Skip to main content

Full text of "USPTO Patents Application 09804625"

See other formats


per 



WORLD INTELLECTUAL PROPERTY ORGANIZATION 
international Bureau 




INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCI) 



(51) Internationa] Patent Classiflcation ^ 

C07K 



A2 



(11) International Publication Number: WO 93/16099 

(43) International Publication Date: 19 August 1993 (19.08.93) 



(21) International Application Number: PCT/EP93/O035O 

(22) International Filing Date: 12 February 1993 (12.02.93) 



(30) Priority data: 

92102324.8 12 February 1992(12.02.92) EP 

(34) Countries for which the regional 
or international application 

was filed: DE et al. 



(71) Applicant (for all designated States except US): BIOPHARM 

GESELLSCHAFT 2UR BIOTECHNOLOGISCHEN 
ENTWICKLUNG VON PHARMAKA MBH {DE/ 
DE]; Czemyring 22, D-6900 Heidelberg (DE). 

(72) Inventors; and 

(75) Inventors/Applicants (for US only) : NEIDHARDT, Helge 
[DE/DE]; Otto-Hahn-PIatz 2. D-6900 Heidelberg (DE). 
HOTTEN, Gertrud [DE/DE]; Weihwiesenweg 17, D- 
6919 Bammental (DE). 



(74) Agents: WEICKMANN, H. et al.; KopemikusstraEe 9, D- 
8000 Mflnchen 80 (DE). 



(81) Designated States: AT, AU, BB, BG, BR, CA, CH, CZ, 
DE, DK, ES, FI, GB, HU, JP, KP, KR, LK, LU, MG, 
MN, MW. NL, NO, N2, PL, PT, RO, RU, SD, SE, SK, 
UA, US, European patent (AT, BE, CH, DE, DK, ES, 
FR, GB, GR. IE, IT, LU, MC, NL, PT, SE), OAPI pa- 
tent (BF, BJ, CF, CG. CI, CM, GA. GN, ML, MR, SN, 
TD, TG). 



Published 

Without international search report and to be republished 
upon receipt of that report. 



(54) Title: DNA SEQUENCES ENCODING NOVEL GROWTH/DIFFERENTIATION FACTORS 
(57) Abstract 

The invention provides DNA sequences encoding novel members of the TGF-P family of proteins. The TGF-P family com- 
prises proteins which function as growth and/or differentiation factors and which are useful in medical applications. According- 
ly, the invention also describes the isolation of the above-mentioned DNA sequences, the expression of the encoded proteins, the 
production of said proteins and pharmaceutical compositions containing said proteins. 



FORTHE FVRi'OSES OF INFORMArWN ONLY 

Codes used lo identify Stales pan> lo the PCI on ihc from pages of pamphletb publishinR iniernanonai 
applications under the PCr. 



AT 




FR 


Hrunci; 


MR 


Manritiinia 


AU 


Australia 


CA 


Gabon 


MW 


Malawi 


BB 


Burhailos 


GB 


UnituJ Kingdom 


NL 


Nciticrland^ 


BE 




CN 


Guinea 


NO 


Norway 


BF 


Burkina Humu 


CR 




m 


New /at*! land 


BC 


Bul^uria 


HU 


Hungary 


PL 


Polanil 


BJ 


Benin 


II- 


trulantl 


PT 


Pnrtnttnl 


Bit 


Brii/il 


IT 


Italy 


RO 


Kiiniania 


CA 




JP 




m 


Ku.s:)iaii Kcileratioi) 


CP 


<:cnirjl ATricaii KiipublW 


KP 


I)L-tni>crattv People'.'* Keptit>lii. 


Sl> 


Sudan 


CC 


< "otigo 




ijl Ktireu 




S wet ten 


CH 


Swiucrlunii 


KR 


KepuhttL «f Korea 


SK 


Sloval^ Kepithltc 


CI 


( oti: trtvnirc 


KZ 


Ka;/.;ikliMan 


SN 


Se neural 


CM 


(\inicrtMtit 


I.I 


1 jectiiensiein 


S\) 


Soviet Uni»n 


CS 


( V-cchuslovii Vui 


l.K 


Sri 1 arika 


TD 


« iKld 


CI 


( VciU Kcpuhlii 


I.U 


Ijixenibotir^; 


1C 




DC 


(icrnutny 


MC 


Monaeu 


UA 


Ukraine 


DK 


f>cnm:irk 


Mi; 


MatJaga^L'ar 


US 


UiHieii Slale^ of Atnerii' 


ES 


Spain 


ML 


Mali 


VN 


Vict Nam 


Fl . 


KinlutiU 


MN 


Moni>olia 







wo 93/1 6099 



-1- 



PCr/EP93/00350 



DNA Sequences Encoding Novel Growth/ 
Differentiation Factors 



The present invention relates to DNA sequences encoding novel 
growth/differentiation factors of the TGF-B family. In 
particular, it relates to novel DNA sequences encoding TGF-S- 
like proteins, to the isolation of said DNA sequences, to 
expression plasBiids containing said DNA, to microorganisms 
transformed by said expression plasmid, to the production of 
said protein by culturing said trans formant, and to pharma- 
ceutical compositions containing said protein. The TGF-B 
family of growth factors comprising BMP, TGF, and Inhibin 
related proteins (Roberts and Sporn, Handbook of Experimental 
Pharmacology 95 (1990), 419-472) is of particular relevance 
in a wide range of medical treatments and applications. These 
factors are useful in processes relating to wound healing and 
tissue repair. Furthermore, several members of the TGF-6 
family are tissue inductive, especially osteo-inductive, and 
consequently play a crucial role in inducing cartilage and 
bone development. 

Wozney, Progress in Growth Factor Research 1 (1989), 267-280 
and Vale et al.. Handbook of Experimental Pharmacology 95 
(1990), 211-248 describe different growth factors such as 
those relating to the BMP (bone morphogenetic proteins) and 
the Inhibin group. The members of these groups share 
significant structural similarity. The precursor of the 
protein is composed of an £iminoterminal signal sequence, a 
propeptide and a carboxy terminal sequence of about 110 
eonino acids, which is subsequently cleaved from the precursor 
and represents the mature protein. Furthermore, their members 
are defined by virtue of amino acid sequence homology. The 



SUBSTITUTE SHEET 



wo 93/16099 



PCr/EP93/003S0 



-2- 

mature protein contains the most conserved sequences, 
especially seven cystein residues which are conserved among 
the family members . The TGF-6-like proteins are 
multifunctional, hormonally active growth factors. They also 
share related biological activities such as chemotactic 
attraction of cells, promoting cell differentiation and their 
tissue-inducing capacity, such as cartilage- and bone- 
inducing capacity. U.S. Patent No. 5,013,649 discloses DNA 
sequences encoding osteo-inductive proteins termed BMP-2 
proteins (bone morphogenetic protein), and U.S. patent 
applications serial nos. 179 101 and 179 197 disclose the BMP 
proteins BMP-1 and BMP-3. Furthermore, maiiy cell types are 
able to synthesize TGF-B- like proteins and virtually all 
cells possess TGF-Q receptors. 

Taken together, these proteins show differences in their 
structure, leading to considerable variation in their 
detailed biological function. Furthermore, they are found in 
a wide variety of different tissues and developmental stages. 
Consequently, they might possess differences concerning their 
function in detail, for istance the required cellular 
physiological environment, their lifespan, their targets, 
their requirement for accessory factors, and their resistance 
to degradation. Thus, although numerous proteins exhibiting 
tissue-inductive, especially osteo-inductive potential are 
described, their natural role in the organism and, more 
importantly , their medical relevance must still be elucidated 
in detail. The occurrence of still-unknown members of the 
TGF-S family relevant for osteogenesis or / 
differentiation/induction of other tissues is strongly 
suspected. However, a major problem in the isolation of these 
new TGF-B-like proteins is that their functions cannot yet be 
described precisely enough for the design of a discriminative 
bioassay. On the other hand, the expected nucleotide sequence 
homology to known members of the family would be too low to 



SUBSTITUTE SHEET 



wo 93/16099 



-3- 



PCr/EP93/003S0 



allow for screening by classical nucleic acid hybridization 
techniques. Nevertheless, the further isolation and 
characterization of new TGF-B-like proteins is urgently 
needed in order to get hold of the whole set of induction and 
differentiation proteins meeting all desired medical 
requirements. These factors might find useful medical 
applications in defect healing and treatments of degenerative 
disorders of bone and/or other tissues like, for example, 
kidney and liver. 

Thus, the technical problem underlying the present invention 
essentially is to provide DNA sequences coding for new 
members of the TGF-S protein family having mitogenic and/or 
differentiation-inductive, e.g. osteo-inductive potential. 

The solution to the above technical problem is achieved by 
providing the embodiments characterized in claims 1 to 17. 
Other features and advantages of the invention will be 
apparent from the description of the preferred embodiments 
and the drawings. The sequence listings and drawings will now 
briefly be described. 

SEP ID NO. 1 shows the nucleotide sequence of MP-52, i.e. the 
embryo derived sequence corresponding to the mature peptide 
and most of the sequence coding for the propeptide of MP-52. 

Some of the propeptide sequence at the 5 '-end of MP-52 has 
not been characterized so far. 

SEP ID NO. 2 shows the so far characterized nucleotide 
sequence of the liver-derived sequence MP-121. 

SEP ID NO- 3 shows the amino acid sequence of MP-52 as 
deduced from SEQ ID NO. 1. 



SUBSTITUTE SHEET 



wo 93/16099 PCT/EP93/00350 

-4- 

Fioure 1 shows an alignment of the amino acid sequences of 
MP-52 and MP-121 with some related proteins, la shows the 
alignment of MP-52 with some members of the BMP protein 
family starting from the first of the seven conserved 
cysteins; lb shows the alignment of MP-121 with some members 
of the Inhibin protein family. * indicates that the amino 
acid is the same in all proteins compared; + indicates that 
the amino acid is the same in at least one of the proteins 
compared with MP-52 (Fig, la) or MP-121 (Fig. lb). 

Figure 2 shows the nucleotide sequences of the oligo- 
nucleotide primer as used in the present invention and an 
alignment of these sequences with known members of the TGF-6 
family. M means A or C; S means C or G; R means A or G; and K 
means G or T. 2a depicts the sequence of the primer OD; 2b 
shows the sequence of the primer OID. 

The present invention relates to novel TGF-S-like proteins 
and provides DNA sequences contained in the corresponding 
genes. Such sequences include nucleotide sequences 
comprising the sequence 

ATGAACTCCATGGACCCCGAGTCCACA and 

CTTCTCAAGGCCAACACAGCTGCAGGCACC 
and in particular sequences as illustrated in SEQ ID Nos. 1 
and 2, allelic derivatives of said sequences and DNA 
sequences degenerated as a result of the genetic <:ode for 
said sequences. They also include DNA sequences hybridizing 
under stringent conditions with the DNA sequences mentioned 
above and containing the following amino acid sequences: 

Met-Asn-Ser-Met-Asp-Pro-Glu-Ser-Thr or 

Leu-Leu-Lys-Ala-Asn-Thr-Ala-Ala-Gly-Thr . 

Although said allelic, degenerate and hybridizing sequences 
may have structural divergencies due to naturally occurring 
mutations, such as small deletions or substitutions, they 



SUBSTITUTE SHEEj 



wo 93/16099 



-5- 



PCT/EP93/003S0 



will usually still exhibit essentially the same useful 
properties, allowing their use in basically the same medical 
applications • 

According to the present invention, the term -hybridization- 
means conventional hybridization conditions, preferably 
conditions with a salt concentration of 6 x SSC at 62* to 
66**C followed by a one-hour wash with 0.6 x SSC, 0.1% SDS at 
62** to 66°C. The term "hybridization" preferably refers to 
stringent hybridization conditions with a salt concentration 
of 4 X SSC at 62''-66*»C followed by a one-hour wash with 0.1 x 
SSC, 0.1% SDS at 62**-66'»C. 

Important biological activities of the encoded proteins 
comprise a mitogenic and osteo- inductive potential and can be 
deterxained in assays according to Roberts et al., PNAS 78 
(1981), 5339-5343, Seyedin et al., PNAS 82 (1985), 2267-2271 
or Sampath and Reddi, PNAS 78 (1981), 7599-7603. 

Preferred embodiments of the present invention are DNA 
sequences as defined above and obtainable from vertebrates, 
preferably mammals such as pig or cow and from rodents such 
as rat or mouse, and in particular from primates such as 
hiimans. 

Particularly preferred embodiments of the present invention 
are the DNA sequences termed MP-52 and MP-121 which are shown 
in SEQ ID Nos. 1 and 2. The corresponding transcripts of MP- 
52 were obtained from embryogenic tissue and code for a 
protein showing considerable amino acid homology to the 
mature part of the BMP-like proteins (see Fig. la). The 
protein sequences of BMP2 (-BMP2A) and BMP4 (=BMP2B) are 
described in Wozney et al.. Science Vol 242, 1528-1534 
(1988). The respective sequences of BMP5, BMP6 and BMP7 are 
described in Celeste et al., Proc. Natl. Acad. Sci. USA Vol 87, 



SUBSTITUTE SHEET 



wo 93/16099 



PCT/EP93/00350 



-6- 

9843-9847 (1990). Some typical sequence homologies, which are 
specific to known BMP-sequences only, were also found in the 
propeptide part of MP-52, whereas other parts of the 
precursor part of MP-52 show marked differences to BMP- 
precursors. The mRNA of MP- 121 was detected in liver tissue, 
and its correspondig amino acid sequence shows homology to 
the amino acid sequences of the Inhibin protein chains (see 
Fig. lb). cDNA sequences encoding TGF-S-like proteins have 
not yet been isolated from liver tissue, probably due to a 
low abundance of TGF-B specific transcripts in this tissue. 
In embryogenic tissue, however, sequences encoding known TGF- 
S-like proteins can be found in relative abundance. The 
inventors have recently detected the presence of a collection 
of TGF-B-like proteins in liver as well. The high background 
level of clones related to kown factors of this group 
presents the main difficulty in establishing novel TGF-B- 
related sequences from these and probably other tissues. In 
the present invention, the cloning was carried out according 
to the method described below. Once the DNA sequence has been 
cloned, the preparation of host cells capable of producing 
the TGF-B-like proteins and the production of said proteins 
can be easily accomplished using known recombinant DNA 
techniques comprising constructing the expression plasmids 
encoding said protein and transforming a host cell with said 
expression plasmid, cultivating the transformant in a 
suitable culture medium, and recovering the product having 
TGF-S-like activity. 

Thus, the invention also relates to recombinant molecules 
comprising DNA sequences as described above, optionally 
linked to an expression control sequence. Such vectors may be 
useful in the production of TGF-S-like proteins in stably or 
transiently transformed cells. Several animal, plant, fungal 
and bacterial systems may be employed for the transformation 
and subsequent cultivation process. Preferably, expression 



SUBSTITUTE SHEET 



wo 93/16099 



-7- 



PCT/EP93/003S0 



vectors which can be used in the invention contain sequences 
necessary for the replication in the host cell and are 
autonomously replicable. It is also preferable to use vectors 
containing selectable marker genes which can be easily 
selected for transformed cells. The necessary operation is 
well-known to those skilled in the art. 

It is another object of the invention to provide a host cell 
transformed by an expression plasmid of the invention and 
capable of producing a protein of the TGF-B family. Examples 
of suitable host cells include various eukaryotic and 
prokaryotic cells, such as E. coli, insect cells, plant 
cells, mammalian cells, and fungi such as yeast. 

Another object of the present invention is to provide a 
protein of the TGF-S family encoded by the DNA sequences 
described above and displaying biological features such as 
tissue-inductive, in particular osteo-inductive and/or 
mitogenic capacities possibly relevant to therapeutical 
treatments. The above-mentioned features of the protein might 
vary depending upon the formation of homodimers or 
heterodimers . Such structures may prove useful in clinical 
applications as well. The amino acid sequence of an 
especially preferred protein of the TGF-B-family (MP-52) is 
shown in SEQ ID NO. 3. 

It is a further aspect of the invention to provide a process 
for the production of TGF-B-like proteins. Such a process 
comprises cultivating a host cell being transformed with a 
DNA sequence of the present invention in a suitable culture 
medium and purifying the TGF-B-like protein produced. Thus, 
this process will allow the production of a sufficient amount 
of the desired protein for use in medical treatments or in 
applications using cell culture techniques requiring growth 
factors for their performance. The host cell is obtainable 



SUeSTiTUTE SHEET 



wo 93/16099 



-8- 



PCr/EP93/00350 



from bacteria such as Bacillus or Escherichia coli, from 
fungi such as yeast, from plants such as tobacco, potato, or 
Arabidopsis, and from animals, in particular vertebrate cell 
lines such as the Mo-, COS- or CHO cell line. 

Yet another aspect of the present invention is to provide a 
particularly sensitive process for the isolation of DNA 
sequences corresponding to low abundance rnHNAs in the tissues 
of interest. The process of the invention comprises the 
combination of four different steps. First, the mRNA has to 
be isolated and used in an amplification reaction using 
olignucleotide primers. The sequence of the oligonucleotide 
primers contains degenerated DNA sequences derived from the 
amino acid sequence of proteins related to the gene of 
interest. This step may lead to the amplification of already 
known members of the gene family of interest, and these 
undesired sequences would therefore have to be eliminated. 
This object is achieved by using restriction endonucleases 
which are known to digest the already-analyzed members of the 
gene family. After treatment of the amplified DNA population 
with said restriction endonucleases, the remaining desired 
DNA sequences are isolated by gel electrophoresis and 
reamplified in a third step by an amplification reaction, and 
in a fourth step they are cloned into suitable vectors for 
sequencing. To increase the sensitivity and efficiency, steps 
two and three are repeatedly performed, at least two times in 
one embodiment of this process. 

In a preferred embodiment, the isolation process descril»ed 
above is used for the isolation of DNA sequences from liver 
tissue. In a particularly preferred embodiment of the above- 
described process, one primer used for the PGR experiment is 
homologous to the polyA tail of the mRNA, whereas the second 
primer contains a gene-specific sequence. The techniques 
employed in carrying out the different steps of this process 



SUBSTITUTE SHEET 



wo 93/16099 



-9- 



PCr/EP93/00350 



(such as amplification reactions or sequencing techniques) 
are known to the person skilled in the art and described, for 
instance, in Sambrook et al., 1989, "Molecular Cloning: A 
laboratory manual". Cold Spring Harbor Laboratory Press. 

It is another object of the present invention to provide 
pharmaceutical compositions containing a therapeutically- 
effective amount of a protein of the TGF-B family of the 
present invention. Optionally, such a composition comprises a 
pharmaceutically acceptable carrier. Such a therapeutic 
composition can be used in wound healing and tissue repair as 
well as in the healing of bone, cartilage, or tooth defects, 
either individually or in conjunction with suitable carriers, 
and possibly with other related proteins or growth factors. 
Thus, a therapeutic composition of the invention may include, 
but is not limited to, the MP-52 encoded protein in 
conjunction with the MP-121 encoded protein, and optionally 
with other known biologically-active substances such as EGF 
(epidermal growth factor) or PDGF (platelet derived growth 
factor). Another possible clinical application of a TGF-B- 
like protein is the use as a suppressor of the immune 
response, which would prevent rejection of organ transplants. 
The pharmaceutical composition comprising the proteins of the 
invention can also be used prophylactically, or can be 
(employed in cosmetic plastic surgery. Furthermore, the 
application of the composition is not limited to humans but 
can include animals, in particular domestic animals, as 
well. 

Finally, another object of the present invention is an 
antibody or antibody fragment, which is capable of 
specifically binding to the proteins of the present 
invention. Methods to raise such specific antibody are 
general knowledge. Preferably such an antibody is a 
monoclonal antibody. Such antibodies or antibody fragments 



SUBSTITUTE SHEET 



WO93/16099 



PCr/EP93/00350 



-10- 

might be useful for diagnostic methods. 

The following examples illustrate in detail the invention 
disclosed, but should not be construed as limiting the 
invention • 

Example 1 
Isolation of MP-121 

1.1 Total RNA was isolated from human liver tissue (40-year- 
old-male) by the method of Chirgwin et al.> Biochemistry 
IB (1979), 5294-5299. Poly A* RNA was separated from 
total RNA by oligo (dT) chromatography according to the 
instructions of the manufacturer (Stratagene Poly (A) 
Quick columns ) . 

1.2 For the reverse transcription reaction, poly A* RNA (1- 
2.5 pg) derived from liver tissue was heated for 5 
minutes to 65**C and cooled rapidly on ice. The reverse 
transcription reagents containing 27 U RNA guard 
(Pharmacia), 2.5 }jq oligo d(T),2-i6 (Pharmacia) 5 x 
buffer (250 mM Tris/HCl pH 8.5; 50 mM MgClg ; 50 mM DTT; 
5 mM each dNTP; 600 mM KCl) and 20 units avian 
myeloblastosis virus reverse transcriptase (AMV, 
Boehringer Mannheim) per ^g poly (A*) RNA were added. 
The reaction mixture (25 pi) was incubated for 2 hours 
at 42**C. The liver cDNA pool was stored at -20*0. 

1.3 The deoxynucleotide primers OD and *OID (Fig. 2) designed 
to prime the amplification reaction were generated on an 
automated DNA- synthesizer (Biosearch). Purification was 
done by denaturating polyacrylamide gel electrophoresis 
and isolation of the main band from the gel by 
isotachophoresis . The oligonucleotides were designed by 
aligning the nucleic acid sequences of some known 



SUBSTITUTE SHEEi 



wo 93/16099 



PCr/EP93/003S0 



-11- 

members of the TGF-B family and selecting regions of the 
highest conservation. An alignment of tis region is 
shown in Fig. 2. In order to facilitate cloning, both 
oligonucleotides contained EcoR I restriction sites and 
OD additionally contained an Nco I restristion site at 
its 5' terminus. 

1.4 In the polymerase chain reaction, a liver-derived cDNA 
pool was used as a template in a 50 ^il reaction mixture. 
The amplification was performed in 1 x PCR-buffer (16.6 
mM (NH^)2S0^; 67 mM Tris/HCl pH 8.8; 2 mM MgClg ; 6.7 fiH 
EDTA; 10 mM B-mercaptoethanol; 170 jjq/ml BSA (Gibco)), 
200 each dNTP (Pharmacia), 30 pmol each 
oligonucleotide (OD and OID) and 1.5 units Tag 
polymerase (AmpliTaq, Perkin Elmer Cetus). The PGR 
reaction contained cDNA corresponding to 30 ng of poly 
(A*^ ) RNA as staring material. The reaction mixture was 
overlayed by paraffine and 40 cycles (cycle 1: 808 
93*»C/40s 52^C/40s 72*'C; cycles 2-9: 606 93**C/40s 
52**C/40s 72*»C; cycles 10-29: 60s 93°C/40s 52'»C/60s 
72^C; cycles 30-31: 60s 93<'C/40s 52'»C/90s 72^*0; cycle 
40: 606 93«C/408 52*C/420s 72*»C) of the PGR were 
performed. Six PCR-reaction mixtures were pooled, 
purified by subsequent extractions with equal volumes of 
phenol , phenol /chloroform (1:1 ( v/v ) ) and 
chloroform/isoamylalcohol (24:1 (v/v)) and concentrated 
by ethanol precipitation. 

1.5 One half of the obtained PGR pool was sufficient for 
digestion with the restriction enzymes Sph I (Pharmacia) 
and AlwN I (Biolabs). The second half was digested in a 
series of reactions by the restriction enzymes Ava I 
(BRL), AlwN I (Biolabs) and Tfi I (Biolabs). The 
restriction endonuclease digestions were performed in 
100 fjl at 37^*0 (except Tfi I at 65**C) using 8 units of 



SUBSTiTUTE SHEEl 



wo 93/16099 



PCr/EP93/00350 



-12- 

each enzyme in a 2- to 12-hour reaction in a buffer 
recommended by the manufacturer. 

1.6 Each DNA sample was fractioned by electrophoresis using 
a 4% agarose gel (3% FMC Nusieve agarose, Biozym and 1% 
agarose, BRL) in Tris borate buffer (89 mM Trisbase, 89 
mM boric acid, 2 mM EDTA, pH 8). After ethidiumbromide 
staining uncleaved amplification products (about 200 bp; 
size marker was run in parallel) were excised from the 
gel and isolated by phenol extraction: an equal volume 
of phenols was added to the excised agarose, which was 
minced to small pieces, frozen for 10 minutes, vortexed 
and centrifuged. The aqueous phase was collected, the 
interphase reextracted by the same volume TE-buffer, 
centrifuged and both aqueous phases were combined. DNA 
was further purified twice by phenol /chloroform and once 
by chloroform/isoamylalcohol extraction. 

1.7 After ethanol precipitation, one fourth or one fifth of 
the isolated DNA was reamplified using the same 
conditions used for the primary amplification except for 
diminishing the number of cycles to 13 (cycle 1: 80s 
93*^C/40s 52'*C/40s 72^C; cycles 2-12: 606 93°C/40s 
52'»C/60s 72°C; cycle 13: 60s 93^C/40s 52**C/420s 
72'*C). The reamplif ication products were purified, 
restricted with the same enzymes as above and the 
uncleaved products were isolated from agarose gels as 
mentioned above for the amplification products. The 
reamplif ication followed by restriction and gel 
isolation was repeated once. 

1.8 After the last isolation from the gel, the amplification 
products were digested by 4 units EcoR I (Phaannacia) for 
2 hours at 37**C using the buffer recommended by the 
manufacturer. One fourth of the restriction mixture was 



SUBSTITUTE SHEET 



wo 93/16099 



-13- 



PCT/EP93/003S0 



ligated to the vector pBluescriptll SK+ (Stratagene) 
which was digested likewise by EcoR I. After ligation, 
24 clones from each enzyme combination were further 
analyzed by sequence analysis. The sample restricted by 
AlwN I and Sph I contained no new sequences, only BMP6 
and Inhibin BA sequences. 19 identical new sequences, 
which were named MP- 121, were found by the Ava I, AlwN I 
and Tfi I restricted saonples. One sequence differed from 
this mainly-found sequence by two nucleotide exchanges. 
Ligation reaction and transformation in E. coli HBlOl 
were performed as described in Sambrook et al.. 
Molecular cloning: A laboratory manual (1989). 
Transformants were selected by Ampicillin resistance and 
the plasmid DNAs were isolated according to standard 
protocols (Sambrook et al. (1989)). Analysis was done by 
sequencing the double-stranded plasmids by 
"dideoxyribonucleotide chain termination sequencing" 
with the sequencing kit "Sequenase Version 2.0" (United 
States Biochemical Corporation). 

The clone was completed to the 3' end of the c-DKA by a 
method described in detail by Frohman (Amplifications, 
published by Perkin-Elmer Corporation, issue 5 (1990), 
pp 11-15). The same liver mRNA whioh was used for the 
isolation of the first fragment of MP-121 was reverse 
transcribed using a primer consisting of oligo dT (16 
residues) linked to an adaptor primer 

(AGAATTCGCATGCCATGGTCGACGAAGC(T),^ ) . Amplification was 
performed using the adaptor primer 
(AGAATTC<3CATGCCATGGTCGAG<3) and an internal primer 
(GGCTACGCCATGAACTTCTGCATA) of the MP-121 sequence. The 
amplification products were reamplified using a nested 
internal primer (ACATAGCAGGCATGCCTGGTATTG) of the MP-121 
sequence and the adaptor primer. The reamplif ication 
products were cloned after restriction with Sph I in the 



SUBSTITUTE SHEET 



wo 93/16099 



-14- 



PCr/EP93/003S0 



likewise restricted vector pT7/T3 U19 (Pharmacia) and 
sequenced with the sequencing kit **Sequena6e Version 
2.0" (United States Biochemical Corporation). Clones 
were characterized by their sequence overlap to the 3' 
end of the known HP-1 21 sequence. 



Example 2 
Isolation of MP-52 

A further cDNA sequence, MP-52, was isolated according to the 
above described method (Example 1) by using RNA from human 
embryo (8-9 weeks old) tissue. The PCR reaction contained 
cDNA corresponding to 20 ng of poly (A* )RNA as starting 
material. The reamplif ication step was repeated twice for 
both enzyme combinations. After ligation, 24 clones from each 
enzyme combination were further analyzed by sequence 
analysis. The sample resticted by AlwN I and Sph I yielded a 
new sequence which was named MP-52. The other clones 
comprised mainly BMP6 and one BMP7 sequence. The sample 
restricted by Ava I, AlwN I and Tfi I contained no new 
sequences, but consisted mainly of BMP7 and a few Inhibin flA 
sequences. 

The clone was completed to the 3' end according to the above 
described method (Example 1). The same embryo n^A, which was 
used for the isolation of the first fragment of MP-52, was 
reverse transcribed as in Excimple 1. Amplification was 
performed using the adaptor primer (AGAATTGGCATGCCATGGTCGAG^;) 
and an internal primer (CTTGAGTACGAGGCTTTCCACTG) of the MP-52 
sequence. The amplif i<:ation products were reamplif ied using a 
nested adaptor primer (ATTG<3CATGCCATGGTCGAC<3AAG) and a nested 
internal primer ( GGAGCCCACGAATCATGCAtSTCA ) of the MP-52 
sequence. The reamplif ication products were cloned after 



SUBSTITUTE SHEET 



wo 93/16099 



-15- 



PCr/EP93/003S0 



restriction with Nco I in a likewise restricted vector (pUC 
19 (Pharmacia #27-4951-01) with an altered multiple cloning 
site containing a unique Nco I restriction site) and 
sequenced. Clones were characterized by their sequence 
overlap to the 3' end of the known MP-52 sequence. Some of 
these clones contain the last 143 basepairs of the 3' end of 
the sequence shown in SEQ ID NO: 1 and the 0,56 kb 3' non 
translated region (sequence not shown). One of these was used 
as a probe to screen a human genomic library (Stratagene 
#946203) by a common method described in detail by Ausubel et 
al. (Current Protocols in Molecular Biology, published by 
Greene publishing Associates and Wiley-Interscience (1989)). 
From 8x105 x phages one phage (X 2.7.4) which was proved to 
contain an insert of about 20 kb, was isolated and deposited 
by the DSM (#7387). This clone contains in addition to the 
sequence isolated from mRNA by the described amplification 
methods sequence information further to the 5' end. For 
sequence analysis a Hind III fragment of about 7,5 kb was 
subcloned in a likewise restricted vector (Bluescript SK, 
Stratagene #212206). This plasmid, called SKL 52 (H3) MP12, 
was also deposited by the DSM (# 7353). Sequence information 
derived from this clone is shown in SEQ ID NO: 1. At 
nucleotide No. 1050, the determined cDNA and the respective 
genomic sequence differ by one basepair (cDNA: G; genomic 
DNA: A). We assume the genomic sequence to be correct, as it 
was confirmed also by sequencing of the amplified genomic DNA 
from embryonic tissue which had been used for the mRNA 
preparation. The genomic DNA contains an intron of about 2 kb 
between basepairs 332 and 333 of SEQ ID NO: 1. The sequence 
of the intron is not shown. The correct exon/exon junction 
was confirmed by sequencing an amplification product derived 
from cDNA which comprises this region. This sequencing 
information was obtained by the help of a slightly modified 
method described in detail by Frohman (Amplifications, 
published by Perkin-Elmer Corporation, issue 5 (1990), pp 11- 
15 ) . The same embryo RNA which was used for the isolation of 



SUBSTITUTE SHEET 



wo 93/16099 



-16- 



PCT/EP93/003S0 



the 3' end of MP-52 was reverse transcribed using an internal 
primer of the MP-52 sequence oriented in the 5' direction 
(ACAGCAGGTGGGTGGTGTGGACT) . A polyA tail was appended to the 
5' end of the first strand cDNA by using terminal 
transferase • A two step amplification was performed first by 
application of a primer consisting of oligo dT and an adaptor 
primer (AGAATTCGCATGCCATGGTCGACGAAGC{T,^ ) ) and secondly an 
adaptor primer (AGAATTCGCATGCCATGGTCGACG) and an internal 
primer ( CCAGCAGCCCATCCTTCTCC ) of the MP-52 sequence. The 
amplification products were reamplified using the same 
adaptor primer and a nested internal primer 
(TCCAGGGCACTAATGTCAAACACG) of the MP-52 sequence. 
Consecutively the reamplif ication products were again 
reamplified using a nested adaptor primer 
(ATTCGCATGCCATGGTCGACGAAG) and a nested internal primer 
(ACTAATGTCAAACACGTACCTCTG) of the MP-52 sequence. The final 
reamplification products were blunt end cloned in a vector 
(Bluescript SK, Stratagene #212206) restricted with EcoRV. 
Clones were characterized by their sequence overlap to the 
DNA of X 2.7.4. 

Plasmid SKL 52 (E3) MP12 was deposited under number 7353 at 
DSM (Deutsche Sammlung von Mikroorganismen und Zellkulturen) , 
Mascheroder Weg lb, 3300 Braunschweig, on 10.12.1992. 

Phage X 2.7.4. was deposited under number 7387 at DSM on 
13.1.1993. 



SUBSTITUTE SHEET 



wo 93/16099 



-17- 



PCr/EP93/003S0 



SBQ ID NDs 1 

SEQUEtOI Tl[PBz Nucleobijde 
SEQUENCE I£M9IB: 1207 base pairs 

SITOANDECNESS: double 
roPODGGY: linear 
MXfiCOEi^ TIPEi 

QRIGHIAL SOURCE: - 
QE^GAHESM: human 

IMMEDIA3E EXFERIMENIAL SCXIRCE; Eofaryo tissue 

PROPERTIES: Sequence coding far human TCF-B-like protein (MP-52) 

im3QQOQC3C CCDSAACOCA A30CAQGACA axnOOOCAA ACAAQQCaGS CraCAGCOOG 60 

GACTSTGaOC OCAAAAQGRC AQCTTO00C3S MGCAAQGCA CXXXTAAAfiG CAOffiTCTOr 120 

OOOCftGCroC TICCIQCTGA AGRfiGQCXaG GSAGOOOGSG OOOOCACGftG AGCXX3^AGGA 180 

QOOGUTIUQC OCftDOOOOCA TCftCftOOOCA 0GRGI3O3G dCTOQCror AaOGMQCT 240 

CTOCGATOCT GftCaGAMOS GftOQCAACAG CAGOGIGAAG TTGCaGQCTO <3CXJIQaOCAA 300 

aoaTCACC AGCTTERTTG ACAAAG3QCA ASmaOOGA QSICC30GPaG OEMCSAftQCA 360 

GAQCTAQSTG TTPSACATTA GTQCXi:!K3GA GAAQSKPGQS CIQCIQQQQG OOGRGCTOGG 420 

GRTCrroOQG AAGAftQOOCr CGSOG3GC CAAOXAGCC QCXIXX3QGaS G013G;a:m3L' 480 

TOCXXMCDG AftQCraiCCA QCTOCmaG OQQCmaCAG OCQQQCroCT 'lOl'lOaiGr 540 

GOQCIOOCTG CCftGGOCTGS AOGGftTCIQG CTOOGAGSTG TTOGRCATCT GGAftQCTCIT 600 

00G?WO!TT A?O\ACr0GG GOCAGCTlGiG OCn^GGAGCIG GfiGSeXTrGGS AACGGC99C3»S 660 

CroOGTOGCX: TSGGCTIOG?^ CX3G0G00G0C OGaCaGSia: ADGftGRftSaC 720 

. asnsnocTs GromGocx: oaocAftSA agqggacctg Ticrmftro mktimgqc 780 

OOGCICIGGC CAGGAOGAXTi A3m33?Sm TGAGEAOCTO TIC^OXNSZ GGGGAAAACG 840 

QCX3GQOaCX3V CIXXXX30C Q3C3^^ 900 

CAGTCXSGAAG TCIT^TOICA^ GGftCftTOGGC TGQGAOGACT GSmxreCC 960 

ADOOCTTCAG TRaSCQCIT TOCftCTOCSGA GaGGL' l UUO: GAGPTOCXaT TQOQCiarA 1020 

OCIQGAQOOC AGGAATCKPG CAGTCKK3CA GRDOCTGAIG AACTOCAIQG MQOGGASK! 1080 

CACACCAOCX: MCTQCrrSTG TQOOCftDQOG ^rTCAGTCXX: MOQCMDC ' l L Ti i :A!I'Jj lL aA 1140 

CICTQaCAAC AADCSroSTOT AIAAGCMm TCAGaCATC GTOGIGGAOT aSIGTOGCTG 1200 

C^mCAG 1207 



SUBSTITUTE SHEET 



wo 93/16099 



-18- 



PCr/EP93/00350 



SBO ID NO: 2 

SEQUENCE TYTE: Nucleotide 
SBQUCnZE I£3X?IB: 265 base pairs 

STRANDECNESS: Single 
TOPQODGY: Tiinftar 

TYPE: dXUi to ziiRNA 

ORIGINAL SOURCE: 
QRG?^SM: Buznan 

IMMEDIfi2E EXEERIMEKIMi SOURZE: Liver tissue 
PROPERTIES: Human TGF-B-like protein (MP-121) 



CATOCftGOCT GAQG3CTACG OCMGAACTT CIGCATAGQG CAGIQOOCAC TRCACATAGC 60 

AGGGATGCXrr QGlM'lGglG CXTICCTl'llA O^OTGCI^iGJG CI^^^ TCAftGOOCAA 120 

CfiCft3CTErA CyrACCACTS GfiQQGaaCTC AlOJllJiljlA OOCftOSGirr Gy3n(rnTrT 180 

G1C1CIQ21C TATTATGACA G3GACAQCAA COTTGfrCAAG ACTGACATAC CTGACATOST 240 

AGTAGAG30C lUiGaGPQCA GITAG 265 



SUBSTITUTE SHEET 



wo 93/16099 



-19- 



PCT/EP93/003S0 



SEP ID NOt 3 

SEQOENCB TXFE: Jtanino add 
SEQaENQB LSNSIB: 401 amino aHdw 

ORLGnBiL SOQRCE: - 

ORGANISM: human 

TMMEDnOE EXFERI2>]EKEftL SOURCE: 

PROPERTIES: Human TCF-B-like protein (MP-52) 



K3GPEPKPGB PPQmWR TVTPKQ3IPG GKRPPIKaGBV PSSHIKKKR EPGEFREEKE 60 

PERPEPITPH EXMLSLXREL SDRDRKQGNS SVKIZfiGMN ITltj^ ' mKm UMSPWRgQ 120 

RYVroiSMfi KDGLECftEER UMaTSEOA KEftfiPOOa^A ASEJOiSSCPS GRQEftSLEDV 180 

RSVPGEDGSG WEVTOIWKLF RNEKNSflOLC IIIEAWERGR AVDEKSDGED RAftRQVHEKA 240 

LELVPSRm RULETHEIFA RSQQDDRIVy EYLESQRRKR RRPIAIRQGK HPSKNIKRRC 300 

SRKMBVNEK EM3JDCWIIA EEEXEAFHCE GDCEEEIRSH lEPTOBAVIQ TEMNSMDPES 360 

TEPTOCVPTO ISPKILEID SflNNWXKQy EEMVVESCX3C R 401 



SUBSTITUTE SHEET 



wo 93/ J 6099 



-20" 



PCr/EP93/00350 



Fioure la 

10 20 30 40 50 

MP 52 CSRKarflVNF KDWSWraWII APIZYEAEBC BC3JCEEPLRS HTEPTOHAVI 

BMP 2 LRKUtojyVDF SDUQWNDWIV APPGYHaFYC BGEXSCTIAD EE/JSTOHAIV 

BMP 4 CJ^HSLyVDF SDVGWNDWIV APPGYQAFYC HC2X3^EFLAD EOCTNHAIV 

BMP 5 CKKHELXVSF RDDSWSCWII AEEXSYAAFYG IXSCSFPIIUi HMNA3NHAIV 

BMP 6 CKKHELYVSF QDDGW3EWII APKGYAfiNYC DGECSEmJA HMNAINHAIV 

BMP 7 CKKHELYVSE RDtiS^DWII APBGamC EGECAFPUe YMNKINHAIV 
* + * * * * ** ^ ^ 

60 70 80 90 100 

MP 52 QTELMNSWDPE STFPTOCVPT RLSPISUFI DSftNNWyi^ YECMWESCG CR 

BMP 2 QTLVNSVNS- KIPKfiCCVPT EIJ5AISMLYL DENEKVVLKN YQDMWBGG5G CR 

BMP 4 QTLVNSVNS- SIEKAOCVPT ELSAISMLYL EEYEKWIW^ YQEJ^WEQCG CR 

BMP 5 CTLVHIMEPD HVEKPC3CAPT KIOT^SVLYF DDSSNVm^ YRNMWRSGG CH 

BMP 6 CTLVHIMNPE YVPKPOCAPr KLZC^SVLYF DENSNVIIKK YRNMWRAGG CH 

BMP 7 CTLVHFINPE TVPKPCCAPT QLHAISVLyF DDSSNVIIKK YHNMWRflO; CH 
*** +++ ++ + * ★*+** *★ * * ^^^^ * * 



SUBSTITUTE SHEET 



wo 93/16099 



-21- 



PCT/EP93/003S0 



FiQure lb 

10 20 30 40 50 

MP121 IQPBGJffiMNF CIGQCPIBIA (MPGIAftSEH aaVLKUKBN TMGnXSSS 

InhihfiA lAPSGYmNY" CH3BC3SHIA QISCSSI^ SIVI^^ 

InhiiBB lAPTGYXGNY CBGSCPMLA GVPGSflSSFH TOWNaXKMR GtMP-GTVUS 

Inhiba VXEPSFEFHy CKmSLBIP ^PNESU> VPGfiPPTPAQ PYSLLPCTQP 

+ * ++ + * * * m H + -H- + *++ +++ + + 



+ + 



60 70 80 90 

MP121 OC— VPEiRR ELSLLjnfDRD SNIVRn>-IP EMWEfiOQCS 

InhiiflA Cr— VPTKm PMSMLJfYDDG CmiKKD-VP KMXVEBOGCS 

InhiifiB CC — TPJXLS nMSMLXEDDE XHIVKRD-VP KMI\CTC3QCA 

Inhibot CraftLPGIMR PIflVRTISDG GSfSTKXEIYP NLI/I?pcaCl 

** +*+ + +++ -H-H- +++* +4+ + ++ ♦+*+ 



SUBSTITUTE SHEET 



wo 93/16099 



-22- 



Figure 2a 



OD 

BMP 2 
BMP 3 
BMP 4 
BMP 7 
TGF-Bl 
TCF-62 
TGF-B3 
inhibin a 
inhibin 6^ 
inhibin Bg 



Bco HI Ncx> I 



AQC'ia3QC.'lGQGAMGGIGGAT 



Figure 2b 



Eco RI 

OID AIGAmOG?y3C3GC^^ 

BMP 2 GAGnLlGUOSGGACACftQCA 

BMP 3 CAICmTCIGGIftCAl^^ 

BMP 4 casncAGiGaac^oi^^ 

inhibin a (XXaGSGfiGftGCTOTAZfl^ 

inhibin CMOTCCTGQGCSy:^^ 



SUBSTITUTE SHEET 



wo 93/16099 



-23- 



PCr/EP93/00350 



Claims 

1. A DNA sequence encoding a protein of the TGF-6 family 
selected from the following group: 

(a) a DNA sequence comprising the nucleotides 
ATGAACTCCATGGACCCCGAGTCCACA 

(b) a DNA sequence comprising the nucleotides 
CTTCTCAAGGCCAACACAGCTGCAGGCACC 

(c) DNA sequences which are degenerate as a result of 
the genetic code to the DNA sequences of (a) and 
(b) 

(d) allelic derivatives of the DNA sequences of (a) and 
(b) 

(e) DNA sequences hybridizing to the DNA sequences in 
(a), (b)^ (c) or (d) and encoding a protein 
containing the aminoacid sequence 

Met-Asn-Ser-Met-Asp-Pro-Glu-Ser-Thr 
or 

Leu-Leu-Lys-Ala-Asn-Thr-Ala-Ala-Gly-Thr 

(f ) DNA sequences hybridizing to the DNA sequences in 
(a), (b)^ (c) and (d) and encoding a protein having 
essentially the saone biological properties. 



SUBSTITUTE SHEET 



wo 93/16099 



PCr/EP93/00350 



-24- 

2. The DNA sequence according to claim 1 which is a 
vertebrate DNA sequence, a mammalian DNA sequence, 
preferably a primate, human, porcine, bovine, or rodent 
DNA sequence, and preferably including a rat and a mouse 
DNA sequence « 

3. The DNA sequence according to claim 1 or 2 which is a 
DNA sequence comprising the nucleotides as shown in SEQ 
ID NO* !• 

4. The DNA sequence according to claim 1 or 2 which is a 
DNA sequence comprising the nucleotides as shown in SEQ 
ID NO. 2. 

5. A recombinant DNA molecule comprising a DNA sequence 
according to any one of claims 1 to 4. 

6. The recombinant DNA molecule according to claim 5 in 
which said DNA sequence is functionally linked to an 
expression-control sequence* 

7 . A host containing a recombinant DNA molecule according 
to claim 5 or 6. 

8. The host according to claim 7 which is a bacterium, a 
fungus, a plant cell or an animal cell. 

9. A process for the production of a protein of the TGF-S 
family comprising cultivating a host according to claim 
7 or 8 and recovering said TGF-B protein from the 
culture. 

10. A protein of the TGF-fl family encoded by a DNA sequence 
according to any one of claims 1 to 4. 



SUBSTITUTE SHEET 



wo 93/16099 



-25- 



PCr/EP93/003S0 



11. A protein according to claim 10 comprising the amino 
acid sequence of SEQ ID MO: 3. 

12. A pharmaceutical composition containing a protein of the 
TGF-B family according to claim 10 or 11, optionally in 
combination with a pharmaceutically acceptable carrier. 

13. The pharmaceutical composition according to claim 12 for 
the treatment of various bone, cartilage or tooth 
defects, and for use in wound and tissue repair 
processes. 

14. A process for the production of a cDNA fragment 
comprising purifying mRHA from a tissue, amplifying the 
desired sequences using degenerated related 
oligonucleotides as primers, selecting the desired cDNA 
sequences by digesting undesired amplified cDNA 
sequences using restriction enzymes, amplifying the 
retained cDNA fragments and optionally determining their 
DKA sequence. 

15. An antibody or antibody fragment which is capable of 
specifically binding to a protein of claims 10 or 11. 

16. Antibody or antibody fragment according to claim 15 
which is a monoclonal antibody. 

17. Use of an antibody or antibody fragment according to 
claims 15 or 16 for diagnostic methods. 



SUBSTITUTE SHEET 



wo 93/16099 



1/3 



PCT/EP93/003SO 



Figure la 



10 20 30 40 50 

MP 52 CSRKALHVNF KDMGWDDWII APLEYEAFHC EGLCEFPLRS HLEPTNHAVI 

BMP 2 CkRHPLYVDF SDVGWNDWIV APPGYHAFYC HGECPFPLAD HLNSTNHAIV 

BMP 4 CRRHSLYVDF SDVGWNDWIV APPGYQAFYC HGDCPFPLAD HLNSTNHAIV 

BMP 5 CKKHELYVSF RDLGWQDWII APEGYAAFYC DGECSFPLNA HMNATNHAIV 

BMP 6 CRKHELYVSF QDLGWQDWII APKGYAANYC DGECSFPLNA HMNATNHAIV 

BMP 7 CKKHELYVSF RDLGWQDWII APEGYAAYYC EGECAFPLNS YMNATNHAIV 

* + * * * * ** ***+ *» * *^ * +* * K** + **** 

60 70 80 90 100 

MP 52 QTLMNSMDPE STPPTCCVPT RLSPISILFI DSANNWYKQ YEDMWESCG CR 

BMP 2 CTLVNSVNS- KIPKACCVPT ELSAISMLYL DENEKWLKN YQDMWE<;CG CR 

BMP. 4 QTLVNSVNS- SIPKACCVPT ELSAISMLYL DEYDKWLKN YQEMWE-GC-G. CR 

BMP 5 QTLVHLMFPD HVPKPCCAPT KLNAISVLYF DDSSNVILKK YRNMVVRSC<3 CH 

BMP 6 . QTLVHLMNPE YVPKPCCAPT KLNAISVLYF DDNSNVILKK YRNMWRACG CH 

BMP 7. QTLVHFINPE TVPKPCCAPT QLNAISVLYF DDSSNVILKK YRNMWRACG CH 

*** +++ ++ + * ** + ** *+ ** » * * * * + 



wo 93/16099 



2/3 



PCr/EP93/00350 



MP121 
InhibpA 
InhibPB 
Inhiba 

MP121 
InhibpA 
InhibpB 
Ixihiba 



Figure lb 
10 

IQPEGYAMNF 
lAPSGYHANY 
lAPTGYYGNy 
VYPPSFIFHY 
+ * ++ + 

60 

CC — VPTARR 

CC~VPTKLR 

CC — IPTKLS 

CCAALPGTMR 
** +*+ + 



20 

CIGQCPLHIA 
CEGECPSHIA 
CEGSCPAYLA 
CHGGCGLHIP 
* * *+++++ 

70 

PLSLLYYDRD 
PMSMLYYDDG 
TMSMLYFDDE 
PLHVRTTSDG 
+++ ++++ 



30 

GMPGIAASFH 
GTSGSSLSFH 
GVPGSASSFH 

PNLSLP 

+ ++ + 

80 

SNIVKTD-IP 
QNIIKKD-IQ 
YNIVKRD-VP 
GYSFKYETVP 



40 

TAVLNLLKAN 
STVINHYRMR 
TAWNQYRMR 
VPGAPPTPAQ 
+++ + + 

90 

DMWEACGCS 
NMIVEECGCS 
NMIVEECGCA 
NLLTQHCACI 
+ ++ *+*+ 



50 

TAAGTTGGGS 
GHSPFT^LKS 
GLNP-GTVNS 
PYSLLPGAQP 



wo 93/16099 



3/3 



PCT/EP93/00350 



Figure 2a 



OD 

BMP 2 

BMP 3 

BMP 4 

BMP 7 

TGF-Bl 

TGF-B2 

TGF-B3 

inhibin 

inhibin 

inhibin 



B 



Eco RI Nco ] 

ATGAATTCCCATGGACCTGGGCTGGMAKGAMTGGAT 
ACGTGGGGTGGAATGACTGGAT 
ATATTGGCTGGAGTGAATGGAT 
ATGTGGGCTGGAATGACTGGAT 
ACCTGGGCTGGCAGGACTGGAT 
AGGACCTCGGCTGGAAGTGGAT 
GGGATCTAGGGTGGAAATGGAT 
AGGATCTGGGCTGGAAGTGGGT 
AGCTGGGCTGGGAACGGTGGAT 
ACATCGGCTGGAATGACTGGAT 
TCATCGGCTGGAACGACTGGAT 



Figure 2b 



OID 
BMP 2 
BMP 3 
BMP 4 
BMP 7 
TGF-Bl 
TGF-B2 
TGF-B3 
inhibin a 
inhibin B^ 
inhibin Bg 



£coR 1 

ATGAATTCGAGCTGCGTSGGSRCACAGCA 
GAGTTCTGTCGGGACACAGCA 
CATCTTTTCTGGTACACAGCA 
CAGTTCAGTGGGCACACAACA 
GAGCTGCGTGGGCGCACAGCA 
CAGCGCCTGCGGCACGCAGCA 
TAAATCTTGGGACACGCAGCA 
CAGGTCCTGGGGCACGCAGCA 
CCCTGGGAGAGCAGCACAGCA 
CAGCTTGGTGGGCACACAGCA 
CAGCTTGGTGGGAATGCAGCA 



This Page is Inserted by IFW Indexing and Scanning 
Operations and is not part of the Official Record 

BEST AVAILABLE IMAGES 

Defective images within this document are accurate representations of the original 
documents submitted by the applicant. 

Defects in the images include but are not limited to the items checked: 

□ BLACK BORDERS 

□ IMAGE CUT OFF AT TOP, BOTTOM OR SIDES 
FADED TEXT OR DRAWING 

[^BLURRED OR ILLEGIBLE TEXT OR DRAWING 

□ SKEWED/SLANTED IMAGES 

□ COLOR OR BLACK AND WHITE PHOTOGRAPHS 

□ GRAY SCALE DOCUMENTS 

□ LINES OR MARKS ON ORIGINAL DOCUMENT 

□ REFERENCE(S) OR EXHIBIT(S) SUBMITTED ARE POOR QUALITY 

□ OTHER: : '. 

IMAGES ARE BEST AVAILABLE COPY. 
As rescanning these documents will not correct the image 
problems checked, please do not report these problems to 
the IFW Image Problem Mailbox.