by any one of 
the plasmids deposited as ATCC Accession No. 75213. By 
"substantially pure preparation" is meant that the 
preparation is at least 70% free of those proteins with 
which the protein of the invention is naturally 

25 associated in the tissue (s) in which it naturally occurs. 
In preferred embodiments, the preparation is at least 90% 
free of such contaminating proteins. 

Also within the invention is a substantially pure 
nucleic acid at least 20 nucleotides in length 

30 (preferably at least 50 nucleotides, more preferably at 
least 100 nucleotides, and most preferably 1000 
nucleotides or more in length) which hybridizes under 
highly stringent conditions to the coding region of a 
plasmid included in the ATCC deposit designated No. 

35 75213. By "substantially pure nucleic acid" is meant an 



wo 93/19177 



PCr/US93/02387 



- 9 - 

RNA or DNA molecule which is substantially free of those 
other nucleic acid molecules, if any, with which it is 
naturally associated in the cell from which it was 
originally derived (i.e., such other nucleic acid 
5 molecules make up less than 50% of the total number of 
nucleic acid molecules in the preparation) . By "other 
nucleic acid molecules" is meant nucleic acid molecules 
which do not encode the same polypeptide as the nucleic 
acid of the invention. In preferred embodiments, less 

10 than 20%, and more preferably less than 10% of the 
preparation consists of such other nucleic acid 
molecules. Such a nucleic acid may be employed in a 
Northern analysis or in situ hybridization assay for 
determining the level of expression of the gene in a 

15 biological sample, which assay would include the steps of 
(1) providing the isolated DNA of the invention, which 
isolated DNA includes single stranded antisense DNA; (2) 
contacting, under hybridizing conditions (preferably of 
high stringency) , the isolated DNA with a biological 

20 sample suspected of containing mRNA encoding a receptor 
of the invention; and (3) determining the level and/or 
pattern of hybridization of the isolated DNA in the 
biological sample, the level or pattern of hybridization 
in the sample being indicative of the level or pattern of 

25 expression of the gene eiKroding the receptor. 

As described below, the receptor proteins of the 
invention (or a ligand-binding portion of such receptors) 
can be used for a number of purposes. They can be fixed 
by standard means to a matrix material to form an 

30 affinity matrix capable of binding ligand, useful for 
purifying ligand, for screening for inhibitors of the 
ligand/ receptor interaction, or for determining the 
amount of ligand present in a given biological sample. 
They can be used in an assay including the steps of (1) 

35 providing the polypeptide of the invention; (2) 



wo 93/19177 



PCr/US93/02387 



- 10 - 

contacting the polypeptide with a biological sample 
suspected of containing MIS, inhibin, or a biologically 
active fragment thereof; and (3) determining the amount 
of receptor/ ligand complex formation in the sample, such 
5 amo\int of complex formation being indicative of the 
amount of MIS or inhibin activity in the sample. They 
can also be used to generate monoclonal or polyclonal 
antibodies specific for (i.e., capable of forming an 
immune complex with) such receptors, which antibodies 

10 would be useful in a method for detecting the presence of 
an MIS or inhibin receptor in a biological sample such as 
serum or txamor cells. Such a method would include the 
steps of (1) contacting the antibody with a biological 
sample suspected of containing an MIS or inhibin 

15 receptor, and (2) detecting immune complex formation 
between the antibody and a component of the biological 
sample, wherein such immxine complex formation is 
indicative of the presence of such a receptor in the 
sample. Furthermore, such antibodies can be linked to a 

20 cytotoxic agent, thereby forming an iromunotoxin useful 
for targeting and killing or disabling cells bearing the 
receptor of the invention. 

Other features and advantages of the invention 
will be apparent from the following detailed description, 

25 and from the claims. 

Detailed Description 
The drawings are first described. 
Drawings 

Fig. 1 is a representation of the DNA coding 
30 sequence of misrl (SEQ ID NO: 1) , and the corresponding 
amino acid sequence of the encoded receptor protein (SEQ 
ID NO: 14) . 

Fig. 2 is a representation of the DNA coding 
sequence (SEQ ID NO: 2) of two overlapping cloned cDNAs, 



wo 93/19177 



PCr/US93/02387 



- 11 - 

inisr2A and inisr2B, and the corresponding amino acid 
sequence of the encoded receptor protein (SEQ ID NO: 15) . 

Fig. 3 is a representation of the DNA coding 
sequence of iaisr3 (SEQ ID NO: 3), and the corresponding 
5 amino acid sequence of the encoded receptor protein (SEQ 
ID NO: 16) . 

Fig. 4 is a representation of the DNA coding 
sequence of misr4 (SEQ ID NO: 4), and the corresponding 
amino acid sequence of the encoded receptor protein (SEQ 

10 ID NO: 17) . 

Figs. 5A-E show partial 20 nucleotide sec[uences of 
each of misrl (SEQ ID NO: 5), misr2A (SEQ ID NO: 6), 
misr2B (SEQ ID NO: 7) , misr3 (SEQ ID NO: 8) , and misr4 
(SEQ ID NO: 9) , respectively. 

15 Figs. 6A-F are photographs showing in situ 

hybridization of the urogenital ridge (UGR) , ovary, and 
testis with a riboprobe (Rl) derived from misrl (SEQ ID 
N0:1) and a second riboprobe (R2) derived from misr2 (SEQ 
ID NO: 2). Left-hand panels (A,C,E) are representative 

20 brightfield views in which hybridization signals appear 
as black granules (Bar=100/im) ; right-hand panels (B,D,F) 
are identical darkfield views in which RNA message 
appears as bright spots (heavy arrows) . A+B) Rl 
hybridization signal in the 15-day (E15) fetal male UGR 

25 is conspicuous over the mesenchyme of the Mull^rian duct 
(M) , but not over the adjacent Wolffian duct (W) • 
C+D) Rl signal is also intense over the oocytes (Oo) of 
preantral and antral follicles (AF) of the postnatal 
day 20 (P20) ovary, with less intense signal over their 

30 adjacent granulosa cells. Two separate Rl riboprobes 
were used to confirm these finding in Fig. 4A-D: one 
from the 5' extracellular domain and one from the 3' 
intracellular region of the coding sequence. 
E+F) R2 signal localizes in a heterogeneous pattern to 

35 seminiferous tubules (ST) of the postnatal day 30 (P30) 



wo 93/19177 



PCr/US93/02387 



" 12 - 

testis. No R2 message was detected in the fetal 
Mullerian duct or the pubertal and adult ovary. Both HI 
and R2 signals were found in the female postnatal 
anterior pituitary and hippocampus (data not shown) . 
5 Fig. 7 shows the results of Noxrthern analysis of 

fetal and postnatal rat tissues for MISR1-MISR4 mRNA 
expression. The left blot was hybridized sequentially 
with misrl, misr3 and pyruvate kinase (pk) probes, while 
the right blot was probed serially with misr2a/misr2b, 
10 misr4 and pk. Approximately 4.0 kb MISRl, 4.4 and 1.5 kb 
MISR2, 4.4 kb MISR3, and 6 kb MISR4 transcripts were all 
detected in the 15-day (E15) fetal urogenital ridge 
(UGRidge) and postnatal day l (Pi) testis and ovary. 
Surprisingly, mRNAs for MISRl, MISR2, and MISR4 were 
15 abundant in the 21-day (E21) fetal brain. MISR1-MISR4 
message was also present in the E21 fetal lung; other E21 
issues, such as the lung, heart, and stomach, contained 
variable levels of MISRl and MISR2 mRNA. 

Fig* 8 illustrates the results of Northern 
20 analysis of a variety of tissues/cells with an misr:l (MIS 
receptor; SEQ ID NO: 1) cDNA probe. A specific 
hybridization signal is seen with RNA extracted f rom ^at 
testicular, ovarian, brain, and pituitary tissues. Lane 
1, 21-day fetal rat testes; 2, 21-day fetal rat ovaries; 
25 3, postnatal day 40 rat testis; 4, postnatal day 40 rat 
ovary; 5, postnatal day 30 male rat pituitary; 6, 
postnatal day 30 female rat pituitary; 7, postnatal day 1 
male rat kidney; 8, postnatal day 1 male rat liver; 9, 
postnatal day l male rat brain; 10, placenta from 15-days 
30 gestation; 11, adult ovary from 18 days gestation; 12, 
hvunan sex cord tumor fragment; 13, A431 human vulvular 
squamous carcinoma cell line. (10 /ig of total RNA per 
lane, except 2 of poly A+ RNA in lane 13; 8 day 
exposure . ) 



wo 93/19177 



PCT/US93/02387 



- 13 - 

Fig. 9 illustrates the results of Northern 
analysis of fetal, prepubertal, pubertal, and adult rat 
testicular tissue with an inisr2 (inhibin receptor; SEQ ID 
NO: 2) cDNA probe. Maximal hybridization signal was 
5 detected with postnatal day 35 and 40 testicular RNA, 
with a rapid decrease in detectable message by 60 days. 
This pattern of RNA expression exactly mirrors the known 
ontogeny of inhibin expression in the maturing rat. 
Hybridization signal was also detected with rat ovarian 
10 and brain tissue (not shown) . E15 and E21 samples are 
from tests collected at days 15 and 21 of gestation, 
respectively; P7, P14, P20, P24, P27, P30, P35, P40, and 
P60 samples are all from postnatal animals. (lo /ig of 
total RNA per lane; 4 day exposure.) 

^5 Preparation of t he isolated DNAs of the invention 

Four different isolated DNAs of the invention were 
prepared by cloning from a rat embryonic urogenital ridge 
cDNA library, as described below. Some alternative means 
of preparing the isolated DNAs of the invention, using 

20 the information provided herein and standard techniques, 
are as follows: 

(1) A nucleic acid having the nucleotide sequence 
shown in any one of Figs. 1-4 (SEQ ID NOs: 1-4, 
respectively) , or a nucleic acid encoding the amino acid 

25 sequence shown in that figure but, owing to the 

degeneracy of the genetic code, having a nucleotide 
sequence different from that shown in the figure, may be 
synthesized by standard chemical means as generally 
applied to synthesis of oligonucleotides. 

30 (2) A nucleic acid hybridization probe containing 

at least 20 nucleotides, and preferably at least 
50 nucleotides, of one of the DNA sequences shown in any 
of Figs. 1-4 (SEQ ID NOs: 1-4) may be prepared by 
standard methodology and used to probe a "library" of the 



wo 93/19177 



PCT/US93/02387 



- 14 - 

five plasmids making up the ATCC deposit designated No. 
75213. For example, a probe which includes at least a 
portion of the nucleotide sequence shown in Fig. 1 (SEQ 
ID NO: 1) , such as the partial sequence shown in Fig. 5A 
5 (SEQ ID NO: 5) , will hybridize under high stringency 

conditions (e.g., hybridizing in 50% deionized formamide, 
800 inM NaCl, 20 mM Pipes, pH 6.5, 0.4% SDS, 500 Mg/ml 
denat\ired, sonicated salmon sperm DNA at 42^C for 12-20 
hoxirs; and washing in 30 mM NaCl, 3.0 mM sodium citrate, 

10 0.5% SDS at 65^C) solely with a plasmid containing the 
complementary sequence, and so would identify clones 
containing the misrl sequence- Similarly, the partial 
sequences shown in Figs. 5B, 50, 5D, and 5E (SEQ ID 
NOs: 6-9, respectively) can be used to identify misr2A, 

15 misr2B, misr3, and misr4, respectively. The desired 
plasmid can be selected as follows: 

The plasmid samples deposited with the ATCC and 
given accession No. 75123 contain 500ng of each of the 
five plasmid DNAs in 50 fxl final volume. A given clone 

20 may be isolated from such a sample by transforming l/il of 
DNA from the sample into bacteria HB 101 by either 
chemical transformation or electroporation. The 
transformed bacteria are selected on 1.5% agar plates 
containing 50 /xg/ml ampicillin. Ampicillin-resistant 

25 colonies are picked individually and grown in 5 ml of LB 
broth containing 50 fig/rsLl ampicillin. The plasmid DNA of 
a few colonies may then be isolated using the standard 
plasmid DNA mini-prep procedure. The mini-prep DNA is 
then characterized by means of a DNA dot-blot, using as 

30 hybridization probe one of the ^^P-labelled misrl, misr2A, 
misr2B, misr3, or misr4 -specif ic probes discussed above. 
Alternatively, a cDNA library prepared from a tissue that 
expresses the gene of interest (such as the rat 
urogenital ridge cDNA library described below) , or a 



wo 93/19177 



PCr/US93/02387 



- 15 - 

genomic library from rat, can be probed with such a 
hybridization probe under highly stringent conditions • 

(3) An isolated DNA prepared by any of the 
methods outlined herein (including the methods originally 
5 used to obtain the DNAs of the invention) may be used to 
probe an appropriate cDNA library or genomic DNA library 
from any vertebrate species. The stringency of the 
hybridization conditions would be adjusted as necessary 
to obtain the desired homolog, while minimizing the 

10 number of related but distinct receptor (such as TGF-B or 
activin receptor) sequences picked up in the assay. It 
is expected that hybridization and wash conditions such 
as the highly stringent conditions set forth in (2) above 
would be adequate; if necessary, the stringency may be 

15 increased or decreased, without undue experimentation, 
using methods well known to those of ordinary skill in 
the art (see, e.g., Sambrook et al.. Molecular Cloning: A 
Laboratory Manual, Cold Spring Harbor Laboratory, Cold 
Spring Harbor, NY, 1989). A given cloned cDNA or genomic 

20 DNA would be identified as a homolog of misrl, misr2, 

misrS, or misr4 by means of sequence comparison, wherein 
an encoded amino acid sequence that is at least 70% 
identical to the amino acid sequence encoded by any one 
of misrl (SEQ ID NO: 1), misr2 (SEQ ID NO: 2), misr3 (SEQ 

25 ID NO: 3), or misr4 (SEQ ID NO: 4) is considered to be a 
homolog of that receptor. Given the apparently 
ubiquitous occxarrence of MIS, inhibin, and bone 
morphogenesis proteins (BMPs) among vertebrate species in 
which they have been sought, it is expected that most or 

30 all vertebrate species, and certainly all mammalian 
species, will be found to have genes encoding at least 
one MIS receptor, inhibin receptor, and BMP receptor 
which can be identified by the methods described herein. 
It is further expected, based upon the infomnation 

35 disclosed herein, that many if not all such species will 



wo 93/19177 



PCr/US93/02387 



- 16 - 

be found to harbor a plxirality of isoforms of such 
receptor genes. 

Each such homolog can be definitively identified 
as an MIS receptor, inhibin receptor, or BMP receptor by 
5 any of the following assays: 

(a) Following transient transfection and 
expression of the putative receptor DNA in an appropriate 
expression system (i.e., a evikaryotic cell line, such as 
COS cells, that does not normally express the receptor), 

10 the cells are exposed to the suspected ligand (e.g., MIS, 
inhibin, or one of the BMPs [either recombinant or 
naturally occurring]) from the same species as the 
subject homolog receptor. The ligand can be labelled in 
order to allow detection of binding to the transfected 

15 cells (which presumably bear the recombinant receptor on 
their surfaces) , or alternatively a labelled antibody 
specific for the ligand can be used to indicate whether 
or not the cells have bound ligand. Binding of the 
ligand (with or without crosslinking to the receptor) by 

20 transfected but not untransfected cells is evidence, that 
the putative receptor DNA does encode a receptor specific 
for the ligand. Such experiments could be carried out 
using recombinant human Mis produced as disclosed in Cate 
et al., U.S. Patent No. 5,047,336 (herein incorporated by 

25 reference) , and purified by means of an affinity column 
using an anti-MIS monoclonal antibody,, such as disclosed 
in Donahoe et al. , U.S. Patent No. 4,792,601 (herein 
incorporated by reference) . The pvirif ied holo MIS is 
then proteolytically cleaved into an amino terminal 

30 fragment and a 24 kDa carboxyl terminal fragment, and the 
biologically active carboxyl terminal fragment is 
isolated and radiolabelled. Details of these procedures 
are provided in the Experimental Data section below. The 
biologically active form of inhibin (a 32 )cDa inhibin 

35 carboxyl-terminal fragment) and the various BMPs may also 



wo 93/19177 



PCT/US93/02387 



- 17 - 

be radiolabelled as described below. The specific 
binding and affinity constant can be calculated by using 
a molar excess of unlabelled ligand for competition. 

(b) MIS, inhibin, or any of the BMPs can be fixed 
5 to an affinity matrix material by standard methods, and 
then used to assay for proteins which bind to the matrix: 
for example, the putative receptor protein expressed by 
cells transfected with a cloned DNA of the invention, and 
isolated from the cells' membranes by standard 

10 techniques, can be passed over a column of such affinity 
matrix material. In a variation on this technique, the 
putative receptor protein itself can be fixed to the 
matrix material, and a preparation including the ligand 
(MIS, inhibin, or a BMP) passed over the column. 

15 (c) Eukaryotic cells which do not normally 

express an MIS, inhibin, or BMP receptor are transfected 
with the putative receptor DNA of the invention, and 
used, in accordance with standard procedures, to generate 
monoclonal antibodies which can differentiate between 

20 such transfected cells and identical but untransf ected 
cells. These monoclonal antibodies are then labelled and 
used in immunohistochemical analysis of given tissues, in 
order to determine what tissues normally express the 
putative receptor DNA, and at what stages of development. 

25 A pattern of expression that correlates with the expected 
pattern (the expected pattern being determined, for 
example, by the pattern of binding of MIS, inhibin, or 
BMPs in such tissues) would provide evidence that the 
putative receptor DNA did indeed encode the predicted 

30 receptor. 

(d) Monoclonal antibodies raised as described 
above could also be used in a competitive binding assay. 
A given tissue sample which, by virtue of its ability to 
bind natural or recombinant MIS, inhibin, or BMP, is 

35 known to bear naturally occurring MIS or inhibin 



wo 93/19177 



PCr/ljS93/02387 



- 18 - 

receptors could be employed in a competitive binding 
assay with either labelled ligand and excess unlabelled 
antibody raised against the putative receptor (as 
described above) , or labelled antibody and excess 
5 unlabelled ligand. Evidence that the ligand and the 

antibody compete for the same binding sites would support 
the conclusion that the putative receptor was indeed an 
MIS, inhibin, or BMP receptor. 

(d) Another technique for confirming the identity 

10 of a putative receptor of the invention is by the use of 
Northern blots, probing the RNA of various tissues with a 
single-stranded hybridization probe made of labelled DNA 
encoding the putative receptor. The expression of 
putative receptor-specific genes in tissues known to be 

15 affected by MIS, inhibin, BMP, or another candidate 

ligand, including both normal and disease-state tissues, 
and the lack of detectible expression in other tissues 
known to be insensitive to the candidate ligand, is 
evidence that the putative receptor is indeed a receptor 

20 for the candidate ligand. 

Use 

The cDNAs of the invention, or fragments thereof 
long enough to serve as specific hybridization probes, 
can be duplicated by standard means by transfection into 

25 appropriate cells (e.g., bacterial cells), purified, and 
then used as hybridization probes in Northern or in situ 
hybridization analyses, in order to determine the level 
of expression of the relevant mRNA in a particular tissue 
sample. Alternatively, a vector encoding a receptor of 

30 the invention plus appropriate expression <:ontrol 
elements can be trans fected into a cell capable of 
expressing the receptor polypeptide. Such cells may 
express the polypeptide as a surface-anchored receptor, 
or may secrete the polypeptide or accumulate it within 



wo 93/1 91 77 PCT/US93/02387 



- 19 - 

the cell. Purified receptor protein, or cells or 
membrane preparations bearing the receptor, may be used 
to generate monoclonal or polyclonal antibodies specific 
for the given receptor, which antibodies can be employed 
5 in assays for detecting the presence or the amount of 
such receptor in biological samples such as searum or 
tissue biopsies. Some tumors, including certain ocular 
melanomas as well as tumors of the female genital tract, 
are susceptible to the antiproliferative effects of MIS 

10 (Donahoe et al.. Science 205:913-915, 1979; Donahoe et 
al., Ann. Surg. 194:472-480, 1981; Fuller et al., J. 
Clin. Endo. Metab. 54:1051-1055, 1982; Fuller et al., 
Gynecol. Oncol. 22:135-148, 1985; Chin et al.. Cancer 
Res. 51:2101-2106, 1991; Parry et al.. Cancer Res. 

15 52:1182-1186, 1992; and Donahoe, U.S. S.N 683,966, herein 
incorporated by reference) , and it is postulated that the 
growth of other tximor types may be similarly reduced by 
inhibin or BMP. The antibodies of the invention would 
therefore be useful for identifying candidate tumors 

20 likely to respond to therapy with MIS, inhibin, BMP, or 
agonists or antagonists thereof. The receptor 
polypeptides of the invention, and their respective 
antibodies, could be used as receptor agonists or 
antagonists in the management of relevant clinical 

25 disorders. The antibodies can also be used as the 

targeting means for directing cytotoxic agents to cells 
(such as tumor cells) bearing the given receptor. 
Examples of cytotoxic agents commonly used in such 
applications include, for example, polypeptide toxins 

30 such as diphtheria toxin, Pseudomonas exotoxin A, ricin, 
and gelonin, or defined toxic portions thereof; 
radioisotopes; and agents such as cisplatinum, 
adriamycin, bleomycin, and other therapeutic cytotoxins. 
Methods for making such immunotoxins are well known to 

35 those of ordinary skill in the art, and may include 



wo 93/19177 



PCr/US93/02387 



- 20 - 

genetic engineering technology as well as chemical-based 
techniques . 

Purified receptor protein, or transformed cells 
expressing the receptor protein, can be used to screen 
5 candidate drugs for their ability to block or enhance the 
binding of MIS, inhibin, or BMPs to their respective 
receptors. This could be accomplished by means of a 
competition assay using, for example, labelled ligand and 
excess candidate drug. Inhibitors of MIS ligand /receptor 

10 binding would potentially be useful for preventing or 
alleviating respiratory distress syndrome in newborns 
(Donahoe et al., U. S.S.N. 416,235, herein incorporated by 
reference) . Substances which act as inhibitors of 
inhibin/receptor binding could be used for treatment of 

15 infertility: for example, the extracellular domain of a 
soluble inhibin receptor can act as an inhibin 
antagonist, thereby increasing the level of FSH in 
infertile patients with low FSH. Inhibitors of 
BMP/receptor binding (such as the extracellular domain of 

20 a BMP receptor) could be used in a similar fashion to 
enhance the action of bone-specific trophic factors. 

Recombinant forms of the MIS receptor, inhibin 
receptor, or BMP receptors, or ligand-binding portions 
thereof, can be used to measiare the amount of ligand 

25 (MIS, inhibin, or one of the BMPs) present in a 

biological sample. This could be accomplished, for 
example, by means of a sandwich assay utilizing the 
recombinant receptor protein fixed to a solid support, 
and labelled anti-ligand antibody. Where the ligand 

30 being measured is MIS, it may be desireable to include 
plasmin or an MIS-specific protease in the assay, in 
order to permit the cleavage of any holo MIS present in 
the sample into its receptor-binding form. The 
recombinant receptors of the invention would also be 

35 useful as a means for assaying receptor binding by 



wo 93/19177 PCT/US93/02387 

- 21 - 

analogs of MIS, inihibin, and the BMPs, in order to 
develop analogs with an enhanced affinity for the given 
receptor. Those analogs which are capable of stimulating 
a signal through the receptor can then be used in MIS, 
5 inhibin or BMP replacement therapy, while those analogs 
which bind but do not activate the given receptor will be 
useful as inhibitors of the natural ligand* 

The receptors of the invention may also have 
therapeutic applications. Where a given condition, such 

10 as respiratory distress syndrome in newborns, is 
attributable to an overabundance of MIS in a given 
tissue, exposure of that tissue to recombinant MIS 
receptor protein, or a soluble, MIS-binding fragment 
thereof, provides a means for reducing the amount of MIS 

15 available for binding to natural receptors in the tissue 
and thereby alleviating the underlying cause of the 
condition. Similarly, a soluble, inhibin-binding 
fragment of the inhibin receptor would be useful, as 
discussed above, for increasing the level of FSH in 

20 patients with infertility attributable to abnormally low 
FSH levels. A soluble, BMP-binding fragment of a BMP 
receptor could be utilized in an assay to measure the 
amount of a particular BMP present in a biological 
sample: for example, to determine whether BMP 

25 supplemental therapy would be called for in a given case 
of retarded bone growth or repair of traumatic bone 
injixries or deficiency due to removal of bone in surgery 
for a malignancy or other deformities. Such soluble 
receptor fragments can be readily produced by genetically 

30 engineering the receptor cDNAs of the invention to delete 
those portions encoding the largely hydrophobic putative 
transmembrane regions, but leaving intact the sequences 
encoding the putative extracellular domains. Such 
methods are well known in the art. One example of a 

35 soluble fragment of MISRl would include most or all of 



wo 93/19177 



PCr/US93/02387 



* 22 - 

amino acids 1 to 510 of the sequence shown in Fig, 1 (SEQ 
ID NO: 14), but would not include amino acids 121 to 138. 

Alternatively, a given soluble receptor fragment may be 
produced by proteolytic treatment of naturally occurring 
5 or recombinant membrane-bound MXS or inhibin receptors. 
Such soluble fragments can be assayed for their ability 
to bind to ligand by the use of radiolabelled ligand or 
ligand fixed to affinity matrix. 

Deposit 

10 Under the terms of the Budapest Treaty on the 

International Recognition of the Deposit of 
Microorganisms for the Purpose of Patent Procedure, a 
deposit of plasmids misrl, misr2A^ misr2B, misrS, and 
misr4 has been made with the American Type Culture 

15 Collection (ATCC) of Rockville, MD, USA, where the 
deposit was given Accession No. 75213. 

Applicants' assignee, the General Hospital 
Corporation, represents that the ATCC is a depositoiry 
affording permanence of the deposit and ready 

20 accessibility thereto by the public if a patent is 
granted. All restrictions on the availability to the 
public of the material so deposited will be irrevocably 
removed upon the granting of a patent. The material will 
be available during the pendency of the patent 

25 application to one determined by the Commissioner to be 
entitled thereto under 37 CFR 1.14 and 35 U.S.C. §122. 
The deposited material will be maintained with all the 
care necessary to keep it viable and uncontaminated for a 
period of at least five years after the most recent 

30 request for the furnishing of a sample of the deposited 
material, cind in any case, for a period of at least 
thirty (30) years after the date of deposit or for the 
enforceable life of the patent, whichever period is 
longer. Applicants' assignee acknowledges its duty to 

35 replace the deposit should the depository be iinable to 



wo 93/19177 



PCT/US93/02387 



- 23 - 

furnish a sample when requested due to the condition of 
the deposit. 



Experimental Data 
Four novel miembrane serine/ threonine kinase 
5 receptor cDNAs from the rat urogenital ridge were cloned 
and characterized as described below* 

Polymerase chain reaction (PCR) using consensus primers. 
The DNA sequence of the cDNA encoding a murine 

activin receptor (Mathews and Vale, Cell 65:973-982, 
10 1991) was compared to that of certain related cDNAs: 

human and porcine TGF-)9 type II receptor (Lin et al., 

Cell 68:775-785, 1992) and the daf-1 receptor of C. 

elegans (Georgi et al.. Cell 61:635-645, 1990), and two 

highly conserved regions defined. These two regions 
15 formed the basis for the design of two degenerate 

oligonucleotides : 

5'- GTGGCCGT(G/C)AA(A/G)AT{C/T)TT - 3' (SEQ ID NO: 

10) 

and 5'- GAC(T/C)TCTGG(G/A)GCCAT(G/A)TA - 3' (SEQ ID NO: 
20 11). 

The oligonucleotides were synthesized with an Applied 
Biosystems 391 DNA synthesizer, and used as primers for 
polymerase chain reaction (PCR) -based selection from a 
14.5 day rat urogenital ridge COS cell expression cDNA 

25 library. PCR was carried out in a 50 ^,l reaction mixture 
containing about 1 ^g of cDNA plasmid; 10 mM Tris-HCl, pH 
8.3; 50 mM KCl; 5 mM MgCl^; 0.001% gelatin; 250 /xM each 
of dATP, dCTP, dGTP, and dTTP; 1 unit of Taq polymerase 
(Perkin-Elmer Cetus) ; and 50 pmol each of the above 

30 oligonucleotides. Thirty cycles of PCR (consisting of 
denaturation at 94<»C for 1 min; annealing at 37 ®C for 1 
min; and elongation at 72«>C for 1 min) were performed. 
The PCR products were separated on a 1.5% agarose gel and 
a predicted 400-500 bp DNA fragment was sliced out and 



wo 93/19177 



PCr/US93/02387 



- 24 - 

purified by Gene-clean~. The purified PGR product was 
blunt-ended with Klenow fragment and phosphorylated with 
T4 polynucleotide kinase. The final PGR fragment was 
ligated, using T4 DNA ligase, with plasmid pGEM72(+) 
5 vector which was digested with Sma I and 

dephosphorylated. The ligation mixture was incubated at 
room temperature for 3 hours, and then transformed into 
bacteria HB 101 by electroporation. Bacterial colonies 
resistant to ampicillin were selected overnight on 1.5% 

10 agar plates containing 50 Mg/ml ampicillin. Individual 
colonies were picked and grown in 5 ml of LB broth, and 
plasmids were isolated according to a standard plasmid 
mini-prep protocol. The plasmid DNA was then sequenced 
with bacterial phage promoter SP6 and T7 primers using 

15 Sequenase (USB) . Four clones containing PGR fragments 
encoding portions of foxir novel polypeptides (putative 
serine/threonine kinases) were designated pGEM7-Misrl, 
pGEM7-Misr2, pGEM7-Misr3 and pGEM7-Misr4, respectively. 
In addition, cDNAs encoding portions of TGF-beta receptor 

20 and activin receptor were isolated during this procedure; 
these were designated pGEM7-tgfb and pGEM7-actr, 
respectively . 
cDNA Library Synthesis 

Approximately 450 urogenital ridges and their 

25 adjacent gonads were collected from 24 litters of 

14.5-15 day gestational age fetal rats, and flash frozen 
in liquid nitrogen. RNA was then extracted from this 
tissue by homogenization in 50% guanidinium 
thiocyanate/14.5% lithium chloride/ 0.2% )9- 

30 mercaptoethanol, centrifugation through 5.7 M cesium 
chloride (50k rpm for 2 hotirs) , and precipitation with 
NaOAc and ethanol. Poly A+ RNA was further obtained by 
oligo dT - cellulose chromatography of 620 fig total RNA. 
Twenty jLig of this poly A+ RNA was subsequently used for 

35 first strand cDNA synthesis, using 4 /iil of reverse 



wo 93/19177 



PCT/US93/02387 



- 25 - 

transcriptase (RT-XL, Life Sciences), 2.5 |xl of 20 inM 
ultrapure dNTP, 1 /xl of oligo dT (Collaborative Research, 
5 /ig//il) as primer, 20 /zL of RTl buffer, 1 /xL 1.0 M DTT, 
and 2 /xl of placental RNase inhibitor (Boehringer, 36 
5 U//11) in a total voltune of 100 /xl, incubated for forty- 
five minutes at 42 °C. The second strand synthesis 
reaction, which employed 5 /xl of DNA polymerase I 
(Boehringer, 5 U//xl) and 2 /xl of RNase H (BRL, 2 U//xl) , 
was performed for one hour at 15 ®C followed by one hour 
10 at 22**C, prior to termination with 20 /xl of 0.5 M EDTA, 
pH 8. 

The cDNA mixture was then phenol extracted and 
ethanol precipitated, and then ligated to non- 
self -complimentary BstXl linkers (Invitrogen) using 1 /xl 

15 of T4 DNA ligase (NE Biolabs, 400 U//xl) , in a volume of 
50 /xl incubated at 15**C overnight. Small cDNA and free 
linkers were removed by centrifugation through a 5-20% 
KOAc gradient. Fractions of the gradient that contained 
cDNA larger than one kilobase were ethanol precipitated 

20 with linear polyacrylamide and pooled. After test 

ligations had determined the optimal ratios, the cDNA was 
ligated into the COS cell expression vector CDM8, 
previously digested with BstXl. The cDNA/ vector products 
were electroporated (BioRad Gene Pulser) into competent 

25 E. coli MCl06l/p3 cells, which were then grown on 20 
LB/ampicillin bacterial plates. The resulting cDNA 
library contained 1 X 10^ individual clones, with an 
average insert size of 1.5-2.0 kb. Maxiprep plasmid DNA 
(total yield 1.9 mg) was subsequently obtained from a 

30 "pooled" overnight liquid culture of these clones. 

A lambda Zap II library was constructed by 
Stratagene using 20 /xg of urogenital ridge mRNA. 



wo 93/19177 



PCr/US93/02387 



- 26 - 

Cloning of the full-lenath cDNAs for Misrl. Misr3 and 
Misr4 , and two partial cDNAs for Misr2 

The plasmid DNA of each of pGEM7-inisrl, pGEM7- 
inisr2, pGEM7-niisr3 , and pGEM7-inisr4 was prepared in large 
5 quantities according to a standard plasmid large-prep 
protocol. The inserts of individual clones were excised 
out of the plasmid vector with restriction enzymes Eco RI 
and Bam HI. The inserts were then gel-separated and 
purified with Gene-clean"*. The purified DNA inserts were 

10 labeled with ^^P-dCTP using a random-priming technique, to 
a specific activity of greater than 1 x 10^ cpm//ig. The 
individually labeled DNA probes were then used to screen 
a 14.5 day rat urogenital ridge lambda ZAP II cDNA 
library made by Stratagene. Positive clones were plaque- 

15 purified and the inserts were excised into plasmid 
pBluescript I SK according to Stratagene 's protocol. 
Full-length clones were secjuenced with Sequenase on both 
strands by synthesizing internal 16-17 oligonucleotide 
sequencing primers. The full-length DNA coding sec[uence 

20 of misrl (SEQ ID NO: 1) and the amino acid sequence of 
its encoded polypeptide (referred to as MISRl; SEQ ID 
NO: 14) are shown in Fig. 1. The full coding sequence of 
misr2A/misr2B is shown in Fig. 2 (SEQ ID NO: 2), where 
the overlap between the two cloned sequences is 

25 indicated. The full length polypeptide encoded by a DNA 
sequence resulting from the ligation of appropriate 
portions of misr2A and misr2B to produce a single, full- 
length coding sequence is also shown in Fig. 2; this 
full-length polypeptide is referred to herein as MISR2 

30 (SEQ ID NO: 15) . Full-length sequences of clones misr3 
and misr4 are shown in Fig. 3 (SEQ ID NO: 3) and Fig. 4 
(SEQ ID NO: 4), respectively. The full-length 
polypeptide encoded by misr3 is termed MISR3 (shown in 
SEQ ID NO: 16) , while the full-length polypeptide encoded 

35 by misr4 is termed MISR4 (shown in SEQ ID NO: 17) . Each 



wo 93/19177 



PCr/US93/02387 



- 27 - 

sequence was compared to sequences in the GenBank 
database, and found to be unique. Misrl (SEQ ID NO: 1) 
is believed to encode an isoform of the rat MIS receptor, 
while jnisr2A/inisr2B (SEQ ID NO: 2), misrS (SEQ ID NO: 3), 
5 and 2nisr4 (SEQ ID NO: 4) are believed to encode monomeric 
isofonas of the rat inhibin receptor and/or BMP receptor. 

Each putative receptor of 501-509 amino acid 
residues possesses the characteristic domain features of 
the TGF-p receptor super family, including a hydrophobic 

10 signal peptide of 19-23 residues (von Heijne, Biochim. 
Biophys. Acta 947:307, 1988); an extracellular, cysteine- 
rich, hydrophilic, ligand-binding domain of 100-150 
residues, a hydrophobic single transmembrane domain of 
23-25 residues (Kyte et al, J. Mol. Biol. 157:105, 1982), 

15 an intracellular serine/threonine kinase domain of 

approximately 300 residues, and a short serine/ threonine 
rich tail* Sequence alignment with the TGF-^ and activin 
type II receptors and daf-1 reveals greatest the 
similarity between their intracellular domains, including 

20 conservation of 22 amino acid residues that are 

characteristic of the serine/threonine subfamily of 
protein kinases (Hanks, Meth. Enzymol. 200:38, 1991). 
All such kinases, including members of the TGF-)ff receptor 
family and MISR1-MISR4, have 12 subdomains of highly 

25 conserved residues. For example, GXGXXGXVX^i.je^' 

conserved in subdomains I and II and thought to form an 
ATP binding site, aligns well in MISR1-MISR4 as 
GKGR{Y/F)GEVX-^2K (SEQ ID NOs: 12 and 13). Subdomains VIB 
and VIII are key regions which determine tyrosine and 

30 serine /threonine kinase specificity; in each of MISRl- 
MISR4, these domains are more homologous to the 
serine/threonine motif than to the tyrosine sequence 
(Hanks et al.. Science 241:42-52, 1988). 



wo 93/19177 



PCT/US93/02387 



" 28 - 

In situ Hybridization 

Plasmids pGEM7"Misrl, pGEM7-Misr2, pGEM7-Misr3, 
and pGEM7-Misr4 were linearized with appropriate 
restriction enzymes. Antisense or sense RNA probes 
5 labelled with [^^SJ-UTP were generated by transcription of 
the linearized plasmid DNA using the Riboprobe Gemini 
System II (Promega Biotech) with SP6 or T7 RNA 
polymerases. 

Tissue sections were postfixed in 4% 

10 paraformaldehyde in O.IM phosphate buffer, pH 7*4, for 5 
minutes at room temperature, then rinsed twice in PBS. 
The sections were rinsed briefly with O.IM 
triethemolamine-HCl, pH 8.0, and then treated with 0.25% 
acetic anhydride in O.IM triethanolamine-HCl, pH 8.0, for 

15 10 min. at room temperature. The sections were rinsed 
twice in 2X sodium chloride/ sodium citrate (SCC) , then 
dehydrated in increasing concentrations of ethanol, 
delipidated in chloroform, rehydrated, and air dried for 
30 min. at room temperature. Sections were hybridized 

20 under coverslips for 15 hours at 55*>C using -^^S-labelled 
sense or antisense probe (2 x 10^ cpm/ml) in 50% 
formamide, 600 mM NaCl, 10 mM Tris-HCl (pH 7.5), 0.02% 
Ficoll, 0.02% bovine serum albumin, 0.02% 
polyvinylpyrrolidone, 1 mM EDTA, 0.01% salmon testis DNA, 

25 0.05% total yeast RNA, 0.005% yeast tRNA, 10% dextran 
sulfate, 0.1% SDS, 0.1% sodium thiosulfate, and 100 mM 
DTT. After hybridization, slides were immersed in 2X SSC 
for 30 min. at room temperature, and floated off the 
coverslips. The slides were first treated with RNase A 

30 (20 mg/ml) in RNase buffer (0.5 M NaCl, 10 mM Tris-HCl, 
pH 8.0, 1.0 mM EDTA) for 30 min. at 37«»C and washed in 
the same buffer for 30 min. at 37**c. The slides were 
then washed in 2X SSC for 1 hour at 50*>C, 0.2X SSC for 1 
hour at 55«C, 0.2X SSC for 1 hour at 60«»C, then 

35 dehydrated sequentially in 70%, 80%, and 95% ethanol 



wo 93/19177 



PCr/US93/02387 



- 29 - 



containing 300 mM ammonium acetate, and absolute ethanol 
before air drying. To detect autoradiographic silver 
grains, the slides were dipped into Kodak NTB-2 nuclear 
track emulsion diluted 1:1 with 0.1% Aerosol 22 (Sigma) 
5 at 42 "C, dried gradually in a high humidity chamber for 2 
hours, then exposed at 4»C for 7-14 days. The slides 
were developed in Kodak D19 for 2 min. at I6»c, rinsed in 
deionized water for 30 sec, fixed in Kodak fixer for 
5 min. , then washed in deionized water and stained with 
10 hematoxylin. Sections were examined using bright and 
darkfield illumination. 

To identify potential ligands for MISR1-MISR4 
binding studies, in situ hybridization was performed with 
13 to 16-day fetal urogenital ridge and fetal, 
15 peripubertal, and adult gonads (Fig. 6) . Remarkably, 

misrl was the only clone to localize specifically to 14.5 
to 15-day fetal male Mullerian duct mesenchyme, but not 
to the adjacent Wolffian duct or gonad or to 13 or 16-day 
Mullerian tissue. This was a consistent finding using 
20 misrl riboprobes derived from either the 3' conserved 
domain or the 5' extracellular region, making cross- 
hybridization with homologous receptors unlikely, m 
addition, misrl message localized to oocytes of preantral 
and antral follicles of the peripubertal and adult ovary. 
25 Because the expression and ontogeny of misrl mRNA is 
consistent with both the known site (Trelstad et al. , 
Develop. Biol. 92:27-40, 1982; Tsuji et al.. 
Endocrinology 131:1481-1488, 1992) and timing (Picon, 
Arch. Anat. Micro. Morphol. Exp. 58:1-19, 1969) of MIS 
30 action in the urogenital ridge, as well as the -cycling 
adult ovary (Takahashi et al., Molec. Cell. Endocr. 
47:225-234, 1986; Ueno et al.. Endocrinology 125:1060- 
1066, 1989), MISRl is the best candidate for the rat MIS 
receptor. MISR2 mRNA, on the other hand, localized in a 
heterogeneous pattern to seminiferous tubules of pubertal 



35 



wo 93/19177 



PCr/US93/02387 



- 30 - 

and adult testes, but was not detectable within the fetal 
or adult ovary (Figs. 6E and 6F) - Both MISRl and MISR2 
transcripts were also observed in the postnatal female 
anterior pituitary and hippocampus (data not shown) , but 
5 their cellular localization has not been clearly 
delineated. 
Northern Analysis 

Northern analysis of a variety of fetal and adult 
rat tissues was performed to determine both the tissue 

10 and temporal specificity of expression of RNA 

corresponding to each of the four newly identified 
receptor clones. Total RNA was extracted by a 
modification of the method of Chirgwin using guanidinium 
thiocyanate/ lithium chloride; RNA quantification was by 

15 spectrophotometric analysis and ethidixim bromide staining 
of test gels. Ten fig of total RNA (or in selected cases, 
1 Mg of poly-A+ RNA) were loaded in each lane of 1.5% 
Morpholinopropanesulfonic acid-formaldehyde agarose gels, 
electrophoresed at 5 V/cm, transferred to Biotrans nylon 

20 membranes (ICN Biomedicals, Irvine, CA) by capillary 
action in 25 mM sodium phosphate, and then fixed by UV 
irradiation. 

Membranes were prehybridized in plaque screen 
buffer (0.05 M Tris-Cl, 0.1% Na pyrophosphate, 1 M NaCl, 

25 0.2% polyvinylpyrrolidone, 0.2% Ficoll, 0.2% BSA, 1% SDS) 
containing 0.1 mg/ml tRNA for 2 hours at 65**C. Membranes 
were then hybridized with one of the four randomly 
primed, ^^P-labeled receptor cDNA clones, which varied in 
length from 0.5 to 3.0 kb. Overnight hybridization was 

30 performed with 1x10^ cpm/ml in plaque screening buffer 
containing 0.1 mg/ml tRNA. All hybridizations and washes 
were done at es^-C; 30 mM NaCl/3.0 mM Na citrate/0.5% SDS 
was the most stringent wash. Autoradiographic exposures 
were for 3-10 days. 



wo 93/19177 



PCT/US93/02387 



- 31 - 

As shown in Fig, 7, mRNA transcripts of 4.0 kb 
(misrl) , 4.4 and 1.5 kb (inisr2A/inisr2B) , 4.4 kb (inisr3) , 
and 6 kb (inisr4) were detected in 15-day (E15) fetal 
urogenital ridge tissue and postnatal day 1 (Pi) testis 
5 and ovary. Similar levels of expression were found for 
each clone in pubertal and adult gonads, misrl, inisr2, 
and inisr4 message was also abundant in the 21-day (E21) 
fetal brain, with misrl mRNA persisting in the adult 
female brain (data not shown) . Interestingly, all four 

10 of these mRNAs are present in the E21 lung (particularly 
misr3 and misr4) and persist there to adulthood (data not 
shown). Transcripts for misrl and misr2, and less so for 
misr3, were detected in other E21 tissues such as the 
lung, heart, and stomach, suggesting a more universal 

15 distribution of these receptors than anticipated. 

As illustrated in Figs. 8 and 9, the misrl (MIS 
receptor) probe hybridized to mRNA from testes, ovary, 
brain, and pituitary, while the misr2 (inhibin receptor) 
probe hybridized with testicular RNA in a distinctive 

20 temporal pattern. Misr2 probe was also found to 

hybridize to ovarian and brain tissue (data not shown) . 
These results are consistent with the conclusion that 
misrl encodes the rat MIS receptor, while misr2A/2B 
together encode the rat inhibin receptor. 

25 Holo RhMIS Purification 

Recombinant human MIS (rhMIS) purification by 
immunoaffinity chromatography from conditioned media of 
Chinese hamster ovary cells transfected with human MIS 
gene is as follows. Media were collected every 3-4 days 

30 from bicreactor cultures (Epstein et al.. In Vitro Cell. 
Dev. Biol. 25:213-216, 1989), and stored at -20*»C until 
use. A 5 ml immunoaffinity column was constructed using 
approximately 50 mg of the protein A-Sepharose (Sigma 
Chemical Co., St. Louis, MO) purified mouse monoclonal 

35 anti-human rhMIS antibody (Hudson et al., J. Clin. 



wo 93/19177 



PCT/US93/02387 



- 32 - 

Endocrinol. Metab. 70:16-22^ 1990) covalently attached to 
Affigel-10 agarose resin (BioRad Laboratories, Richmond 
CA) . The coliimn was equilibrated with 100 ml of 20 mM 4 - 
(2-hydroxyethyl)-l-piperazineethanesulfonic acid (Hepes) , 
5 pH 7.4, and 200 ml of concentrated meditm loaded after 
filtration through Whatman #4 paper at l colximn volume/h 
at 4*'C. After loading, the coliamn was washed with 20 mM 
Hepes, pH 7.4, until the absorbance at 280 nm returned to 
baseline (60-100 ml) . 

10 RhMIS was eluted using 1 M acetic acid in 20 mM 

Hepes, pH 3.0, after a one column volume pre-elution wash 
containing 0.5 M NaCl, 1 mM EDTA, 0.001% nonidet P-40 
(NP-40, Sigma Chemical Co., St. Louis, MO), 20 mM Hepes, 
pH 7.4. The majority of the rhMIS eluted in a single 2 

15 ml fraction, which was immediately neutralized with NaOH 
to a pH between 7.0 and 7.4. The acid-e luted 
immunoaff inity-pxirif ied (TAP) fractions were dialyzed 
overnight versus 0.02 M Hepes, 0.001% NP-40, pH 7.4. The 
resulting samples were analyzed for total protein by the 

20 Bradford method (Bradford, Anal. Biochem. 72:248-254, 
1976) and for rhMIS concentrations by an enzyme-linked 
immunosorbent assay (Hudson et al., J. Clin. Endocrinol. 
Metab. 70:16-22, 1990) . They were further examined by 
polyacrylamide gel electrophoresis (Weber et al., J. 

25 Biol. Chem. 244:4406-4412, 1969) and activity determined 
in an in vitro Miillerian duct regression bioassay. 
Purification of the carboxvl-terminus of rhMIS 

Immunoaffinity purified rhMIS (1.1-1.5 mg in 2.5 
ml of 20 mM Hepes buffer, pH 7.4) was incubated with 

30 plasmin (EC 3.4.21.7, Sigma Chemical Co., St. Louis, MO) 
at a ratio of 20 to 25:1 rhMIS to plasmin w:w for 2 hr at 
room temperature as previously described (Pepinsky et 
al., J. Biol. Chem. '263:18961-18964, 1988). The 
preparation was then placed onto a 2.5 x 16 cm P-100 

35 polyacrylamide column (BioRad Laboratories, Richmond, CA) 



wo 93/19177 



PCT/US93/02387 



- 33 - 

equilibrated at .4*»C with 1.0 M acetic aci. in 20 mM Hepes 
at pH 3.0, Protein was eluted in 0.54 ml fractions at a 
flow rate of approximately 2.0 ml/hr. Ten microliter 
aliquots were analyzed for protein by the Bradford method 
5 (Bradford, Anal. Biochem. 72:248-254, 1976). Two peaks 
of protein, termed A and B, elute from this column. 
These peaks were pooled separately, frozen in liquid 
nitrogen, and concentrated by lyophilization in a Savant 
Speed Vac apparatus. The resulting pools were dissolved 

10 in either 20 mM Hepes, pH 7.4, or 0.3 M sodium phosphate, 
pH 7.4, so that a final protein concentration of 1 mg/ml 
was achieved. Elution buffer in volumes similar to those 
of the pools was also lyophilized and dissolved in buffer 
as above to serve as controls for the rhMIS bioassays. 

15 Rh MIS Bioassav 

The standard organ culture bioassay for MIS was 
performed as described (Donahoe et al., Biol. Reprod. 
16:238-243; MacLaughlin et al.. Methods in Enzymology 
198:358-369, 1991). Briefly, 14^ day female fetal rat 

20 urogenital ridges were placed on agar-coated stainless 
steel grids above fortified CMRL 1066 medixim (GIBCO/BRL, 
Gaithersburg, MD) containing female fetal (and therefore 
MIS-free) calf serum (Necklaws et al.. Endocrinology 
118:791-796, 1986) and testosterone at 10"^ M, to enhance 

25 the Wolffian duct for direct comparison of the Miillerian 
duct in each tissue section. RhMIS protein samples of 
0.5 to 8.0 Mg each, or buffer controls, were added in 
serum containing CMRL medium after sterile filtration in 
that solution through a 0.22 Millex GV membrane. 

30 Control studies using carboxyl-terminal rhMIS 

radiolabeled with I^^^ by a standard technique (Hunter, 
Proc. Soc. Exp. Biol. Med. 133:989-992, 1970) 
demonstrated no loss of the protein to this filter. 
After incubation for 3 days in humidified 5% COj at 37«C, 

35 the specimens were fixed in 15% formalin, embedded in 



wo 93/19177 



PCr/US93/02387 



- 34 - 

paraffin, and 8 /xm sections of the cephalic end stained 
with hematoxylin and eosin. The sections were then 
ranked from grade 0 (no regression) to grade 5 (complete 
regression) , by two experienced observers. One unit of 
5 activity is defined as causing a 1 grade increase in 
Miillerian duct regression. Data were compared by 
Student's t-test for significant differences among 
groups • 

Radioisotope labelling of liaand 

10 lodination of both MIS and inhibin carboxyl 

terminal fragments is performed with ^^^I Na and 
chloramine-T . One to five ^tg of protein is suspended in 
0.3 M sodium phosphate buffer, pH 7.5, and radioisotope 
then added at a ratio of lmCi:5/ig. Three serial 

15 additions of chloramine-T solution are next performed, 
with a final chloramine-T to protein ratio of 1:7 and a 
total reaction time of 4.5 minutes. The reaction is 
terminated with saturated potassium iodide solution 
containing 0.1% BSA; free isotope is then separated from 

20 radiolabeled ligand by size exclusion chromatography. 
Estimated specific activities of 50-70 x 10^ cpm/Mg have 
been obtained for both ligands using this method. 

Other embodiments are within the following claims. 



wo 93/19177 



PCT/US93/02387 



mat is claimed is: - 35 - 

1. Isolated DNA comprising a sequence encoding a 
Miillerian Inhibitory Substance (MIS) receptor. 

2. The isolated DNA of claim 1, wherein said . 
receptor is a mammalian protein • 

5 3. The isolated DNA of claim 1, wherein said 

receptor is a human protein. 

4. The isolated DNA of claim 1, wherein said 
receptor is a rat protein. 

5. The isolated DNA of claim 4, wherein said 
10 receptor has substantially the amino acid sequence of 

MISRl (SEQ ID NO: 14). 

6. The isolated DNA of claim 1, wherein said 
sequence encoding said receptor hybridizes under high 
stringency conditions with the coding sequence of a 

15 plasmid contained in the ATCC deposit designated No. 
75123. 

7. An isolated DNA comprising a 20-nucleotide 
sequence which hybridizes under high stringency 
conditions with the coding sequence of misrl (SEQ ID 

20 NO: 1) . 

8. A cell comprising the isolated DNA of claim 1. 

9. The cell of claim 8, wherein said cell is 
capable of expressing said receptor. 

10. The cell of claim 8, wherein said cell is a 
25 eukaryotic cell. 



wo 93/19177 



PCr/US93/02387 



- 36 - 

11. The isolated DNA of claim 1, wherein said 
sequence encoding said receptor is under the 
transcriptional control of a heterologous promoter. 

12. A substantially pure nucleic acid at least 20 
5 nucleotides in length which hybridizes under high 

stringency conditions to the coding region of a plasmid 
included in the ATCC deposit designated No, 75213. 

13. A vector comprising a nucleotide sequence at 
least 20 nucleotides in length which hybridizes under 

10 high stringency conditions to the coding region of a 
plasmid included in the ATCC deposit designated No. 
75213. 

14. The vector of claim 13, wherein said vector 
is a viral nucleic acid. 

15 15. A substantially pure preparation of an MIS 

receptor protein. 

16. A substantially pxire preparation of a 
polypeptide having an amino acid sequence substantially 
identical to that shown in Fig. 1 (SEQ ID NO: 14) • 

20 17. A substantially pure polypeptide encoded by 

the isolated DNA of claim 7, wherein said isolated DNA 
comprises a 100-nucleotide sequence which hybridizes 
iinder high stringency conditions with the coding sequence 
of misrl (SEQ ID NO: 1). 

25 18. The polypeptide of claim 17, wherein said 

isolated DNA comprises a 1000-nucleotide sequence which 
hybridizes under high stringency conditions with the 
coding sequence of misrl (SEQ ID NO: 1) . 



wo 93/19177 



PCT/US93/02387 



- 37 - 

19. An affinity matrix comprising a polypeptide 
encoded by the isolated DNA of claim 7, wherein said 
isolated DNA comprises a 100-nucleotide sequence which 
hybridizes under high stringency conditions with the 

5 coding sequence of misrl (SEQ ID NO: 1) . 

20. An antibody which forms an immune complex 
with an MIS receptor. 

21. A method of detecting the presence of an MIS 
receptor in a biological sample, said method comprising: 

10 contacting the antibody of claim 20 with a 

biological sample suspected of containing an MIS 

receptor , and 

detecting immune complex formation between said 

antibody and a component of said biological sample, 
15 wherein said immune complex formation is indicative of 

the presence of an MIS receptor in said biological 

sample. 

22. The method of claim 21, wherein said 
biological sample comprises tumor cells. 

20 23. The method of claim 21, wherein said 

biological sample is serum. 

24. A method of determining the level of 
expression of a gene in a biological sample, said method 
comprising: 

25 providing the isolated DNA of claim 1, said 

isolated DNA comprising single stranded antisense DNA; 

contacting, under hybridizing conditions, said 
isolated DNA with a biological sample suspected of 
containing mRNA encoding an MIS receptor; and 



wo 93/19177 



PCr/US93/02387 



- 38 - 

determining the level of hybridization of said 
isolated DNA with said biological sample, said level of 
hybridization being indicative of the level of expression 
in said biological sample of a gene encoding said MIS 
5 receptor . 

25. A method for determining the amount of MIS 
activity in a biological sample, said method comprising: 

providing a substantially pure preparation of an 
MIS receptor or MIS-binding fragment thereof; 
10 contacting said receptor or fragment with a 

biological sample suspected of comprising MIS or a 
biologically active fragment of MIS; and 

determining the amount of receptor/ ligand complex 
formation in said biological sample, said amount of 
15 complex formation being indicative of the amount of MIS 
activity in said biological sample. 

26. An immunotoxin comprising the antibody of 
claim 20 linked to a cytotoxic agent. 

27. The immunotoxin of claim 26, wherein said 
20 antibody is chemically conjugated to said cytotoxic 

agent. 

28. The immunotoxin of claim 26, wherein said 
cytotoxic agent is a polypeptide toxin 

29. Isolated DNA comprising a sequence encoding 
25 an inhibin receptor. 

30. The isolated DNA of claim 29, wherein said 
receptor is a mammalian protein. 



wo 93/19177 



PCT/US93/02387 



- 39 - 

31. The isolated DNA of claim 30, wherein said 
receptor is a human protein. 

32. The isolated DNA of claim 30, wherein said 
receptor is a rat protein. 

5 33. The isolated DNA of claim 30, wherein said 

receptor is MISR2. 

34. A cell comprising the isolated DNA of claim 

29. 

35. The isolated DNA of claim 29, wherein said 
10 sequence hybridizes under high stringency conditions with 

a sense or antisense strand of DNA encoding the amino 
acid sequence given in Fig, 2 (SEQ ID NO: 15) . 

36. The isolated DNA of claim 29, wherein said 
sequence hybridizes under high stringency conditions with 

15 the coding sequence of a plasmid contained in the ATCC 
deposit designated No. 75213. 

37. The isolated DNA of claim 29, wherein said 
sequence encoding said receptor is under the 
transcriptional control of a heterologous promoter. 

20 38- A substantially pure preparation of an 

inhibin receptor. 

39. A substantially pure polypeptide having an 
amino acid sequence substantially identical to that shown 
in Fig. 2 (SEQ ID NO: 15) . 

25 40. A substantially pure polypeptide encoded by 

the isolated DNA of claim 29, wherein said isolated DNA 



wo 93/19177 



PCr/US93/02387 



" 40 - 

comprises a 100-nucleotide sequence which hybridizes 
under high stringency conditions with the coding sequence 
of misr2 (SEQ ID NO: 2). 

41. The polypeptide of claiia 40, wherein said 

5 isolated DNA comprises a 1000-nucleotide sequence which 
hybridizes under high stringency conditions with the 
coding sequence of misr2 (SEQ ID NO: 2) • 

42. An affinity matrix comprising the polypeptide 
of claim 40. 

10 43. An antibody which forms an immune complex 

with an inhibin receptor. 

44. A method of detecting the presence of an 
inhibin receptor in a biological sample, said method 
comprising: 

15 contacting the antibody of claim 43 with a 

biological sample suspected of containing an inhibin 

receptor, and 

detecting immune complex formation between said 

antibody and a component of said biological sample, 
20 wherein said immxine complex formation is indicative of 

the presence of an inhibin receptor in said biological 

sample. 

45. A method for determining the amount of 
inhibin activity in a biological sample, said method 

25 comprising: 

providing a substantially pure inhibin receptor 
protein or inhibin-binding fragment thereof; 

contacting said receptor protein or fragment with 
a biological sample suspected of comprising inhibin or a 
30 biologically active fragment of inhibin; and 



wo 93/19177 



PCr/US93/02387 



- 41 - 

determining the amount of receptor/ ligand complex 
formation in said biological sample, said amount of 
complex formation being indicative of the amount of 
inhibin activity in said biological sample. 

46. An immunotoxin comprising the antibody of 
claim 43 linked to a cytotoxic agent. 

47. Isolated DNA comprising a sequence which 
hybridizes under high stringency conditions with a 
sequence encoding MISR3 (SEQ ID NO: 16). 

48. The isolated DNA of claim 47, wherein said 
sequence encoding MISR3 is misr3 (SEQ ID NO: 3) . 

49. The isolated DNA of claim 47, wherein said 
sequence which hybridizes under high stringency 
conditions encodes a human receptor protein. 

50. The isolated DNA of claim 49, wherein said 
human receptor protein is a bone morphogenic protein 
(BMP) receptor. 

51. A substantially pure polypeptide encoded by 
the isolated DNA of claim 47. 



52. The polypeptide of claim 51, wherein said 
polypeptide is a BMP receptor. 

53. Isolated DNA comprising a sequence which 
hybridizes under high stringency conditions with a 
sequence encoding MISR4 (SEQ ID NO: 17) . 

54. The isolated DNA of claim 53, wherein said 
sequence encoding MISR4 is misr4 (SEQ ID NO: 4) . 



wo 93/19177 



PCr/US93/02387 



- 42 - 

55. The isolated DNA of claim 53, wherein said 
sequence which hybridizes under high stringency 
conditions encodes a hximan receptor protein. 

56. The isolated DNA of claim 55, wherein said 
5 human receptor protein is a bone morphogenic protein 

( BMP ) receptor . 

57. A substantially pure polypeptide encoded by 
the isolated DNA of claim 53. 

58. The polypeptide of claim 57, wherein said 

10 polypeptide is a bone morphogenic protein (BMP) receptor- 



wo 93/19177 



PCT/US93/02387 



1/13 

560 580 600 

atggtcgatggagcaatgatcctttctgtgctaatgatgatggctctcccttccccgagt 
MetValAspGlyAlaMetlleLeuSerValLeuMetMetMetAlaLeuProSerProSer 
620 640 660 

atggaagatgaggagcccaaggtcaacccgaagctttacatgtgtgtgtgtgagggcctc 
MetGluAspGluGluProLysValAsnProLysLeuTyrMetCysValCysGluGlyLeu 
680 700 720 

tcctgcgggaacgaggaccactgtgagggccagcagtgtttttcctccctgagcgtcaat 
SerCysGlyAsnGluAspHisCysGluGlyGlnGlnCysPheSerSerLeuSerValAsn 
740 760 780 

gatggcttccgcgtctaccagaagggctgctttcaggtctatgagcaggggaagatgacg 
AspGlyPheArgValTyrGlnLysGlyCysPheGlnValTyrGluGlnGlyLysMetThr 
800 820 840 

tgtaagaccccgccgtcgcctggccaggctgtggagtgctgccaaggggactggtgcaac 
CysLysThrProProSerProGlyGlnAlaValGluCysCysGlnGlyAspTrpCysAsn 
860 880 900 

aggaacgtcacggcccggctgcccactaaagggaaatccttccctggatcgcagaacttc 
ArgAsnValThrAlaArgLepProThrLysGlyLysSerPheProGlySerGlxAsnPhe 
920 940 960 

cacctggaagttggccttatcatcctctccgtggtgtttgcggtatgccttttcgcttgc 
HisLeuGluValGlyLeuIlelleLeuSerValValPheAlaValCysLeuPheAlaCys 
980 1000 1020 

atccttggcgttgctctcaggaagtttaaaaggcgcaatcaagagcgcctgaaccccaga 
IleLeuGlyValAlaLeuArgLysPheLysArgArgAsnGlnGluArgLeuAsnProArg 

1040 1060 1080 

gacgtggagtacggtactatcgaagggctcatcaccaccaacgtcggagatagcactcta 
AspValGluTyrGlyThrlleGluGlyLeuIleThrThrAsnValGlyAspSerThrLsta 

1100 1120 1140 

gcggaattactagatcactcgtgtacatcaggaagtggctccggtcttccttttctggta 
AlaGluLeuLeuAspHisSerCysThrSerGlySerGlySerGlyLeuProPheLeuVal 

1160 1180 1200 

cagagaactgtggctcgacagataaccctgttggagtgtgtcgggaagggccggtatgga 
GlnArgThrValAlaArgGlnlleThrLeuLeuGluCysValGlyLysGlyArgTyrGly 

1220 1240 1260 

gaagtgtggaggggcagctggcaaggcgaaaatgttgctgtgaagatcttctcctcccgt 
GluValTrpArgGlySerTrpGlnGlyGluAsnValAlaValLysIlePheSerSerArg 

1280 1300 1320 

gatgagaagtcgtggttcagggagacagaattgtacaacacggtgatgctgaggcatgag 
AspGluLysSerTxpPheArgGluThrGliiLeuTyrAsnThrValMetLeuArgHisGlu 

1340 1360 1380 

aatatcttaggtttcattgcttcagacatgacctctagacactccagtacccagctgtgg 
Asnllel^uGlyPhelleAlaSerAspMetThriSerArgHisSerSerThrGlnLeuTrp 

1400 1420 1440 

ctcattacacattaccacgaaatgggatcgttgtatgactaccttcagctcaccactctg 
LeuIleThrHisTyrHisGlxoMetGlySerLeuTyrAspTyrLeuGlnLeuThrThrLeu 

1460 1480 1500 

gacacggttagctgccttcggatcgtgttgtccatagccagcggccttgcacacttgcac 
AspThrValSerCysLeuArglleValLeuSerlleAlaSerGlyLeiiAlaHisLeuHis 

1520 1540 1560 

atagagatatttgggacccaggggaagtctgccatcgcccaccgagatctaaagagcaaa 
IleGluIlePheGlyThrGlnGlyLysSerAlalleAlaHisArgAspLeuLysSerLys 

1580 1600 1620 

aacatcctcgtgaagaagaacggacagtgctgcatagcagatttgggcctggcagtcatg 
Asm leLeuValLysLysAsnGlyGlnCysCysI leAlaAspLeuGlyLeuAlaValMet 

1640 1660 1680 

cattcccagagcacgaatcagcttgatgtgggaaacaacccccgtgtggggaccaagcgc 
HisSerGlftSerThrAsnGlnLeiaAspValGlyAsnAsnProArgValGlyThrLysArg 



wo 93/19177 



PCr/US93/02387 



2/13 



1720 ^^^^ 



T?^Ss2SpPraThrl*uThrSerl^uMaLys^une^ 
2060 

tccctagacaaattaaaaactgactgttga 
SerLeuAspLysLeuLysThrAspCysEna 



wo 93/19177 



PCT/US93/02387 



3/13 
PIG. 2 

10 30 50 

130 150 

190 210 230 

Qacatggagcaccacgtacgcacctgcatccccaaggtggagcttgtgcctgctgggaag 

GlSe?GlSSsHisValA?gThrCysIleProL^ 

' 250 270 290 

cccttctactgcctgagttcagaggacctgcgcaacacgcactgctgctatattga^^^ 
ProPheTyK^sLeuSerSerGluAspLeuArgAsnThrHisCysCysTyrlleAspPhe 

310 330 3S0 

tgcaacaagattgacctgagggtgcccagtggacacctcaaggagcctgagcacccctcc 

370 3S0 «iO 

430 450 470 

atcatcatcatcgtcttcctggtcatcaactatcatcagcgtgtctaccacaaccg^aa 
IlellellelleValPheLeuVallleAsnTyrHisGlnArgValTyrHisAsnArgGln 

490 510 530 

agactggacatggaggacccctcatgtgagatgtgtctctccaaagacaagacgctccag 
Argl^uLpMetGluLpProSerCysGluMetCysLeuSerLysAspLysThrLeuGln 

gatctcgtctacgatctctccacttcaggatcgggctcagggttacccctttttgtccag 
LpLeuValTyrAspLeuSerThrSerGlySerGlySerGlyLsuProLeuPheValGln 

610 630 650 

SSS\^lIlSISSneV^ll^uGlnGlS 

^ 670 690 ■'iO 

730 750 770 

790 810 830 

flSuli^hSiSSSSSSSylSS^S^^ 

850 870 890 

910 930 950 

970 990 1010 

gagattgtgggcactcaggggaagcctggaattgctcatcgagactt^aagtcaaagaac 

GluIleValSyThrGlnGl?LysPro^^^ 

1030 1050 1070 

1090 1110 1130 

gatgctgtcactgacaccatagacatt^tccaaatcagagggtgggaaccaaacgatac 

LiAlaVal-HirLpThrneAspIleAlaProAsnGlnftrgValGlyThrLysArgTyr 



wo 93/19177 



PCT/US93/02387 



4/13 



FIG, 2 CONT. 1150 _ 1170 1190 

atggctcctgaagtacttgacgagaccatcaacatgaagcactttgactccttcaagtgt 
MetAlaProGluValLeuAspGluThrlleAsnMetLysHisPheAspSerPheLysCys 

1210 1230. 1250 

gccgatatctacgccctcgggcttgtctattgggagattgctcggaggtgcaattctgga 
AlaAspIleTyrAlaLeuGlyLeuValTyrTrpGluIleAlaArgArgCysAsnSerGly 

1270 1290 1310 

ggagtccatgaagagtatcaactgccatattatgatttagtgccctctgacccttccatt 
GlyValHisGluGluTyrGlnLeuProTyrTyrAspLeuValProSerAspProSerlle 

1330 1350 1370 

gaggaaatgcgaaaggtcgtctgtgaccagaagctacggcccaatgtccccaactggtgg 
GluGluMetArgLysValValCysAspGlnLysLeuArgProAsnValProAsnTrpTrp 

1390 1410 1430 

cagagttatgaggccttgcgagtgatggggaagatgatgcgggagtgctggtacgccaat 
GlnSerTyrGluAlaLeuArgValMetGlyLysMetMetArgGluCysTrpTyrAlaAsn 

1450 1470 1490 

ggtgctgcccgcctgacagcgctgcgcatcaagaagactttgtcccagctaagcgtgcag 
GlyAlaAlaArgLeuThrAlaLeuArglleLysLysThrLeuSerGlnLeuSerValGln 

1510 

gaagacgtgaagatttaa 
GluJ^spValLys IleEnd 



wo 93/19177 



PCr/US93/02387 



5/13 

PIGo 3 

270 290 310 

atgaccctggggatttttcgaagggtctttttgatgctgtcggtggccttgggcctaact 
MetThrLeuGlyllePheArgArgValPheLeuMetLeuSerValAlaLeuGlyLeuThr 

330 350 370 

aagggagacttggtgaagccctccaggggtcagctggtaaactgcacttgtgagaaccca 
LysGlyAspLeuValLysProSerArgGlyGlnLeuValAsnCysThrCysGluAsnPro 

390 410 430 

cactgcaagaggccaatctgccagggggcatggtgcacagtggtgctagttcgagagcag 
HisCysLysArgProIleCysGlnGlyAlaTrpCysThrValValLeuValArgGluGln 

450 470 490 

ggcaggcacccccaggtctatcggggctgcgggagcctgaaccaggagctctgcctggga 
GlyArgHisProGlnValTyrArgGlyCysGlySerLeiiAsnGlnGluLeuCysLeuGly 

510 530 550 

cgtcccacggagtttgtgaaccatcactgctgctatagatccttctgcaaccacaatgtg 
ArgProThrGluPheValAsnHisHisCysCysTyrArgSerPheCysAsnHisAsnVal 

570 590 610 

tccctgatgctggaggccacccaaactccttcggaggagccagaagtagatgcccatctg 
SerLexoMetLeuGluAlaThrGlnThrProSerGluGluProGluValAspAlaHisLsu 

630 650 S70 

cctctgatcctgggtcccgtgctggccttgctggtcctggtggccctgggcactctgggc 
ProLeuIleLeuGlyProValLeviAlaLeuLeuValLeuValAlaLeuGlyThrLeuGly 

690 710 730 

ttgtggcgtgtccggagaaggcaggagaagcagcggggtctgcacagtgacctgggcgag 
LeuTrpArgValArgArgArgGlnGluLysGlnArgGlyLeuHisSerAspLeuGlyGiu 

750 770 790 

tccagtctcatcctgaaggcatcggaacagggagacagcatgttgggggacttcctggtc 
SerSerLeuIleLeuLysAlaSerGluGlnGlyAspSerMetLeuGlyAspPheLeuVal 

810 830 850 

agcgactgtaccacaggcagcggctcagggctacccttcttggtgcagaggacagtagcg 
SerAspCysThrThrGlySerGlySerGlyLeuProPheLeuValGlnArgThrValAla 

870 890 910 

cgacaggttgcactggtggagtgtgtgggaaagggccgatatggcgaggtgtggcgcggt 
ArgGlnValAlaLeuValGluCysValGlyLysGlyArgTyrGlyGluValTrpArgGly 

930 950 970 

tcgtggcatggcgagagtgtggcggtcaagattttctcctcacgagatgagcagtcctgg 
SerTrpHisGlyGluSerValAlaValLysIlePheSerSerArgAspGluGlnSerTrp 

990 1010 1030 

ttccgggagacagagatctacaacacagttctgcttagacacgacaacatcctaggcttc 
PheArgGluThrGluIleTyrAsnThrValLeuLeuArgHisAspAsnlleLsuGlyPhe 

1050 1070 1090 

atcgcctccgacatgacctcgcggaactccagcacgcagctgtggcttatcacccactac 
IleAlaSerAsi^tThrSerArgAsnSerSerThrGlnLeuTrpLeuIleThrHisTyr 

1110 1130 1150 

caegagcatggctccctctatgactttctgcagaggcagacgctggagccccagttggcc 
HisGluHisGlySerLeuTyrAspPheLeuGlnArgGlnThrLeuGluProGlnLeuAla 

1170 1190 1210 

ctgaggctggctgtgtccgcggcctgcgctggcctggcgcacctgcatgtagagatcttt 
LeuArgLeiiAlaValSerAlaAlaCysAlaGlyLexiAlaHisLeuHisValGluIlePhe 

1230 1250 1270 

ggcactcaaggcaaaccagccatcgcccatcgtgacctcaagagccgcdacgtgctggtc 
GlyThrGlnGlyLysProAlalleAlaHisArgAspLeuLysSerArgAsnValLeuVal 

1290 1310 1330 

aagagcaacttgcagtgttgcattgcagacctgggattggctgtgatgcactcgcaaagc 
Ly sSerAsnLeuGlnCysCys I leAlaAspLeuGlyLeuAlaValMetHisSerGlnSer 

1350 1370 1390 

agcgattacctggacattggtaacaacccccgagtgggtaccaagagatacatggcaccc 
SerAspTyrLetAsplleGlyAsnAsnProArgValGlyThrLysArgTyrMetAlaPro 



wo 93/19177 



PCr/US93/02387 



6/13 



FIG. 3 CONT. 1410 1430 1450 

gaggtgctggatgagcagatccgcacagactgttttgagtcgtacaagtggacagacatc 
GluValLeuAspGluGlnlleArgThrAspCysPheGluSerTyrLysTrpThrAspIle 
1470 1490 1510 

tgggccttcggcttagtgctatgggagattgcccggcggaccatcatcaatggcattgtg 
TrpAlaPheGlyLeuValLeuTrpGluIleAlaArgArgThrllelleAsnGlylleVal 

1530 1550 1570 

gaggactacaggccacccttctatgacatggtacccaatgaccccagttttgaggacatg 
GluAspTyrArgProProPheTyrAspMetValProAsnAspProSerPheGluAspMet 

1590 1610 1630 

aaaaaggtggtgtgtgttgaccagcagacccccaccatccctaaccgactggcagcagat 
LysLysValValCysValAspGlnGlnThrProThrlleProAsnArgLeviAlaAlaAsp 

1650 1670 1690 

ccggtcctctccgggctggcccagatgatgcgagagtgctggtaccccaacccctccgct 
ProValLeuSerGlyLeuAlaGlnMetMetArgGluCysTrpTyrProAsnProSerAla 

1710 1730 1750 

cgcctcaccgcactgcgcataaagaagacattacagaagctcagccagaatccagagaaa 
ArgLeuThrAlaLeiiArglleLysLysThrLeuGlnLysLeuSerGlnAsnProGluLys 

1770 

cccaaagtgattcactag 
ProLysVallleHisEnd 



W093/lI9n7 



PCT/US93/02387 



7/13 

60 80 10 

atggaggcggcgtcggctgctttgcgtcgctgcctgcttctcatcgtgttggtggcggcg 
MetGluAlaAlaSerAlaAlaLeuArgArgCysLeuLeuLeuIleValLeuValAlaAla 
0 120 140 16 

gcgacgctgctcccgggggcgaaggcattacagtgtttctgccacctctgtacaaaggac 
AlaThrLeuLeuProGlyAlaLysAlaLeuGlnCysPheCysHisLeuCysThrLysAsp 
0 180 200 22 

aattttacttgtgagacagatggtctctgctttgtctcagtcaccgagaccacagacaaa 
AsnPheThrCysGluThrAspGlyLeuCysPheValSerValThrGluThrThrAspLys 
0 240 260 28 

gttatacacaatagcatgtgtatagctgaaatcgacctaattccccgagacaggccattt 
VallleHisAsnSerMetCysIleAlaGluIleAspLeuIleProArgAspArgProPhe 
0 300 320 34 

gtttgtgcaccatcttcaaaaacaggggcagttacgtattgctgcaatcaggatcactgc 
ValCysAlaProSerSerLysThrGlyAlaValThrTyrCysCysAsnGlnAspHisCys 
0 360 380 40 

aataaaatagaactcccaactacaggacctttttcagaaaagcagtcagctggcctcggt 
AsnLysIleGluLeuProThrThrGlyProPheSerGluLysGlnSerAlaGlyLeuGly 
0 420 440 ^6 

cctgtggagctggcagctgtcattgctggtccagtctgcttcgtctgcattgcacttatg 
ProValGluLeuAlaAlaVall leAlaGlyProValCysPheValCysI leAlaLeiaMet 
0 480 500 52 

ctgatggtctatatctgccataaccgcactgtcattcaccaccgcgtgccaaatgaagag 
LeuMetValTyrlleCysHisAsnArgThrVallleHisHisArgValProAsnGluGlu 
0 540 560 58 

gatccctcactagatcgccctttcatttcagagggcaccaccttaaaagatttaatttat 
AspPr oSerLeuAspArgProPhe lleSerGluGl yThrThrLeuLy sAspLeuI leTysr 
0 600 620 64 

gatatgacaacatcagggtctggatcaggtttaccactgcttgttcaaagaacaattgca 
Asi^tThrThrSerGlySerGlySerGlyLeuProLeuLeuValGlnArgThrlleAla 
0 660 680 70 

aggaccattgtgctacaagaaagcatcggcaaaggtcggtttggagaagtttggcgaggc 
ArgThrlleValLeuGlnGluSerlleGlyLysGlyArgPheGlyGluValTrpArgGly 
0 720 740 76 

aaatggcggggagaagaagttgccgtgaagataTTCTCTTCTAGAGAAGAACGTTCATGG 
LysTrpArgGlyGluGluValAlaValLysIlePheSerSerArgGluGluArgSerTrp 
0 780 800 82 

TTCCGAGAGGCAGAGATTTATCAGACTGTAATGTTACGCCATGAAAATATCCT<^^ 
PheArgGluAlaGluIleTyrGlnThsrValMetLeuArgHisGluAsnlleLeuGlyPhe 
0 840 860 88 

ATAGCAGCAGACRACAAAGACAATGGTACATGgactcagctgtggttggtgtcggattat 
IleAlaAlaAspAsnLysAspAsnGlyThrTrpThrGlnLeuTspLeuValSerAspTyr 
0 900 920 94 

catgagcatggatcccttttcgattacttgaatagatacactgttactgtggaaggaatg 
HisGluHisGlySerLeuPheAspTyrLeuAsnArgTyrThrValThrValGluGlyHet 
0 960 980 100 

atcaaactcgctctgtccacggcaagtggtcttgcccatcttcacatggagattgttggt 
IleLysLeuAlaLeuSerThrAlaSerGlyLeiiAlaHisLeuHisMetGluIleValGly 
0 1020 1040 106 

acccaaggaaaaccagctattgccCATAGAGATTTGAAATCAAAGAATATCTTGGTC^G 
ThrGlnGlyLysProAlalleAlaHisArgAspLeuLysSerLysAsnlleLeuValLys 
0 1080 1100 112 

AAAAATGGAACXriCTTGTATTGCAGATTTGGGACTTGCTCT 

LysAsnGlyThrCysCysIleAlaAspLeuGlyLexiAlaValArgHisAspSerAlaThr 
0 1140 1160 118 

GATACAATTGATATTGCTCCAAACCACAGAGTAGGCACTAAAAGGtatatggTO^ 
AspThr I leAspI leAlaProAsnHisArgValGl yThrLysArgTyrMetAlaPrcGlu 



wo 93/19177 



PCT/US93/02387 



8/13 



FIG. A CONT- 0 



1200 



1220 



124 



gttctagatgattccataaatatgaaacattttgaatccttcaaacgtgctgacatctat 
ValLeuAspAspSerlleAsnMetLysHisPheGluSerPheLysArgAlaAspIleTvr 



gcaatgggcttagtattctgggaaatcgctcgacgctgttccattggcggaatccacgaa 
AlaMetGlyLeuValPheTrpGluIleAlaArgArgCysSerlleGlyGlylleHisGlu 
0 1320 1340 136 

gactaccagttgccttactatgatcttgtaccttctgatccatccgttgaagaaatgaga 
AspTyrGlnLeuProTyrTyrAspLeuValProSerAspProSerValGluGluMetArg 
0 1380 1400 142 

aaagtagtttgtgaacagaagttaaggccaaatattcccaacagatggcagagctgtgag 
LysValValCysGluGlnLysLeuArgProAsnlleProAsrvArgTrpGlnSerCysGlu 
0 1440 1460 148 

gccttgagagtgatggccaaaattatgagagaatgttggtatgccaatggagcagctagg 
AlaLetArgValMetAlaLysIleMetArgGluCysTrpTyrAlaAsnGlyAlaAlaArg 
0 1500 1520 154 

ctgacagctttgcgaattaaaaaaacattgtcacagctcagccaacaggaaggcatcaaa 
LeuThrAlaLeuArglleLysLysThrLeuSerGlnLeuSerGlnGlnGluGlylleLys 



0 




0 

atgtaa 
MetEnd 



wo 93/19177 



PCr/US93/02387 



9/13 



A. Misrl (BCORI insert size -2.7 specific oligo sequence. 
5'-GTCTACCAGAAGGGCTGCTT-3') (SEQ 1° /<>• J) ...^^ , 
All inserts are in the ECORI site of plasmid pBluescript I 

SK(-). 

B. MISr2a (-1.4 kb, 5 ' -CCGGAGCCTCCTCCTTCTTC-3 ' ) (SEQ ID NO: 6) 



C. MISr2b (-2.1 kb, 5'-TCCCTACTGGGTTTGAGACA-3') (SEQ ID NO: 7) 

D. MISr3 (-3.2 kb, 5'-GCTGCGGGAGCCTGAACCAG-3') (SEQ ID NO: 8) 

E. MISr4 (-2.8 kb. 5'-AAATCCAATGTTTGAATACT-3') (SEQ ID NO: 9) 



FIG. 5 



wo 93/19177 PCr/US93/02387 

10/13 





FIG. 6 



wo 93/19177 



11/13 



PCr/US93/02387 




to 



a 



LLI 



9m9m 

ipiioois I 




t • 



I 
1 

1 
1 



wo 93/19177 



12/13 



PCr/US93/02387 




wo 93/19177 



13/13 



PCr/US93/02387 




.NTERNATIONAL SEARCH REPORT 



Inu .ualional t^licttion No. 
PCTAJS93/02387 



A. CLASSinCATION OF SUBJECT MATTER 

IPC{5) :C12N 15/12, 1/00. 15/63; C07K 13/00, 17/02: C12Q 1/68. 1/00 
US CL :536a3.5, 24^1; 435/69.1, 320.1. 240,1, 6,7.1.7.2:530595 
According to imemaiional Patent Ciassificaiion OPC) or lo both nai ionai classification and IPC 

B. RELPS SEARCHED 

Minimum documentation searched (classification system followed by classification symbols) 
U.S, : 536/23.5. 24.31; 435/69.1. 320.1. 240.1, 6, 7.1. 7.2; 530/395 

Documentstion searched other than minimum documentation to the extent that such documenu are included in the fields searched 



Eleetronic daU base consulted during the international search (name of data base and, where practicable, seareb terms used) 
Please See Extra Sheet 



C. DOCUMENTS CONSIDERED TO BE RELEVANT 



CategOTy* 



Citation of document, with indication, where appropriate, of the idevant passages 



Relevant to claim No. 



Molecular and Cellular Endocrinology, Volume 62, issued 1989, G. 
Lefevre et al., "Anti-idiotypic antibodies to a monoclonal antibody 
raised against anti-MuUerian hormone exhibit anti-Mullerian 
biological activity-, pages 125-133, especially the abstract 

Proceedings of the National Academy of . Sciences of the USA. 
Volume 80, issued March 1983, R. A. Young et al., "Efficient 
isolation of genes by using antibody probes", pages 1194-98, 
especially the abstract. 



M9, 24, 25 



1-19, 24, 25 



B Furtherdocumemsare listtdinthecominuationofBoxC Q See patent family 



tDbepwiof 



hi nr i II r I ■■ II p iili liih nj after fe» 
daa* iod M b fiooniciviik ^ 
pmcipb orifamy iMkr^ 



T 
•0* 

•r 



pybliihed CQ or after Ifae BUMiaOBl filiBf due 

wmy itnm dniba co pffioriqr cfan(t) or wkkk ■ 
ckxA lo alibiiih tte pubbcarioo dat» of KWtbcr ciwiae or other 
maimapttitkd) 

iBfenriDi lo an oiat diackmire. um. athihiiMni or oifaer 



fitiDS< 
lo 



the chinad 

lo nvohfcwi 



corpnoniy 
iibe 



t of paiticukr ntnaaoe; the chined m 
to hnrohrc aa hrvcaihfe aiep wfaca die 
mtbioed wkh ooa or nof* other aiach doa 
faeing ohvkiui to a penoo ikiUod B the ait 



be 
1* 

rn 



Date of the actual completion of the inieinational search 
07 June 1993 


Date of mailing of the international search npon 

14JUN1993 


Name and mailing address of the ISAAIS 
ComnuBaioner of totems and Tndcmafki 
BoxPCT 

Waahmtnon. D.C. 20231 
Facsimile No. NOT APPLICABLE 


AuUionzed officer /T^J. ""^^ - ^ 
DAVID L. Tm^^&^^J^^^^ ^ 
Tetcnhone No, r703) 308-0196 



INTERNATIONAL SEARCH REPORT 



A>«iematioiuU application No. 
PCT/US93/Q2387 



C (Continuation). DOCUMENTS CONSIDERED TO BE RELEVANT 



Catcgoiy* 



Citation of document, wth indication, where appropriate, of the relevant passages 



Relevant to claim No. 



Y 



Y,P 



Journal of Cell Biology, Volume 107, Number 6, part 3, C. S. 
Teng et al., "Identification of the Mullerian Inhibiting Substance 
(MIS) Receptor on tiie Human Tumor Cells", page 71A, abstract 
no. 381. 

US, A, 4,792,601 (Donahoe et al.), 20 December 1988, especially 
col. 16, lines 31-34 

Cell, Volume 65, issued 14 June 1991, L. S. Mathews et al., 
"Expression Cloning of an Activin Receptor, a Predicted 
Transmembrane Soine Kinase", pages 973-982, especially pages 
973 and 979 and Figures 3 and 7 (die misri sequoice exhibits 
52% overall similarity to that of Fig.3 of the referaice, with 
regions of locally higher sequence idoitity). 

Proceedings of the National Academy of Scioices of the USA, 
Volume 78, Number 11, S. V. Suggs et al., "Use of synthetic 
oligonucleotides as hybridization probes: Isolation of cloned 
cDNA sequences for human B2-microglobulin", pages 6613-6617, 
especially die abstract. 

GenBank record no. L02911, entered 29 September 1992, K. 
Matsuzald et al., "Nobel serine-kinase receptor type 1" (die listed 
sequoice exhibits 88% sequence identity to misrl). 



1-19, 24, 25 



1-19, 24-25 



1-6, 7-19, 24, 25 



1-19, 24, 25 



1-19, 24, 25 



Forni PCT/lSA/210 (continuation of second 8heet)(July 1992)* 



INTERNATIONAL SEARCH REPORT 



^ternattonal application No. 
PCTAJS93/02387 



B. FIELDS SEARCHED 

Eiectronic daU bases consulted (Name of data base and where practicable terms used): 

KEYWORD DATABASES: US PTCAPS, Medline. Pascal. CanccrLit. Biosis. Denvent Biotech. Abstracts. Derwent 
WPI 

SEARCH TERMS: MuUerian Inhibit?; Bind?. Ligand. Receptor; Inhib'm; Transforming growth factor beta 
SEQUENCE DATABASES: GenBanlc, GcneScq, EMBL, SwissProt. PIR 

BOX U. OBSERVATIONS WHERE UNITY OF INVENTION WAS LACKING 
This ISA found multiple inventions as follows: 



I. 



IV. 



VI. 



Clauns M9, 24. and 25. drawn to the misrl ctone. vectors, cells, probes, p^des, and h)*ridiz8tion and 
ligand binding assays, classified in U.S. Class 536, subclasses 23^ and 24.31; Class 435, subclasses 320 1 

240.2. 252.3, 6, and 7.6; and Class 530, subclasses 395 and 402. 

Claims 20-23 and 26-28, drawn to MIS receptor antibodies, immunotoxins, and immunoassays, classifi^ in 
U.S. Class 530, subclasses 387.1 and 391.7, and Class 435, subclass 7^1. 

Claims 29^2 and 45. drawn to the misr2 clone, vectors, cells, probes, pq>Udes, and hybridization and tigand 
bmdmg assays, classified in U.S. Class 536, subclasses 23.2 and 24.31 ; Class 435, subclasses 320 1 240 2 

252.3, 6, and 7.6; and Class 530, subclasses 395 and 402. 

Claims 43, 44» and 46, drawn to tnhibin receptor antibodies, immunotoxins, and immunoassays, classified in 
U.S. Class 530, subclasses 387.1 and 391.7, and Class 435, subclass 7^1. 

Claims 47-52, drawn to the misr3 clone, probes, and peptides, classified in U.S. Class 536. subclasses 23 2 
and 24.31, and and Class 530, subclass 395. 

Claims 53-58, drawn to tfve misr4 clone, probes, and peptides, classified in U.S. Class 536, subclasses 23 2 
and 24 J 1, and and Class 530, subclass 395. 



The groups are held to lack unity of invention as follows.' 

The special technical feature of each group is the composition of matter, one of the cbnes misrl , misi2 
nusi3, or misr4, the MIS receptor, or the inhibin reeq)tor. The four misr clones arc disclosed as unique and distinct 
species which are not expected to have subitantiaUy similar property in vivo : each thus defines a unique contribution 
over the pnor art. WhDe misrl is postulated to eneode a MIS receptor and misi2, an inhibin receptor, the assignments 
are putative only, and anUbodies which recognize these receptors are known in the art. The two clones misrl and 
misr2 thus define contributions over the prior art, and unity of invention does not exist between the ckmes and the 
rBcq>torB they are postulated to encode. 



i 



Form PCT/ISA/210 (extra shectKJuly 1992)* 



This Page is Inserted by IFW Indexing and Scanning 
Operations and is not part of the Official Record 

BEST AVAILABLE IMAGES 

Defective images within this document are accurate representations of the original 
documents submitted by the applicant. 

Defects in the images include but are not limited to the items checked: 

□ BLACK BORDERS 

□ IMAGE CUT OFF AT TOP, BOTTOM OR SIDES 
C^TfADED TEXT OR DRAWING 
[^BLURRED OR ILLEGIBLE TEXT OR DRAWING 

□ SKEWED/SLANTED IMAGES 

□ COLOR OR BLACK AND WHITE PHOTOGRAPHS 

□ GRAY SCALE DOCUMENTS 

□ LINES OR MARKS ON ORIGINAL DOCUMENT 

□ REFERENCE(S) OR EXHIBIT(S) SUBMITTED ARE POOR QUALITY 

□ OTHER: . 

IMAGES ARE BEST AVAILABLE COPY. 
As rescanning these documents will not correct the image 
problems checked, please do not report these problems to 
the IFW Image Problem Mailbox.