Skip to main content

Full text of "USPTO Patents Application 09804625"

See other formats


per 



WORLD INTELLECTUAL PROPERTY ORGANIZATION 
International Bureau 




INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) 



(51) Inteniational Patent Qassification ^ ; 




(11) International Publication Number: 


WO 93/09229 


C12N 15/12, C12P 21/02 


Al 


A61K 37/02, C12N 5/12 


(43) International Publication Date: 


13 IVlay 1993(13.05.93) 


C07K 15/06 







(21) International Application Number: PCT/US92/09430 

(22) International Filing Date : 2 November 1 992 (02. 1 1 .92) 



(30) Priority data: 
787,496 
864,692 



4 November 1 99 1 (04. 1 1.9 1 ) US 
7 April 1992(07.04.92) US 



(71) Applicant: GENETICS INSTITUTE, INC. [US/US]; 87 

Cambridge Park Drive, Cambridge. MA 02140 (US). 

(72) Inventors: ISRAEL, David ; 117 Anson Road, Concord. 

MA 01742 (US). WOLFMAN, Neil, M, ; 30 Rolling 
Lane, Dover, MA 02030 (US). 

(74) Agent: KAPINOS, Ellen, J.; Genetics Institute, Inc.. 87 
Cambridge Park Drive, Cambridge. MA 02140 (US). 



(81) Designated States: AU. BR, CA, FI, HU. JP, KR, NO, 
RU, European patent (AT, BE, CH, DE, DK, ES. FR, 
GB, GR, IE, IT, LU, MC, NL, SE). 



Published 

With international search report. 



(54) Title: RECOMBINANT BONE MORPHOGENETIC PROTEIN HETERODIMERS, COMPOSITIONS AND METH- 
ODS OF USE 



(57) Abstract 

The present invention relates to methods for producing recombinant heterodimeric BMP proteins useful in the field of 
treating bone defects, healing bone injury and in wound healing in general. The invention also relates to the recombinant heterod- 
imers and compositions containing them. 



FOR THE PURPOSES OF INFORMATION ONLY 



Codes used lo identify States party lo the PCT on the front pages of pamphlets publishing international 
applications under the PCT. 



AT 


Austria 


FR 


France 


AU 


Australia 


GA 


Gabon 


BB 


Barbados 


GB 


United Kingdom 


BE 


Belgium 


GN 


Guinea 


BF 


Burkina Faso 


GR 


Greece 


BG 


Bulgaria 


HU 


Hungary 


BJ 


Benin 


IE 


Ireland 


BR 


Braul 


IT 


Italy 


CA 




JP 


Japan 


CF 


Central African RcpubPic 


KP 


Democratic People's Republic 


CG 


Congo 




of Korea 


CH 


Switzerland 


KR 


Republic of Korea 


a 


Cote d*Ivcirc 


U 


tJcchtenstein 


CM 


Cameroon 


LK 


Sri Lanka 


CS 


Guxboslovakb 


VU 


Luxembourg 


CZ 


Ceecb Republic 


MC 


Monaco 


DE 


Germany 


MC 


Madagascar 


DK 


Denmark 


ML 


Mali 


ES 


Spain 


MN 


Mongolia 


Fl 


Finland 







MR 


Mauritania 




MW 


Malawi 




NL 


Netherlands 




NO 


Norway 




NZ 


New Zealand 




PL 
PT 


Poland 
Portugal 




RO 


Romania 


K 


RU 


Russian Federation 




SO 


Sudan 


S£ 


Sweden 




SK 


Slovak Republic 




SN 


Senegal 




SU 


Soviet Union 




TD 


Chad 




TG 


Togo 




UA 


Ukraine 




US 


United Stales of America 




VN 


Vict Nam 





wo 93/09229 



PCT/US92/09430 



RECOMBINANT BONE MORPHOGENETIC PROTEIN HETERODIMERS , 
COMPOSITIONS AND METHODS OF USE 

Field of the Invention 
5 The present invention relates to a series of 

novel recombinant heterodimeric proteins useful in the 
field of treating bone defects, healing bone injury and 
in wound healing in general. The invention also relates 
to methods for obtaining these heterodimers, methods for 
10 producing them by recombinant genetic engineering 

techniques, and compositions containing them. 

Background of the Invention 

In recent years, protein factors which are 
characterized by bone or cartilage growth inducing 

15 properties have been isolated and identified. See, e.g., 
U. S. Patent No. 5,013,649, PCT published application 
WO90/11366; PCT published application W09 1/05802 and the 
variety of references cited therein. See, also, 
PCT/US90/05903 which discloses a protein sequence termed 

20 OP-1, which is substantially similar to human BMP-7, and 
has been reported to have osteogenic activity. 

A family of individual bone morphogenetic 
proteins (BMPs) , termed BMP-2 through BMP-9 have been 
isolated and identified. Incorporated by reference for 

25 the purposes of providing disclosure of these proteins 



wo 93/09229 



PCr/US92/09430 



2 

and methods of producing them are co-owned, co-pending U. 
S. Patent Application SN 721,847 and the related 
applications recited in its preamble. Of particular 
interest, are the proteins termed BMP-2 and BMP-4, 
5 disclosed in the above-referenced application; BMP-7, 

disclosed in SN 438,919; BMP-5, disclosed in SN 370,547 
and SN 356,033; and BMP-6, disclosed in SN 370,544 and SN 
347,559; and BMP-8, disclosed in SN 525,357. Additional 
members of the BMP family include BMP-1, disclosed in SN 

10 655,578; BMP-9, disclosed in SN 720,590; and BMP-3, 

disclosed in SN 179,197 and PCT publication 89/01464. 
These applications are incorporated herein by reference 
for disclosure of these BMPs. 

There remains a need in the art for other 

15 proteins and compositions useful in the fields of bone 
and wound healing. 
.qiiimiiary of the I nvention 

In one aspect, the invention provides a method 
for producing a recombinant heterodimeric protein having 

20 bone stimulating activity comprising culturing a selected 
host cell containing a polynucleotide sequence encoding a 
first selected BMP or fragment thereof and a 
polynucleotide sequence encoding a second selected BMP or 
fragment thereof. The resulting co-expressed, 

25 biologically active heterodimer is isolated from the 
culture medium. 

According to one embodiment of this invention. 



wo 93/09229 



PCr/US92/09430 



3 

the host cell may be co-transf ected with one or more 
vectors containing coding sequences for one or more BMPs. 
Each BMP polynucleotide sequence may be present on the 
same vector or on individual vectors transfected into the 
5 cell. Alternatively, the BMPs or their fragments may be 
incorporated into a chromosome of the host cell. 
Additionally, a single transcription unit may encode 
single copy of two genes encoding a different BMP. 

According to another embodiment of this 

10 invention, the selected host cell containing the two 
polypeptide encoding sequences is a hybrid cell line 
obtained by fusing two selected, stable host cells, each 
host cell transfected with, and capable of stably 
expressing, a polynucleotide sequence encoding a selected 

15 first or second BMP or fragment thereof. 

In another aspect of the present invention, 
therefore, there are provided recombinant heterodimeric 
proteins comprising a protein or fragment of a first BMP 
in association with a protein or fragment of a second 

20 BMP. The heterodimer may be characterized by bone 

stimulating activity. The heterodimers may comprise a 
protein or fragment of BMP-2 associated with a protein or 
fragment of either BMP-5, BMP-6, BMP-7 or BMP-8; or a 
protein or fragment of BMP-4 associated with a protein or 

25 fragment of either BMP-5, BMP-6, BMP-7 or BMP-8. In 
further embodiments the heterodimers may comprise a 
protein or fragment of BMP-2 associated with a protein or 



wo 93/09229 



PCT/US92/09430 



4 

fragment of either BMP-1, BMP-3 or BMP-4. BMP-4 may also 
form a heterodimer in association with BMP-1, BMP-2 or a 
fragment thereof. Still fvirther embodiments may comprise 
heterodimers involving combinations of BMP-5, BMP-6, BMP- 
5 7 and BMP-8. For example, the heterodimers may comprise 
BMP-5 associated with BMP-6, BMP-7 or BMP-8; BMP-6 
associated with BMP-7 or BMP-8; or BMP-7 associated with 
BMP-8. These heterodimers may be produced by co- 
expressing each protein in a selected host cell and 

10 isolating the heterodimer from the culttire medium. 

. AS a further aspect of this invention a cell 
line is provided which comprises a first polynucleotide 
sequence encoding a first BMP or fragment thereof and a 
second polynucleotide sequence encoding a second BMP or 

15 fragment thereof, the sequences being under control of 
one or more suitable expression regulatory systems 
capable of co-expressing the BMPs as a heterodimer. The 
cell line may be transfected with one or more than one 
polynucleotide molecule. Alternatively, the cell line 

20 may be a hybrid cell line created by cell fusion as 
described above. 

Another aspect of the invention is a 
polynucleotide molecule or plasmid vector comprising a 
polynucleotide sequence encoding a first selected BMP or 

25 fragment thereof and a polynucleotide sequence encoding a 
second selected BMP or fragment thereof. The sequences 
are under the control of at least one suitable regulatory 



wo 93/09229 



PCr/US92/09430 



5 

sequence capable of directing co-expression of each 
protein or fragment. The molecule may contain a single 
transcription unit containing a copy of both genes, or 
more than one transcription unit, each containing a copy 
5 of a single gene. 

As still another aspect of this Invention there 
is provided a method for producing a recombinant dimeric 
or heterodlmerlc protein having bone stimulating activity 
in a prokatyotic cell comprising culturing a selected 

10 host cell containing a polynucleotide sequence encoding a 
first selected BMP or fragment thereof; culturing a 
second selected host cell containing a polynucleotide 
secpaence encoding a second selected BMP or fragment 
thereof; isolating monomeric forms of each BMP protein 

15 from the culture medium and co-assembling a monomer of 
the first protei-n with a monomer of the second protein. 
The first protein and the second protein may be the same 
or different BMPs. The resulting biologically active 
dlmer or heterodlmer is thereafter Isolated from the 

20 mixture. Preferred cells are coll . 

Thus, as further aspects of this Invention 
recombinant BMP dimers or heterodimers produced in 
exikaryotic cells are provided, as well as suitable 
vectors or plasmlds, and selected transformed cells 

25 useful in such a production method. 

Other aspects and advantages of the present 
invention are described further in the following detailed 



wo 93/09229 



PCT/US92/09430 



description of preferred embodiments of the present 
invention. 

prief Descr-iptioP the Ficrures 

Figure 1 provides the DNA and amino acid 
5 sequences of human BMP-2 (SEQ ID NOs: 1 and 2). 

Figure 2 provides the DNA and amino acid 
sequences of human BMP-4 (SEQ ID NOs: 3 and 4) . 

Figure 3 provides the DNA and amino acid 
sequences of hximan BMP-7 (SEQ ID NOs: 5 and 6). 

Figure 4 provides the DNA and amino acid 
sequences of human BMP-6 (SEQ ID NOs: 7 and 8). 

Figure 5 provides the DNA and amino acid 
sequences of human BMP-5 (SEQ ID NOs: 9 and 10) • 

Figure 6 provides the DNA and amino acid 
15 sequences of human BMP-8 (SEQ ID NOs: 11 and 12) . 

Figure 7 provides the DNA sequence of vector 
PALB2-781 containing the mature portoin of the BMP-2 gene 
(SEQ ID NOs: 13 and 14). 

Figiire 8 compares the activity of CHO BMP-2 and 
20 CHO BMP-2/7 in the W20 alkaline phosphatase assay. 

Figure 9 compares the activity of CHO BMP-2 and 
CHO BMP-2/7 in the BGP (osteocalcin) assay. 

Figxire 10 provides a comparison of the W-20 
activity of coli produced BMP-2 and BMP-2/7 

25 heterodimer. 

Figure 11 depicts BMP-3 DNA and amino acid sequence. 
Figure 12 provides a comparison of BMP-2 and BMP-2/6 



wo 93/09229 



PCr/US92/09430 



7 

in the W-20 assay. 

Figure 13 provides a comparison of the in vivo 
activity of BMP-2/6 and BMP-2. 

Figure 14 provides a comparison of BMP-2, BMP-6 and 
5 BMP-2 /€ in vivo activity. 

Detailed Description of the Invention 

The present invention provides a method for 
producing recombinant heterodimeric proteins having bone 
stimulating activity, as well as the recombinant 

10 heterodimers themselves, and compositions containing them 
for bone-stimulating or repairing therapeutic use. 

As used throughout this document, the term 
'heterodimer' is defined as a biologically-active protein 
construct comprising the association of two different BMP 

15 protein monomers or active fragments thereof joined 
through at least one covalent, disulfide linkage. A 
heterodimer of this invention may be characterized by the 
presence of between one to seven disulfide linkages 
between the two BMP component strands. 

20 According to the present invention, therefore, 

a method for producing a recombinant BMP heterodimer 
according to this invention comprises culturing a 
selected host cell containing a polynucleotide sequence 
encoding a first selected BMP or a biologically active 

25 fragment thereof and a polynucleotide sequence encoding a 
second selected BMP or a fragment thereof. The resulting 



wo 93/09229 



PCr/US92/09430 



8 

co-expressed, biologically active heterodiner is formed 
within the host cell, secreted therefrom and isolated 
from the culture medium. Preferred embodiments of 
methods for producing the heterodimeric proteins of this 
invention, are described in detail below and in the 
following examples. Preferred methods of the invention 
involve known recombinant genetic engineering techniques 
[See, e.g., Sambrook et al, "Molecular Cloning. A 
Laboratory Manuals ", 2d edition. Cold Spring Harbor 
Laboratory, Cold Spring Harbor, NY (1989)]. However, 
other methods, such as conventional chemical synthesis 
may also be useful in preparing a heterodimer of this 
invention. 

BMP heterodimers generated by this method are 
produced in a mixtture of homodimers and heterodimers. 
oaiis mixture of heterodimers and homodimers may be 
separated from contaminants in the culture medium by 
resort to essentially conventional methods, such as 
classical protein biochemistry or affinity antibody 
columns specific for one of the BMPs making up the 
heterodimer. Additionally, if desired, the heterodimers 
may be separated from homodimers in the mixture. Such 
separation techniques allow unambiguous determination of 
the activity of the heterodimeric species. Example 4 
provides one presently employed purification scheme for 
this purpose. 

Preferably the recombinant heterodimers of this 



wo 93/09229 



PCr/US92/09430 



9 

invention produced by these methods involve the BMPs 
designated human BMP-2, human BMP-4, hvunan BMP--5, human 
BMP-6, human BMP-7 and BMP-8. However, BMP-3 has also 
been determined to form an active heterodimer with BMP-2. 
5 Other species of these BMPs as well as BMPs than those 
specifically identified above may also be employed in 
heterodimers useful for veterinary, diagnostic or 
research use. However, the human proteins, specifically 
those proteins identified below, are preferred for hxirnan 

10 phazmaceutical uses. 

Human BMP-2 is characterized by containing 
substantially the entire sequence, or fragments, of the 
amino acid sequence and DNA sequence disclosed in Figure 
1. Hiunan BMP-2 proteins are further characterized as 

15 disulfide- linked dimers and homodimers of mature BMP-2 

subunits. Recombinantly-expressed BMP-2 subunits include 
protein species having heterogeneous amino tezrmini« One 
BMP-2 subunit is characterized by comprising amino acid 
#249 (Ser) - #396 (Arg) of Figure l (SEQ ID NOs: 1 and 

20 2) • Another BMP-2 subunit is characterized by comprising 
amino acid #266 (Thr) - #396 (Arg) of Figure 1. Another 
BMP-2 subunit is characterized by comprising amino acid 
#296 (Cys) • #396 (Arg) of Figure 1. A mature BMP-2 
subunit is characterized by comprising amino acid #283 

25 (Gin) - #396 (Arg) of Figure 1. This latter subunit is 

the presently most abundant protein species which results 
from recombinant expression of BMP-2 (Figure 1) . 



wo 93/09229 



PCr/US92/09430 



10 

However, the proportions of certain species of BMP-2 
produced may be altered by manipulating the culture 
conditions. BMP-2 may also include modifications of the 
sequences of Figure 1, e.g., deletion of amino acids 
5 #241-280 and changing amino acid #245 Arg to He, among 

other changes. 

As described in detail in United States Patent 
Application SN 721,847, incorporated by reference herein, 
human BMP-2 may be produced by culturing a cell 

10 transformed with a DNA sequence comprising the nucleotide 
coding sequence from nucleotide #356 to #1543 in Figure 1 
and recovering and purifying from the culture medium one 
or more of the above-identified protein species, 
substantially free from other proteinaceous materials 

15 with which it is co-produced. Human BMP-2 proteins are 
characterized by the ability to induce bone formation. 
Human BMP-2 also has in vitro activity in the W20 
bioassay. Human BMP-2 is further characterized by the 
ability to induce cartilage formation. Human BMP-2 may 

20 be further characterized by the ability to demonstrate 

cartilage and/ or bone formation activity in the rat bone 
formation assay described in the above-referenced 

application . 

Human BMP-4 is characterized by containing 
25 substantially the entire sequence, or fragments, of the 
amino acid sequence and DNA sequence disclosed in Figure 
2 (SEQ ID NOs: 3 and 4) . Human BMP-4 proteins are 



wo 93/09229 



PCT/US92/09430 



11 

further characterized as disulf ide-linked dimers and 
homodimers of mature BMP-4 subunits, Recombinantly- 
expressed BMP-4 subunits may include protein species 
having heterogeneous amino termini. A mature subunit of 
5 himan BMP-4 is characterized by an amino acid sequence 

comprising amino acids #293 (Ser) - #408 (Arg) of Figure 
2. Other amino termini of BMP-4 may be selected from the 
sequence of Figure 2* Modified versions of BMP-4, 
including proteins further truncated at the amino or 

10 carboxy termini, may also be constructed by resort to 
conventional mutagenic techniques. 

As disclosed in above -incorporated patent 
application SN 721,847, BMP-4 may be produced by 
culturing a cell transformed with a DNA sequence 

15 comprising the nucleotide coding sequence from nucleotide 
#403 to nucleotide #1626 in Figure 2 and recovering and 
purifying from the culture medium a protein containing 
the amino acid sequence from amino acid #293 to #408 as 
shown in Figure 2, substantially free from other 

20 proteinaceous materials with which it is co-produced. 

BMP-4 proteins are capable of inducing the formation of 
bone. BMP-4 proteins are capable of inducing formation 
of cartilage. BMP-4 proteins are further characterized 
by the ability to demonstrate cartilage and/ or bone 

25 formation activity in the rat bone formation assay. 

Human BMP-7 is characterized by containing 
substantially the entire sequence, or fragments, of the 



wo 93/09229 



PCT/US92/09430 



12 

amino acid sequence and DNA sequence disclosed in Figure 
3. Human BMP-7 proteins are further characterized as 
disulf ide-linked dimers and homodimers of mature BMP-7 
subunits. Recombinantly-expressed BMP-7 subunits include 
5 protein species having heterogeneous amino termini. One 
BMP-7 subunit is characterized by comprising amino acid 
#293 (Ser) - #431 (His) of Figure 3 (SEQ ID NOs: 5 and 
6) . This subunit is the most abundantly formed protein 
produced by recombinant expression of the BMP-7 sequence. 

10 Another BMP-7 subunit is characterized by comprising 

amino acids #300 (Ser) - #431 (His) of Figure 3. Still 
another BMP-7 subunit is characterized by comprising 
amino acids #316 (Ala) - #431 (His) of Figure 3. Other 
amino termini of BMP-7 may be selected from the sequence 

15 of Figure 3. Similarly, modified versions, including 
proteins further trxincated at the amino or carboxy 
termini, of BMP-7 may also be constructed by resort to 
conventional mutagenic techniques. 

As disclosed in above- incorporated patent 

20 application SN 438,919, BMP-7 may be produced by 
culturing a cell transformed with a DNA sequence 
comprising the nucleotide coding sequence from nucleotide 
#97 to nucleotide #1389 in Figure 3 and recovering and 
purifying from the culture medixim a protein containing 

25 the amino acid sequence from amino acid #293 to #431 as 
shown in Figure 3, substantially free from other 
proteinaceous or contaminating materials with which it is 



wo 93/09229 



PCT/US92/09430 



co-produced • These proteins are capable of stimulating, 
promoting, or otherwise inducing cartilage and/ or bone 
formation. 

Human BMP-6 is characterized by containing 
5 substantially the entire sequence, or fragments, of the 
amino acid sequence and DNA sequence disclosed in Figure 
4. Human BMP-6 proteins are further characterized as 
disulf ide-linked dimers of mature BMP-6 subunits. 
Recombinantly-expressed BMP-6 subunits may include 

10 protein species having heterogeneous amino termini • One 
BMP-6 subunit is characterized by comprising amino acid 
#375 (Ser) - #513 (His) of Figure 4 (SEQ ID NOs: 7 and 
8) . Other amino termini of BMP-6 may be selected from 
the sequence of Figure 4. Modified versions, including 

15 proteins further truncated at the amino or carboxy 

termini, of BMP-6 may also be constructed by resort to 
conventional mutagenic techniques. 

As described in detail in United States Patent 
Application SN 490,033, incorporated by reference herein, 

20 human BMP-6 may be produced by culturing a cell 

transformed with a DNA sec[uence comprising the nucleotide 
coding sequence from nucleotide #160 to #1698 in Figure 4 
and recovering and purifying from the culture medium a 
protein comprising amino acid #375 to #513 of Figure 4, 

25 substantially free from other proteinaceous materials or 
other contaminating materials with which it is co- 
produced. Human BMP-6 may be further characterized by 



wo 93/09229 



PCr/US92/09430 



14 

the ability to demonstrate cartilage and/ or bone 
formation activity in the rat bone formation assay. 

Human BMP-5 is characterized by containing 
substantially the entire sequence, or fragments, of the 
5 amino acid sequence and DNA sequence disclosed in Figure 
5 (SEQ ID NOs: 9 and 10). Human BMP-5 proteins are 
further characterized as disulf ide-linked dimers of 
mature BMP-5 subunits. Recombinant ly-expr ess ed BMP-5 
subunits may include protein species having heterogeneous 

10 amino termini. One BMP-5 subimit is characterized by 

comprising amino acid #329 (Ser) - #454 (His) of Figure 
5. Other amino termini of BMP-5 may be selected from the 
sequence of Figure 5. Modified versions, including 
proteins further truncated at the amino or carboxy 

15 termini, of BMP-5 may also be constructed by resort to 
conventional mutagenic techniques. 

As described in detail in United States Patent 
Application SN 588,227, incorporated by reference herein, 
htiman BMP-5 may be produced by culturing a cell 

20 transformed with a DNA sequence comprising the nucleotide 
coding sequence from nucleotide #701 to #2060 in Figure 5 
and recovering and purifying from the cultxire medium a 
protein comprising amino acid #329 to #454 of Figure 5, 
substantially free from other proteinaceous materials or 

25 other contaminating materials with which it is co- 
produced. Human BMP-5 may be further characterized by 
the ability to demonstrate cartilage and/ or bone 



wo 93/09229 



PCT/US92/09430 



formation activity in the rat bone formation assay 
described in the above-referenced application. 

Hxman BMP-8 is characterized by containing 
substantially the entire sequence, or fragments, of the 
5 amino acid sequence and DNA sequence disclosed in Figure 
6. Human BMP-8 proteins may be further characterized as 
disulf ide-linked dimers of mature BMP-8 subunits. 
Recombinantly-expressed BMP-8 subunits may include 
protein species having heterogeneous amino termini. A 

10 BMP-8 sequence or subujiit sequence comprises amino acid 
#143 (Ala) - #281 (His) of Figure 6 (SEQ ID NOs: 11 and 
12) . Other amino termini of BMP-8 may be selected from 
the sequence of Figure 6. Modified versions, including 
proteins further truncated at the amino or carboxy 

15 termini, of BMP-8 may also be constructed by resort to 
conventional mutagenic techniques. 

As described generally in United States Patent 
Application SN 525,357, incorporated by reference herein, 
and as further described herein, human BMP-8 may be 

20 produced by culturing a cell transformed with a DNA 

sequence comprising the nucleotide coding sequence from 
nucleotide #1 to #850 in Figure 6 and recovering and 
purifying from the culture medium a protein comprising 
amino acid #143 to #281 of Figure 6, or similar amino 

25 acid sequences with heterogenous N-termini, substantially 
free from other proteinaceous materials or other 
contaminating materials with which it is co-produced. 



wo 93/09229 



PCr/US92/09430 



16 

This BMP-8 may also be produced in E. cp^j by inserting 
into a vector the sequence encoding amino acid #143 to 
281 of Figure 6 with a Met inserted before amino acid 
#143. Hiiman BMP-8 may be further characterized by the 
5 ability to demonstrate cartilage and/ or bone formation 
activity in the rat bone formation asisay. 

Each above described BMP protein in its native, 
non-reduced dimeric form may be further characterized by 
an apparent molecular weight on a 12% Laemmli gel ranging 

10 between approximately 28kD to approximately 40kD. 

Analogs or modified versions of the DNA and amino acid 
sequences described herein which provide proteins or 
active fragments displaying bone stimulating or repairing 
activity in the rat bone formation assay described below 

15 in Example 9, are also classifed as suitable BMPs for use 
in this invention, further provided that the proteins or 
fragments contain one or more cys residues for 
participation in disulfide linkages. Useful 
modifications of these sequences may be made by one of 

20 skill in the art with resort to known recombinant genetic 
engineering techniques. Production of these BMP 
sequences in mammalian cells produces homodimers, 
generally mixtvires of homodimers having heterologous N 
termini. Production of these BMP sequences in E.coli 

25 produces monomeric protein species. 

Thus, according to this invention one 
recombinant heterodimer of the present invention 



wo 93/09229 



PCr/US92/09430 



17 

comprises the association of a hxiinan BMP-2, including, 
e.g., a monomer ic strand from a mature BMP-2 subunit as 
described above or an active fragment thereof, bound 
through one or up to seven covalent, disulfide linkagies 
5 to a human BMP-5 including, e.g., a monomeric strand from 
a mature BMP-5 subunit as described above or an active 
fragment thereof. Another recombinant heterodimer of the 
present invention comprises the association of a hxuaan 
BMP-2, as described above, bound through one or up to 

10 seven covalent, disulfide linkages to a human BMP-6, 

including, e.g., a monomeric strand from a BMP-6 subunit 
as described above or an active fragment thereof. 
Another recombinant heterodimer of the present invention 
comprises the association of a hximan BMP-2, as described 

15 above, bound through one or up to seven covalent, 

disulfide linkages to a human BMP-7, including, e.g., a 
monomeric strand of a BMP-7 subunit as described above or 
an active fragment thereof. Another recombinant 
heterodimer of the present invention comprises the 

20 association of a human BMP-2, as described above, bound 
through one or up to seven covalent, disulfide linkages 
to a human BMP-8, including, e.g., a monomeric strand of 
a BMP-8 subunit as described above or an active fragment 
thereof . 

25 Still another recombinant heterodimer of the 

present invention comprises the association of a human 
BMP-4, including, e.g., a monomeric strand of a BMP-4 



wo 93/09229 



PCr/US92/09430 



18 

subimit as described above or an active fragment thereof, 
bound through one or up to seven covalent, disulfide 
linkages to a human BMP-5, as described above. Another 
recombinant heterodimer of the present invention 
comprises the association of a human BMP-4, as described 
above, bound through one or more covalent, disulfide 
linkages to a human BMP-6, as described above. Another 
recombinant heterodimer of the present invention 
comprises the association of a human BMP-4, as described 
above bound through one or more covalent, disulfide 
linkages to a human BMP-7, as described above. Another 
recombinant heterodimer of the present invention 
comprises the association of a human BMP-4, as described 
above, bound through one or more covalent, disulfide 
linkages to a human BMP-8, as described above. 

A further recombinant heterodimer of the 
present invention . comprises the association of a human 
BMP-2, including, e.g., a monomer ic strand from a mature 
BMP-2 subunit as described above or an active fragment 
thereof, bound through at least one disulfide linkage to 
a human BMP-3 including, e.g., a monomeric strand from a 
mat\ire BMP-3 subunit as described above or an active 
fragment thereof. Another recombinant heterodimer of the 
present invention comprises the association of a human 
BMP-2, as described above, bound through at least one 
disulfide lirdcage to a human BMP-4, including, e.g., a 
monomeric strand from a BMP-4 subunit as described above 



wo 93/09229 



PCT/US92/09430 



19 

or an active fragment thereof. Another recombinant 
heterodimer of the present invention comprises the 
association of a hximan BMP-5, as described above, bound 
through at least one disulfide linkage to a human BMP-6, 
5 including, e.g., a monomer ic strand of a BMP-6 subunit as 
described above or an active fragment thereof. Another 
recombinant heterodimer of the present invention 
comprises the association of a human BMP-^5, as described 
above, bound through at least one disulfide linkage to a 

10 human BMP-7, including, e.g., a monomer ic strand of a 
BMP-7 subunit as described above or an active fragment 
thereof. In addition, hximan BMP-5 may be associated with 
human BMP-8 bound through at least one disulfide linkage 
to a human BMP-8 subunit or active fragment thereof. 

15 Still another recombinant heterodimer of the 

present invention comprises the association of a himan 
BMP-6, including, e.g., a monomer ic strand of a BMP-6 
subunit as described above or an active fragment thereof, 
bound through at least one disulfide linkage to a h\iman 

20 BMP-7, as described above. Another recombinant 

heterodimer of the present invention comprises the 
association of a human BMP-6, as described above, bound 
through one or more covalent, disulfide linkages to a 
human BMP-8, as described above. Another recombinant 

25 heterodimer of the present invention comprises the 

association of a human BMP-7 , as described above bound 
through one or more covalent, disulfide linkages to a 



wo 93/09229 



PCr/US92/09430 



20 

humeoi BMP-8, as described above. 

The disulfide linkages formed between the 
monomeric strands of the BMPs may occur between one Cys 
on each strand. Disulfide linkages may form between two 
5 cys on each BMP. Disulfide linkages may form between 
three Cys on each BMP. Disulfide linkages may form 
between four Cys on each BMP. Disulfide linkages may 
form between five C^s on each BMP. Disulfide linkages 
may form between six Cys on each BMP. Disulfide linkages 

10 may form between seven Cys on each BMP. These disulfide 
linkages may form between adjacent Cys on each BMP or 
between only selected Cys interspersed within the 
respective protein sequence. Various heterodimers having 
the same BMP component strands may form with different 

15 numbers of disulfide linkages. Various heterodimers 
having the same BMP component strands may form with 
disulfide bonds at different Cys locations. Different 
heterodimers encompassed by this invention having the 
same BMP components may differ based upon their 

20 recombinant production in mammalian cells, bacterial 
cells, insect or yeast cells. 

These recombinant heterodimers may be 
characterized by increased alkaline phosphatase activity 
in the W20 mouse stromal cell line bioassay (Example 8) 

25 compared to the individual BMP homodimers, one strand of 
which forms each heterodimer. Further, these 
heterodimers are characterized by greater activity in the 



wo 93/09229 



PCr/US92/09430 



21 

W20 bioassay than is provided by simple mixtures of the 
individual BMP dimers. Preliminary characterization of 
heterodimers measured on the W20 bioassay have 
demonstrated that heterodimers of BMP-2 with BMP-5, BMP-6 
5 or BMP-7 are very active. Similarly, heterodimers of 

BMP-4 with BMP-5, BMP-6 or BMP-7 are strongly active in 
the W20 bioassay. 

Heterodimers of this invention may also be 
characterized by activity in bone growth and stimulation 

10 assays. For example, a heterodimer of this invention is 
also active in the rat bone formation assay described 
below in Example 9. The heterodimers are also active in 
the osteocalcin bioassay described in Example 8. Other 
characteristics of a heterodimer of this invention 

15 include co-precipitation with anti-BMP antibodies to the 
two different constituent BMPs, as well as characteristic 
results on Western blots, high pressure liquid 
chromatography (HPLC) and on two-dimensional gels, with 
and without reducing conditions. 

20 One embodiment of the method of the present 

invention for producing recombinant BMP heterodimers 
involves culturing a suitable cell line, which has been 
co-transf ected with a DNA sequence coding for expression 
of a first BMP or fragment thereof and a DNA sequence 

25 coding for expression of a second BMP or fragment 

thereof, under the control of known regulatory sequences. 
The transformed host cells are cultured and the 



wo 93/09229 



PCr/US92/09430 



10 



22 

heterodimeric protein recovered and purified from the 

culture nediun. 

In another embodiment of this method which is 
the presently preferred method of expression of the 
heterodimers of this invention, a single host cell, e.g. , 
a CHO DUKX cell, is co-transf ected with a first DNA 
molecule containing a DNA sequence encoding one BMP and a 
second DNA molecule containing a DNA sequence encoding a 
second selected BMP. One or both plasmids contain a 
selectable marker that can be used to establish stable 
cell lines expressing the BMPs. These separate plasmids 
containing distinct BMP genes on seperate transcription 
units are mixed and transf ected into the CHO cells using 
conventional protocols. A ratio of plasmids that gives 
15 maximal expression of activity in the W20 assay, 
generally, 1:1, is determined. 

For example, as described in detail in Example 
3, equal ratios of a plasmid containing the first BMP and 
a dihydrofolate reductase (DHFR) marker gene and another 
20 plasmid containing a second BMP and a DHFR marker gene 

can be co-introduced into DHFR-def icient CHO cells, DDKX- 
BII, by calcitm phosphate coprecipitation and 
transfection, electroporation, microinjection, protoplast 
fusion or lipofection. Individual DHFR expressing 
25 transformants are selected for growth in alpha media with 
dialyzed fetal calf serum by conventional means. DHFR+ 
cells containing increased gene copies can be selected 



wo 93/09229 



PCr/US92/09430 



23 

for propagation in increasing concentrations of 
methotrexate (MTX) (e.g. sequential steps in 0.02, 0.1, 
0.5 and 2.0 viM MTX) according to the procedures of 
Kaufman and Sharp, J. Mol. Biol. . 159:601-629 (1982); and 
5 Kaufman et al, Mol. Cell Biol. . 5:1750 (1983). 

Expression of the heterodimer or at least one BMP linked 
to DHFR should increase with increasing levels of MTX 
resistance. Cells that stably express either or both 
BMP/DHFR genes will survive. However at a high 

10 frequency, cell lines stably incorporate and express both 
plasmids that were present during the initial 
transfection. The conditioned medium is thereafter 
harvested and the heterodimer isolated by conventional 
methods and assayed for activity. This approach can be 

15 employed with DHFR-def icient cells. 

As an alternative embodiment of this method, a 
DNA molecule containing one selected BMP gene may be 
transfected into a stable cell line which already 
expresses another selected BMP gene. For example as 

20 described in detail in Example 3 below, a stable CHO cell 
line expressing BMP-7 with the DHFR marker (designated 
7MB9) [Genetics Institute, Inc] is transfected with a 
plasmid containing BMP-2 and a second selectable marker 
gene, e.g., neomycin resistance (Neo) . After 

25 transfection, the cell is cultured and suitable cells 

selected by treatment with MTX and the antibiotic, G-418. 
Surviving cells are then screened for the expression of 



wo 93/09229 



PCT/US92/09430 



24 

the heterodimer. This expression system has the 
advantage of permitting a single step selection. 

Alternative dual selection strategies using 
different cell lines or different markers can also be 
5 used. For example, the use of an adenosine deaminase 

(ADA) marker to amplify the second BMP gene in a stable 
CHO cell line expressing a different BMP with the DHFR 
marker may be preferable, since the level of expression 
can be increased using decxycoformycin (DCF) -mediated 
10 gene amplification. (See the ADA containing plasmid 
described in Example 1) . Alternatively, any BMP cell 
line made by first using this marker can then be the 
recipient of a second BMP expression vector containing a 
distinct marker and selected for dual resistance and BMP 

15 coe3q)ression. 

Still another anbodiment of a method of 
expressing the heterodimers of this invention includes 
transf ecting the host cell with a single DNA molecule 
encoding multiple genes for expression either on a single 

20 transcription unit or on separate trsmscription units. 

Multicistronic expression involves multiple polypeptides 
encoded within a single transcript, which can be 
efficiently translated from vectors utilizing a leader 
sequence, e.g. , from the EMC virus, from poliovirus, or 

25 from other conventional sources of leader sequences. Two 
BMP genes and a selectable marker can be expressed within 
a single transcription unit. For example, vectors 



wo 93/09229 



PCT/US92/09430 



25 

containing the configuration BMPx-EMC-BMPy-DHFR or BMPx- 
EMC-BMPy-EMC-DHFR can be transfected into CHO cells and 
selected and amplified using the DHFR marker. A plasmid 
may be constructed which contains DNA sec[uences encoding 
5 two different BMPs, one or more marker genes and a 
suitable leader or regulatory sequence on a single 
transcription unit. 

Similarly > host cells may be transfected with a 
single plasmid which contains separate transcription 

10 units for each BMP. A selectable marker, e.g., DHFR, can 
be contained on a another transcription unit, or 
alternatively as the second cistron on one or both of the 
BMP genes. These plasmids may be transfected into a 
selected host cell for expression of the heterodimer, and 

15 the heterodimer isolated from the cells or culture medium 
as described above. 

Another embodiment of this expression method 
involves cell fusion. Two stable cell lines which 
express selected BMPs, such as a cell line expressing 

20 BMP-2 (e.g., 2EG5) and a cell line expressing BMP-7 
(e.g., 7MB9), developed using the DHFR/MTX gene 
amplification system and expressing BMP at high levels, 
as described in Example 1 and in the above incorporated 
U^S. applications, can be transfected with one of several 

25 dominant marker genes (e.g., neo', hygromycin', GPT) . 

After sufficient time in coculture (approximately one 
day) one resultant cell line expressing one BMP and a 



wo 93/09229 



PCr/US92/09430 



26 

dominant marker can be fused with a cell line expressing 
a different BMP and preferably a different marker using a 
fusigenic reagent, such as polyethylene glycol, Sendai 
virus or other known agent. 
5 The resulting cell hybrids expressing both 

dominant markers and DHFR can be selected using the 
appropriate cultiire conditions, and screened for 
coexpression of the BMPs or their fragments. The 
selected hybrid cell contains sequences encoding both 

10 selected BMPs, |ind the heterodimer is formed in the cell 
and then secreted. The heterodimer is obtained from the 
conditioned medium and isolated and purified therefrom by 
conventional methods (see e.g.. Example 4). The 
resulting heterodimer may be characterized by methods 

15 described herein. 

Cell lines generated from the approaches 
described above can be used to produce co-expressed, 
heterodimeric BMP polypeptides. The heterodimeric 
proteins are isolated from the cell medixim in a form 

20 substantially free from other proteins with which they 

are co-produced as well as from other contaminants found 
in the host cells by conventional purification 
techniques. The presently preferred method of production 
is co-transfection of different vectors into CHO cells 

25 and methotrexate-mediated gene amplification. Stable 
cell lines may be used to generate conditioned media 
containing recombinant BMP that can be purified and 



wo 93/09229 



PCT/US92/09430 



27 

assayed for in vitro and in vivo activities. For 
example, the resulting heterodimer-producing cell lines 
obtained by any of the methods described herein may be 
screened for activity by the assays described in Examples 
5 8 and 9, RNA expression, and protein expression by sodium 
dodecyl sulfate polyacrylamide gel electrophoresis (SDS- 
PAGE) . 

The above-described methods of co-expression of 
the heterodimers of this invention utilize suitable host 
10 cells or cell lines. Suitable cell preferably include 
mammalian cells, such as Chinese hamster ovary cells 
(CHO) • The selection of suitable mammalian host cells 
and methods for transformation, -culture, amplification, 
screening and product production and purification are 
known in the art. See, e.g., Gething and Sambrook, 
Nature, 293 :620-625 (1981), or alternatively, Kaufman et 
al, Mol. Cell. Biol. . 5(7) : 1750-1759 (1985) or Howley et 
al, U. S. Patent 4,419,446. Other suitable mammalian 
cell lines are the CV-l cell line, BHK cell lines and the 
293 cell line. The monkey COS-1 cell line is presently 
believed to be inefficient in BMP heterodimer production. 

Many strains of yeast cells known to those 
skilled in the art may also be available as host cells 
for expression of the polypeptides of the present 
invention, e.g., Saccharomvces cerevisiae . Additionally, 
where desired, insect cells may be utilized as host cells 
in the method of the present invention. See, e.g.. 



wo 93/09229 



PCr/US92/09430 



28 

Miller et al, ffi<=>Tie-bic En gineering. 8:277-298 (Plenum 
Press 1986) and references cited therein. 

Another method for producing a biologically 
active heterodimeric protein of this invention may be 
employed where the host cells are microbial, preferably 
bacterial cells, in particular coli. For example, the 
various strains of E. coli (e.g., HBlOl, MC1061) are 
well-known as host cells in the field of biotechnology. 
Various strains b. subtil is . pgeudomonas. other 
bacilli and the like may also be employed in this method. 

This method, which may be employed to produce 
monomers and dimers (both homodimers and heterodimers) is 
described in European Patent Application No. 433,225, 
incorporated herein by reference. Briefly, this process 
involves culturing a microbial host comprising a 
nucleotide sequence encoding the desired BMP protein 
linked in the proper reading frame to an expression 
control sequence which permits expression of the protein 
and recovering the monomeric, soluble protein. Where the 
protein is insoluble in the host cells, the water- 
insol\ible protein fraction is isolated from the host 
cells and the protein is solubilized. After 
chromatographic purification, the solvibilized protein is 
subjected to selected conditions to obtain the 
biologically active dimeric configuration of the protein. 
This process, which may be employed to produce the 
heterodimers of this invention, is described specifically 



wo 93/09229 



PCr/US92/09430 



29 

in Example 7, for the production of a BMP-2 homodimer. 

Toother aspect of the present invention 
provides DNA molecules or plasmid vectors for use in 
expression of these recombinant heterodimers . These 
5 plasmid vectors may be constructed by resort to known 

methods and available components known to those of skill 
in the art. In general, to generate a vector useful in 
the methods of this invention, the DNA encoding the 
desired BMP protein is transferred into one or more 
10 appropriate expression vectors suitable for the selected 
host cell. 

It is presently contemplated that any 
expression vector suitable for efficient expression in 
mammalian cells may be employed to produce the 

15 recombinant heterodimers of this invention in mammalian 
host cells. Preferably the vectors contain the selected 
BMP DNA sequences described above and in the Figures, 
which encode selected BMP components of the heterodimer. 
Alternatively, vectors incorporating modified sequences 

20 as described in the above-referenced patent applications 
are also embodiments of the present invention and useful 
in the production of the vectors. 

In addition to the specific vectors described 
in Example 1, one skilled in the art can construct 

25 mammalian expression vectors by employing the sequence of 
Figures 1-6 or other DNA sequences containing the coding 
sequences of Figures 1-6 (SEQ ID NOs: 1, 3, 5, 7, 9 and 



wo 93/09229 



PCrAJS92/09430 



30 

11), or other modified sequences and known vectors, such 
as pCD [Okayama et al, Mni . Cell Biol. . 2:161-170 (1982)] 
and pJL3, pJL4 [Gough et al, EMBO J.. 4:645-653 (1985)]. 
The BMP DNA sequences can be modified by removing the 
5 non-coding nucleotides on the 5' and 3' ends of the 

coding region. The deleted non-coding nucleotides may or 
may not be replaced by other sequences known to be 
beneficial for expression. The transformation of these 
vectors into appropriate host cells as described above 

10 can produce desired heterodimers. 

One skilled in the art could manipulate the 
sequences of Figures 1-6 by eliminating or replacing the 
mammalian regulatory sequences flanking the coding 
sequence with e.g., yeast or insect regulatory sequences, 

15 to create vectors for intracellular or extracellular 
expression by yeast or insect cells. [See, e.g., 
procedures described in published European Patent 
Application 155,476] for expression in insect cells; and 
procedures described in published PCT application 

20 WO86/00639 and European Patent Application EPA 123,289 
for ea^ression in yeast cells] . 

Similarly, bacterial sequences and preference 
codons may replace sequences in the described and 
exemplified mammalian vectors to create suitable 

25 expression systems for use in the production of BMP 

monomers in the method described above. For example, the 
coding sequences could be further manipulated (e.g.. 



wo 93/09229 



PCT/US92/09430 



31 

ligated to other known linkers or modified by deleting 
non^coding sequences therefrom or altering nucleotides 
therein by other known techniques) . The modified BMP 
coding sequences could then be inserted into a known 
5 bacterial vector using procedures such as described in T. 
Taniguchi et al, Proc. Natl. Acad, Sci. USA , 72:5230-5233 
(1980) . The exemplary bacterial vector could then be 
transformed into bacterial host cells and BMP 
heterodimers expressed thereby. An exemplary vector for 

10 microbial, e.g., bacterial, expression is described below 
in Example 7. 

Other vectors useful in the methods of this 
invention may contain multiple genes in a single 
transcription unit. For example, a proposed plasmid 

15 p7E2D contains the BMP-7 gene followed by the EMC leader 
sequence, followed by the BMP-2 gene, followed by the 
DHFR marker gene. Another example is plasmid p7E2ED 
which contains the BMP-7 gene, the EMC leader, the BMP-2 
gene, another EMC leader sequence and the DHFR marker 

20 gene. Alternatively, the vector may contain more than 
one transcription unit. As one example, the plasmid 
p2ED7ED contains a transcription unit for BMP-2 and a 
separate transcription unit for BMP-7, i.e., BMP-2-EMC- 
DHFR and BMP-7-EMC-DHFR. Alternatively, each 

25 transcription unit on the plasmid may contain a different 
marker gene. For example, plasmid p2EN7ED contains BMP- 
2-EMC-Neo and BMP-7 -EMC-DHFR. 



wo 93/09229 



PCT/US92/09430 



32 

Additionally the vectors also contain 
appropriate expression control sequences which are 
capable of directing the replication and expression of 
the BMP in the selected host cells. Useful regulatory 
5 sequences for such vectors are knovn to one of skill in 
the art and may be selected depending upon the selected 
host cells. Such selection is routine and does not form 
part of the present- invention. Similarly, the vectors 
may contain one or more selection markers, such as the 

10 antibiotic resistance gene, Neo or selectable markers 
such as DHFR and ADA. The presently preferred marker 
gene is DHFR. These marker genes may also be selected by 
one of skill in the art. 

Once they are expressed by one of the methods 

15 described above, the heterodimers of this invention may 
be identified and characterized by application of a 
variety of assays and procedures. A co-precipitation 
(immunoprecipitation) assay may be performed with 
antibodies to each of the BMPs forming the heterodimer. 

20 Generally antibodies for this use may be developed by 
conventional means, e.g., using the selected BMP, 
fragments thereof, or synthetic BMP peptides as antigen. 
Antibodies employed in assays are generally polyclonal 
antibodies made from individual BMP peptides or proteins 

25 injected into rabbits according to classical techniques. 
This assay is performed conventionally, and permits the 
identification of the heterodimer, which is precipitated 



wo 93/09229 



PCT/US92/09430 



33 

by antibodies to both BMP components of the heterodimer . 
In contrast, only one of the two antibodies causes 
precipitation of any homodimeric form which may be 
produced in the process of producing the heterodimer. 
5 Another characterizing assay is a Western 

assay, employing a precipitating antibody, a probing 
antibody and a detecting antibody. This assay may also 
be performed conventionally, by using an antibody to one 
of the BMPs to precipitate the dimers, which are run on 

10 reducing SDS-PAGE for Western analysis. An antibody to 
the second BMP is used to probe the precipitates on the 
Western gel for the heterodimer. A detecting antibody, 
such as a goat-antirabbit antibody labelled with 
horseradish peroxidase (HRP) , is then applied, which will 

15 reveal the presence of one of the component subunits of 
the heterodimer. 

Finally, the specific activity of the 
heterodimer may be G[uantitated as described in detail in 
Example 6. Briefly, the amount of each BMP is 

20 c[uantitated using Western blot analysis or pulse 

labelling and SDS-PAGE analysis in samples of each BMP 
homodimer and the heterodimer. The W20 activity is also 
determined as described specifically in Example 8. The 
relative specific activities may be calculated by the 

25 formula: W20 alkaline phosphatase activity/ amount of BMP 
on Western blot or by f luorography. As one example, this 
formula has been deterained for the BMP-2/7 heterodimer. 



wo 93/09229 



PCrAJS92/09430 



34 

demonstrating that the heterodimer has an estimated 5 to 
50 fold higher specific activity than the BMP-2 
homodimer. 

The heterodimers of the present invention may 
5 have a variety of therapeutic and pharmaceutical uses, 
e.g., in compositions for wound healing, tissue repair, 
and in similar compositions which have been indicated for 
use of the individual BMPs. Increased potency of the 
heterodimers over the individual BMPs may permit lower 

10 dosages of the compositions in which they are contained 
to be administered to a patient in comparison to dosages 
of compositions containing only a single BMP. A 
heterodimer ic protein of the present invention, which 
induces cartilage and/or bone growth in circumstances 

15 where bone is not normally formed, has application in the 
healing of bone fractvires and cartilage defects in humans 
and other animals. Such a preparation employing a 
heterodimeric protein of the invention may have 
prophylactic use in closed as well as open fracture 

20 reduction and also in the improved fixation of artificial 
joints. De novo bone formation induced by an osteogenic 
agent contributes to the repair of congenital, trauma 
induced, or oncologic resection induced craniofacial 
defects, and also is useful in cosmetic plastic surgery. 

25 A heterodimeric protein of this invention may 

be used in the treatment of periodontal disease, and in 
other tooth repair processes. Such agents may provide an 



wo 93/09229 



PCT/US92/09430 



35 

environment to attract bone-forming cells, stimulate 
growth of bone-forming cells or induce differentiation of 
progenitors of bone-forming cells. Heterodimeric 
polypeptides of the invention may also be useful in the 
5 treatment of osteoporosis. A variety of osteogenic, 

cartilage-inducing and bone inducing factors have been 
described. See, e.g., European Patent Applications 
148,155 and 169,016 for discussions thereof. 

The proteins of the invention may also be used 

10 in wound healing and related tissue repair. The types of 
wounds include, but are not limited to burns, incisions 
and ulcers. (See, e.g., PCT Publication WO84/01106 
incorporated by reference herein for discussion of wound 
healing and related tissue repair) . 

15 Additionally, the proteins of the invention may 

increase neuronal survival and therefore be useful in 
transplantation and treatment of conditions exhibiting a 
decrease in neuronal survival. 

In view of the usefulness of the heterodimers , 

20 therefore, a further aspect of the invention is a 
therapeutic method and composition for repairing 
fractures and other conditions related to cartilage 
and/or bone defects or periodontal diseases. In 
addition, the invention comprises therapeutic methods and 

25 compositions for wound healing and tissue repair. Such 
compositions comprise a therapeutically effective amount 
of a heterodimeric protein of the invention in admixture 



wo 93/09229 



PCr/US92/09430 



36 

with a phannaceutically acceptable vehicle, carrier or 
matrix. The preparation and formulation of such 
physiologically acceptable protein compositions, having 
due regard to pH, isotonicity, stability and the like, is 
5 within the skill of the art. 

It is expected that the proteins of the 
invention may act in concert with other related proteins 
and growth factors. • Therapeutic methods and compositions 
of the invention therefore comprise a therapeutic amount 

10 of a heterodimeric protein of the invention with a 
therapeutic amount of at least one of the other BMP 
proteins disclosed in co-owned and concurrently filed U. 
S. applications described above. Such combinations may 
comprise separate molecules of the BMP proteins or other 

15 heteromolecules of the present invention. 

In further compositions, heterodimeric proteins 
of the invention may be combined with other agents 
beneficial to the treatment of the bone and/ or cartilage 
defect, wound, or tissue in question. These agents 

20 include various growth factors such as epidermal growth 
factor (EGF) , platelet derived growth factor (PDGF) , 
transforming growth factors (TGF-a and TGF-^) , and 
insulin-like growth factor (IGF) . 

The therapeutic compositions are also presently 

25 valuable for veterinary applications due to the lack of 
species specificity in BMP proteins. Particularly 
domestic animals and thoroughbred horses, in addition to 



wo 93/09229 



PCr/US92/09430 



37 

humans, are desired patients for such treatment with 
heterodimeric proteins of the present invention. 

The therapeutic method includes administering 
the composition topically, systematically, or locally as 
5 an implant or device. When administered, the therapeutic 
composition for use in this invention is, of course, in a 
pyrogen-free, physiologically acceptable form. Further, 
the composition may desirably be encapsulated or injected 
in a viscous form for delivery to the site of bone, 

10 cartilage or tissue damage. Topical administration may 
be suitable for wound healing and tissue repair. 
Therapeutically useful agents other than the 
heterodimeric proteins of the invention which may also 
optionally be included in the composition as described 

15 above, may alternatively or additionally, be administered 
simultaneously or sequentially with the heterodimeric BMP 
composition in the methods of the invention. Preferably 
for bone and/or cartilage formation, the composition 
would include a matrix capable of delivering the 

20 heterodimeric protein-containing composition to the site 
of bone and/or cartilage damage, providing a structxire 
for the developing bone and cartilage and optimally 
capable of being resorbed into the body. Such matrices 
may be formed of materials presently in use for other 

25 implanted medical applications. 

The choice of matrix material is based on 
biocompatibility, biodegradability, mechanical 



wo 93/09229 



PCT/US92/09430 



properties, cosmetic appearance and interface properties. 
The particular application of the heterodimeric BMP 
compositions will define the appropriate formulation. 
Potential matrices for the compositions may be 
5 biodegradable and chemically defined calcixim sulfate, 
tricalcixomphosphate, hydroxy apatite, poly lactic acid, 
polyglycolic acid and polyanhydrides. Other potential 
materials are biodegradable and biologically well 
defined, such as bone or dermal collagen. Further 

10 matrices are comprised of pure proteins or extracellulea: 
matrix components • Other potential matrices are 
nonbiodegradable and chemically defined, such as sintered 
hydroxyapatite, bioglass, aluminates, or other ceramics. 
Matrices may be comprised of combinations of any of the 

15 above mentioned types of material, such as poly lactic 
acid and hydroxyapatite or collagen and 
tricalcitimphosphate. The bioceramics may be altered in 
composition, such as in calcium-alviminate-phosphate and 
processing to alter pore size, particle size, particle 

20 shape, and biodegradability. 

Presently preferred is a 50:50 (mole weight) 
copolymer of lactic acid and glycolic acid in the form of 
porous particles having diameters ranging from 150 to 800 
microns. In some applicatons, it will be useful to 

25 utilize a sequestering agent, such as carboxymethyl 

cellulose or autologous blood clot, to prevent the BMP 
compositions from dissassociating from the matrix. 



wo 93/09229 



PCT/US92/09430 



39 

The dosage regimen of a heterodimeric protein- 
containing pharmaceutical composition will be determined 
by the attending physician considering various factors 
which modify the action of the heterodimeric proteins, 
5 e.g. amount of bone weight desired to be formed, the site 
of bone damage, the condition of the damaged bone, the 
size of a wound, type of damaged tissue, the patient's 
age, sex, and diet, the severity of any infection, time 
of administration and other clinical factors. The dosage 

10 may vary with the type of matrix used in the 

reconstitution and the BMP proteins in the heterodimer 
and any additional BMP or other proteins in the 
pharmaceutical composition. For example, the addition of 
other known growth factors, such as IGF I (insulin like 

15 growth factor I) , to the final composition, may also 

effect the dosage. Progress can be monitored by periodic 
assessment of bone growth and/or repair, for example, X- 
rays, histomorphometric determinations and tetracycline 
labeling. 

20 The following examples are illustrative of the 

present invention and do not limit its scope. 



EXT^LE 1 - BMP Vector Constructs and Cell Lines 
A. BMP-2 Vectors 

The mammalian expression vector pMT2 CXM 
25 is a derivative of p91023 (b) [Wong et al. Science, 

221:810-815 (1985)] differing from the latter in that it 



wo 93/09229 



PCr/US92/09430 



40 

contains the ampicillin resistance gene (Amp) in place of 
the tetracycline resistance gene (Tet) and further 
contains a Xhol site for insertion of cDNA clones. The 
fxinctional elements of pMT2 CXM have been described [R. 
J. Kaufman, Ptqc. Natl - Acad. Sci. USA. 8^:689-693 
(1985)3 and include the adenovirus VA genes, the SV40 
origin of replication including the 72 bp enhancer, the 
adenovirus major late promoter including a 5' splice site 
and the majority of the adenovirus tripartite leader 
sequence present on adenovirus late mRNAs, a 3' splice 
acceptor site, a DHFR insert, the SV40 early 
polyadenylation site (SV40) , and pBR322 sequences needed 
for propagation in E. coli . 

EcoRI digestion of pMT2-VWF, which has 
been deposited with the American Type Culture Collection 
(ATCC) , Rockville, MD (USA) under accession number ATCC 
67122, excises the cDNA insert present in pMT2-VWF, 
yielding pMT2 in linear form. Plasmid pMT2 can be 
ligated and used to transform coli HB 101 or DH-5 to 
ampicillin resistance. Plasmid pMT2 DNA can be prepared 
by conventional methods. 

Plasmid pMT2 CXM is then constructed using 
loopout/in mutagenesis [Morinaga et al. Biotechnology, 
84:636 (1984)]. This removes bases 1075 to 1145 relative 
to the Hindlll site near the SV40 origin of replication 
and enhancer sequences of pMT2. In addition it inserts 
the following sequence: 



wo 93/09229 



PCT/US92/09430 



41 

5' P04-CATGGGCAGCTCGAG-3 ' (SEQ ID NO: 15) 

at nucleotide 1145. This sequence contains the 
recognition site for the restriction endonuclease Xhol. 

A derivative of pMT2 CXM, termed plasmid pMT23, 
5 contains recognition sites for the restriction 

endonucleases PstI, EcoRI, Sail and Xhol* 

Full length BMP-2 cDNA (Fig. 1) (SEQ ID NO: 1) 
is released from the XGTIO vector by digestion with EcoRI 
and subcloned into pSP65 [Promega Biotec, Madison, 
10 Wisconsin; see, e.g., Melton et al, Nucl. Acids Res. . 

12:7035-7056 (1984)] in both orientations yielding pBMP-2 
#39-3 or pBMP-2 #39-4. 

The majority of the untranslated regions of the 

BMP-2 cDNA are removed in the following manner. The 5' 

15 sequences are removed between the Sail site in the 

adapter (present from the original cDNA cloning) and the 

Sail site 7 base pairs upstream of the initiator ATG by 

digestion of the pSP65 plasmid containing the BMP-2 cDNA 

with Sail and religation. The 3' untranslated region is 

20 removed using heteroduplex mutagenesis using the 

oligonucleotide 

5' GAGGGTTGTGGGTGTCGCTAGTGAGTCGACTACAGCAAAATT 3'. 

End Sail 

(SEQ ID NO: 16) 

25 The sequence contains the terminal 3' coding region of 
the BMP-2 cDNA, followed immediately by a recognition 
site for Sail. The sequence introduces a Sail site 
following the termination (TAG) codon. 



wo 93/09229 



PCr/US92/09430 



42 

The Sail fragment of this clone was subcloned 
into the expression vector pMT23, yielding the vector 
PMT23-BMP2aUT. Restriction enzyme sites flank the BMP-2 
coding region in the sequence PstI-EcoRI-SalI-BMP-2 cDNA- 

5 sall-EcoRI-XhoI. 

The expression plasmid pED4 [Kaufman et al, 
wnr.i . Acids Res. . ia:4485-4490 (1991)] was linearized by 
digestion with EcoRI and treated with calf intestinal 
phosphatase. The BMP-2 cDNA gene was excised from pMT23- 

.0 BMP2AUT by digestion with EcoRI and recovery of the 1.2 
kb fragment by electrophoresis through a 1.0% low melt 
agarose gel. The linearized pED4 vector and the EcoRI 
BMP-2 fragment were ligated together, yielding the BMP-2 
expression plasmid pBMP2A-EMC. 

5 Another vector pBMP-2A-EN contains the same 

sequences contained within the vector pBMP2A-EMC, except 
the DHFR gene has been replaced by conventional means 
with the neomycin resistance gene from the Tn5 
transposable element. 

0 B. BMP4 Vectors 

A BMP-4 cDNA sequence set forth in Figure 
2 (SEQ ID NO: 3), in which the 3' untranslated region is 
removed, is made via heteroduplex mutagenesis with the 
mutagenic oligonucleotide: 



wo 93/09229 



PCT/US92/09430 



43 

5' GGATGTGGGTGCCGCTGACTCTAGAGTCGACG GAATTC 3' 

End EcoRI 

(SEQ ID NO: 17) 

This deletes all of the sequences 3' to the translation 

5 terminator codon of the BMP-4 cDNA, juxtaposing this 

terminator codon and the vector polylinker sequences. 

This step is performed in an SP65 vector [Promega 

Biotech] and may also be conveniently performed in pMT2- 

derivatives containing the BMP-4 cDNA similar to the BMP2 

10 vectors described above. The 5' untranslated region is 

removed using the restriction endonuclease BsmI, which 

cleaves within the eighth codon of BMP-4 cDNA. 

Reconstruction of the first eight codons 

is accomplished by ligation to oligonucleotides: 

15 EcoRI Initiator BsmI 

5' ^fiAOTCACCATGATTCCTGGTAAC CGAATGCT 3' (SEQ ID NO: 18) 

and 

3' GTGGTACTAAGGACCATTGGCTTAC 5' (SEQ ID NO: 19) 

These oligonucleotides form a duplex which has a BsmI 
20 complementary cohesive end capable of ligation to the 
BsmI restricted BMP-4 cDNA, and it has an EcoRI 
complementary cohesive end capable of ligation to the 
EcoRI restricted vector pMT2. Thus the cDNA for BMP-4 
with the 5' and 3' untranslated regions deleted, and 
retaining the entire encoding sequence is contained 
within an EcoRI restriction fragment of approximately 1.2 
kb. 

The pMT2 CXM plasmid containing this BMP-4 



wo 93/09229 



PCT/US92/09430 



44 

sequence is designated pXMBMP-4AUT. It is digested with 
EcoRI in order to release the BMP-4 cDNA containing 
insert from the vector. This insert is subcloned into 
the EcoRI site of the mammalian expression vector pED4, 
5 resulting pBMP4A-EMC. 

C. BMP-5 Vectors 

A BMP-5 cDNA sequence comprising the 
nucleotide sequence from nucleotide #699 to #2070 of Fig. 
5 (SEQ ID NO: 9) is specifically amplified as follows. 

10 The oligonucleotides CGACCTGCAGCCACCATGCATCTGACTGTA (SEQ 

ID NO: 20) and TGCCTGCAGTTTAATATTAGTGGCAGC (SEQ ID NO: 
21) are utilized as primers to allow the amplification of 
nucleotide sequence #699 to #2070 of Fig. 5 from the BMP- 
5 insert of X-ZAP clone U2-16 [ATCC #68109]. This 

15 procedure introduces the nucleotide sequence 

CGACCTGCAGCCACC (SEQ ID NO: 22) immediately preceeding 
nucleotide #699 and the nucleotide sequence CTGCAGGCA 
immediately following nucleotide #2070. The addition of 
these sequences results in the creation of PstI 

20 restriction endonuclease recognition sites at both ends 
of the amplified DNA fragment. The resulting amplified 
DNA product of this procedure is digested with the 
restriction endonuclease PstI and stibcloned into the PstI 
site of the pMT2 derivative pMT21 [Kaufman, Nucl. Acids 

25 Res. . 19:4485-4490 (1991)]. The resulting clone is 
designated H5/5/pMT. 

The insert of H5/5/pMT is excised by PstI 



wo 93/09229 



PCT/US92/09430 



45 

digestion and subcloned into the plasmid vector pSP65 
[Promega Biotech] at the PstI site, resulting in plasmid 
BMP5/SP6. BMP5/SP6 and U2-16 are digested with the 
restriction endonucleases Nsil and Ndel to excise the 
5 portion of their inserts corresponding to nucleotides 

#704 to #1876 of Fig, 5, The resulting 1173 nucleotide 
Nsil-Ndel fragment of clone U2-16 is ligated into the 
Nsil-Ndel site of BMP5/SP6 from which the corresponding 
1173 nucleotide Nsil-Ndel fragment had been removed. The 

10 resulting clone is designated BMP5mix/SP65. 

Direct DNA seguence analysis of BMP5mix/SP65 is 
performed to confirm identity of the nucleotide sequences 
produced by the amplification to' those set forth in Fig. 
5. The clone BMP5mix/SP65 is digested with the 

15 restriction endonuclease PstI resulting in the excision 
of an insert comprising the nucleotides #699 to #2 070 of 
Fig. 5 and the additional sequences containing the PstI 
recognition sites as described above. The resulting 1382 
nucleotide PstI fragment is subcloned into the PstI site 

20 of the pMT2 derivative pMT21. This clone is designated 
BMP5mix/pMT21#2. 

The same fragment is also subcloned into the 
PstI site of pED4 to yield the vector designated BMPSmix- 
EMC-11. 

25 D. BMP-6 Vectors 

A BMP-6 cDNA sequence comprising the 
nucleotide sequence from nucleotide #160 to #1706 of 



wo 93/09229 



PCr/US92/09430 



10 



46 

Fig. 4 (SEQ ID no: 7) is produced by a series of 
techniques known to those skilled in the art. The clone 
BMP6C35 [ATCC 68245] is digested with the restriction 
endonucleases Apal and TaqI, resulting in the excision of 
a 1476 nucleotide portion of the insert comprising 
nucleotide #231 to #1703 of Fig. 4. Synthetic 
oligonucleotides with Sail restriction endonuclease site 
converters are designed to replace those nucleotides 
corresponding to #160 to #230 and #1704 to #1706 which 
are not contained in the 1476 Apal-TaqI fragment of the 

BMP-6 cDNA sequence. 

Oligonucleotide/Sall converters conceived to 

replace the missing 5' 

(TCGACCCACCATGCCGGGGCTGGGGCGGAGGGCGCAGTGGCTGT 
GCTGGTGGTGG6GGCTGTGCTGCAGCTGCTGCGGGCC (SEQ ID NO: 23) and 
CGCAGCAGCTGCACAGCAGCCCCCACCACCAGCACAGCCACTGCGCCCTCCGCCCCA 

GCCCCGGCATGGTGGG) (SEQ ID NO: 24) and 3' (TCGACTGGTTT 
(SEQ ID NO: 25) and CGAAACCAG (SEQ ID NO: 26) ) sequences 
are annealed to each other independently. The annealed 
5' and 3' converters are then ligated to the 1476 
nucleotide Apal-TagI described above, creating a 1563 
nucleotide fragment comprising the nucleotide sequence 
from #160 to #1706 of Fig. 4 and the additional sequences 
contrived to create Sail restriction endonuclease sites 
25 at both ends. The resulting 1563 nucleotide fragment is 
subdoned into the Sail site of pSP64 [Promega Biotech, 
Madison, WIJ. This clone is designated BMP6/SP64#15. 



IS 



20 



wo 93/09229 



PCr/US92/09430 



47 

DNA sequence analysis of BMP6/SP64#15 is 
performed to confiirm identity of the 5' and 3' sequences 
replaced by the converters to the sequence set forth in 
Fig, 4. The insert of BMP6/SP64#15 is excised by 
5 digestion with the restriction endonuclease Sail. The 

resulting 1563 nucleotide Sail fragment is subcloned into 
the Xhol restriction endonuclease site of pMT21 and 
designated herein as BMP6/pMT21. 

The PstI site of pED4 is converted to a Sail 
10 site by digestion of the plasmid with PstI and ligation 
to the converter oligonucleotides: 

5'-TCGACAGGCTCGCCTGCA-3' (SEQ ID NO: 27) and 
3'-GTCCGAGCGG-5' (SEQ ID NO: 28), 

The above 1563 nucleotide Sail fragment is also subcloned 
15 into the Sail site of this pED4 vector, yielding the 

expression vector BMP6/EMC. 

E. BMP-7 Vectors 

A BMP-7 sequence comprising the nucleotide 
sequence from nucleotide #97 to #1402 of Fig. 3 (SEQ ID 
20 NO: 5) is specifically amplified as follows. The 

oligonucleotides CAGGTCGACCCACCATGCAGGTGCGCTCA (SEQ ID 
NO: 29) and TCTGTCGACCTCGGAGGAGCTAGTGGC (SEQ ID NO: 30) 
are utilized as primers to allow the amplification of 
nucleotide sequence #97 to #1402 of Fig. 3 from the 
25 insert of clone PEH7-9 [ATCC #68182]. This procedure 

generates the insertion of the nucleotide sequence 
CAGGTCGACCCACC immediately preceeding nucleotide #97 and 



wo 93/09229 



PCr/US92/09430 



10 



48 

the insertion of the nucleotide sequence GTCGACAGA 
immediately following nucleotide #1402. The addition of 
these sequences results in the creation of a Sail 
restriction endonuclease recognition site at each end of 
the amplified DNA fragment. The resulting amplified DNA 
product of this procedure is digested with the 
restriction endonuclease Sail and subcloned into the Sail 
site of the plasmid vector pSP64 [Promega Biotech, 
Madison, WI] resulting in BMP7/SP6#2. 

The clones BMP7/SP6#2 and PEH7-9 are digested 
with the restriction endonucleases Ncol and StuI to 
excise the portion of their inserts corresponding to 
nucleotides #363 to #1081 of Fig. 3. The resulting 719 
nucleotide NcoI-StuI fragment of clone PEH7-9 is ligated 
15 into the Ncol-Stui site of BMP7/SP6#2 from which the 

corresponding 719 nucleotide fragment is removed. The 
resulting clone is designated BMP7mix/SP6. 

Direct DNA sequence analysis of BMP7mix/SP6 
confirmed identity of the 3' region to the nucleotide 
20 sequence from #1082 to #1402 of Fig. 3, however the 5' 
region contained one nucleotide mis incorporation. 

Amplification of the nucleotide sequence (#97 
to #1402 of Fig. 3) utilizing PEH7-9 as a template is 
repeated as described above. The resulting amplified DNA 
25 product of this procedure is digested with the 

restriction endonucleases Sail and Pstl. This digestion 
results in the excision of a 747 nucleotide fragment 



wo 93/09229 



PCr/US92/09430 



49 

comprising nucleotide #97 to #833 of Fig. 3 plus the 
additional sequences of the 5' priming oligonucleotide 
used to create the Sail restriction endonuclease 
recognition site described earlier. This 747 Sall-PstI 
5 fragment is subcloned into a Sall-PstI digested pSP65 
[Promega Biotech, Madison, WI] vector resulting in 
5'BMP7/SP65. DNA sequence analysis demonstrates that the 
insert of the 5'BMP7/SP65#1 comprises a sequence 
identical to nucleotide #97 to #362 of Fig. 3. 

10 The clones BMP7mix/SP6 and 5'BMP7/SP65 are 

digested with the restriction endonucleases Sail and 
Ncol. The resulting 3' Ncol-Sall fragment of BMP7mix/SP6 
comprising nucleotides #363 to #1402 of Fig. 3 and 5' 
Sall-Ncol fragment of 5'BMP7/SP65 comprising nucleotides 

15 #97 to #362 of Fig. 3 are ligated together at the Ncol 
restriction sites to produce a 1317 nucleotide fragment 
comprising nucleotides #97 to #1402 of Fig. 3 plus the 
additional sequences derived from the 5' and 3' 
oligonucleotide primers which allows the creation of Sail 

20 restriction sites at both ends of this fragment. 

This 1317 nucleotide Sail fragment is 
ligated nto the Sail site of the pMT2 derivative pMT2Cla- 
2. pMT2Cla-2 is constructed by digesting pMT21 with 
EcoRV and Xhol, treating the digested DNA with Klenow 

25 fragment of DNA polymerase I and ligating Clal linkers 

(NEBio Labs, CATCGATG) . This removes bases 2171 to 2420 
starting from the Hindlll site near the SV40 origin of 



wo 93/09229 



PCr/US92/09430 



50 

replication and enhancer sequences of pMT2 and introduces 
a unique Clal site, but leaves the adenovirus VAI gene 
intact, resulting in pMT2Cla-2. This clone is designated 

BMP-7-pMT2 . 

The insert of BMP-7-pMT2 is excised by 
digestion with the restriction endonuclease Sail. The 
resulting 1317 nucleotide Sail fragment is subcloned into 
the Xhol restriction endonuclease site of pMT21 to yield 
the clone BMP-7/pMT21. This Sail fragment is also 
subcloned into the Sail site of the pED4 vector in which 
the PstI site was converted into a Sail site as described 
above, resulting in the vector pBMP7/EMC#4. 

F. pip-a Vectors 

At present no mammalian BMP-8 vectors have 
been constructed. However, using the sequence of Figure 
6 (SEQ ID NO: 11) , it is contemplated that vectors 
similar to those described above for the other BMPs may 
be readily constructed. A bacterial expression vector 
similar to the BMP-2 vector described in detail in 
Example 7 may also be constructed for BMP-8, by 
introducing a Met before the amino acid #284 Ala of Fig. 
6. This sequence of BMP-8 is inserted into the vector 
PALBP2-781 in place of the BMP-2 sequence. See Example 
7. 

G. BMP Vectors Containing t he Adenosine 
neaminasp ^^da^ Marker 

BMP genes were inserted into the vector 



wo 93/09229 



PCT/US92/09430 



51 

pMT3SV2Ada [R. J. Kaufman, Meth . Enz > . 185 :537-566 
(1990)] to yield expression plasmids containing separate 
transcription units for the BMP cDNA gene and the 
selectable marker Ada. pMT3SV2Ada contains a polylinker 
5 with recognition sites for the enzymes PstI, EcoRI, Sail 
and Xbal that can be used for insertion of and expression 
of genes (i.e. BMP) in mammalian cells. In addition, the 
vector contains a second transcription unit encoding Ada 
which serves as a dominant and amplifiable marker in 

10 mammalian cells. 

To construct expression vectors for BMP-5, BMP- 
6 and BMP-7, individually, the same general method was 
employed. The gene for BMP 5 (Fig. 5), 6 (Fig. 4) or 7 
(Fig. 3) was inserted into the polylinker essentially as 

15 described above for the p£D4 vector. These vectors can 
be used for transfection into CHO DUKX cells and 
subsequent selection and amplification using the Ada 
marker as previously described [Kaufman et al, Proc. 
Natl. Acad. Sci, USA . 83:3136-3140 (1986)]. Since each 

20 such vector does not contain a DHFR gene, the resultant 
transformed cells remain DHFR negative and can be 
subsequently transfected with a second vector containing 
a different BMP in conjunction with DHFR and amplified 
with methotrexate. 

25 Alternatively, the pMT3SV2Ada/BMP vectors can 

be used to transfect stable CHO cell lines previously 
transfected with a different BMP gene and amplified using 



wo 93/09229 



PCr/US92/09430 



52 

the DHFR/methotrexate system. The resultant 
transfectants can be subsequently amplified using the Ada 
system, yielding cell lines that coexpress two different 
BMP genes, and are amplified using both the DHFR and Ada 
5 markers . 

H. pMP-Expressina M ammalian Cell Lines 

At present, the most desiraOsle mammalian 
cell lines for use in producing the recombinant 
homodimers and heterodimers of this invention are the 
10 following. These cell lines were prepared by 

conventional transformation of CHO cells using vectors 

described above. 

The BMP-2 expressing cell line 2EG5 ie a 
CHO cell stably transformed with the vector pBMP2delta- 
15 EMC- 

The BMP-4 expressing cell line 4E9 is a 
CHO cell stably transformed with the vector pBMP4delta- 
EMC. 

The BMP-5 expressing cell line 5E10 is a 
20 CHO cell stably transformed with the vector BMP5mix-EMC- 
11 (at a amplification level of 2 micromolar MTX) . 

The BMP-6 expressing cell line 6HG8 is a 
CHO cell stably transformed with the vector BMP6/EMC. 

The BMP-7 expressing cell line 7MB9 is a 
25 CHO cell stably transformed with the vector BMP7/pMT21. 



^YRMPLE 2 - TRANSIENT EXPRESSTQW OF P WP ^FTRRODIMERS 



wo 93/09229 



PCT/US92/09430 



53 

The heterodimers of the present invention may 
be prepared by co-expression in a transient expression 
system for screening in the assays of Example 8 by two 
different techniques as follows. 
5 In the first procedure, the pMT2 -derived and 

EMC-derived expression plasmids described in Example 1 
and other similarly derived vectors were constructed 
which encoded, individually, BMP-2 through BMP-7, and 
transforming growth factor-beta (TGF)3l) . All 

10 combinations of pairs of plasmids were mixed in equal 

proportion and used to co-transfect CHO cells using the 
DEAE-dextran procedure [Sompayrac and Danna, Proc. Natl, 
Acad. Sci. USA , 28:7575-7578 (1981); Luthman and 
Magnusson, Nucl. Acids Res. . 11:1295-1308 (1983)]. The 

15 cells are grown in alpha Minimal Essential Medium (a-MEM) 
supplemented with 10% fetal bovine serum, adenosine, 
deoxyadenosine, thymidine (100 tig/ml each), pen/strep, 
and glutamine (1 mM) . 

The addition of compounds such as heparin, 

20 suramin and dextran sulfate are desirable in growth 

medium to increase the amounts of BMP-2 present in the 
conditioned medium of CHO cells. Similarly responsive to 
such compounds is BMP-5. Therefore, it is expected that 
these compounds will be added to growth medixim for any 

25 heterodimer containing these BMP components. Other BMPs 
may also be responsive to the effects of these compounds, 
which are believed to inhibit the interaction of the 



wo 93/09229 



PCr/US92/09430 



54 

mature BMP molecules with the cell surface. 

The following day, fresh growth medium, with or 
without 100 Mg/ml heparin, was added. Twenty-four hours 
later, conditioned medium was harvested. 
5 In some experiments, the conditioned medium was 

collected minus heparin for the 24-48 hour period post- 
transfection, and the same plates were then used to 
generate conditioned medium in the presence of heparin 
48-72 hour post-transfection. Controls included 
10 transf ecting cells with expression plasmids lacking any 
BMP sequences, transf ecting cells with plasmids 
containing sequences for only a single BMP, or mixing 
conditioned medium from cells transfected with a single 
BMP with conditioned medium from cells transfected with a 

15 different BMP. 

caiaracterizations of the coexpressed 
heterodimer BMPs in cjnide conditioned media, which is 
otherwise not purified, provided the following results. 
Transiently coexpressed BMP was assayed for induction of 

20 alkaline phosphatase activity on W20 stromal cells, as 
described in Example 8. 

Co-expression of BMP-2 With BMP-5, BMP- 6 and 
BMP-7, and BMP-4 with BMP-5, BMP-6 and BMP-7 yielded more 
alkaline phosphatase inducing activity in the W20 assay 

25 than either of the individual BMP homodimers alone or 

mixtures of homodimers, as shown below. Maximal activity 
( in vitro ) , was obtained when BMP-2 was coexpressed with 



wo 93/09229 



PCr/US92/09430 



55 

BMP-7. Increased activity was also found the 
heterodimers BMP-2/5; BMP-2/6; BMP-4/5; BMP-4/6; and BMP- 
4/7. 



BMP-2 
BMP-3 
BMP-4 
BMP-5 
BMP-6 
BMP-7 
TGF-/S 



BMP-2 
BMP-3 
BMP-4 
BMP-5 
BMP-6 
BMP-7 
TGF-j8 



TGF-/S 
33 

12 



TGF-/S 
88 



BMP-7 
240 

115 



Condition Medium 
BMP-6 BMP-5 



99 



25 



89 



22 



BMP-4 
53 
14 
24 



Condition Medium + heparin 
BMP-7 BMP-6 BMP-5 BMP-4 



454 



119 



132 



30 



127 



41 



70 

7 

37 



BMP-3 
9 



BMP-3 
77 



BMP-2 
29 



BMP-2 
169 



Units: 1 unit of activity is equivalent to that of 1 ng/ml of rh6MP-2. 
— : indicates activity below die detection limit of the assay. 



10 



These BMP combinations were subsequently expressed 
using various ratios of expression plasnids (9:1, 3:1, 
1:1, 1:3, 1:9) during the CHO cell transient 
transfection. The performance of this method using 
plasmids containing BMP-2 and plasmids containing BMP-7 
at plasmid number ratios ranging from 9:1 to 1:9, 
respectively, demonstrated that the highest activity in 



wo 93/09229 



PCr/US92/09430 



56 

the W20 assay was obtained when approximately the same 
number of plasmids of each BMP were transfected into the 
host cell. Ratios of BMP-2 to BMP-7 plasmids of 3:1 to 
1:3, respectively, also resulted in increased activity in 
5 W20 assay in comparison to host cells transfected with 
plasmids containing only a single BMP. However, these 
latter ratios produced less activity than the 1:1 ratio. 

Similar rdtios may be deteirmined by one of 
skill in the art for heterodimers consisting of other 

10 than BMP-2 and BMP-7. For example, preliminary work on 
the heterodimer formed between BMP-2 and BMP-6 has 
indicated that a preferred ratio of plasmids for co- 
transfection is 3:1, respectively. The determination of 
preferred ratios for this method is within the skill of 

15 the art. 

As an alternative means to transiently generate 
coexpressed BMPs, the stable CHO cell lines identified in 
Example 1 expressing each BMP-2, BMP-4, BMP-5, BMP-6 and 
BMP-7, are cocultured for one day, and are then fused 

20 with 46.7% polyethylene glycol (PEG). One day post- 
fusion, fresh medium is added and the heterodimers are 
harvested 24 hours later for the W20 assay, described in 
Example 8. The assay results were substantially similar 
to those described immediately above. 

25 Therefore, all combinations of BMP-2 or 4 

coexpressed with either BMP-5, 6 or 7 yielded greater 
activity than any of the BMP homodimers alone. In 



wo 93/09229 



PCT/US92/09430 



57 

control experiments where each BMP homodimer was 
X expressed alone and conditioned media mixed post harvest, 

the activity was always intermediate between the 
individual BMPs, demonstrating that the BMP co-expressed 
5 heterodimers yield higher activity than combinations of 
the individually expressed BMP homodimers, 

EXAMPLE 3 - STABLE EXPRESSION OF BMP HETERODIMERS 
A. BMP-2/7 

Based on the results of the transient assays in 
10 Example 2, stable cell lines were made that co-express 
BMP-2 and BMP-7. 

A preferred stable cell line, 2E7E-10, was 
obtained as follows: Plasmid DNA (a 1:1 mixture of pBMP- 
7 -EMC and pBMP-2-EMC, described in Example 1) is 
15 transfected into CHO cells by electroporation [Neuman et 
al, EMBO J> , 1:841-845 (1982)]. 

Two days later, cells are switched to selective 
medivun containing 10% dialyzed fetal bovine serxim and 
lacking nucleosides. Colonies expressing DHFR are 
20 counted 10-14 days later. Individual colonies or pools 
of colonies are expanded and analyzed for expression of 
each heterodimer BMP component RNA and protein using 
^ standard procedures and are subsequently selected for 

amplification by growth in increasing concentrations of 
25 MTX. stepwise selection of the preferred clone, tearmed 

2E7E, is carried out up to a concentration of 0.5 fiVL MTX. 



wo 93/09229 



PCrAJS92/09430 



58 

The cell line is then subcloned and assayed for 
heterodimer 2/7 expression. 

Procediires for such assay include Western blot 
analysis to detect the presence of the component DNA, 
protein analysis and SDS-PAGE analysis of metabolically 
labelled protein, W20 assay, and analysis for cartilage 
and/or bone formation activity using the ectopic rat bone 
formation assay of Example 9. The presently preferred 
clonally-derived cell line is identified as 2E7E-10. 
This cell line secretes BMP-2/7 heterodimer proteins into 
the media conteuLning 0.5 nH MTX. 

The CHO cell line 2E7E-10 is grown in 
Dulbecco's modified Eagle's medium (DMEM) /Ham's nutrient 
mixture F-12, 1:1 (vol/vol), supplemented with 10% fetal 
bovine serum. When the cells are 80 to 100% confluent, 
the medium is replaced with serum-free DMEM/F-12.' Medium 
is harvested eveiry 24 hours for 4 days. For protein 
production and purification the cells are cultured serum- 
free. 

While the co-expressing cell line 2E7E-10 
preliminarily appears to make lower amounts of BMP 
protein than the BMP2 -expressing cell line 2EG5 described 
in Example 2, preliminary evidence suggests that the 
specific activity of the presumptive heterodimer is at 
least 5-fold greater than BMP-2 homodimer (see Example 
6). 

To construct another heterodimer producing cell 



wo 93/09229 



PCr/US92/09430 



59 

line, the stable CHO cell line 7MB9, previously 
transfected with pBMP-7-pMT2, and which expresses BMP-7, 
is employed. 7MB9 may be amplified and selected to 2 juM 
methotrexate resistance using the DHFR/MTX system. To 
5 generate a stable co-expressing cell line, cell line 7MB9 
is transfected with the expression vector pBMP-2A-EN 
(EMC-Neo) containing BMP-2 and the neomycin resistance 
gene from the Tn5 transposable element. The resulting 
transfected stable cell line was selected for both G-418 

10 and MTX resistance. Individual clones were picked and 
analyzed for BMP expression, as described above. 

It is anticipated that stable cell lines co- 
expressing other combinations of BMPs which show enhanced 
activity by transient coexpression will likewise yield 

15 greater activity upon stable expression. 

B. BMP-2/6 

Based on the results of the transient assays in 
Example 2, stable cell lines were made that co-express 
BMP-2 and BMP-6. 

20 A preferred stable cell line, 12C07, was 

obtained as follows: Plasmid DNA (a 1:3 mixture of pBMP- 
6-EMC and pBMP-2-EMC, described in Example 1) is 
transfected into CHO cells by electroporation [Neuman et 
al, EMBO J. , 1:841-845 (1982)]. 

25 Two days later, cells are switched to selective 

medium containing 10% dialyzed fetal bovine serum and 
lacking nucleosides. Colonies expressing DHFR are 



wo 93/09229 



PCr/US92/09430 



60 

counted 10-14 days later. Individual colonies or pools 
of colonies are expanded and analyzed for expression of 
each heterodimer BMP component RNA and protein using 
standard procedures and are subsequently selected for 
amplification by growth in increasing concentrations of 
MTX. Stepwise selection of the preferred clone, termed 
12 -C, is Ceirried out up to a concentration of 2.0 /*M MTX. 
The cell line is then subcloned and assayed for 
heterodimer 2/6 expression. 

Procedures for such assay include Western blot 
analysis to detect the presence of the component DNA, 
protein analysis and SDS-PAGE analysis of metabolically 
labelled protein, W20 assay, and analysis for cartilage 
and/or bone formation activity using the ectopic rat bone 
formation assay of Example 9. The presently preferred 
donally-derived cell line is identified as 12C07. This 
cell line secretes BMP-2/6 heterodimer proteins into the 
media containing 2.0 mM MTX. 

The CHO cell line 12C07 is grown in Dulbecco's 
modified Eagle's medium (DMEM) /Ham's nutrient mixture F- 
12, 1:1 (vol/vol) , supplemented with 10% fetal bovine 
serum. When the cells are 80 to 100% confluent, the 
medium is replaced with serum-free DMEM/F-12. Medium is 
harvested every 24 hours for 4 days. For protein 
production and purification the cells are cultured serum- 
free. 

While the co-expressing cell line 12C07 



wo 93/09229 



PCr/US92/09430 



61 

preliminarily appears to make lower amounts of BMP 
protein than the BMP2-expressing cell line 2EG5 described 
in Example 2, preliminary evidence suggests that the 
specific activity of the presumptive heterodimer is at 
5 least 3-5-fold greater than BMP-2 homodimer (see Example 

6). 

To construct another heterodimer producing cell 
line, the stable CHG cell line 2EG5, previously 
transfected with pBMP-2-EMC, and which expresses BMP-2, 

10 is. employed. 2EG5 may be amplified and selected to 2 fM 

methotrexate resistance using the DHFR/MTX system. To 
generate a stable co-expressing cell line, cell line 2EG5 
is transfected with the expression vector pBMP-6-ada (ada 
deaminase) containing BMP-6 and the ADA resistance gene. 

15 The resulting transfected stable cell line was selected 
for both DCF and MTX resistance. Individual clones are 
picked and analyzed for BMP expression, as described 
above. 

It is anticipated that stable cell lines co- 
20 expressing other combinations of BMPs which show enhanced 
activity by transient coexpression will likewise yield 
greater activity upon stable expression. 

EXAMPLE 4 -PURIFICATION OF BMP2/7 AND BMP-2/6 HETERODIMER 
The same purification procedure? is used for BMP-2/6 
25 heterodimer and BMP-2/7 heterodimer. Conditioned media 
from cultures of cell line 2E7E-10 or 12C07 containing 



wo 93/09229 



PCr/US92/09430 



62 

recombinantly produced BMP heterodimer 2/7V or 2/6, 
respectively, can be generated froB either adherent or 
suspension cultures. For small to medium scale 
generation of coexpressed BMP, adherent cultures are 
5 seeded into roller bottles and allowed to grow to 

confluence in alpha-Minimal Eagles Medium [a-MEM, Gibco, 
Grand Island, NY] containing 10% dialyzed heat- 
inactivated fetal calf serum [Hazleton, Denver, PA]. The 
media is then switched to a serum-free, albumin free, low 

10 protein medium based on a 50:50 mixture of Delbecco's 

Modified Eagle's medium and Hams F-12 medium, optionally 
supplemented with 100 micrograms/ml dextran sulfate. 
Four or five daily harvests are pooled, and used to 
purify the recombinant protein. 

15 Conditioned medium from roller bottle cultures 

obtained as described above was thawed slowly at room 
temperature and pooled. The pH of the pooled medium was 
adjusted to pH 8.0 using 1 M Tris, pH 8.0. A column was 
poured containing Matrex Celluf ine Sulfate [Amicon] and 

20 equilibrated in 50 mM Tris, pH 8.0. 

Upon completion of loading of the medium, the 
column was washed with buffer containing 50 mM Tris, 0.4 
M NaCl, pH 8.0 until the absorbance at 280 nm reached 
baseline. The coliimn was then washed with 50 mM Tris, pH 

25 8.0 to remove NaCl from the buffer. The resin was then 
washed with 50 bM Tris, 0.2 M NaCl, 4 M Urea, pH 8.0 
until a peak had eluted. The column was then washed into 



wo 93/09229 



PCr/US92/09430 



63 

50 mM Tris, pH 8.0 to remove the urea. 

The bound BMP-2/7 or BMP-2/6 was then eluted 
using 50 mM Tris, 0.5 M NaCl, 0.5 M Arginine, pH 8.0. 
The eluate was collected as a single pool and may be 
5 optionally stored frozen prior to further purification. 

This Cellufine Sulfate eluate was diluted with 14 volumes 
of 6M urea and the pH of the sample was then adjusted to 
6.0. A hydroxyapatite-Ultrogel [IBF] column was poured 
and equilibrated with 80 mM potassium phosphate, 6M urea, 
10 pH 6.0. 

After the completion of sample loading, the 
column was washed with 10 bed volumes of the 
ecjuilibration buffer. Bound BMP-2/7 or BMP-2/6 
heterodimers were eluted with 5 bed volumes of 100 mM 

15 potassium phosphate, 6M urea, pH 7.4. This eluate was 

loaded directly onto a Vydac C4 reverse-phase HPLC column 
equilibrated in water - 0.1% TFA. BMP-2/7 or BMP-2/6 
heterodimers were eluted with a gradient of 30-50% 
acetonitrile in water - 0.1% trif luoroacetic acid. 

20 Fractions containing BMPs are identified by SDS-PAGE 

in the presence or absence of reductant. The identity of 
the BMPs with respect to the heterodimers vs. homodimers 
is determined by 2D-PAGE (+/- reductant) . Fractions with 
heterodimers gave bands which reduce to two spots. Bands 

25 from homodimer fractions reduce to a single spot for each 
BMP species. 



wo 93/09229 



PCr/US92/09430 



64 

The BMP-2/6 heterodimer subvmits are analyzed 
on a protein sequenator. BMP-2/6 heterodimers of the 
followig species are present: BMP-6 subunit beginning 
with amino acid #375 Ser-Ala-Ser-Ser in association with 
BMP-2 subiinit beginning with amino acid #283 Gin-Ala-Lys 
or #249 Ser-Lev-His, though other less abundant species 
may be present. 

It is contemplated that the same or substantially similar 
purification techniques may be employed for any 
recombinant BMP heterodimer of this invention. The 
hydroxyapatite-Ultrogel column may be unnecessary and 
that the purification scheme may be modified by loading 
the Cellufine Sulfate eluate directly onto the C4 reverse- 
phase HPLC column without use of the former column for 
BMP2/7 or BMP-2/6 or the other heterodimers of this 
invention. 



EXAMPLE 5 - PROTETW CHARAC TBRT2ATION 

Total protein secreted from the co-expressing 
cell lines is analyzed after labelling with '^S-methionine 
or by Western blot analysis using antibodies raised 
against both BMPs of the heterodimer, e.g., BMP-2 and 
BMP-7. Together with the alkaline phosphatase assays, 
the data indicates the presence of the heterodimer and 
the specific activity. The following specific details 
are directed towards data collected for the BMP-2 /7 and 
BMP-2/6 heterodimers; however, by application of similar 



wo 93/09229 



PCT/US92/09430 



65 

methods to the other heterodimers described herein, 
similar results are expected* 

A. ^^S-Met labelling 

Cell lines derived by cotransfection of 
5 BMP2A-EMC and BMP7a-EMC expression vectors were pulsed 

with ^S-methionine for 15 minutes, and chased for 6 hours 
in serum free media in the presence or absence of 
heparin. Total secreted protein was analyzed under 
reducing conditions by PAGE and f luorography • The 

10 results demonstrate that several cell lines secrete both 
BMP-2 and BMP-7 protein. There is a good correlation 
between the amount of alkaline phosphatase activity and 
the amount of coexpressed protein. 

Several cell lines secrete less total BMP- 

15 2 and 7 than the BMP-2-only expressing cell line 2EG5, 
which produces 10 ^g/nl BMP-2. Cell line 2E7E-10 
(amplified at a level of O.SmM MTX) secretes equal 
proportions of BMP-2 and BMP-7 at about the same overall 
level of expression as the cell line 2EG5. Cell line 

20 2E7E-10 produces the equivalent of 600 micrograms/ml of 
BMP-2 homodimer activity in one assay. 

Total labelled protein was also analyzed on a 
two-dimensional non-reducing/reducing gel system to 
ascertain whether a heterodimer is made. Preliminary 

25 results demonstrate the presence of a unique spot in this 
gel system that is not found in either the BMP-2-only or 
BMP-7-only cell lines, suggesting the presence of 2/7 



wo 93/09229 



PCr/US92/09430 



66 

heterodimer. The same gel with purified material 
produced the same results (e.g. , two unique spots on the 
gel) indicative of the presence of the 2/7 heterodimer. 
The homodimer of BMP2 produced distinct species on this 

5 gel system. 

In contrast to the recombinant BMP-2/7 purification, 
BMP-2 homodimers are not detected during the BMP-2/6 
preparation; however, significant amounts of BMP-6 
homodimers are fotmd. In addition, a significant amount 

10 of a -20 amino acid N-terminal truncated form of BMP-6 is 
found; this could be eliminated by the inclusion of 
protease inhibitors during cell culture. BMP-2/6 was 
found to elute two to three fractions later from C4 RP- 
HPLC than did BMP-2/7. 

15 Amino acid sequencing indicates that the predominant 

BMP-2/7 heterodimer species comprises a mature BMP-2 
subunit [amino acid #283 (Gln)-#396{Arg) ] and a mature 
subunit of BMP-7 [#293{Ser)-#431{His)]. BMP-2/6 
heterodimer comprises the mature BMP-2 subunit (#283-396) 

20 and the mature BMP-6 subunit [#375(Ser)-#513 (His) ] . 



B. 7Tninunonrecipitation eounled Western blot analysis 

Conditioned media from a BMP-2 -only 
(2EG5) , a BMP-7-only (7MB9) , or the 2E7E-10 co-expressing 
cell line were subjected to immiinoprecipitation with 
either a BMP-2 or BMP-7 antibody (both conventional 



wo 93/09229 



PCr/US92/09430 



67 

polyclonal antibodies raised in rabbits) , then analyzed 
on Western blots probed with either an anti-BMP-2 or 
anti-BMP-7 antibody. The 2/7 heterodiiner precipitates 
and is reactive on Western blots with both the BMP-2 and 
5 BMP-7 antibodies, while either BMP by itself reacts with 
its specific antibody, but not with the reciprocal 
antibody. 

It has been demonstrated using this 
strategy that a protein in the co-expressing cell line 

10 that is precipitated by the anti-BMP-7 antibody W33 

[Genetics Institute, Inc, Cambridge, Massachusetts] and 
reacts on a Western blot with the anti-BMP-2 antibody W12 
or WIO [Genetics Institute, Inc.] is not present in the 
BMP-2 or 7-only expressing cell lines. This experiment 

15 indicates that this protein species is the heterodimeric 
protein. Conversely, precipitation with W12 and probing 
with W33 yielded similar results. 

EXAMPLE 6 - SPECIFIC ACTIVITY OF HETERODIMERS 
A. In vitro Assays 
20 The specific activity of the BMP-2/7 or BMP-2/6 

heterodimer and the BMP-2 homodimer secreted into growth 
medium of the stable cell lines 2E7E-10 and 2EG55, and 
12C07 and 2EG5, respectively, were estimated as follows. 

The amount of BMP protein in conditioned medium 
25 was measured by either Western blot analysis or by 



wo 93/09229 



PCr/US92/09430 



68 

analyzing protein secreted from ''s-methionine labelled 
cells by PAGE and f luorography. The amount of activity 
produced by the same cell lines on W20 cells using either 
the alkaline phosphatase assay or osteocalcin-induction 
5 assay was then estimated. The specific activity of the 
BMP was calculated from the ratio of activity to protein 
secreted into the growth medium. 

In one experiment 2E7E-10 and 2EG5 secreted 
similar amounts of total BMP proteins as determined by 

10 PAGE and f luorography. 2E7E-10 produced about 50-fold 
more alkaline phosphatase inducing activity the 2EG5, 
suggesting that the specific activity of the heterodimer 
is about 50-fold higher than thfe homodimer. 

In another ea^eriment the amount of BMP-2 

15 secreted by 2EG5 was about 50% higher than BMP-2/7 

secreted by 2E7E-10, however, 2E7E-10 produced about 10- 
fold more osteocalcin-inducing activity that 2EG5. From 
several different ea^eriments of this type the specific 
activity of the BMP-2/7 heterodimer is estimated to be 

20 between 5 to 50 fold higher than the BMP-2 homodimer. 

Figures 8 and 9 compare the activity of BMP-2 
and BMP-2/7 in the W20 alkaline phosphatase and BGP (Bone 
Gla Protein, osteocalcin) assays. BMP-2/7 has greatly 
increased specific activity relative to BMP-2 (Figure 8) . 

25 From Figure 8, approximately 1.3 ng/ml of BMP-2/7 was 
sufficient to induce 50% of the maximal alkaline 
phosphatase response in W-20 cells. A comparable value 



wo 93/09229 



PCT/US92/09430 



69 

for BMP-2 is difficult to calculate, since the alkaline 
phosphatase response did not maximize, but greater than 
30 ng/ml is needed for a half-maximal response. BMP-2/7 
thus has a 20 to 30-fold higher specific activity than 

5 BMP~2 in the W-20 assay. 

As seen in Figure 9, BMP-2/7 was also a more 
effective stimulator of BGP (bone gla protein, 
osteocalcin) production than BMP-2 in this experiment. 
Treating W-20-17 cells with BMP-2/7 for four days 

0 resulted in a maximal BGP response with 62 ng/ml, and 11 
ng/ml elicits 50% of the maximal BGP response. In 
contrast, maximal stimulation of BGP synthesis by BMP-2 
was not seen with doses up to 468 ng/ml of protein. The 
minimal dose of BMP-2/7 needed to elicit a BGP response 

5 by W-20-17 cells was 3.9 ng/ml, about seven-fold less 

than the 29 ng/ml required of BMP-2. These results were 
consistent with the data obtained in the W-20-17 alkaline 
phosphatase assays for BMP-2 and BMP-2/7. 

Preliminary analysis indicates that BMP-2/6 has 

D a specific activity in vitro similar to that of BMP-2/7. 
The potencies of BMP-2 and BMP-2/6 on induction of 
alkaline phosphatase production in W-20 is compared, as 
shown in Figure 12, BMP-2/6 has a higher specific 
activity than BMP-2 in this assay system. This data is 

5 in good agreement with data obtained from the in vivo 
assay of BMP-2 and BMP-2/6). 



wo 93/09229 



PCr/US92/09430 



70 

B. Tw Vivo Assay 
(i) BMP-2/7 

The ptirified BMP-2/7 and BMP-2 were tested in 
the rat ectopic bone formation assay. A series of 
5 different amounts of BMP-2/7 or BMP-2 were implanted in 
triplicate in rats. After 5 and 10 days, the implants 
were removed and examined histologically for the presence 
of bone and cartilage. The histological scores for the 
amounts of new cartilage and bone formed are summarized 
10 in Table A. 



wo 93/09229 



PCT/US92/09430 



71 



Table A 

5 Day Implants 10 Day Implants 



BMP-2/7 BMP-2 BMP-2/7 BMP-2 



0.04 C ±-± ±-± 

B ±-± 

0.02 C ±1± 212 "±± 

B 1±1 -±- 

1.0 C 1±± ±±± 222 11± 

B 233 11± 

5.0 C 2 2 1 1 ± 1 112 12 1 

B ±-1 4 4 3 232 

25.0 C - ± ± 2 2 2 2 

B 4 4 3 3 3 3 



The euaount of BMP-2/7 rec[uired to induce cartilage and 
bone in the rat ectopic assay is lower than that of BMP- 
2. Histologically, the appearance of cartilage and bone 
induced by BMP-2/7 and BMP-2 are identical. 
5 (ii) BMP-2/6 

The in vivo activity of BMP-2/6 was compared with 
that of BMP-2 by implantation of various amounts of each 
BMP for ten days in the rat ectopic bone formation assay. 
The results of this study (Table B, Figure 13) indicate 
10 that BMP-2/6, similar to BMP-2/7, has increased in vivo 
activity relative to BMP-2. The specific activities of 
BMP-2, BMP-6, and BMP-2/6 are compared in the ectopic 
* bone formation assay ten days after the proteins are 

implanted. The results of these experiments are shown in 
15 Table C and Figure 14. BMP-2/6 is a more potent inducer 

of bone formation than either BMP-2 or BMP-6. The amount 



wo 93/09229 



PCr/US92/09430 



72 

of bone formation observed with BMP-2/6 was comparable 
that observed with equivalent doses of BMP-2/7. The 
appearance of BMP-2/6 implants is quite similar to 
implants containing BMP-2 or BMP-2/7. 

Table B 

Histological scores of Implants of BMP 2/6 and BMP-2 In rat ectopic 
assay (10 day implants). 



10 



BMP U/g) 


C/B 


BMP-2/6 


BMP-2 


0.04 


c 


- ± - 






B. 






0.20 


C 


1 1 ± 




B 


± ± ± 




1.0 


C 


13 3 


1 1 ± 


B 


12 2 


1 1 ± 


5.0 


C 


2 2 2 


12 2 


B 


2 3 3 


2 2 2 


25. 


C 


111 


2 2 1 


B 


3 3 3 


3 3 3 



Table C 

Histological scores of implants of BMP-2, BMP-6, and BMP-2/6 in rat 
ectopic assay (10 day implants). 



20 



BMP U/g) 


C/B 


BMP-2 


BMP-6 


BMP-2/6 


0.04 


c 

B 






— ± 

— ± 


0.20 


C 
B 


- - 2 

— 1 




12 2 
2 2 2 


1.0 


C 
B 


- ± i 

- ± ± 


2 11 
1 ± ± 


111 
3 3 2 


5.0 


C 
B 


2 2 1 
111 


3 13 
2 ± 1 


± ± 1 
4 5 4 


25. 


C 
B 


i ± ± 
5 4 5 


± ± ± 
4 4 5 


± ± ± 
4 5 3 



KyAMPLE 7 - EXPRESSION OF B MP DIMER TN E. COLI 

A biologically active, homodimeric BMP-2 was 
expressed in JEj. coli using the techniques described in 



wo 93/09229 



PCT/US92/09430 



73 

European Patent Application 433,255 with minor 
modifications. Other methods disclosed in the above- 
referenced Etiropean patent application may also be 
employed to produce heterodimers of the present invention 
5 from E, coli . Application of these methods to the 

heterodimers of this invention is anticipated to produce 
active BMP heterodimeric proteins from E. coli. 
A. BMP-2 Expression Vector 

An expression plasmid pALBP2-781 (Figure 

10 7) (SEQ ID NO: 13) was constructed containing the mature 
portion of the BMP-2 (SEQ ID NO: 14) gene and other 
sequences which are described in detail below. This 
plasmid directed the accvunulation of 5-10% of the total 
cell protein as BMP-2 in an E^ coli host strain, GI724, 

15 described below. 

Plasmid pALBP2-781 contains the following 
principal features. Nucleotides 1-2060 contain DNA 
sequences originating from the plasmid pUC-18 [Norrander 
et al, Gene . 26:101-106 (1983)] including sequences 

20 containing the gene for )5-lactamase which confers 

resistance to the antibiotic ampicillin in host E^ coli 
strains, and a colEl-derived origin of replication. 
Nucleotides 2061-2221 contain DNA sequences for the major 
leftward promoter (pL) of bacteriophage X [Sanger et al, 

25 J. Mol. Biol. . 162:729-773 (1982)], including three 

operator sequences, OlI, 0^2 and 0^3. The operators are 
the binding sites for Xcl repressor protein, 



wo 93/09229 



PCrAJS92/09430 



74 

intracellular levels of which control the amoiint of 
transcription initiation from pL. Nucleotides 2222-2723 
contain a strong ribosome binding sequence included on a 
sequence derived from nucleotides 35566 to 35472 and 
38137 to 38361 from bacteriophage lambda as described in 
Sanger et al, 7- mqI . Biol. . 162:729-773 (1982). 
Nucleotides 2724-3133 contain a DNA sequence encoding 
mature BMP-2 protein with an additional 62 nucleotides of 
3 ' -untranslated sequence. 

Nucleotides 3134-3149 provide a "Linker" DNA 
sequence containing restriction endonudease sites. 
Nucleotides 3150-3218 provide a transcription termination 
sequence based on that of the E-. coli aspA gene [Takagi 
et al, TJiml. Acids Res. . 13:2063-2074 (1985)]. 
Nucleotides 3219-3623 are DNA sequences derived from pDC- 
18. 

As described below, when cultured under 
the appropriate conditions in a suitable E^. coli host 
strain, pALBP2-781 can direct the production of high 
levels (approximately 10% of the total cellular protein) 

of BMP-2 protein. 

pAIJ3P2-781 was transformed into the £^ coj-j 
host strain GI724 (F, lacl', lacp", ampC: :XcI+) by the 
procedure of Dagert and Ehrlich, Gene. 6:23 (1979). [The 
ointransformed host strain la. coli GI724 was deposited 
with the American Type Culture Collection, 12301 Parklawn 
Drive, Rockville, Maryland on January 31, 1991 under ATCC 



wo 93/09229 



PCT/US92/09430 



75 

No. 55151 for patent purposes pursuant to applicable laws 
and regulations.] Transf ormants were selected on 1.5% 
w/v agar plates containing IMC medium, which is composed 
of M9 medilun [Miller, "Experiments in Molecular 
5 Genetics", Cold Spring Harbor Laboratory, New York 

(1972)] supplemented with 0.5% w/v glucose, 0.2% w/v 
casamino acids and 100 m9/iq1 ampicillin. 

GI724 contains a copy of the wild-type Xcl 
repressor gene stably integrated into the chromosome at 

10 the amp C locus, where it has been placed under the 

transcriptional control of Salmonella tvphimurium trp 
promoter /operator sequences. In GI724, Xcl protein is 
made only during growth in tryptophan-f ree media, such as 
minimal media or a minimal medium supplemented with 

15 casamino acids such as IMC, described above. Addition of 
tryptophan to a culture of GI724 will repress the trp 
promoter and turn off synthesis of Xcl, gradually causing 
the induction of transcription from pL promoters if they 
are present in the cell. 

20 GI724 transformed with pALBP2-781 was 

grown at 37**C to an A^^q of 0.5 (Absorbence at 550 nm) in 
IMC medium. Tryptophan was added to a final 
concentration of 100 fig/ml and the culture incubated for 
a further 4 hours. During this time BMP-2 protein 

25 accumulated to approximately 10% of the total cell 
protein, all in the "inclusion body" fraction. 

BMP-2 is recovered in a non-soluble. 



wo 93/09229 



PCr/US92/09430 



76 

monomeric form as follows. Cell disruption and recovery 
is performed at 4«C. Approximately 9 g of the wet 
fermented E,_coli GI724/pAIBP2-781 cells are suspended in 
30 mL of 0.1 M Tris/HCl, 10 mM EDTA, 1 mM phenyl methyl 
5 sulphonyl fluoride (PMSF) , pH 8.3 (disruption buffer). 

The cells are passed four times through a cell disrupter 
and the volume is brought to 100 mL with the disruption 
buffer. The suspension is centrifuged for 20 min. 
(15,000 X g). The pellet obtained is suspended in 50 mL 

10 disruption buffer containing 1 M NaCl and centrifuged for 
10 min. as above. The pellet is suspended in 50 mL 
disruption buffer containing 1% Triton X-100 (Pierce) and 
again centrifuged for 10 min. as above. The washed 
pellet is then suspended in 25 mL of 20 mM Tris/HCl, 1 mM 

15 EDTA, 1 mM PMSF, 1% DTT, pH 8.3 and homogenized in a 
glass homogenizer. The resulting suspension contains 
crude monomeric BMP-2 in a non-soluble form. 

Ten mL of the BMP-2 suspension, obtained 
as described above, are acidified with 10% acetic acid to 

20 pH 2.5 and centrifuged in an Eppendorf centrifuge for 10 
min. at room temperature. The supernatant is 
chromatographed. Chromatography was performed on a 
Sephacryl S-100 HR column (Pharmacia, 2.6 x 83 cm) in 1% 
acetic acid at a flow rate of 1.4 mL/minute. Fractions 

25 containing monomeric, BMP-2 are pooled. This material is 
used to generate biologically active, homodimer BMP-2. 

Biologically active, homodimer ic BMP-2 can 



wo 93/09229 



PCT/US92/09430 



77 

be generated from the monomeric BMP-2 obtained following 
solubilization and purification, described above, as 
follows. 

0.1, 0.5 or 2.5 mg of the BMP-2 is 
5 dissolved at a concentration of 20, 100 or 500 /ig/mL, 

respectively, in 50 mM Tris/HCl, pH 8.0, 1 M NaCl, 5 mM 
EDTA, 2 mM reduced glutathione, 1 mM oxidized glutathione 
and 33 mM CHAPS [Calbiochem] . After 4 days at 4**C or 
23*»C, the mixture is diluted 5 to 10 fold with 0.1% TFA. 

10 Purification of biologically active BMP-2 

is achieved by subjecting the diluted mixture to reverse 
phase HPLC on a a Vydac C4 214TP54 column (25 x .46 cm) 
[The NEST Group, USA] at a flow rate of 1 ml /minute. 
Buffer A is 0.1% TFA. Buffer B is 90% acetonitrile, and 

15 0.1% TFA. The linear gradient was 0 to 5 minutes at 20% 
Buffer B; 5 to 10 minutes at 20 to 30 % Buffer B; 10 to 
40 minutes at 30 to 60% Buffer B; and 40 to 50 minutes at 
60 to 100% Buffer B. Homodimeric BMP-2 is eluted and 
collected from the HPLC column. 

20 The HPLC fractions are lyophilized to 

dryness, redissolved in sample buffer (1.5 M Tris-HCl, pH 
8.45, 12% glycerol, 4% SDS, .0075% Serva Blue G, .0025% 
Phenol Red, with or without 100 mM dithiothreitol) and 
heated for five minutes at 95*'C. The running buffer is 

25 100 mM Tris, 100 mM tricine (16% tricine gel) [Novex] , 

0.1% SDS at pH 8.3. The SDS-PAGE gel is run at 125 volts 
for 2.5 hours. 



wo 93/09229 



PCr/US92/09430 



78 

The gel is stained for one hour with 200 
ml of 0.5% Coomassie Brilliant Blue R-250, 25% 
isopropanol, 10% acetic acid, heated to 60»C. The gel is 
then destained with 10% acetic acid, 10% isopropanol 

5 until the background is cle2u:. 

The reduced material ran at approximately 
13kD; the non-reduced material ran at approximately 30 
kD, which is indicative of the BMP-2 dimer. This 
material was later- active in the W20 assay of Example 8. 

0 B . BMP-7 Expression Vector 

For high level expression of BMP-7 a 
plasmid pALBMP7-981 was constrxicted. pAlBMP7-981 is 
identical to plasmid pALBP2-781 with two exceptions: the 
BMP-2 gene (residues 2724-3133 of pALBP2-781) is replaced 

5 by the mature portion of the BMP-7 gene, deleted for 

sequenced encoding the first seven residues of the mature 
BMP-7 protein sequence: 



wo 93/09229 



PCr/US92/09430 



79 



ATGTCTCATAATC GTTCTAAAAC TCCAAAAAAT CAAGAAGCTC TGCXiTATGGC 



CAACGTGGCA 


GAGAACAGCA 


GCAGCGACCA 


GAGGCAGGCC 


TGTAAGAAGC 


ACGAGCTGTA 


TGTCAGCTTC 


CGAGACCTGG 


GCTGGCAGGA 


CTGGATCATC 


GCGCCTGAAG 


GCTACGCCGC 


CTACTACTGT 


GAGGGGGAGT 


GTGCCTTCCC 


TCTGAACTCC 


TACATGAACG 


CCACCAACCA 


CGCCATCGTG 


CAGACGCTGG 


TCCACTTCAT 


GAACCCGGAA 


ACGGTGCCCA 


AGGCCTGCTG 


TGOSCCCACG 


CAGCTCAATG 


CCATCTCCGT 


CCTCTACTTC 


GATGACAGCT 


CCAACGTCAT 


CCTGAAGAAA 


TACAGAAACA 


TGGTGGTCCG 


GGCCTGTGGC 


TGCCACTAGC 


TCCrCCGAGA 


ATTCAGACCC 


TTTGGGGCCA 


AGTTTTTCrG 


GATCCT 



10 and the ribosone binding site found between residues 

. 2707 and 2723 in pALBP2-781 is replaced by a different 
ribosome binding site, based on that found preceding the 
T7 phage gene 10, of sequence 5 ' -CAAGAAGGAGATATACAT-3 ' . 
The host strain and growth conditions used for the 
15 production of BMP-7 were as described for BMP-2. 

C. BMP-3 Expression Vector 

For high level expression of BMP-3 a 
plasmid pALB3-782 was constructed. This plasmid is 
identical to plasmid pALBP2-781, except that the BMP-2 
20 gene (residues 2724-3133 of pALBP2-781) is replaced by a 
gene encoding a form of mature BMP-3 . The sequence of 
this BMP-3 gene is: 



wo 93/09229 



PCr/US92/09430 



80 

ATGCGTAAAC AATGGATTGA ACCACGTAAC TGTGCTCGTC GTrATCTGAA 
AGTAGACITT GCAGATATTG GCTGGAGTGA ATGGATTATC TCCCCCAAGT 
CCITTGATGC CTATTATTGC TCTGGAGCAT GCCAGTTCCC CATGCCAAAG 
TCTTTGAAGC CATCAAATCA TGCTACCATC CAGAGTATAG TGAGAGCTGT 
5 GGGGGTCGTT CCTGGGATTC CTGAGCCTTG CTGTGTACCA GAAAAGATGT 

CCrCACrCAG TATnTAITC TTTGATGAAA ATAAGAATGT AGTGCITAAA 
GTATACCCTA ACATGACAGT AGAGTCITGC GCTTGCAGAT AACCTGGCAA 
AGAACTCATT TGAATGCTTA ATTCAAT 

The host strain and growth conditions used for the 
10 production of BMP-3 were as described for BMP-2. 

D* Expression of a BNP-2/7 He terodimer in E. 

coli 

Denatured and purified coli BMP-2 and BMP-7 
monomers were isolated from E^. coli inclusion body 
15 pellets by acidification and gel filtration as previously 
as previously described above. 125 ug of each BMP in 1% 
acetic acid were mixed and taken to dryness in a speed 
vac. The material was resuspended in 2.5 mi 50 mM Tris, 
1.0 NaCl^ 5 mM EDTA^ 33 mM CHAPS, 2 mM glutathione 
20 (reduced), 1 mM glutathione (oxidized), pH 8.0. The 
sample was incubated at 23 C for one week. 

The BMP-2/ 7 heterodimer was isolated by 
HPLC on a 25 X 0.46 cm Vydac C4 column. The sample was 
centrifuged in a microfuge for 5 minutes, and the 
25 supernatant was diluted with 22.5 ml 0.1% TFA. 

A buffer : 0.1% TFA 

B buffer : 0.1% TFA, 95% acetonitrile 



wo 93/09229 



PCT/US92/09430 



81 

1.0 ml /minute 

0-5' 20% B 

5-10' 20-30% B 

10-90' 30-50% B 
5 90-100' 50-100% B 

By SDS-PAGE analysis, the BMP-2/7 heterodimer eluted at 
about 23' . 

Figure 10 is a comparison of the W-20 activity of E. 
coli BMP-2 and BMP-2/7 heterodimer, indicating greater 
10 activity of the heterodimer. 

F. Ex pression of BMP-2/ 3 Heterodimer in E. 

coli 

BMP-2 and BMP-3 monomers were isolated as 
follows: to 1.0 g of frozen harvested cells expressing 
15 either BMP-2 or BMP-3 was added 3.3 ml of 100 mM Tris, 10 
mM EDTA, pH 8.3. The cells were resuspended by vortexing 
vigorously. 33 ul of 100 mM PMSF in isopropanol was 
added and the cells lysed by one pass through a French 
pressure cell. The lysate was centrifuged in a microfuge 
20 for 20 minutes at 4 C. The supernatant was discarded. 

The inclusion body pellet was taken up in 8.0 M quanidine 
hydrochloride, 0.25 M OTT, 0.5 M Tris, 5 mM EDTA, pH 8.5, 
and heated at 37 C for one hour. 

The reduced and denatured BMP monomers were isolated 
25 by HPLC on a Supelco C4 guard column as follows: 

A buffer : 0.1% TFA 

B buffer : 0.1% TFA, 95% acetonitrile 



wo 93/09229 



PCT/US92/09430 



82 

1.0 nl/ninute 

0-5' 1% B 

5-40' 1-70% B 

40-45' 70-100% B 
5 Monomeric BMP eluted at 28-30' '. Protein concentration 
was estimated by A280 and the appropriate extinction 
coefficient. 

10 ug of BMP-2and BMP-3 were combined and taken to 
dryness in a speed vac. To this was added 50 ul of 50 

10 mM Tris, 1.0 M NaCl, 5 mM EDTA, 33 mM CHAPS, 2 mM reduced 
glutathione, 1 mM oxidized glutathione, pH 8.5. The 
sample was incubated at 23 for 3 days. The sample was 
analyzed by SDS-PAGE on a 16% tricine gel under reducing 
and nonreducing conditions. The BMP-2/3 heterodimer 

15 migrated at about 35 kd nonreduced, and reduced to BMP-2 
monomer at about 13 kd and BMP-3 monomer at about 21 kd. 

BMP-2/3 heterodimer produced in E. coli is 
tested for in vivo activity. (20 nq) at (ten days) is 
utilized to compare the in vivo activity of BMP-2/3 to 

20 BMP-2. BMP-2/3 implants showed no cartilage or bone 

forming activity, while the BMP-2 control implants showed 
the predicted amounts of bone and cartilage formation. 
The in vivo data obtained with BMP-2/3 is consistent with 
the in vitro data from the W-20 assay. 



wo 93/09229 PCr/US92/09430 

83 

EXAMPLE 8 - W-20 BIOASSAYS 

A. Description of W-20 cells 

Use of the W-20 bone marrow stromal cells 
as an indicator cell line is based upon the conversion of 
5 these cells to osteoblast- like cells after treatment with 
BMP-2 [R. S. Thies et al, "Bone Morphogenetic Protein 
alters W-20 stromal cell differentiation in vitro", 
Journal of Bone and Mineral Research , 5(2):305 (1990); 
and R. S. Thies et al, "Recombinant Human Bone 

10 Morphogenetic Protein 2 Induces Osteoblastic 

Differentiation in W-20-17 Stromal Cells", Endocrinology . 
in press (1992) ]• Specifically, W-20 cells are a clonal 
bone marrow stromal cell line derived from adult mice by 
researchers in the laboratory of Dr. D. Nathan, 

15 Children's Hospital, Boston, MA. BMP-2 treatment of W-20 
cells results in (1) increased alkaline phosphatase 
production, (2) induction of PTH stimulated cAMP, and (3) 
induction of osteocalcin synthesis by the cells. While 
(1) and (2) represent characteristics associated with the 

20 osteoblast phenotype, the ability to synthesize 

osteocalcin is a phenotypic property only displayed by 
mature osteoblasts. Furthermore, to date we have 
observed conversion of W-20 stromal cells to osteoblast- 
like cells only upon treatment with BMPs. In this 

25 manner, the in vitro activities displayed by BMP treated 
W-20 cells correlate with the in vivo bone forming 
activity known for BMPs. 



wo 93/09229 



PCr/US92/09430 



84 

Below two in vitro assays useful in comparison 
of BMP activities of novel osteoinductive molecules are 
described. 

B. W-20 Alkaline Phosphatase Assav Protocol 
5 W-20 cells are plated into 96 well tissue 

culture plates at a density of 10,000 cells per well in 
200 Ml of media (DME with 10% heat inactivated fetal calf 
serum, 2 mM glutamine and 100 U/ml + 100 ng/nl 
streptomycin. The cells are allowed to attach overnight 
10 in a 95% air, 5% COj incubator at BV^C. 

The 200 fil of media is removed from each 
well with a multichannel pipettor and replaced with an 
equal volume of test sample delivered in DME with 10% 
heat inactivated fetal calf serum, 2 mM glutamine and 1% 
15 penicillin-streptomycin. Test substances are assayed in 
triplicate. 

The test samples and standards are allowed 
a 24 hour incubation period with the W-20 indicator 
cells. After the 24 hours, plates are removed from the 
20 sy^C incubator and the test media are removed from the 
cells. 

The W*20 cell layers are washed 3 times 
with 200 fil per well of calcium/magnesium free phosphate 
buffered saline and these washes are discarded. 
25 50 Ml of glass distilled water is added to 

each well and the assay plates are then placed on a dry 
ice/ethanol bath for quick freezing. Once frozen, the 



wo 93/09229 



PCr/US92/09430 



85 

assay plates are removed from the dry ice/ethanol bath 
and thawed at 37®C. This step is repeated 2 more times 
for a total of 3 freeze-thaw procedures. Once complete, 
the membrane bound alkaline phosphatase is available for 
5 measurement • 

50 ^1 of assay mix (50 mM glycine, 0.05% 
Triton X-100, 4 mM MgClj, 5 mM p-nitrophenol phosphate, pH 
e= 10.3} is added to each assay well and the assay plates 
are then incubated for 30 minutes at 37 *C in a shaking 
10 waterbath at 60 oscillations per minute. 

At the end of the 30 minute incubation, 
the reaction is stopped by adding 100 /il of 0.2 N NaOH to 
each well and placing the assay plates on ice. 

The spectrophotometric absorbance for each 
15 well is read at a wavelength of 405 nanometers. These 
values are then compared to known standards to give an 
estimate of the alkaline phosphatase activity in each 
sample. For example, using known amounts of p- 
nitrophenol phosphate, absorbance values are generated. 
20 This is shown in Table I. 



Table I 

Absorbance Values for Known Standards 
of P-Nitrophenol Phosphate 

25 P-nitrophenol phosphate umoles Mean absorbance (405 nm^ 

0.000 
0.006 
0.012 
0.018 



0 

0.261 +/- .024 

0.521 +/- .031 

0.797 +/- .063 



wo 93/09229 



PCr/US92/09430 



86 



10 



0.024 1-074 +/- .061 

0.030 1-305 +/- -083 



Absorbance values for known amounts of 
BMP-2 can be determined and converted to (moles of p- 
nitrophenol phosphate cleaved per unit time as shown in 
Table II. 

Table II 

Alkaline Phosphatase Values for W-20 Cells 
Treating with BMP-2 

BMP-2 concentration Absorbance Reading umoles substrate 
nt y/ml ^05 nmeters per hour 



0 



0.645 0.024 

1R 1 56 0.696 • 0.026 

^ I'll 0.765 0.029 

6*25 0,923 0.036 

12.50 1.121 0.044 

25 0 1.457 0.058 

20 50 0 1.662 0.06.7 

^ loS.O 1.977 0.080 



These values are then used to compare the 
activities of known amounts of BMP heterodimers to BMP-2 
25 homodimer. 

C. osteocalcin RIA Protocol 

W-20 cells are plated at 10* cells per well 
in 24 well multiwell tissue culture dishes in 2 mis of 
DME containing 10% heat inactivated fetal calf serum, 2 
30 mM glutamine. The cells are allowed to attach overnight 
in an atmosphere of 95% air 5% COj at 37«C. 

The next day the medium is changed to DME 



wo 93/09229 



PCr/US92/09430 



87 

containing 10% fetal calf serum, 2 mM glutamine and the 
test substance in a total voluBe of 2 ml. Each test 
substance is administered to triplicate wells. The test 
substances are incubated with the W-20 cells for a total 
5 of 96 hours with replacement at 48 hours by the same test 
medias . 

At the end of 96 hours, 50 /xl of the test 
media is removed from each well and assayed for 
osteocalcin production using a radioimmunoassay for mouse 

10 osteocalcin. The details of the assay are described in 

the kit manufactured by Biomedical Technologies Inc., 378 
Page Street, Stoughton, MA 02072. Reagents for the 
assay are found as product numbers BT-431 (mouse 
osteocalcin standard), BT-432 (Goat anti-mouse 

15 Osteocalcin), BT-431R (iodinated mouse osteocalcin), BT- 
415 (normal goat senam) and BT-414 (donkey anti goat 
IgG) . The RIA for osteocalcin synthesized by W-20 cells 
in response to BMP treatment is carried out as described 
in the protocol provided by the manufacturer. 

20 The values obtained for the test samples 

are compared to values for known standards of mouse 
osteocalcin and to the amount of osteocalcin produced by 
W-20 cells in response to challenge with known amounts of 
BMP-2. The values for BMP-2 induced osteocalcin 

25 synthesis by W-20 cells is shown in Table III. 



wo 93/09229 



PCr/US92/09430 



88 



Table III 



5 



10 



Osteocalcin Synthesis by W-20 Cells 
o »«+.^a4-<«T, i^rr/tni Osteocalcin Synthesis nq/well 


0 


0.8 


2 


0.9 


4 


0.8 


8 


2.2 


16 


2.7 


31 


3.2 


62 


5.1 


125 


6.5 


250 


8.2 


500 


9.4 


1000 


10. 0 



T:YaMPr.E 9 - posen modtpied sam path-reddi assay 

A modified version of the rat bone forination 
assay described in Sampath and Reddi, Proc. ^^tlt Acad. 

20 sei. USA . SO: 6591-6595 (1983) is used to evaluate bone 

and/or cartilage activity of BMP proteins. This modified 
assay is herein called the Rosen-modified Sampath-Reddi 
assay. The ethanol precipitation step of the Sampath- 
Reddi procedure is replaced by dialyzing (if the 

25 composition is a solution) or diafiltering (if the 

composition is a suspension) the fraction to be assayed 
against water. The solution or suspension is then 
redissolved in 0.1% TFA, and the resulting solution added 
to 20 mg; of rat matrix. A mock rat matrix sample not 

30 treated with the protein serves as a control. This 
material is frozen and lyophilized and the resulting 
powder enclosed in #5 gelatin capsules. The capsules are 



wo 93/09229 



PCT/US92/09430 



89 

implanted subcutaneously in the abdominal thoracic area 
of 21-49 ay old male Long Evans rats. The implants are 
removed after 7-14 days. Half of each implant is used 
for alkaline phosphatase analysis [see, A. H. Reddi et 
5 al, Proc. Natl, Acad. Sci. . 69:1601 (1972)]. 

The other half of each implant is fixed and 
processed for histological analysis. 1 fim 
glycolmethacrylate sections are stained with Von Kossa 
and acid fuschin to score the amount of induced bone and 

10 cartilage formation present in each implant. The terms 
+1 through +5 represent the area of each histological 
section of an implant occupied by new bone and/ or 
cartilage cells and matrix. A score of +5 indicates that 
greater than 50% of the implant is new bone and/or 

15 cartilage produced as a direct result of protein in the 
implant. A score of +4/ +3, +2, and +1 would indicate 
that greater than 40%, 30%, 20% and 10% respectively of 
the implant contains new cartilage and/or bone. 

The heterodimeric BMP proteins of this 

20 invention may be assessed for activity on this assay. 

Numerous modifications and variations in 
practice of this invention are expected to occur to those 
skilled in the art. Such modifications and variations 
are encompassed within the following claims. 



WOW/09K9 - PCr/USM/0»430 

90 

SEQUENCE LISTING 

(1) GENERAL INFORMATION: 

(i) APPLICANT: Israel, David 

Wolfman, Neil M. 

(ii) TITLE OF INVENTION: Recombinant Bone Morphogenetic Protein 
Heterodimers, Compositions and Methods of Use. 

(iii) NUMBER OF SEQUENCES: 30 

(iv) CORRESPONDENCE ADDRESS: 

(A) ADDRESSEE: Legal Affairs, Genetics Institute, Inc, 

(B) STREET: 87 CambridgeParlc Drive 

(C) CITY: Cambridge 

(D) STATE: MA 

(E) COUNTRY: USA 

(F) ZIP: 02140-2387 

(V) COMPUTER READABLE FORM: 

(A) MEDIUM TYPE: Tape 

(B) COMPUTER: IBM PC compatible 

(C) OPERATING SYSTEM: PC-DOS/MS-DOS 

(D) SOFTWARE: Patentin Release #1.0, Version #1.25 

(Vi) CURRENT APPLICATION DATA: 

(A) APPLICATION NUMBER: US 

(B) FILING DATE: 

(C) CLASSIFICATION: 

(Viii) ATTORNEY/AGENT INFORMATION: 

(A) NAME: Kapinos, Ellen J. 

(B) REGISTRATION NUMBER: 32,245 

(C) REFERENCE/DOCKET NUMBER: GI-5192B 

(ix) TELECOMMUNICATION INFORMATION: 

(A) TELEPHONE: 617-876-1170 

(B) TELEFAX: 617-876-5851 



!) INFORMATION FOR SEQ ID N0:1: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 1607 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: double 

(D) TOPOLOGY: unknown 

(ii) MOLECULE TYPE: DNA (genomic) 



(ix) FEATURE: 

(A) NAME/KEY: CDS 

(B) LOCATION: 356.. 1543 



(Xi) SEQUENCE DESCRIPTION: SEQ ID N0:1: 



wo 93/09229 PCr/US92/09430 

91 

GTCGACTCTA GAGTGTGTGT CAGCACTTGG CTGGGGACTT CTTGAACTTG CAGGGAGAAT 60 

AACTTGCGCA CCCCACTTTG CGCCGGTGCC TTTGCCCCAG CGGAGCCTGC TTCGCCATCT 12 0 

CCGAGCCCCA CCGCCCCTCC ACTCCTCGGC CTTGCCCGAC ACTGAGACGC TGTTCCCAGC 18 0 

GTGAAAAGAG AGACTGCGCG GCCGGCACCC GGGAGAAGGA GGAGGCAAAG AAAAGGAACG 240 

GACATTCGGT CCTTGCGCCA GGTCCTTTGA CCAGAGTTTT TCCATGTGGA CGCTCTTTCA 3 00 

ATGGACGTGT CCCCGCGTGC TTCTTAGACG GACTGCGGTC TCCTAAAGGT CGACC ATG 3 58 

Met 
1 

GTG GCC GGG ACC CGC TGT CTT CTA GCG TTG CTG CTT CCC GAG GTC CTC 406 
Val Ala Gly Thr Arg Cys Leu Leu Ala Leu Leu Leu Pro Gin Val Leu 
5 10 15 

CTG GGC GGC GCG GCT GGC CTC GTT CCG GAG CTG GGC CGC AGG AAG TTC 4 54 

Leu Gly Gly Ala Ala Gly Leu Val Pro Glu Leu Gly Arg Arg Lys Phe 
20 25 30 

-GCG GCG GCG TCG TCG GGC CISC CCC TCA TCC CAG CCC TCT GAC GAG GTC 502 
Ala Ala Ala Ser Ser Gly Arg Pro Ser Ser Gin Pro Ser Asp Glu Val • 
35 40 45 

CTG AGC GAG TTC GAG TTG CGG CTG CTC AGC ATG TTC GGC CTG AAA CAG 550 
Leu Ser Glu Phe Glu Leu Arg Leu Leu Ser Met Phe Gly Leu Lys Gin 
50 55 60 65 

AG A CCC ACC CCC AGC AGG GAC GCC GTG GTG CCC CCC TAC ATG CTA GAC 598 
Arg Pro Thr Pro Ser Arg Asp Ala Val Val Pro Pro Tyr Met Leu Asp 
70 75 BO 

CTG TAT CGC AGG CAC TCA GGT CAG CCG GGC TCA CCC GCC CCA GAC CAC 64 6 

Leu Tyr Arg Arg His Ser Gly Gin Pro Gly Ser Pro Ala Pro Asp His 
85 90 95 

CGG TTG GAG AGG GCA GCC AGC CGA GCC AAC ACT GTG CGC AGC TTC CAC 694 
Arg Leu Glu Arg Ala Ala Ser Arg Ala Asn Thr Val Arg Ser Phe His 
100 105 110 

CAT GAA GAA TCT TTG GAA GAA CTA CCA GAA ACG AGT GGG AAA ACA ACC 74 2 

His Glu Glu Ser Leu Glu Glu Leu Pro Glu Thr Ser Gly Lys Thr Thr 
115 120 125 

CGG AGA TTC TTC TTT AAT TTA AGT TCT ATC CCC ACG <;AG GAG TTT ATC 790 
Arg Arg Phe Phe Phe Asn Leu Ser Ser lie Pro Thr Glu Glu Phe lie 
130 135 140 145 

ACC TCA GCA GAG CTT CAG GTT TTC CGA GAA CAG ATG CAA GAT GCT TTA 838 
Thr Ser Ala Glu Leu Gin Val Phe Arg Glu Gin Met Gin Asp Ala Leu 
150 155 160 

GGA AAC AAT AGC AGT TTC CAT CAC CGA ATT AAT ATT TAT <;AA ATC ATA 886 
Gly Asn Asn Ser Ser Phe His His Arg He Asn He Tyr Glu He He 
165 170 175 



AAA CCT GCA ACA GCC AAC TCG AAA TTC CCC GTG ACC AGA CTT TTG GAC 
Lys Pro Ala Thr Ala Asn Ser Lys Phe Pro Val Thr Arg Leu ^Leu Asp 



934 



wo 93/09229 



PCTAJS92/09430 



92 



180 



185 



190 



ACC AGG TTG GTG AAT CAG AAT GCA AGC AGG TGG GAA ACT TTT GAT GTC 
Thr Arg Leu Val Asn Gin Asn Ala Ser Arg Trp Glu Thr Phe Asp Val 
195 200 205 

ACC CCC GCT GTG ATG CGG TGG ACT GCA CAG GGA CAC GCC AAC CAT 6GA 

Thr Pro Ala Val Met Arg Trp Thr Ala Gin Gly His Ala Asn His Gly 
210 215 220 225 

TTC GTG GTG GAA GTG GCC CAC TTG GAG GAG AAA CAA GGT GTC TCC AAG 
Phe val val Glu Val Ala His Leu Glu Glu Lys Gin Gly Val Ser Lys 
230 235 240 

AGA CAT GTT AGG ATA AGC AGG TCT TTG CAC CAA GAT GAA CAC AGC TGG 
Arg His val Arg He Ser Arg Ser Leu His Gin Asp Glu His Ser Trp 
245 250 255 

TCA CAG ATA AGG CCA TTG CTA GTA ACT TTT GGC CAT GAT GGA AAA GGG 
Ser Gin He Arg Pro Leu Leu Val Thr Phe Gly His Asp Gly Lys Gly 
260 265 270 

CAT CCT CTC CAC AAA AGA GAA AAA CGT CAA GCC AAA CAC AAA CAG CGG 
His Pro Leu His Lys Arg Glu Lys Arg Gin Ala Lys His Lys Gin Arg 
275 280 285 

AAA CGC CTT AAG TCC AGC TGT AAG AGA CAC CCT TTG TAC GTG GAC TTC 
Lys Arg Leu Lys Ser Ser Cys Lys Arg His Pro Leu Tyr Val Asp Phe 
290 295 300 305 

AGT GAC GTG GGG TGG AAT GAC TGG ATT GTG GCT CCC CCG GGG TAT CAC 
Ser Asp Val Gly Trp Asn Asp Trp He Val Ala Pro Pro Gly Tyr His 
310 315 320 

GCC TTT TAC TGC CAC GGA GAA TGC CCT TTT CCT CTG GCT GAT CAT CTG 
Ala Phe Tyr Cys His Gly Glu Cys Pro Phe Pro Leu Ala Asp His Leu 
325 330 335 

AAC TCC ACT AAT CAT GCC ATT GTT CAG ACG TTG GTC AAC TCT GTT AAC 
Asn Ser Thr Asn His Ala He Val Gin Thr Leu Val Asn Ser Val Asn 
340 345 350 

TCT AAG ATT CCT AAG GCA TGC TGT <3TC CCG ACA GAA CTC AGT GCT ATC 
Ser Lys He Pro Lys Ala Cys Cys Val Pro Thr Glu Leu Ser Ala He 
355 360 365 

TCG ATG CTG TAC CTT GAC GAG AAT GAA AAG GTT GTA TTA AAG AAC TAT 
Ser Met Leu Tyr Leu Asp Glu Asn Glu Lys Val Val Leu Lys Asn Tyr 
370 375 380 385 

CAG GAC ATG GTT GTG GAG GGT TGT GGG TGT CGC TAGTACAGCA AAATTAAATA 
Gin Asp Met Val Val Glu Gly Cys Gly Cys Arg 
390 395 



982 



1030 



1078 



1126 



1174 



1222 



1270 



1318 



1366 



1414 



1462 



1510 



1563 



CATAAATATA TATATATATA TATATTTTAG AAAAAAGAAA AAAA 



1607*^ 



(2) INFORMATION FOR SEQ ID NO: 2: 

(i) SEQUENCE CHARACTERISTICS: 



wo 93/09229 PCT/US92/09430 

93 

(A) LENGTH: 396 amino acids 

(B) TYPE: aTnino acid 
(D) TOPOI.OGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2: 

Met Val Ala Gly Thr Arg Cys Leu Leu Ala Leu Leu Leu Pro Gin Val 
15 10 15 

Leu Leu Gly Gly Ala Ala Gly Leu Val Pro Glu Leu Gly Arg Arg Lys 
20 25 30 

Phe Ala Ala Ala Ser Ser Gly Arg Pro Ser Ser Gin Pro Ser Asp Glu 
35 40 45 

Val Leu Ser Glu Phe Glu Leu Arg Leu Leu Ser Met Phe Gly Leu Lys 
50 55 60 

Gin Arg Pro Thr Pro Ser Arg Asp Ala Val Val Pro Pro Tyr Met Leu 
65 70 - 75 80 

Asp Leu Tyr Arg Arg Hi§ Ser Gly Gin Pro Gly Ser Pro Ala Pro Asp 
85 90 95 

His Arg Leu Glu Arg Ala Ala Ser Arg Ala Asn Thr Val Arg Ser Phe 
100 105 110 

His His Glu Glu Ser Leu Glu Glu Leu Pro Glu Thr Ser Gly Lys Thr 
115 120 125 

Thr Arg Arg Phe Phe Phe Asn Leu Ser Ser lie Pro Thr Glu Glu Phe 
130 135 140 

He Thr Ser Ala Glu Leu Gin Val Phe Arg Glu Gin Met Gin Asp Ala 
145 150 155 160 

Leu Gly Asn Asn Ser Ser Phe His His Arg He Asn He Tyr Glu He 
165 ' 170 175 

He Lys Pro Ala Thr Ala Asn Ser Lys Phe Pro Val Thr Arg Leu Leu 
180 185 190 

Asp Thr Arg Leu Val Asn Gin Asn Ala Ser Arg Trp Glu Thr Phe Asp 
195 200 205 

Val Thr Pro Ala Val Met Arg Trp Thr Ala Gin Gly His Ala Asn His 
210 215 220 

Gly Phe Val Val Glu Val Ala His Leu Glu Glu Lys Gin Gly Val Ser 
225 230 235 240 

Lys Arg His Val Arg He Ser Arg Ser Leu His Gin Asp Glu His Ser 
245 250 255 

Trp Ser Gin He Arg Pro Leu Leu Val Thr Phe Cly His Asp Gly Lys 
260 265 270 

Gly His Pro Leu His Lys Arg Glu Lys Arg Gin Ala Lys His Lys Gin 



wo 93/09229 PCr/US92/09430 

94 

275 280 285 

Arg Lys Arg Leu Lys Ser Ser Cys Lys Arg His Pro Leu Tyr Val Asp 
290 295 300 

Phe Ser Asp Val Gly Trp Asn Asp Trp lie Val Ala Pro Pro Gly Tyr 
305 310 315 320 

His Ala Phe Tyr Cys His Gly Glu Cys Pro Phe Pro Leu Ala Asp His 
325 . 330 335 

Leu Asn Ser Thr Asn His Ala lie Val Gin Thr Leu Val Asn Ser Val ' 
340 345 350 

Asn Ser Lys lie Pro Lys Ala Cys Cys Val Pro Thr Glu Leu Ser Ala 
355 360 365 

lie Ser Met Leu Tyr Leu Asp Glu Asn Glu Lys Val Val Leu Lys Asn 
370 375 380 

Tyr Gin Asp Met Val Val Glu Gly Cys Gly Cys Arg 
385 390 . 395 

(2) INFORMATION FOR SEQ ID NO: 3: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 1954 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: double 

(D) TOPOLOGY: unknown 

(ii) MOLECULE TYPE: DNA (genomic) 

(ix) FEATURE: 

(A) NAME/KEY: CDS 

(B) LOCATION: 403 ,.1626 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3: 

CTCTAGAGGG CAGAGGAGGA GGGAGGGAGG GAAGGAGCGC GGAGCCCGGC CCGGAAGCTA 60 

GGTGAGTGTG GCATCCGAGC TGAGGGACGC GAGCCTGAGA CGCCGCTGCT GCTCCGGCTG 120 

AGTATCTAGC TTGTCTCCCC GATGGGATTC CCGTCCAAGC TATCTCGAGC CTGCAGCGCC 180 

ACAGTCCCCG GCCCTCGCCC AGGTTCACTG CAACCGTTCA GAGGTCCCCA GGAGCTGCTG 24 0 

CTGGCGAGCC CGCTACTGCA GGGACCTATG GAGCCATTCC GTAGTGCCAT CCCGAGCAAC 300 

GCACTGCTGC AGCTTCCCTG AGCCTTTCCA GCAAGTTTGT TCAAGATTGG CTGTCAAGAA 3 6.0 

TCATGGACTG TTATTATATG CCTTGTTTTC TGTCAAGACA CC ATG ATT CCT -GGT 414 , 

Met lie Pro Gly 
1 

AAC CGA ATG CTG ATG GTC GTT TTA TTA TGC CAA GTC CTG CTA GGA GGC 4 62 j 

Asn Arg Met Leu Met Val Val Leu Leu Cys Gin Val Leu Leu Gly Gly 
5 10 15 20 



wo 93/09229 



PCT/US92/09430 



95 

GCG AGC CAT OCT ACT TTG ATA CCT GAG ACG GGG AAG AAA AAA GTC GCC 510 
Ala Ser His Ala Ser Leu lie Pro Glu Thr Gly Lys Lys Lys Val Ala 
25 30 35 

GAG ATT CAG GGC CAC GCG GGA GGA CGC CGC TCA GGG GAG AGC CAT GAG 558 
Glu He Gin Gly His Ala Gly Gly Arg Arg Ser Gly Gin Ser His Glu 
40 45 50 

CTC CTG CGG GAC TTC GAG GCG ACA CTT CTG CAG ATG TTT GGG CTG CGC 606 
Leu Leu Arg Asp Phe Glu Ala Thr Leu Leu Gin Met Phe Gly Leu Arg 
55 60 65 

, CGC CGC CCG CAG CCT AGC AAG AGT GCC GTC ATT CCG GAC TAC ATG CGG 654 
Arg Arg Pro Gin Pro Ser Lys Ser Ala Val He Pro Asp Tyr Met Arg 
70 75 80 

GAT CTT TAC CGG CTT CAG TCT GGG GAG GAG GAG GAA GAG CAG ATC CAC 7 02 

Asp Leu Tyr Arg Leu Gin Ser Gly Glu Glu Glu Glu Glu Gin He His 
65 90 95 100 

AGC ACT GGT CTT GAG TAT CQT GAG CGC CCG GCC AGC CGG GCC AAC ACC 7 50 

Ser Thr Gly Leu Glu Tyr Pro Glu Arg Pro Ala Ser Arg Ala Asn Thr 
105 110 115 

GTG AGG AGC TTC CAC CAC GAA GAA CAT CTG GAG AAC ATC CCA GGG ACC 7S8 
Val Arg Ser Phe His His Glu Glu His Leu Glu Asn He Pro Gly Thr 
120 125 130 

AGT GAA AAC TCT GCT TTT CGT TTC CTC TTT AAC CTC AGC AGC ATC CCT 64 6 

Ser Glu Asn Ser Ala Phe Arg Phe Leu Phe Asn Leu Ser Ser He Pro 
135 140 145 

GAG AAC GAG GTG ATC TCC TCT GCA GAG CTT CGG CTC TTC CGG GAG CAG 694 
Glu Asn Glu Val He Ser Ser Ala Glu Leu Arg Leu Phe Arg Glu Gin 
150 155 160 

GTG GAC CAG GGC CCT GAT TGG GAA AGG GGC TTC CAC CGT ATA AAC ATT 94 2 

Val Asp Gin Gly Pro Asp Trp Glu Arg Gly Phe His Arg He Asn He 

170 175 ' 180 

TAT GAG GTT ATG AAG CCC CCA GCA GAA GTG GTG CCT GGG CAC CTC ATC 9 90 

Tyr Glu Val Met Lys Pro Pro Ala Glu Val Val Pro Gly His Leu He 
185 190 195 

ACA CGA CTA CTG GAC ACG AGA CTG GTC CAC CAC AAT GTG ACA CGG TGG 103 8 

Thr Arg Leu Leu Asp Thr Arg Leu Val His His Asn Val Thr Arg Trp 
200 205 210 

GAA ACT TTT GAT GTG AGC CCT GCG GTC CTT CGC TGG ACC CGG GAG AAG t 08 6 

Glu Thr Phe Asp Val Ser Pro Ala Val Leu Arg Trp Thr Arg Glu Lys 
215 220 225 

CAG CCA AAC TAT GGG CTA GCC ATT GAG GTG ACT CAC CTC CAT CAG ACT 113 4 

Gin Pro Asn Tyr Gly Leu Ala He Glu Val Thr His Leu His Gin Thr 
230 235 240 

CGG ACC CAC CAG GGC CAG CAT GTC AGG ATT AGC CGA TCG TTA CCT CAA nS2 
Arg Thr His Gin Gly Gin His Val Arg He Ser Arg Ser Leu Pro GLn 
245 250 255 260 



93/09229 



PCr/US92/09430 



96 



GGG AGT GGG AAT TGG GCC CAG dC CGG CCC CTC CTG GTC ACC TTT GGC 
Gly ser Gly Asn Trp Ala Gin Leu Arg Pro Leu Leu Val Tnr pne exy 



265 



CAT GAT GGC CGG GGC CAT GCC TTG ACC CGA CGC CGG AGG GCC AAG CCT 1278 
His Asp Gly Arg Gly His Ala Leu Thr Arg Arg Arg Arg Ala Lys Arg 
280 285 

AGC CCT AAG CAT CAC TCA CAG CGG GCC AGG AAG AAG AAT AAG AAC TGC 1326 
ser So Ss Ss sS Arg Ala Arg Lys Lys Asn Lys Asn Cys 
295 300 



rrr CGC CAC TCG CTC TAT GTG GAC TTC AGC GAT GTG GGC TGG AAT GAC 1374 
Arg Sg sS ^ vTl Asp Phe Ser Asp Val Gly Trp Asn Asp 
310 315 320 

TGG ATT GTG GCC CCA CCA GGC TAC CAG GCC TTC TAC TGC CAT GGG GAC 1422 

??p iTe vll lit P?o Gly Tyr Gin Ala Phe Tyr Cys His Gly Asp 
325 330 335 

TGC CCC TTT CCA CTG GCT GAC CAC CTC AAC TCA ACC AAC CAT GCC ATT 1470 
cys Pro Phe Pro Leu Ala Asp His Leu Asn Ser Thr Asn His Ala He 
' 345 350 355 

GTG CAG ACC CTG GTC AAT TCT GTC AAT TCC AGT ATC CCC AAA GCC TGT 1518 
val Gin Thr Leu Val Asn Ser Val Asn Ser Ser He Pro Lys Ala Cys 
360 365 370 

TGT GTG CCC ACT GAA CTG.AGT GCC ATC TCC ATG CTG TAC CTG GAT GAG 1566 
cys Val Pro Thr Glu Leu Ser Ala He Ser Met Leu Tyr Leu Asp Glu 
375 380 385 

TAT GAT AAG GTG GTA CTG AAA AAT TAT CAG GAG ATG GTA GTA GAG GGA 1614 
Tyr Asp Lys Val Val Leu Lys Asn Tyr Gin Glu Met Val Val Glu Gly 
390 395 *00 

TGT GGG TGC CGC TGAGATCAGG CAGTCCTTGA GGATAGACAG ATATACACAC 1666 

Cys Gly Cys Arg 

405 



CACACACACA 


CACCACATAC ACCACACACA 


CACGTTCCCA 


TCCACTCACC 


CACACACTAC 


1726 


ACAGACTGCT 


TCCTTATAGC TGGACTTTTA 


TTTAAAAAAA 


AAAAAAAAAA AATGGAAAAA 


1786 


ATCCCTAAAC 


ATTCACCTTG ACCTTATTTA 


TGACTTTACG 


TGCAAATGTT 


TTGACCATAT 


1846 


TGATCATATA 


TTTTGACAAA ATATATTTAT 


AACTACGTAT 


TAAAAGAAAA 


AAATAAAATG 


1906 


AGTCATTATT 


TTAAAAAAAA AAAAAAAACT 


CTAGAGTCGA 


CGGAATTC 




1954 



(2) INFORMATION FOR SEQ ID NO: 4: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 408 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 



wo 93/09229 



PCT/US92/09430 



97 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4: 

Met He Pro Gly Asn Arg Met Leu Met Val Val Leu Leu Cys Gin Val 
1 5 10 15 

Leu Leu Gly Gly Ala Ser His Ala Ser Leu He Pro Glu Thr Gly Lys 
20 25 30 

Lys Lys Val Ala Glu He Gin Gly His Ala Gly Gly Arg Arg Ser Gly 
35 40 45 

Gin Ser His Glu Leu Leu Arg Asp Phe Glu Ala Thr Leu Leu Gin Met 
50 55 60 

Phe Gly Leu Arg Arg Arg Pro Gin Pro Ser Lys Ser Ala Val He Pro 
65 70 75 80 

Asp Tyr Met Arg Asp Leu Tyr Arg Leu Gin Ser Gly Glu Glu Glu Glu 
85 90 95 

Glu Gin He His Ser Thr Gly Leu Glu Tyr Pro Glu Arg Pro Ala Ser 
100 105 110 

V 

Arg Ala Asn Thr Val Arg Ser Phe His His Glu Glu His Leu Glu Asn 
115 120 125 

He Pro Gly Thr Ser Glu Asn Ser Ala Phe Arg Phe Leu Phe Asn Leu 
130 135 140 

Ser Ser He Pro Glu Asn Glu Val He Ser Ser Ala Glu Leu Arg Leu 
145 150 155 160 

Phe Arg Glu Gin Val Asp Gin Gly Pro Asp Trp Glu Arg Gly Phe His 
165 170 175 

Arg He Asn He Tyr Glu Val Met Lys Pro Pro Ala Glu Val Val Pro 
180 185 190 

Gly His Leu He Thr Arg Leu Leu Asp Thr Arg Leu Val His His Asn 
195 200 205 

Val Thr Arg Trp Glu Thr Phe Asp Val Ser Pro Ala Val Leu Arg Trp 
210 215 220 

Thr Arg Glu Lys Gin Pro Asn Tyr Gly Leu Ala He Glu Val Thr His 
225 230 235 240 

Leu His Gin Thr Arg Thr His Gin Gly Gin His Val Arg He Ser Arg 
245 250 255 

Ser Leu Pro Gin Gly Ser Gly Asn Trp Ala Gin Leu Arg Pro Leu Leu 
260 2^5 270 

Val Thr Phe Gly His Asp Gly Arg Gly His Ala Leu Thr Arg Arg Arg 
275 280 285 

Arg Ala Lys Arg Ser Pro Lys His His Ser Gin Arg Ala Arg Lys Lys 
290 295 300 



wo 93/09229 PCr/US92/09430 

98 

Asn Lys Asn Cys Arg Arg His Ser Leu Tyr Val Asp Phe Ser Asp Val 
305 310 3-^^ 

Gly Trp Asn Asp Trp He Val Ala Pro Pro Gly Tyr Gin Ala Phe Tyr 



325 



cys His Gly Asp cys Pro Phe Pro Leu Ala Asp His Leu Asn Ser Thr 
340 345 

His Ala He Val Gin Thr Leu Val Asn Ser Val Asn Ser Ser He 



Asn 



355 360 



365 



Pro Lys Ala Cys Cys Val Pro Thr Glu Leu Ser Ala He Ser Met Leu 
370 375 380 

Tyr Leu Asp Glu Tyr Asp Lys Val Val Leu Lys Asn Tyr Gin Glu Met 
385 390 395 

Val Val Glu Gly Cys Gly Cys Arg 
405 

(2) INFORMATION FOR SEQ ID NO: 5: 

(i) SEQUENCE CHAHACTERISTI CS: 

(A) LENGTH: 1448 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS : double 

(D) TOPOLOGY: unknown 

(ii) MOLECULE TYPE: DNA (genomic) 

(ix) FEATURE: 

(A) NAME/KEY: CDS 

(B) LOCATION: 97.. 1389 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5: 
GTGACCGAGC GGCGCGGACG GCCGCCTGCC CCCTCTGCCA CCTGGGGCGG TGCGGGCCCG 

GAGCCCGGAG CCCGGGTAGC GCGTAGAGCC GGCGCG ATG CAC GTG CGC TCA CTG 

Met His Val Arg Ser Leu 
1 5 

CGA GCT GCG GCG CCG CAC AGC TTC GTG GCG CTC TGG GCA CCC CTG TTC 
Arg Ala Ala Ala Pro His Ser Phe Val Ala Leu Trp Ala Pro Leu Phe 
10 15 20 

CTG CTG CGC TCC GCC CTG GCC GAC TTC AGC CTG GAC AAC GAG GTG CAC 
Leu Leu Arg Ser Ala Leu Ala Asp Phe Ser Leu Asp Asn Glu Val His 
25 30 35 

TCG AGC TTC ATC CAC CGG CGC CTC CGC AGC CAG GAG CGG CGG GAG ATG 
ser Ser Phe He His Arg Arg Leu Arg Ser Gin Glu Arg Arg Glu Met 
40 45 50 

CAG CGC GAG ATC CTC TCC ATT TTG GGC TTG CCC CAC CGC CCG CGC CCG 
Gin Arg Glu He Leu Ser He Leu Gly Leu Pro His Arg Pro Arg Pro 
55 60 65 70 



wo 93/09229 



PCT/US92/09430 



99 

CAC CTC CAG GGC AAG CAC AAC TCG OCA CCC ATG TTC ATG CTG GAC CTG 354 

His Leu Gin Gly Lys His Asn Ser Ala Pro Met Phe Met Leu Asp Leu 
75 80 85 

TAG AAC GCC ATG GCG GTG GAG GAG GGC GGC GGG CCC GGC GGC CAG GGC 4 02 

Tyr Asn Ala Met Ala Val Glu Glu Gly Gly Gly Pro Gly Gly Gin Gly 
^ ■ 90 95 100 

TTC TCC TAC CCC TAC AAG GCC GTC TTC AGT ACC CAG GGC CCC CCT CTG 4 50 

Phe Ser Tyr Pro Tyr Lys Ala Val Phe Ser Thr Gin Gly Pro Pro Leu 
105 110 115 

GCC AGC CTG CAA GAT AGC CAT TTC CTC ACC GAC GCC GAC ATG GTC ATG 4 98 

Ala Ser Leu Gin Asp Ser His Phe Leu Thr Asp Ala Asp Met Val Met 
120 125 130 

AGC TTC GTC AAC CTC GTG GAA CAT GAC AAG GAA TTC TTC CAC CCA CGC 54 6 

Ser Phe Val Asn Leu Val Glu His Asp Lys Glu Phe Phe His Pro Arg 
135 140 145 150 

TAC CAC CAT CGA GAG TTC CGG TTT GAT CTT TCC AAG ATC CCA GAA GGG 59 4 

Tyr His His Arg Glu Phe Arg Phe Asp Leu Ser Lys He Pro Glu Gly 
155 160 165 

GAA GCT GTC ACG GCA GCC GAA TTC CGG ATC TAC AAG GAC TAC ATC CGG 64 2 

Glu Ala Val Thr Ala Ala Glu Phe Arg He Tyr Lys Asp Tyr He Arg 
170 175 180 

GAA CGC TTC GAC AAT GAG ACG TTC CGG ATC AGC GTT TAT CAG GTG CTC 69 0 

Glu Arg Phe Asp Asn Glu Thr Phe Arg He Ser Val Tyr Gin Val I,eu 
185 190 195 

CAG GAG CAC TTG GGC AGG GAA TCG GAT CTC TTC CTG CTC GAC AGC CGT 7 38 

Gin Glu His Leu Gly Arg Glu Ser Asp Leu Phe Leu Leu Asp Ser Arg 
200 205 210 

ACC CTC TGG GCC TCG GAG GAG GGC TGG CTG GTG TTT GAC ATC ACA GCC 786 
Thr Leu Trp Ala Ser Glu Glu Gly Trp Leu Val Phe Asp He Thr Ala 
215 220 225 230 

ACC AGC AAC CAC TGG GTG GTC AAT CCG CGG CAC AAC CTG GGC CTG CAG 8 34 

Thr Ser Asn His Trp Val Val Asn Pro Arg His Asn Leu Gly Leu Gin 
235 240 245 

CTC TCG GTG GAG ACG CTG GAT GGG CAG AGC ATC AAC CCC AAG TTG GCG 88 2 

Leu Ser Val Glu Thr Leu Asp Gly Gin Ser He Asn Pro Lys Leu Ala 
250 255 260 

GGC CTG ATT GGG CGG CAC GGG CCC CAG AAC AAG CAG CCC TTC ATG GTG 93 0 

Gly Leu He Gly Arg His Gly Pro Gin Asn Lys Gin Pro Phe Met Val 
265 270 275 

GCT TTC TTC AAG GCC ACG GAG GTC CAC TTC CGC AGC ATC CGG TCC ACG 9 78 

Ala Phe Phe Lys Ala Thr Glu Val His Phe Arg Ser He Arg Ser Thr 
280 285 290 

GGG AGC AAA CAG CGC AGC CAG AAC CGC TCC AAG ACG CCC AAG AAC CAG 102 6 

Gly Ser Lys Gin Arg Ser Gin Asn Arg Ser Lys Thr Pro Lys Asn Gin 
295 300 305 310 



wo 93/09229 



PCr/US92/09430 



100 



1074 



1122 



S ^ S S V^J fe? SI 

330 335 

S5 £1 ?S S S ??? |S 

345 

TGT GAG GGG GAG TGT 6CC TTC CCT CTG AAC TCC TAC AT6 AAC GCC ACC 
Ss Glu Gly Glu cys Ala Phe Pro Leu Asn Ser Tyr Met Asn Ala Thr 
360 365 370 

375 380 385 

GTG CCC AAG CCC TGC TGT GGG CCC ACG CAG CTC AAT GCC ATC TCC GTC 
Val Pro Lys Pro Cys Cys Ala Pro Thr Gin Leu Asn Ala He Ser Val 
395 .. 

CTC TAC TTC GAT GAC AGC TCC AAC GTC ATC CTG AAG AAA TAC AGA AAC 
SS ?JS Sp Sp ser Ser Asn Val He Leu Lys Lys Tyr Arg Asn 
410 415 

ATG GTG GTC CGG GCC TGT GGC TGC CAC TAGCTCCTCC GAGAATTCAG 
Met Val Val Arg Ala Cys Gly Cys His 
425 430 

ACCCTTTGGG GCCAAGTTTT TCTGGATCCT CCATTGCTC 

(2) INFORMATION FOR SEQ ID NO: 6: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 431 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6: 

Met His val Arg Ser Leu Arg Ala Ala Ala Pro His Ser Phe Val Ala 
1 5 10 

Leu Trp Ala Pro Leu Phe Leu Leu Arg Ser Ala Leu Ala Asp Phe Ser 
20 25 

Leu Asp Asn Glu Val His Ser Ser Phe lie His Arg Arg Leu Arg Ser 
35 40 45 

Gin Glu Arg Arg Glu Met Gin Arg Glu He Leu Ser He Leu Gly Leu 
50 55 60 

Pro His Arg Pro Arg Pro His Leu Gin Gly Lys His Asn Ser Ala Pro 



1218 



1266 



1314 



1362 



1409 



1448 



wo 93/09229 



PCT/US92/09430 



101 



65 



70 



75 



80 



Met Phe Met Leu Asp Leu Tyr Asn Ala Met Ala Val Glu Glu Gly Gly. 

85 90 95 

Gly Pro Gly Gly Gin Gly Phe Ser Tyr Pro Tyr Lys Ala Val Phe Ser 
100 105 110 

Thr Gin Gly Pro Pro Leu Ala Ser Leu Gin Asp Ser His Phe Leu Thr 
115 120 125 

Asp Ala Asp Met Val Met Ser Phe Val Asn Leu Val Glu His Asp Lys 
130 135 140 

Glu Phe Phe His Pro Arg Tyr His His Arg Glu Phe Arg Phe Asp Leu 
145 150 155 160 

Ser Lys lie Pro Glu Gly Glu Ala Val Thr Ala Ala Glu Phe Arg He 
165 170 175 

Tyr Lys Asp Tyr He Arg Glu Arg Phe Asp Asn Glu Thr Phe Arg He 
180 185 190 

Ser Val Tyr Gin Val Leu Gin Glu His Leu Gly Arg Glu Ser Asp Leu 
195 " 200 205 

Phe Leu Leu Asp Ser Arg Thr Leu Trp Ala Ser Glu Glu Gly Trp Leu 
210 215 220 

Val Phe Asp He Thr Ala Thr Ser Asn His Trp Val Val Asn Pro Arg 
225 230 235 240 

His Asn Leu Gly Leu Gin Leu Ser Val Glu Thr Leu Asp Gly Gin Ser 



He Asn Pro Lys Leu Ala Gly Leu He Gly Arg His Gly Pro Gin Asn 
260 265 270 

Lys Gin Pro Phe Met Val Ala Phe Phe Lys Ala Thr Glu Val His Phe 
275 280 285 

Arg Ser He Arg Ser Thr Gly Ser Lys Gin Arg Ser Gin Asn Arg Ser 
290 295 300 

Lys Thr Pro Lys Asn Gin Glu Ala Leu Arg Met Ala Asn Val Ala Glu 
305 310 315 320 

Asn Ser Ser Ser Asp Gin Arg Gin Ala Cys Lys Lys His Glu Leu Tyr 
325 330 335 

Val Ser Phe Arg Asp Leu Gly Trp Gin Asp Trp He He Ala Pro Glu 
340 345 350 

Gly Tyr Ala Ala Tyr Tyr Cys Glu Gly Glu Cys Ala Phe Pro Leu Asn 
355 360 365 

Ser Tyr Met Asn Ala Thr Asn His Ala He Val Gin Thr Leu Val His 
370 375 380 

Phe He Asn Pro Glu Thr Val Pro Lys Pro Cys Cys Ala Pro Thr Gin 



245 



250 



255 



WO»3/(»22» I.CT/LS92/09430 

102 

385 390 400 

Leu Asn Ala lie Ser Val Leu Tyr Phe Asp Asp Ser Ser Asn Val He 
405 ^" 

Leu Lys Lys Tyr Arg Asn Met Val Val Arg Ala Cys Gly Cys His 
420 425 

(2) INFORMATION FOR SEQ ID NO: 7: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 2923 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: double 

(D) TOPOLOGY: circular 

(ii) MOLECULE TYPE: cDNA to mRNA 

(iii) HYPOTHETICAL: NO 

(vi) ORIGINAL SOURCE: 

(A) ORGANISM: • Homo sapiens 

(F) TISSUE TYPE: Human placenta 

(vii) IMMEDIATE SOURCE: 

(A) LIBRARY: Stratagene catalog #936203 Human placenta 

cDNA library 

(B) CLONE: BMP6C35 

(viii) POSITION IN GENOME: 

(C) UNITS: bp 

(ix) FEATURE: 

(A) NAME/KEY: CDS 

(B) LOCATION: 160.. 1701 

(ix) FEATURE: 

(A) NAME/KEY: matj)eptide 

(B) LOCATION: 1282.. 1698 

(ix) FEATURE: 

(A) NAME/KEY: mRNA 

(B) LOCATION: l.,2923 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7: 

CGACCATGAG AGATAAGGAC TGAGGGCCAG GAAGGGGAAG CGAGCCCGCC GAGAGGTGGC 60 

GGGGACTGCT CACGCCAAGG <3CCACAGCGG CCGCGCTCCG GCCTCGCTCC GCCGCTCCAC 120 

GCCTCGCGGG ATCCGCGGGG GCAGCCCGGC CGGGCGGGG ATG CCG GGG CTG GGG 174 

Met Pro Gly Leu Gly 
-374 -370 

CGG AGG GCG CAG TGG CTG TGC TGG TGG TGG GGG CTG CTG TGC AGC TGC 222 
Arg Arg Ala Gin Trp Leu Cys Trp Trp Trp Gly Leu Leu Cys Ser Cys 

-365 -360 -355 . 

TGC GGG CCC CCG CCG CTG CGG CCG CCC TTG CCC GOT GCC GCG GCC GCC 270 



wo 93/09229 



PCr/US92/09430 



103 



Cys Gly Pro Pro Pro Leu Arg Pro Pro Leu Pro Ala Ala Ala Ala Ala 
-350 -345 -340 

GCC GCC GGG GGG CAG CTG CTG GGG GAG GGC GGG AGC CCC GGC CGC ACG 
Ala Ala Gly Gly Gin Leu Leu Gly Asp Gly Gly Ser Pro Gly Arg Thr 
-335 -330 -325 

GAG CAG CCG CCG CCG TCG CCG CAG TCC TCC TCG GGC TTC CTG TAC CGG 
Glu Gin Pro Pro Pro Ser Pro Gin Ser Ser Ser Gly Phe Leu Tyr Arg 
-320 -315 -310 



318 



366 



CGG CTC AAG ACG CAG GAG AAG CGG GAG ATG CAG AAG GAG ATC TTG TCG 
Arg Leu Lys Thr Gin Glu Lys Arg Glu Met Gin Lys Glu He Leu Ser 
-305 -300 -295 -290 

GTG CTG GGG CTC CCG CAC CGG CCC CGG CCC CTG CAC GGC CTC CAA CAG 
Val Leu Gly Leu Pro His Arg Pro Arg Pro Leu His Gly Leu Gin Gin 
-285 -280 -275 



414 



4 62 



CCG CAG CCC CCG GCG CTC CGG CAG CAG GAG GAG CAG CAG CAG CAG CAG 
Pro Gin Pro Pro Ala Leu Arg Gin Gin Glu Glu Gin Gin Gin Gin Gin 

-270 -265 -260 

CAG CTG CCT CGC GGA GAG CCC CCT CCC GGG CGA CTG AAG TCC GCG CCC 
Gin Leu Pro Arg Gly gIu Pro Pro Pro Gly Arg Leu Lys Ser Ala Pro 
-255 -250 -245 

CTC TTC ATG CTG GAT CTG TAC AAC GCC CTG TCC GCC GAC AAC GAC GAG 
Leu Phe Met Leu Asp Leu Tyr Asn Ala Leu Ser Ala Asp Asn Asp Glu 
-240 . -235 -230 



510 



558 



606 



GAC GGG GCG TCG GAG GGG GAG AGG CAG CAG TCC TGG CCC CAC GAA GCA 654 
Asp Gly Ala Ser Glu Gly Glu Arg Gin Gin Ser Trp Pro His Glu Ala 
"225 -220 -215 -210 

GCC AGC TCG TCC CAG CGT CGG CAG CCG CCC CCG GGC GCC GCG CAC CCG 7 02 

Ala Ser Ser Ser Gin Arg Arg Gin Pro Pro Pro Gly Ala Ala His Pro 
-205 -200 -195 

CTC AAC CGC AAG AGC CTT CTG GCC CCC GGA TCT GGC AGC GGC GGC GCG 750 
Leu Asn Arg Lys Ser Leu Leu Ala Pro Gly Ser Gly Ser Gly Gly Ala 
-190 -185 -180 

TCC CCA CTG ACC AGC GCG CAG GAC AGC GCC TTC CTC AAC GAC GCG GAC 7 98 

Ser Pro Leu Thr Ser Ala Gin Asp Ser Ala Phe Leu Asn Asp Ala Asp 
-175 -170 -165 

ATG GTC ATG AGC TTT GTG AAC CTG GTG GAG TAC GAC AAG GAG TTC TCC 84 6 

Met Val Met Ser Phe Val Asn Leu Val Glu Tyr Asp Lys Glu Phe Ser 
-160 -155 -150 

CCT CGT CAG CGA CAC CAC AAA GAG TTC AAG TTC AAC TTA TCC CAG ATT 894 
Pro Arg Gin Arg His His Lys Glu Phe Lys Phe Asn Leu Ser Gin He 
"145 -140 -135 -130 

CCT GAG GGT GAG GTG GTG ACG GCT GCA GAA TTC CGC ATC TAC AAG ^AC 94 2 

Pro Glu Gly Glu Val Val Thr Ala Ala Glu Phe Arg He Tyr Lys Asp 
-125 -120 -115 



TGT GTT ATG GGG AGT TTT AAA AAC CAA ACT TTT CTT ATC AGC ATT TAT 



990 



wo 93/09229 



104 



pCr/US92/09430 



Cys Val Met Gly Ser Phe Lys Asn Gin Thr Phe Leu lie Ser lie Tyr 
-110 -105 -100 

CAA GTC TTA CAG GAG CAT CAG CAC AG A GAC TCT GAC CTG TTT TTG TTG 103 s 

Gin Val Leu Gin Glu His Gin His Arg Asp Ser Asp Leu Phe Leu Leu 
-95 -90 -85 

GAC ACC CGT GTA GTA TGG GCC TCA GAA GAA GGC TGG CTG GAA TTT GAC 1086 
Asp Thr Arg Val Val Trp Ala Ser Glu Glu Gly Trp Leu Glu Phe Asp 
-80 -75 -70 

ATC ACG GCC ACT AGC AAT CTG TGG GTT GTG ACT CCA CAG CAT AAC ATG 11^4 
He Thr Ala Thr Ser Asn Leu Trp Val Val Thr Pro Gin His Asn Met 
-65 -60 -55 -50 

GGG CTT CAG CTG AGC GTG GTG ACA AGG GAT GGA GTC CAC GTC CAC CCC 1182 
Gly Leu Gin Leu Ser Val Val Thr Arg Asp Gly Val His Val His Pro 
-45 -40 -35 

CGA GCC GCA GGC CTG GTG GGC AGA GAC GGC CCT TAC GAT AAG CAG CCC 1230 
Arg Ala Ala Gly Leu Val Gly Arg Asp Gly Pro Tyr Asp Lys Gin Pro 
-30 . -25 • -20 

TTC ATG GTG GCT TTC TTC AAA GTG AGT GAG GTC CAC GTG CGC ACC ACC 1278 
Phe Met Val Ala Phe Pile Lys Val Ser Glu Val His Val Arg Thr Thr 
-15 -10 -5 

AGG TCA GCC TCC AGC CGG CGC CGA CAA CAG AGT CGT AAT CGC TCT ACC 132 6 

Arg Ser Ala Ser Ser Arg Arg Arg Gin Gin Ser Arg Asn Arg Ser Thr 
'1 5 10 • . • 15 

CAG TCC CAG GAC GTG GCG CGG GTC TCC AGT GCT TCA GAT TAC AAC AGC 1374 
Gin Ser Gin Asp Val Ala Arg Val Ser Ser Ala Ser Asp Tyr Asn Ser 
20 25 30 

AGT GAA TTG AAA ACA GCC TGC AGG AAG CAT GAG CTG TAT GTG AGT TTC 1422 
Ser Glu Leu Lys Thr Ala Cys Arg Lys His Glu Leu Tyr Val Ser Phe 
35 40 45 

CAA GAC CTG GGA TGG CAG GAC TGG ATC ATT GCA CCC AAG GGC TAT GCT 1470 
Gin Asp Leu Gly Trp Gin Asp Trp He He Ala Pro Lys Gly Tyr Ala 
50 55 60 

GCC AAT TAC TGT GAT GGA GAA TGC TCC TTC CCA CTC AAC GCA CAC ATG 1518 
Ala Asn Tyr Cys Asp Gly Glu Cys Ser Phe Pro Leu Asn Ala His Met 
65 70 75 

AAT GCA ACC AAC CAC GCG ATT GTG CAG ACC TTG GTT CAC CTT ATG AAC 1566 
Asn Ala Thr Asn His Ala He Val Gin Thr Leu Val His Leu Met Asn 
80 85 90 95 

CCC GAG TAT GTC CCC AAA CCG TGC TGT GCG CCA ACT AAG CTA AAT GCC 1614 
Pro Glu Tyr Val Pro Lys Pro Cys Cys Ala Pro Thr Lys Leu Asn Ala 

100 105 110 ^ 

ATC TCG GTT CTT TAC TTT GAT GAC AAC TCC AAT GTC ATT CTG AAA AAA 1662 
He Ser Val Leu Tyr Phe Asp Asp Asn Ser Asn Val He Leu Lys Lys 

115 120 125 , 

TAC AGG AAT ATG GTT GTA AGA GCT TGT GGA TGC CAC TAACTCGAAA 1708 



wo 93/09229 PCr/US92/09430 

105 

Tyr Arg Asn Met Val Val Arg Ala Cys Gly Cys His 
^30 135 

CCAGATGCTG GGGACACACA TTCTGCCTTG GATTCCTAGA TTACATCTGC CTTAAAAAAA 17 68 
CACGGAAGCA CAGTTGGAGG TGGGACGATG AGACTTTGAA ACTATCTCAT GCCAGTGCCT 1828 
TATTACCCAG GAAGATTTTA AAGGACCTCA TTAATAATTT GCTCACTTGG TAAATGACGT 1888 
GAGTAGTTGT TGGTCTGTAG CAAGCTGAGT TTGGATGTCT GTAGCATAAG GTCTGGTAAC 1948 
TGCAGAAACA TAACCGTGAA GCTCTTCCTA CCCTCCTCCC CCAAAAACCC ACCAAAATTA 2008 
GTTTTAGCTG TAGATCAAGC TATTTGGGGT GTTTGTTAGT AAATAGGGAA AATAATCTCA 2068 
AAGGAGTTAA ATGTATTCTT GGCTAAAGGA TCAGCTGGTT CAGTACTGTC TATCAAAGGT 2128 
AGATTTTACA GAGAACAGAA ATCGGGGAAG TGGGGGGAAC GCCTCTGTTC AGTTCATTCC 2188 

CAGAAGTCCA CAGGACGCAC AGCCCAGGCC ACAGCCAGGG CTCCACGGGG CGCCCTTGTC 224 8 

TCAGTCATTG CTGTTGTATG TTCGTGCTGG AGTTTTGTTG GTGTGAAAAT ACACTTATTT 2308 

CAGCCAAAAC ATACCATTTC TACACCTCAA TCCTCCATTT GCTGTACTCT TTGCTAGTAC 2 3 68 

CAAAAGTAGA CTGATTACAC TGAGGTGAGG CTACAAGGGG TGTGTAACCG TGTAACACGT 24 28 

GAAGGCAGTG CTCACCTCTT CTTTACCAGA ACGGTTCTTT GACCAGCACA TTAACTTCTG 2 488 

GACTGCCGGC TCTAGTACCT TTTCAGTAAA GTGGTTCTCT GCCTTTTTAC TATACAGCAT 2548 

ACCACGCCAC AGGGTTAGAA CCAACGAAGA AAATAAAATG AGGGTGCCCA GCTTATAAGA 2608 

ATGGTGTTAG GGGGATGAGC ATGCTGTTTA TGAACGGAAA TCATGATTTC CCTGTAGAAA 2668 

GTGAGGCTCA GATTAAATTT TAGAATATTT TCTAAATGTC TTTTTCACAA TCATGTGACT 2 728 

GGGAAGGCAA TTTCATACTA AACTGATTAA ATAATACATT TATAATCTAC AACTGTTTGC 2788 

ACTTACAGCT TTTTTTGTAA ATATAAACTA TAATTTATTG TCTATTTTAT ATCTGTTTTG 2 848 

CTGTGGCGTT GGGGGGGGGG CCGGGCTTTT GGGGGGGGGG GTTTGTTTGG GGGGTGTCGT 2 908 
GGTGTGGGCG GGCGG 

2923 

(2) INFORMATION FOR SEQ ID NO: 8: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 513 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8: 

-374^" Arg Arg Ala Gin Trp Leu Cys Trp Trp Trp Gly 

"3*^0 -365 -360 



PCr/US92/0943(. 

106 

Leu Leu cys Ser Cys Cys Gly Pro Pro Pro Leu Arg Pro Pro Leu Pro 
-355 -350 -345 

Ala Ala Ala Ala Ala Ala Ala Gly Gly Gin Leu Leu Gly Asp Gly Gly 
-340 -335 -330 

Ser Pro Gly Arg Thr Glu Gin Pro Pro Pro Ser Pro Gin Ser Ser Ser 
-325 -320 -315 

Gly Phe Leu Tyr Arg Arg Leu Lys Thr Gin Glu Lys Arg Glu Met Gin 
-310 -305 -300 -295 

Lys Glu lie Leu Ser Val Leu Gly Leu Pro His Arg Pro Arg Pro Leu 
-290 -285 -280 

His Gly Leu Gin Gin Pro Gin Pro Pro Ala Leu Arg Gin Gin Glu Glu 
-275 -270 -265 

Gin Gin Gin Glh Gin Gin Leu Pro Arg Gly Glu Pro Pro Pro Gly Arg 
-260 -255 -250 

Leu Lys Ser Ala Pro Leu Phe Met Leu Asp Leu Tyr Asn Ala Leu Ser 
-245 " -240 -235 

Ala Asp Asn Asp Glu A^ Gly Ala Ser Glu Gly Glu Arg Gin Gin Ser 
-230 -225 -220 -215 

Trp Pro His Glu Ala Ala Ser Ser Ser Gin Arg Arg Gin Pro Pro Pro 
-210 -205 -200 

Gly Ala Ala His Pro Leu Asn Arg Lys Ser Leu Leu Ala Pro Gly Ser 
-195 -190 -185 

Gly Ser Gly Gly Ala Ser Pro Leu Thr Ser Ala Gin Asp Ser Ala Phe 
-180 -175 -170 

Leu Asn Asp Ala Asp Met Val Met Ser Phe Val Asn Leu Val Glu Tyr 
-165 -160 -155 

Asp Lys Glu Phe Ser Pro Arg Gin Arg His His Lys Glu Phe £ys Phe 
-150 -145 -140 -135 

Asn Leu Ser Gin lie Pro Glu Gly Glu Val Val Thr Ala Ala Glu Phe 
-130 -125 -120 

Arg lie Tyr Lys Asp Cys Val Met Gly Ser Phe Lys Asn Gin Thr Phe 
-115 -110 -105 

Leu lie Ser lie Tyr Gin Val Leu Gin Glu His Gin His Arg Asp Ser 
-100 -95 -90 

Asp Leu Phe Leu Leu Asp Thr Arg Val Val Trp Ala Ser Glu Glu Gly 
-85 -80 -75 

Trp Leu Glu Phe Asp lie Thr Ala Thr Ser Asn Leu Trp Val Val Thr 
-70 -65 -60 -55 

Pro Gin His Asn Met Gly Leu Gin Leu Ser Val Val Thr Arg Asp Gly 
-50 -45 -40 



wo 93/09229 PCT/US92/09430 

107 

Val His Val His Pro Arg Ala Ala Gly Leu Val Gly Arg Asp Gly Pro 
-35 -30 -25 

Tyr Asp Lys Gin Pro Phe Met Val Ala Phe Phe Lys Val Ser Glu Val 
-20 -15 -10 

His Val Arg Thr Thr Arg Ser Ala Ser Ser Arg Arg Arg Gin Gin Ser 
-5 15 10 

Arg Asn Arg Ser Thr Gin Ser Gin Asp Val Ala Arg Val Ser Ser Ala 
15 20 25 

Ser Asp Tyr Asn Ser Ser Glu Leu Lys Thr Ala Cys Arg Lys His Glu 
30 35 40 

Leu Tyr Val Ser Phe Gin Asp Leu Gly Trp Gin Asp Trp lie lie Ala 
45 50 55 

Pro Lys Gly Tyr Ala Ala Asn Tyr Cys Asp Gly Glu Cys Ser Phe Pro 
60 65 70 

Leu Asn Ala His Met Asn Ala Thr Asn His Ala lie Val Gin Thr Leu 
75 80 • 85 90 

Val His Leu Met Asn Pro Glu Tyr Val Pro Lys Pro Cys Cys Ala Pro 
95 100 105 

Thr Lys Leu Asn Ala lie Ser Val Leu Tyr Phe Asp Asp Asn Ser Asn 
110 115 120 

Val lie Leu Lys Lys Tyr Arg Asn Met Val Val Arg Ala Cys Gly Cys 
125 ' 130 135 

His 



(2) INFORMATION FOR SEQ ID NO: 9: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 2153 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: double 

(D) TOPOLOGY: linear 

(iii) HYPOTHETICAL: NO 

(Vi) ORIGINAL SOURCE: 

(A) ORGANISM: Homo sapiens 

(H) CELL LINE: U2-0S osteosarcoma 

(vii) IMMEDIATE SOURCE: 

(A) LIBRARY: U2-0S human osteosarcoma cDNA library 

(B) CLONE: U2-16 

(viii) POSITION IN GENOME: 

(C) UNITS: bp 

(ix) FEATURE: 

(A) NAME/KEY: CDS 



wo 93/09229 PCr/US92/09430 

108 

(B) LOCATION: 699 ,.2063 

(ix) FEATURE: 

(A) NAME/KEY: mat_peptide 

(B) LOCATION: 1647. ,2060 

(ix) FEATURE: 

(A) NAME/KEY: mRNA 

(B) LOCATION: 1..2153 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9: 

CTGGTATATT TGTGCCTGCT GGAGGTGGAA TTAACAGTAA GAAGGAGAAA GGGATTGAAT 60 

GGACTTACAG GAAGGATTTC AAGTAAATTC AGGGAAACAC ATTTACTTGA ATAGTACAAC 120 

CTAGAGTATT ATTTTACACT AAGACGACAC AAAAGATGTT AAAGTTATCA CCAAGCTGCC 180 

GGACAGATAT ATATTCCAAC ACCAAGGTGC AGATCAGCAT AGATCTGTGA TTCAGAAATC 240 

AGGATTTGTT TTGGAAAGAG CTCAAGGGTT GAGAAGAACT CAAAAGCAAG TGAAGATTAC 300 

TTTGGGAACT ACAGTTTATC AGAAGATCAA CTTTTGCTAA TTCAAATACC AAAGGCCTGA 360 

TTATCATAAA TTCATATAGG AATGCATAGG TCATCTGATC AAATAATATT AGCCGTCTTC 420 

TGCTACATCA ATGCAGCAAA AACTCTTAAC AACTGTGGAT AATTGGAAAT CTGAGTTTCA 480 

GCTTTCTTAG AAATAACTAC TCTTGACATA TTCCAAAATA TTTAAAATAG GACAGGAAAA 540 

TCGGTGAGGA TGTTGTGCTC AGAAATGTCA CTGTCATGAA AAATAGGTAA ATTTGTTTTT 600 

TCAGCTACTG GGAAACTGTA CCTCCTAGAA CCTTAGGTTT TTTTTTTTTT AAGAGGACAA 660 

GAAGGACTAA AAATATCAAC TTTTGCTTTT GGACAAAA ATG CAT CTG ACT GTA 713 

Met His Leu Thr Val 
-316-315 

TTT TTA CTT AAG GGT ATT GTG GOT TTC CTC TGG AGC TGC TGG GTT CTA 761 
Phe Leu Leu Lys Gly lie Val Gly Phe Leu Trp Ser cys Trp Val Leu 
-310 -305 -300 

GTG GGT TAT GCA AAA GGA GGT TTG GGA GAC AAT CAT GTT CAC TCC AGT 809 
Val Gly Tyr Ala Lys Gly Gly Leu Gly Asp Asn His Val His Ser Ser 
-295 -290 -285 -280 

TTT ATT TAT AGA AGA CTA CGG AAC CAC GAA AGA CGG GAA ATA CAA AGG 857 
Phe lie Tyr Arg Arg Leu Arg Asn His Glu Arg Arg Glu lie Gin Arg 
-275 -270 -265 

GAA ATT CTC TCT ATC TTG GGT TTG CCT CAC AGA CCC AGA CCA TTT TCA 905 
Glu lie Leu Ser lie Leu Gly Leu Pro His Arg Pro Arg Pro Phe Ser 
-260 -255 -250 

CCT GGA AAA ATG ACC AAT CAA GCG TCC TCT GCA CCT CTC TTT ATG CTG 953 
Pro Gly Lys Met Thr Asn Gin Ala Ser Ser Ala Pro Leu Phe Met Leu 
-245 -240 -235 

GAT CTC TAC AAT GCC GAA GAA AAT CCT GAA GAG TC<; GAG TAC TCA GTA 1001 



wo 93/09229 PCT/US92/09430 

109 

Asp Leu Tyr Asn Ala Glu Glu Asn Pro Glu Glu Ser Glu Tyr Ser Val 

-230 -225 -220 

AGG GCA TCC TTG GCA GAA GAG ACC AGA GGG GCA AG A AAG GGA TAG CCA 104 9 

Arg Ala Ser Leu Ala Glu Glu Thr Arg Gly Ala Arg Lys Gly Tyr Pro 
-215 -210 -205 -200 

GCC TCT CCC AAT GGG TAT OCT CGT CGC ATA CAG TTA TCT CGG ACG ACT 1097 
Ala Ser Pro Asn Gly Tyr Pro Arg Arg He Gin Leu Ser Arg Thr Thr 
-195 -190 -185 

CCT CTG ACC ACC CAG AGT CCT CCT CTA GCC AGC CTC CAT GAT ACC AAC 1145 
Pro Leu Thr Thr Gin Ser Pro Pro Leu Ala Ser Leu His Asp Thr Asn 
-180 -175 -170 

TTT CTG AAT GAT GCT GAC ATG GTC ATG AGC TTT GTC AAC TTA GTT GAA 1193 
Phe Leu Asn Asp Ala Asp Met Val Met Ser Phe Val Asn Leu Val Glu 
-165 -160 -155 

AGA GAC AAG GAT TTT TCT CAC CAG CGA AGG CAT TAC AAA GAA TTT CGA 1241 
Arg Asp Lys Asp Phe Ser His Gin Arg Arg His Tyr Lys Glu Phe Arg 
-150 -145 -140 

TTT GAT CTT ACC CAA ATT CCT CAT GGA GAG GCA GTG ACA GCA GCT GAA 1289 
Phe Asp Leu Thr Gin He Pro His Gly Glu Ala Val Thr Ala Ala Glu 
-135 -130 -125 -120 

TTC CGG ATA TAC AAG GAC CGG AGC AAC AAC CGA TTT GAA AAT GAA ACA 13 37 

Phe Arg He Tyr Lys Asp Arg Ser Asn Asn Arg Phe Glu Asn Glu Thr 
-115 -110 -105 

ATT- AAG ATT AGC ATA TAT CAA ATC ATC AAG GAA TAC ACA AAT AGG GAT 13 85 

lie Lys He Ser He Tyr Gin He He Lys Glu Tyr Thr Asn Arg Asp 
-100 -95 -90 

GCA GAT CTG TTC TTG TTA GAC ACA AGA AAG GCC CAA GCT TTA GAT GTG 14 3 3 

Ala Asp Leu Phe Leu Leu Asp Thr Arg Lys Ala Gin Ala Leu Asp Val 
-85 -80 -75 

GGT TGG CTT GTC TTT GAT ATC ACT GTG ACC AGC AAT CAT TGG GT6 ATT 14 81 

Gly Trp Leu Val Phe Asp He Thr Val Thr Ser Asn His Trp Val He 
-70 -65 -60 

AAT CCC CAG AAT AAT TTG GGC TTA CAG CTC TGT GCA GAA ACA GGG GAT 15 2 9 

Asn Pro Gin Asn Asn Leu Gly Leu Gin Leu Cys Ala Glu Thr Gly Asp 
-55 -50 -45 -40 

GGA CGC AGT ATC AAC GTA AAA TCT GCT GGT CTT GTG GGA AGA CAG GGA 157 7 

Gly Arg Ser He Asn Val Lys Ser Ala Gly Leu Val Gly Arg Gin Gly 
-35 -30 -25 

CCT CAG TCA AAA CAA CCA TTC ATG GTG GCC TTC TTC AAG GCG AGT GAG 1625 
Pro Gin Ser Lys Gin Pro Phe Met Val Ala Phe Phe Lys Ala Ser Glu 
-20 -15 -10 

GTA CTT CTT CGA TCC GTG AGA GCA GCC AAC AAA GGA AAA AAT CAA AAC 167 3 

Val Leu Leu Arg Ser Val Arg Ala Ala Asn Lys Arg Lys Asn Gin Asn 
-5 15 



CGC AAT AAA TCC AGC TCT CAT CAG GAC TCC TCC AGA ATG TCC AGT GTT 



1721 



wo 93/09229 



PCr/US92/09430 



110 

\rg Asn Lys Ser Ser Ser His Gin Asp Ser 
10 15 

3GA GAT TAT AAC ACA AGT GAG CAA AAA CAA 

Sly Asp Tyr Asn Thr Ser Glu Gin Lys Gin 
30 3^ 



45 



50 



Ser Arg Met 
20 


ser 


Ser Val 
25 




GCC TGT AAG 
iVXa v-ijfo Jjjro 


AAG 
liVS 


CAC 
His 
40 


GAA 
Glu 


1769 


CAG GAC TGG 
Gin Asp Trp 


ATT 
lie 
55 


ATA 
He 


GCA 
Ala 


1817^ 


GGA GAA TGT 
Vffiy vxu Vrjfo 
70 


TCT 

Ser 


TTT 
Phe 


CCA 
Pro 


1865F 


GCT ATA GTT 
Ala Tie Val 
85 


CAG 
Gin 


ACT 
Thr 


CTG 
Leu 


1913 


AAG CCT TGT 
100 


TGT 
Cys 


GCT 
Ala 


CCA 
Pro 
105 


1961 


TTT GAT GAC 
Phe Asp Asp 


Ser 


TCC 
Ser 
120 


AAT 
Asn 


2009 


GTA CGC TCA 
Val Arg Ser 


TGT 
Cys 


GGC TGC 
Gly cys 


2057 



fro wj-jf — — * 

60 65 

^TT AAC GCC CAT ATG AAT GCC ACC AAC CAC 
Asn Ala His Met Asn Ala Thr Asn His 
75 80 

STT CAT CTG ATG TTT CCT GAC CAC GTA CCA 
;al His Leu Met Phe Pro Asp His Val Pro 
90 ^5 ' 

\CC AAA TTA AAT GCC ATC* TCT GTT CTG TAC 
Phr Lys Leu Asn Ala He Ser Val Leu Tyr 
110 



vai xxe xieu i^y^ xijr» j-yj- - ^.^c 

CAC TAATATTAAA TAATATTGAT AATAACAAAA AGATCTGTAT TAAGGTTTAT 
His 

GGCTGCAATA AAAAGCATAC TTTCAGACAA ACAGAAAAAA AAA 

(2) INFORMATION FOR SEQ ID NO: 10: 

(i) SEQUENCE CHARACTERISTICS: ^ 

(A) LENGTH: 454 amino acxds 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10: 

Met His Leu Thr Val Phe Leu Leu Lys Gly He Val Gly Phe Leu Trp 
-316 -315 -310 -305 

ser cys Trp Val Leu Val Gly Tyr Ala Lys Gly Gly Leu Gly Asp Asn_^^^ 
-300 "295 "290 

His Val His ser Ser Phe He Tyr Arg Arg Leu Arg Asn His Glu Arg 
-280 -275 

Arg Glu He Gin Arg Glu He Leu Ser He Leu Gly Leu Pro His Arg 

-265 -260 -255 



2110 



2153 



wo 93/09229 



PCr/US92/09430 



111 

Pro Arg Pro Phe Ser Pro Gly Lys Met Thr Asn Gin Ala Ser Ser Ala 
*250 ^245 -240 

Pro Leu Phe Met Leu Asp Leu Tyr Asn Ala Glu Glu Asn Pro Glu Glu 
"235 .230 "225 



Ser Glu Tyr Ser Val Arg Ala Ser Leu Ala Glu Glu Thr Arg Gly Ala 
-220 -215 -210 

Arg Lys Gly Tyr Pro Ala Ser Pro Asn Gly Tyr Pro Arg Arg He Gin 
-200 -195 -190 

Leu Ser Arg Thr Thr Pro Leu Thr Thr Gin Ser Pro Pro Leu Ala Ser 
-185 -180 -175 

Leu His Asp Thr Asn Phe Leu Asn Asp Ala Asp Met Val Met Ser Phe 
-170 -165 -160 

Val Asn Leu Val Glu Arg Asp Lys Asp Phe Ser His Gin Arg Arg His 
-155 -150 -145 



-205 



Tyr Lys Glu Phe Arg Phe Asp Leu Thr Gin He Pro His Gly Glu Ala 
-140 -135 -130 

val Thr Ala Ala Glu Phe Arg He Tyr Lys Asp Arg Ser Asn Asn Arg 
"120 -115 -110 

Phe Glu Asn Glu Thr He Lys He Ser He Tyr Gin He He Lys Glu 



-125 



"105 



-100 



-95 



Tyr Thr Asn Arg Asp Ala Asp Leu Phe Leu Leu Asp Thr Arg Lys Ala 
-90 -85 ^ -80 

Gin Ala Leu Asp Val Gly Trp Leu Val Phe Asp He Thr Val Thr Ser 
-75 .70 _65 

Asn His Trp Val He Asn Pro Gin Asn Asn Leu Gly Leu Gin Leu Cvs 

-55 -50 -45 

Ala Glu Thr Gly Asp Gly Arg Ser He Asn Val Lys Ser Ala Gly Leu 
-40 -35 -30 

Val Gly Arg Gin Gly Pro Gin Ser Lys Gin Pro Phe Met Val Ala Phe 
-25 -20 -15 

Phe Lys Ala Ser Glu Val Leu Leu Arg Ser Val Arg Ala Ala Asn Lys 
-10 -5 1 

Arg Lys Asn Gin Asn Arg Asn Lys Ser Ser Ser His Gin Asp Ser Ser 
5 10 15 20 

Arg Met Ser Ser Val Gly Asp Tyr Asn Thr Ser Glu Gin Lys Gin Ala 
25 30 35 

Cys Lys Lys His Glu Leu Tyr Val Ser Phe Arg Asp Leu Gly Trp Gin 
40 45 50 

Asp Trp He He Ala Pro Glu Gly Tyr Ala Ala Phe Tyr Cys Asp Gly 
55 60 65 



wo 93/09229 



112 



PCrAJS92/09430 



Glu Cys ser Phe Pro Leu Asn Ala His Met Asn Ala Thr Asn His Ala 
70 75 80 

He val Gin Thr Leu Val His Leu Met Phe Pro Asp His Val Pro Lys 

85 90 
Pro cys cys Ala Pro Thr Lys Leu Asn Ala lie Ser Val Leu Tyr Phe 



105 



Asp ASP ser ser Asn Val He Leu Lys Lys Tyr Arg Asn Met Val Val 
120 125 J-JU 

Arg Ser Cys Gly Cys His 
135 

(2) INFORMATION FOR SEQ ID NO: 11: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 1003 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS : double 

(D) TOPOLOGY: circular 

(ii) MOLECULE TYPE: cDNA to mRNA 

(iii) HYPOTHETICAL: NO 

(vi) ORIGINAL SOURCE: 

(A) ORGANISM: Homo sapiens 
(F) TISSUE TYPE: Human Heart 

fvii) IMMEDIATE SOURCE: ^ ^ ^ t 

(A) LIBRARY: Human heart cDNA library stratagene catalog 

#936208 

(B) CLONE: hH38 

(viii) POSITION IN GENOME: 

(C) UNITS: bp 

(ix) FEATURE: 

(A) NAME/KEY: CDS 

(B) LOCATION: 8.. 850 

(ix) FEATURE: 

(A) NAME/KEY: mat__peptide 

(B) LOCATION: 427.. 843 

(ix) FEATURE: 

(A) NAME/KEY: mRNA 

(B) LOCATION: 1..997 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11: 

GAATTCC GAG CCC CAT TGG AAG GAG TTC CGC TTT GAC CTG ACC CAG ATC 
Glu Pro His Trp Lys Glu Phe Arg Phe Asp Leu Thr Gin lie 
-139 -135 -3.30 



wo 93/09229 



PCr/US92/09430 



U3 

CCG GCT GGG GAG GCG GTC ACA GCT GCG GAG TTC CGG ATT TAC AAG GTG 9* 

Pro Ala Gly Glu Ala Val Thr Ala Ala Glu Phe Arg lie Tyr Lys Val 
-125 -120 -115 -110 

CCC AGC ATC CAC CTG CTC AAC AGG ACC CTC CAC GTC AGC ATG TTC GAG 14 i 

Pro Ser lie His Leu Leu Asn Arg Thr Leu His Val Ser Met Phe Gin 
-105 -100 -95 

GTG GTC CAG GAG CAG TCC AAC AGG GAG TCT GAC TTG TTC TTT TTG GAT 19: 
Val Val Gin Glu Gin Ser Asn Arg Glu Ser Asp Leu Phe Phe Leu Asp 
-90 -85 -80 

CTT CAG ACG CTC CGA GCT GGA GAC GAG GGC TGG CTG GTG CTG GAT GTC 24: 
Leu Gin Thr Leu Arg Ala Gly Asp Glu Gly Trp Leu Val Leu Asp Val 
-75 -70 -65 

ACA GCA GCC AGT GAC TGC TGG TTG CTG AAG CGT CAC AAG GAC CTG GGA 2Bi 
Thr Ala Ala Ser Asp Cys Trp Leu Leu Lys Arg His Lys Asp Leu Gly 
-60 -55 -50 

CTC CGC CTC TAT GTG GAG ACT GAG GAT GGG CAC AGC GTG GAT CCT GGC 33: 
Leu Arg Leu Tyr Val Glu Thr Glu Asp Gly His Ser Val Asp Pro Gly 
-45 -40 -35 -30 

CTG GCC GGC CTG CTG GGT CAA CGG GCC CCA CGC TCC CAA CAG CCT TTC 38! 
Leu Ala Gly Leu Leu Gly Gin Arg Ala Pro Arg Ser Gin Gin Pro Phe 
-25 -20 -15 

GTG GTC ACT TTC TTC AGG GCC AGT CCG AGT CCC ATC CGC ACC CCT CGG 43: 
Val Val Thr* Phe Phe Arg Ala Ser Pro Ser Pro lie Arg Thr Pro Arg 
-10 -5 1 

GCA GTG AGG CCA CTG AGG AGG AGG CAG CCG AAG AAA AGC AAC GAG CTG 48: 
Ala Val Arg Pro Leu Arg Arg Arg Gin Pro Lys Lys Ser Asn Glu Leu 
5 10 15 

CCG CAG GCC AAC CGA CTC CCA GGG ATC TTT GAT GAC GTC CAC GGC TCC 525 
Pro Gin Ala Asn Arg Leu Pro Gly lie Phe Asp Asp Val His Gly Ser 
20 25 30 35 

CAC GGC CGG CAG GTC TGC CGT CGG CAC GAG CTC TAC GTC AGC TTC CAG 57: 
His Gly Arg Gin Val Cys Arg Arg His Glu Leu Tyr Val Ser Phe Gin 
40 45 50 

GAC CTT GGC TGG CTG GAC TGG GTC ATC GCC CCC CAA GGC TAC TCA GCC 62 5 

Asp Leu Gly Trp Leu Asp Trp Val lie Ala Pro Gin Gly Tyr Ser Ala 
55 60 65 

TAT TAC TGT GAG GGG GAG TGC TCC TTC CCG CTG GAC TCC TGC ATG AAC 671 
Tyr Tyr Cys Glu Gly Glu Cys Ser Phe Pro Leu Asp Ser Cys Met Asn 
70 75 80 

GCC ACC AAC CAC GCC ATC CTG CAG TCC CTG GTG CAC CTG ATG AAG CCA 72 j 

Ala Thr Asn His Ala lie Leu Gin Ser Leu Val His Leu Met Lys Pro 
85 90 95 

AAC GCA GTC CCC AAG GCG TGC TGT GCA CCC ACC AAG CTG AGC GCC ACC 7 65 

Asn Ala Val Pro Lys Ala Cys Cys Ala Pro Thr Lys Leu Ser Ala Thr 
100 105 110 115 



wo 93/09229 



PCT/US92/09430 



114 



TCT GTG CTC TAC TAT GAC AGC AGC AAC AAC GTC ATC CTG CGC JAG CAC 

Tyr 
120 



Ser val Leu Tyr Tyr Asp Ser Ser Asn Asn Val He Leu Arg Lys His 



CGC AAC ATG GTG GTC AAG GCC TGC GGC TGC CAC TGAGTCAGCC CGCCCAGCCC 
Arg Asn Met Val Val Lys Ala Cys Gly Cys His 
135 140 

TACTGCAGCC ACCCTTCTCA TCTGGATCGG GCCCTGCAGA GGCAGAAAAC CCTTAAATGC 
TGTCACAGCT CAAGCAGGAG TGTCAGGGGC CCTCACTCTC GGTGCCTACT TCCTGTCAGG 

CTTCTGGGAA TTC 

(2) INFORMATION FOR SEQ ID NO: 12: 

(i) SEQUENCE CHARACTERISTICS: ^ 

(A) LENGTH: 281 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 12: 

Glu Pro His Trp Lys Glu Phe Arg Phe Asp Leu Thr Gin He Pro Ala 
-139 -135 -130 

Gly Glu Ala val Thr Ala Ala Glu Phe Arg He Tyr Lys Val Pro Ser 
-120 -115 ; -110 

He His Leu Leu Ash Arg Thr Leu His Val Ser Met Phe Gin Val Val 
-105 -100 -95 

Gin Glu Gin Ser Asn Arg Glu Ser Asp Leu Phe Phe Leu Asp Leu Gin 
-90 -85 -80 

Thr Leu Arg Ala Gly Asp Glu Gly Trp Leu Val Leu Asp Val yhr Ala 
-75 -70 

Ala ser Asp Cys Trp Leu Leu Lys Arg His Lys Asp Leu Gly Leu Arg 
—55 —50 

Leu Tyr Val Glu Thr Glu Asp Gly His Ser Val Asp Pro Gly Leu Ala 
-40 -35 -30 

Gly Leu Leu Gly Gin Arg Ala Pro Arg Ser Gin Gin Pro Phe Val Val 
-25 -20 

Thr Phe Phe Arg Ala Ser Pro Ser Pro He Arg Thr Pro Arg Ala Val 
-10 -5 15 

Arg Pro Leu Arg Arg Arg Gin Pro Lys Lys Ser Asn Glu Leu Pro Gin 
10 15 20 

Ala Asn Arg Leu Pro Gly He Phe Asp Asp Val His Gly Ser His Gly 
25 30 35 

Arg Gin Val Cys Arg Arg His Glu Leu Tyr Val Ser Phe Gin Asp Leu 



817 
870 

936 
990 
1003 



wo 93/09229 



PCT/US92/09430 



115 



40 



45 



50 



Gly Trp Leu Asp Trp Val He Ala Pro Gin Gly Tyr Ser Ala Tyr Tyr 

55 60 65 

Cys Glu Gly Glu Cys Ser Phe Pro Leu Asp Ser Cys Met Asn Ala Thr 

70 75 80 85 

Asn His Ala He Leu Gin Ser. Leu Val His Leu Met Lys Pro Asn Ala 



Val Pro Lys Ala Cys Cys Ala Pro Thr Lys Leu Ser Ala Thr Ser Val 
105 110 115 

Leu Tyr Tyr Asp Ser Ser Asn Asn Val He Leu Arg Lys His Arg Asn 
120 125 130 

Met Val Val Lys Ala Cys Gly Cys His 



(2) INFORMATION FOR SEQ ID NO: 13: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 362 3 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS : double 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 



(vii) IMMEDIATE SOURCE: 

(B) CLONE: pALBP2-781 

(ix) FEATURE: 

(A) NAME/KEY: CDS 

(B) LOCATION: 2724.. 3071 

(ix) FEATURE: 

<A) NAME/KEY: terminator 
(B) LOCATION: 3150.. 3218 

(ix) FEATURE: 

(A) NAME/KEY: RBS 

(B) LOCATION: 2222,. 2723 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 13: 
GACGAAAGGG CCTCGTGATA CGCCTATTTT TATAGGTTAA TGTCATGATA ATAATGGTTT 
CTTAGACGTC AGGTGGCACT TTTCGGGGAA ATGTGCGCGG AACCCCTATT TGTTTATTTT 
TCTAAATACA TTCAAATATG TATCC^CTCA TGAGACAATA ACCCTGATAA AT<;CTTCAAT 
AATATTGAAA AAGGAA<3AGT ATGAGTATTC AACATTTCCG TOTCGCCCTT ATTCCCTTTT 
TTGCGGCATT TTGCCTTCCT GTTTTTGCTC ACCCA-GAAAC GCTGGTGAAA GTAAAA<3ATG 
CTGAAGATCA GTTGCGTGCA CGA<;TGGGTT ACATCCAACT CGATCTCAAC A0CGGTAA<5A 



90 



95 



100 



135 



140 



wo 93/09229 



PCr/US92/09430 



U6 

TCCTTGAGAG TTTTCGCCCC GAAGAACGTT TTCCAATGAT GAGCACTTTT AAAGTTCTGC 
TATGTGGCGC GGTATTATCC CGTATTGACG CCGGGCAAGA GCAACTCGGT CGCCGCATAC 
ACTATTCTCA GAATGACTTG GTPGAGTACT CACCAGTCAC AGAAAAGCAT CTTACGGATG 
GCATGACAGT AAGAGAATTA TGCAGTGCTG CCATAACCAT GAGTGATAAC ACTGCGGCCA 
ACTTACTTCT GACAACGATC GGAGGACCGA AGGAGCTAAC CGCTTTOTTG CACAACATGG 
GGGATCATGT AACTCGCCTT GATCGTTGGG AACCGGAGCT GAATGAAGCC ATACCAAACG 
ACGAGCGTGA CACCACGATG CCTGTAGCAA TGGCAACAAC GTTGCGCAAA CTATTAACTG 
GCGAACTACT TACTCTAGCT TCCCGGCAAC AATTAATAGA CTGGATGGAG GCGGATAAAG 
TOGCAGGACC ACTTCTGCGC TCGGCCCTTC CGGCTGGCTG GTTTATTGCT GATAAATCTG 
GAGCCGGTGA GCGTGGGTCT CGCGGTATCA I^GCAGCACT GGGGCCAGAT GGTAAGCCCT 
CCCGTATCGT AGTTATCTAC ACGACGGGGA GTCAGGCAAC TATGGATGAA CGAAATAGAC 
AGATCGCTGA GATAGGTGCC T«^CTGATTA AGCATTGGTA ACTGTCAGAC CAAGTTTACT 
CATATATACT TTAGATTGAT TTAAAACTTC ATTTTTAATT TAAAAGGATC TAGGTGAAGA 
TCCTTTTTGA TAATCTCATG ACCAAAATCC CTTAACGTGA GTTTTCGTTC CACTGAGCGT 
CAGACCCCGT AGAAAAGATC AAAGGATCTT CTTGAGATCC TTTTTTTCTG CGCGTAATCT 
GCTGCTTGCA AACAAAAAAA CCACCGCTAC CAGCGGTGGT TTGTTTGCCG GATCAAGAGC 
TACCAACTCT TTTTCCGAAG GTAACTGGCT TCAGCAGAGC GCAGATACCA AATACTGTCC 
TTCTAGTGTA GCCGTAGTTA GGCCACCACT TCAAGAACTC TGTAGCACGG CCTACATACC 
TCGCTCTGCT AATCCTCTTA CCAGTGGCTG CTGCCAGTGG CGATAAGTCG TGTCTTACCG 
GGTTGGACTC AAGACGATAG TTACCGGATA AGGCGCAGCG GTCGGGCTGA AC<iGGGGGTT 
CGTGCACACA GCCCAGCTTG GAGCGAACGA CCTACACCGA ACTGAGATAC CTACAGCGTG 
AGCATTGAGA AAGCGCCACG CTTCCCGAAG GGAGAAAGGC GGACAGGTAT CCGGTAAGCG 
GCAGGGTCGG AACAGGAGAG CGCACGAGGG AGCTTCCAGG GGGAAACGCC TGGTATCTTT 
ATAGTCCTGT CGGGTTTCGC CACCTCTGAC TTGAGCGTCG ATTTTTGTGA TGCTCGTCAG 
GGGGGCGGAG CCTATGGAAA AACGCCAGCA ACGCGGCCTT OTTAGGGTTC CTGGCCTTTT 
GCTGGCCTTT TGCTCACATG TTCTTTCCTG CGTTATCCCC TGATTCTGTG GATAACGGTA 
TTACCGCCTT TGAGTGAGCT GATACCGCTC GCCGCAGCCG AACGACCGAG CGCAGCXSAGT 
CAGTGAGCGA GGAAGCGGAA GAGCGCCCAA TACGCAAACC GCCTCTCCCC GCGCGTTGGC 
CGATTCATTA ATGCAGAATT GATCTCTCAC CTACCAAACA ATGCCCCC<:T GCAAAAAATA 
AATTCATATA AAAAACATAC AGATAACCAT CTGGGGTGAT AAATTATCTC TGGCGGTGTT 



420 
480 
540 
600 ^ 
660 
720 i 
780 
840 
900 
960 
1020 
1080 
1140 
1200 
1260 
1320 
1380 
1440 
1500 
1560 
1620 
1680 
1740 
1800 
1860 
1920 
1980 
2040 
2100,. 
2160 



wo 93/09229 



PCT/US92/09430 



U7 



GACATAAATA 


CCACTGGCGG 


TGATACTGAG 


CACATCAGCA 


GGACGCACTG 


ACCACCATGA 


2220 


AGGTGACGCT 


CTTAAAAATT 


AAGCCCTGAA 


GAAGGGCAGC 


ATTCAAAGCA 


GAAGGCTTTG 


2280 


GGGTGTGTGA 


TACGAAACGA 


AGCATTGGCC 


GTAAGTGCGA 


TTCCGGATTA 


GCTGCCAATG 


2340 


TGCCAATCGC 


GGGGGGTTTT 


CGTTCAGGAC 


TACAACTGCC 


ACACACCACC 


AAAGCTAACT 


2400 


GACAGGAGAA 


TCCAGATGGA 


TGCACAAACA 


CGCCGCCGCG 


AACGTCGCGC 


AGAGAAACAG 


2460 


GCTCAATGGA 


AAGCAGCAAA 


TCCCCTGTTG 


GTTGGGGTAA 


GCGCAAAACC 


AGTTCCGAAA 


2520 


GATTTTTTTA 


ACTATAAACG 


CTGATGGAAG 


CGTTTATGCG 


GAAGAGGTAA 


AGCCCTTCCC 


2580 


GAGTAACAAA 


AAAACAACAG 


CATAAATAAC 


CCCGCTCTTA 


CACATTCCAG 


CCCTGAAAAA 


2640 


GGGCATCAAA 


TTAAACCACA 


CCTATGGTGT 


ATGCATTTAT 


TTGCATACAT 


TCAATCAATT 


2700 


GTTATCTAAG 


GAAATACTTA 


CAT ATG CAA GCT AAA CAT AAA CAA CGT AAA 


2750 



Met Gin Ala Lys His Lys Gin Arg Lys 
1 5 

CGT CTG AAA TCT AGC TGX AAG AGA CAC CCT TTG TAG GTG GAC TTC AGT 2798 
Arg Leu Lys Ser Ser Cys Lys Arg His Pro Leu Tyr Val Asp Phe Ser 
10 15 20 25 

GAC GTG GGG TGG AAT GAC TGG ATT GTG GCT CCC CCG GGG TAT CAC GCC 2 84 6 

Asp Val Gly Trp Asn Asp Trp He Val Ala Pro Pro Gly Tyr His Ala 
30 35 40 

TTT TAC TGC CAC GGA GAA TGC CCT TTT CCT CTG GCT GAT CAT CTG AAC 2894 
Phe Tyr Cys His Gly Glu Cys Pro Phe Pro Leu Ala Asp His Leu Asn 
45 50 55 

TCC ACT AAT CAT GCC ATT GTT CAG ACG TTG GTC AAC TCT GTT AAC TCT 294 2 

Ser Thr Asn His Ala He Val Gin Thr Leu Val Asn Ser Val Asn Ser 
60 65 70 

AAG ATT CCT AAG GCA TGC TGT GTC CCG ACA GAA CTC AGT GCT ATC TCG 299 0 

Lys He Pro Lys Ala Cys Cys Val Pro Thr Glu Leu Ser Ala He Ser 
75 80 85 

ATG CTG TAC CTT GAC GAG AAT GAA AAG GTT GTA TTA AAG AAC TAT CAG 303 8 

Met Leu Tyr Leu Asp Glu Asn Glu Lys Val Val Leu Lys Asn Tyr Gin 
90 95 100 105 



GAC ATG GTT GTG GAG GGT TGT GGG TGT CGC TAGTACAGCA AAATTAAATA 
Asp Met Val Val Glu Gly Cys Gly Cys Arg 
110 115 


3088 


CATAAATATA TATATATATA TATATTTTAG AAAAAAGAAA 


AAAATCTAGA 


GTCGACCTGC 


3148 


AGTAATCGTA CAGGGTAGTA CAAATAAAAA AGGCACGTCA 


GATGACGTGC 


CTTTTTTCTT 


3208 


GTGAGCAGTA AGCTTGGCAC TGGCCGTCGT TTTACAACGT 


CGTGACTGGG 


AAAACCCTGG 


3268 


CGTTACCCAA CTTAATCGCC TTGCAGCACA TCCCCCTTTC 


GCCAGCTGGC 


GTAATACCGA 


3328 


AGAGGCCCGC ACCGATCGCC CTTCCCAACA GTTGCGCAGC 


CTGAATGGCG 


AATGGCGCCT 


3388 



«-,,nn-,nft PCr/US92/09430 
WO 93/09229 

118 

GATGCGGTAT TTTCTCCTTA CGCATCTGTG CGGTATTTCA CACCGCATAT ATGGTGCACT 3448 
CTCAGTACAA TCTGCTCTGA TGCCGCATAG TTAAGCCAGC CCCGACACCC GCCAACACCC 3508 
GCTGACGCGC CCTGACGGGC TTGTCTGCTC CCGGCATCCG CTTACAGACA AGCTGTGACC 3568 
GTCTCCGGGA GCTGCATGTG TCAGAGGTTT TCACCGTCAT CACCGAAACG CGCGA 3 623 

(2) INFORMATION FOR SEQ ID NO: 14: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 115 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 14: 

Met Gin Ala Lys His Lys Gin Arg Lys Arg Leu Lys Ser Ser Cys Lys 
1 5 10 15 

Arg His Pro Leu Tyr Val Asp Phe Ser Asp Val Gly Trp Asn Asp Trp 
20 25 30 

He Val Ala Pro Pro Gly Tyr His Ala Phe Tyr Cys His Gly Glu Cys 
35 40 45 

Pro Phe Pro Leu Ala Asp His Leu Asn Ser Thr Asn His Ala He Val 
50 55 60 

Gin Thr Leu Val Asn Ser Val Asn Ser Lys He Pro Lys Ala Cys Cys 
65 70 75 80 

Val Pro Thr Glu Leu Ser Ala He Ser Met Leu Tyr Leu Asp Glu Asn 
85 90 95 

Glu Lys Val Val Leu Lys Asn Tyr Gin Asp Met Val Val Glu Gly Cys 
100 105 110 

Gly Cys Arg 
115 

(2) INFORMATION FOR SEQ ID NO: 15: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 14 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS : single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 15: 



wo 93/09229 



PCr/US92/09430 



119 



CATGGGCAGC TGAG 



14 



(2) INFORMATION FOR SEQ ID NO: 16: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 41 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS : single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 



(2) INFORMATION FOR SEQ ID NO: 17: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 38 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 17: 
GGATGTGGGT GCCGCTGACT CTAGAGTCGA CGGAATTC 3 8 

(2) INFORMATION FOR SEQ ID NO: 18: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 31 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 18: 
AATTCACCAT GATTCCTGGT AACCGAATGC T 31 
(2) INFORMATION FOR SEQ ID NO: 19: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 25 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 



(xi) 



SEQUENCE DESCRIPTION: SEQ ID NO: 16: 



GAGGGTTGTG GGTGTCGCTA GTGAGTCGAC TACAGCAAAT T 



41 



wo 93/09229 



120 



PCT/US92/09430 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 19: 
GTGGTACTAA GGACCATTGG CTTAC 
(2) INFORMATION FOR SEQ ID NO: 20: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 27 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 20: 
CGACCTGCAG CCATGCATCT GACTGTA 
(2) INFORMATION FOR SEQ ID NO: 21: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 27 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 21: 
TGCCTGCAGT TTAATATTAG TGGCAGC 
(2) INFORMATION FOR SEQ ID NO: 22: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 15 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 22: 
CGACCTGCAG CCACC 

(2) INFORMATION FOR SEQ ID NO: 23: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 81 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 



wo 93/09229 



121 



PCT/US92/09430 



(D) TOPOLOGY: linear 
(ii) MOLECULE TYPE: DNA (genomic) 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 23: 
TCGACCCACC ATGCCGGGGC TGGGGCGGhG GGCGCAGTGG CTGTGCTGGT GGTGGGGGCT 
GTGCTGCAGC TGCTGCGGGC C 
(2) INFORMATION FOR SEQ ID NO: 24: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 73 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS : single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 24: 
CGCAGCAGCT GCACAGCAGC CCCCACCACC AGCACAGCCA CTGCGCCCTC CGCCCCAGCC 
CCGGCATGGT GGG 

(2) INFORMATION FOR SEQ ID NO: 25: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 11 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 25: 
TCGACTGGTT T 

(2) INFORMATION FOR SEQ ID NO: 26: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 9 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 26: 



wo 93/09229 



PCr/US92/09430 



122 

CGAAACCAG 

(2) INFORMATION FOR SEQ ID NO: 27: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 18 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS : single 

(D) TOPOLOGY: linear 

(ii) MOLECUI£ TYPE: DNA (genomic) 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 
TCGACAGGCT CGCCTGCA 
(2) INFORMATION FOR SEQ ID NO: 28: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 10 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 28: 
GTCCGAGCGG 

(2) INFORMATION FOR SEQ ID NO: 29: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 2& base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 29: 
CAGGTCGACC CACCATGCAC GTGCGCTCA 
(2) INFORMATION FOR SEQ ID NO: 30: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 27 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 



wo 93/09229 



PCr/US92/09430 



123 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 30; 
TCTGTCGACC TCGGAGGAGC TAGTGGC 



wo 93/09229 



PCr/US92/09430 



124 

VmKT IS CLAIMED IS: 

1. A method for producing a heterodimeric 
protein having bone stimulating activity comprising 
culturing a selected host cell containing a sequence 

5 encoding a first selected BMP or fragment thereof and a 
sequence encoding a second selected BMP or fragment 
thereof, said sequences each being under the control of a 
suitable regulatory sequence capable of directing co- 
expression of said proteins, and isolating said 
10 heterodimeric protein from the culture medium. 

2. The method according to claim 1 wherein 
said first BMP or fragment thereof is present on a first 
vector transfected into said host cell and said second 
BMP or fragment thereof is present on a second vector 

15 transfected into said host cell. 

3. The method according to claim 1 wherein 
both said BMPs or fragments thereof are incorporated into 
a chromosome of said host cell. 

4. The method according to claim 1 wherein 
20 both BMPs or fragments thereof are present on a single 

vector. 

5. The method according to claim 2 wherein 



wo 93/09229 



PCr/US92/09430 



125 

more than a single copy of the gene encoding each said 
BMP or fragment thereof is present on each vector, 

6. The method according to claim 1 wherein 
said host cell is a hybrid cell prepared by culturing two 
5 fused selected, stable host cells, each host cell 

transfected with a sequence encoding a selected first or 
second BMP or fragment thereof, said sequences under the 
control of a suitable regulatory sequence capable of 
directing expression of each protein or fragment. 

10 ?• The method according to claim 1 wherein 

said host cell is a mammalian cell. 

8. The method according to claim 1 wherein 
said host cell is an insect cell. 

9. The method according to claim 1 wherein 
15 said host cell is a yeast cell. 

10. A method for producing a heterodimeric 
protein having bone stimulating activity in a bacterial 
cell comprising culturing a selected host cell containing 
a sequence encoding a first selected BMP or fragment 

20 thereof under the control of a suitable regulatory 

sequence capable of directing expression of the protein 
or protein fragment under conditions suitable for the 



wo 93/09229 



PCr/US92/09430 



126 

formation of a soluble, monomeric protein; culturing a 
selected host cell containing a sequence encoding a 
second selected BMP or fragment thereof under the control 
of a suitable regulatory sequence capable of directing 
5 ejcpression of the protein or protein fragment under said 
conditions to form a second soluble, monomeric protein; 
and mixing said soluble monomeric proteins under 
conditions permitting the formation of dimeric proteins 
associated by at least one covalent disulfide bond; 
10 isolating from the mixture a heterodimeric protein. 

11. The method according to claim 10 wherein 
said host cell is E. coli. 

12. The method according to claim 10 wherein 
said conditions comprise treating said protein with a 

15 solubilizing agent. 

13. A recombinant heterodimeric protein having 
bone stimulating activity comprising a first protein or 
fragment of BMP-2 in association with a second protein or 
fragment thereof selected from the group consisting of 

20 BMP-5, BMP-6, BMP-7 and BMP-8. 



14. The protein according to claim 13 wherein 
said second protein is BMP-5. 



wo 93/09229 



PCr/US92/09430 



127 

15. The protein according to claim 13 wherein 
said second protein is BMP-6. 

16. The protein according to claim 13 wherein 
said second protein is BMP-7. 

5 17. The protein according to claim 13 wherein 

said second protein is BMP-8. 

18. A recombinant heterodimeric protein having 
bone stimulating activity comprising a protein or 
fragment of BMP-4 in association with a second protein or 

10 fragment thereof selected from the group consisting of 
BMP-5, BMP-6, BMP-7 and BMP-8. 

19. The protein according to claim 18 wherein 
said second protein is BMP-5. 

20. The protein according to claim 18 wherein 
15 said second protein is BMP-6. 

21. The protein according to claim 18 wherein 
said second protein is BMP-7. 

22. The protein according to claim 18 wherein 
said second protein is BMP-8. 



wo 93/09229 



PCr/US92/09430 



128 

23. A recombinant heterodimeric protein having 
bone stimulating activity comprising a protein or 
fragment of a first BMP in association with a second 
protein or fragment of a second BMP produced by co- 

5 expressing said proteins in a selected host cell. 

24. The protein according to claim 23 wherein 
said first BMP is BMP-2 and said second BMP is BMP-7. 

25. A cell line comprising a nucleotide 
sequence encoding a first BMP or fragment thereof under 

10 control of a suitable expression regulatory system and a 
nucleotide sequence encoding a second BMP or fragment 
thereof \inder control of a suitable expression regulatory 
system, said regulatory systems capable of directing the 
co-expression of said BMPs or fragments thereof and the 

15 formation of heterodimeric protein. 

26. The cell line according to claim 25 
wherein said nucleotide sequences encoding said first and 
second BMP proteins are present in a single DNA molecule. 

27. The cell line according to claim 25 

20 wherein said nucleotide sequence encoding said first BMP 
is present on a first DNA molecule and said nucleotide 
sequence encoding said second BMP is present on a second 
DNA molecule. 



wo 93/09229 



PCT/US92/09430 



129 

28. The cell line according to claim 26 
wherein said single DNA molecule comprises a first 
transcription unit containing a gene encoding a first BMP 
or fragment thereof and a second transcription unit 
5 containing a gene encoding a second BMP or fragment 
thereof . 



29. The cell line according to claim 26 
wherein said single DNA molecule comprises a single 
transcription unit containing multiple copies of said 

10 gene encoding said first BMP or fragments thereof and 

multiple copies of said gene encoding said second BMP or 
fragments thereof. 

30. A DNA molecule comprising a sequence 
encoding a first selected BMP or fragment thereof and a 

15 sequence encoding a second selected BMP or fragment 

thereof, said sequences under the control of at least one 
suitable regulatory sequence capable of directing co- 
expression of each BMP or fragment thereof. 

31. The molecule according to claim 30 

20 comprising a first transcription unit containing a gene 
encoding a first BMP or fragment thereof and a second 
transcription unit containing a gene encoding a second 
BMP or fragment thereof. 



wo 93/09229 



PCr/US92/09430 



130 



32. The molecule according to claim 30 
comprising a single transcription unit containing 
multiple copies of said gene encoding said first BMP or 
fragments thereof and multiple copies of said gene 

5 encoding said second BMP or fragments thereof. 

33. The protein according to claim 23 wherein 
said first BMP is BMP-2 and said second BMP is MIP-6. 

34. A recombinant BMP-2 homodimer having bone 
stimulating activity said homodimer produced in E^. G2li. 

20 35. A method for producing a homodimeric BMP-2 

protein having bone stimulating activity said method 
comprising culturing £^ coli host cells and isolating and 
purifying said protein from the resulting culture medium. 

36. A recombinant heterodimeric protein having 
15 bone stimulating activity comprising a first protein or 

fragment of BMP-2 in association with a second protein or 
fragment of BMP-2. 



wo 93/09229 PCr/US92/09430 

1/32 

FIGURE lA 



10 20 30 40 50 60 70 

GTCGACTCTA GAGTGTGTGT CAGCACTTGG CTGGGGACTT CTTGAACTTG CAGGGAGAAT AACTTGCGCA 



80 90 100 110 120 130 140 

CCCCACTTTG CGCCGGTGCC TTTGCCCCAG CGGAGCCTGC TTCGCCATCT CCGAGCCCCA CCGCCCCTCC 



150 160 170 180 190 200 210 

ACTCCTCGGC CTTGCCCGAC ACTGAGACGC TGTTCCCAGC GTGAAAAGAG AGACTGCGCG GCCGGCACCC 



220 230 240 250 260 270 280 

GGGAGAAGGA GGAGGCAAAG AAAAGGAACG GACATTCGGT CCTTGCGCCA GGTCCTTTGA CCAGAGTTTT 



290 300 310 320 330 340 350 

TCCATGTGGA CGCTCTTTCA ATGGACGTGT CCCCGCGTGC TTCTTAGACG GACTGCGGTC TCCTAAAGGT 



(1) 370 385 400 

CGACC ATG GTG GCC GGG ACC CGC TGT CTT CTA GCG TTG CTG CTT CCC CAG GTC 
MET Val Ala Gly Thr Arg Cys Leu Leu Ala Leu Leu Leu Pro Gin Val 

415 430 445 

CTC CTG GGC GGC GCG GCT GGC CTC GTT CCG GAG CTG GGC CGC AGG AAG TTC GCG 
Leu Leu Gly Gly Ala Ala Gly Leu Val Pro Glu Leu Gly Arg Arg Lys Phe Ala 

(24) 

460 475 490 505 

GCG GCG TCG TCG GGC CGC CCC' TCA TCC CAG CCC TCT GAC GAG GTC CTG AGC GAG 

Ala Ala Ser Ser Gly Arg Pro Ser Ser Gin Pro Ser Asp Glu Val I^u Ser Glu 

520 535 550 565 

TTC GAG TTG CGG CTG CTC AGC ATG TTC GGC CTG AAA CAG AGA CC^ ACC CCC AGC 
Phe Glu Leu Arg Leu Leu Ser MET Phe Gly Leu Lys Gin Arg Pro Thr Pro Ser 

580 595 610 

AGG GAC GCC GTG GTG CCC CCC TAC ATG CTA GAC CTG TAT CGC AGG CAC TCA GGT 
Arg Asp Ala Val Val Pro Pro Tyr MET Leu Asp Leu Tyr Arg Arg His Ser Gly 

625 640 655 670 

CAG CCG GGC TCA CCC GCC CCA GAC CAC CGG TTG GAG AGG GCA GCC AGC CGA GCC 
Gin Pro Gly Ser Pro Ala Pro Asp His Arg Leu Glu Arg Ala Ala Ser Arg Ala 



SUBSTITUTE SHEET 



wo 93/09229 



2/32 



PCr/US92/09430 



FIGURE IB 



685 700 715 

AAC ACT GTG CGC AGC TTC CAC CAT GAA GAA TCT TTG GAA GAA CTA CCA GAA ACG 
Asn Thr Val Arg Ser Phe His His Glu Glu Ser Leu Glu Glu Leu Pro Glu Thr 

730 745 760 775 

AGT GGG AAA ACA ACC CGG AGA TTC TTC TTT AAT TTA ACT TCT ATC CCC ACG GAG 

Ser Gly Lys Thr Thr Arg Arg Phe Phe Phe Asn Leu Ser Ser He Pro Thr Glu 

790 805 820 835 

GAG TTT ATC ACC TCA GCA GAG CTT CAG GTT TTC CGA GAA CAG ATG CAA GAT GCT 
Glu Phe He Thr Ser Ala Glu Leu Gin Val Phe Arg Glu Gin MET Gin Asp Ala 

850 865 880 

TTA GGA AAC AAT AGC AGT TTC CAT CAC CGA ATT AAT ATT TAT GAA ATC ATA AAA 
Leu Gly Asn Asn Ser Ser Phe His His Arg He Asn He Tyr Glu He He Lys 

910 925 940 

CCT GCA ACA GCC AAC TCG AAA TTC CCC GTG ACC AGA CTT TTG GAC ACC AGG TTG 
Pro Ala Thr Ala Asn &er Lys Phe Pro Val Thr Arg Leu Leu Asp Thr Arg Leu 

955 970 985 

GTG AAT CAG AAT GCA AGC AGG TGG GAA AGT TTT GAT GTC ACC CCC GCT GTG ATG 
Val Asn Gin Asn Ala Ser Arg Trp Glu Ser Phe Asp Val Thr Pro Ala Val MET 

1000 1015 1030 1045 

CGG TGG ACT GCA CAG GGA CAC GCC AAC CAT GGA TTC GTG GTG GAA GTG GCC CAC 

Arg Trp Thr Ala Gin Gly His Ala Asn His Gly Phe Val Val Glu Val Ala His 

1060 • 1075 1090 1105 

TTG GAG GAG AAA CAA GGT GTC TCC AAG AGA CAT GTT AGG ATA AGC AGG TCT TTG 
Leu Glu Glu Lys Gin Gly Val Ser Lys Arg His Val Arg He Ser Arg Ser Leu 

(249) 

1120 1135 1150 

CAC CAA GAT GAA CAC AGC TGG TCA CAG ATA AGG CCA TTG CTA GTA ACT TTT GCC 
His Gin Asp Glu His Ser Trp Ser Gin He Arg Pro Leu Leu Val Thr Phe Gly 

(266) 

1165 1180 1195 1210 

CAT GAT GGA AAA GGG CAT CCT CTC CAC AAA AGA GAA AAA CGT CAA GCC AAA CAC 
His Asp Gly Lys Gly His Pro Leu His Lys Arg Glu Lys Arg Gin Ala Lys His 

(283) 

1225 1240 1255 

AAA CAG CGG AAA CGC CTT AAG TCC AGC TGT AAG AGA CAC CCT TTG TAC GTG GAC 
Lys Gin Arg Lys Arg Leu Lys Ser Ser Cys Lys Arg His Pro Leu Tyr Val Asp 

(296) 

1270 1285 1300 1315 

TTC AGT GAC GTG GGG TGG AAT GAC TGG ATT GTG GCT CCC CCG GGG TAT CAC GCC 
Phe Ser Asp Val Gly Trp Asn Asp Trp He Val Ala Pro Pro <;iy Tyr His Ala 



SUBSTITUTE SHEET 



wo 93/09229 



3/32 



PCT/US92/09430 



FIGURE IC 





1330 








1345 








1360 










1375 


TTT 


TAC 


TGC 


•CAC 


GGA 


GAA 


TGC CCT 


TTT 


CCT 


CTG 


GCT GAT 


CAT 


CTG 


AAC 


TCC 


ACT 


Phe 


Tyr 


Cys 


His 


Gly 


Glu 


Cys Pro 


Phe 


Pro 


Leu 


Ala Asp 


His 


Leu 


Asn 


Ser 


Thr 








1390 






1405 






1420 








AAT 


CAT 


GCC 


ATT 


GTT 


CAG 


ACG TTG 


GTC 


AAC 


TCT 


GTT AAC 


TCT 


AAG 


ATT 


CCT 


AAG 


Asn 


His 


Ala 


lie 


Val 


Gin 


Thr Leu 


Val 


Asn 


Ser 


Val Asn 


Ser 


Lys 


He 


Pro 


Lys 


1435 








1450 






1465 






1480 




GCA 


TGC 


TGT 


GTC 


CCG 


ACA 


GAA CTC 


AGT 


GCT 


ATC 


TCG ATG 


CTG 


TAC 


CTT 


GAC 


GAG 


Ala 


Cys 


Cys 


Val 


Pro 


Thr 


Glu Leu 


Ser 


Ala 


He 


Ser MET 


Leu 


Tyr 


Leu 


Asp 


Glu 






1495 






1510 






1525 










AAT 


GAA 


AAG 


GTT 


GTA 


TTA 


AAG AAC 


TAT 


CAG 


GAC 


ATG GTT 


GTG 


GAG 


GGT 


TGT 


GGG 


Asn 


Glu 


Lys 


Val 


Val 


Leu Lys Asn Tvr Gin 


ASD MET val 


Val 


G3.U 


Gly 


Cys 


Gly 


1540(396) 


1553 




1563 




1573 




1583 




1593 




16C 



TGT CGC TAGTACAGCA AAATTAAATA CATAAATATA TATATATATA TATATTTTAG AAAAAAGAAA 
Cys Arg 

AAAA 



SUBSTITUTE SHEET 



wo 93/09229 



4/32 



PCr/US92/09430 



FIGURE 2A 



20 30 40 50 60 its 

CTCTAGAGGG CAGAGGAGGA GGGAGGGAGG GAAGGAGCGC GGAGCCCGGC CCGGAAGCTA GGTGAGTGTG 

GCATCCGAG? TGAGGGAcI? GAGCCTGiSA CGCCGCTGCT GCTCCGGCTG AGTATCTAG? TTGTCTCcJ? 

150 160 170 180 190 200 o i n 

GATGGGATTC CCGTCCAAGC TATCTCGAGC CTGCAGCGCC ACAGTCCCCG GCCCTCGCCC AGGTTCACTG 

CAACCGT??A GAGGTCCCCA GGAGCTGCTC CTGGCGaI?? CGCTACTgS GGGACCtIJg GAGCCATT?? 

GTAGTGC?!? CCCGAGC^? GCACTGCTC? AGCTTCCCTC AGCCTTtJJa GCAAGTT^CT TCAAGAi4gG 

370 380 390 400 fll 

CTGTCAAGAA TCATGGACTG TTATTATATG CCTTGTTTTC TGTCAAGACA CC ATG ATT CCT 

MET He Pro 

417 432 447 

GGT AAC CGA ATG CTG ATG GTC GTT TTA TTA TGC CAA GTC CTG CTA GGA GGC GCG 
Gly Asn Arg MET Leu MET Val Val Leu Leu Cys Gin Val Leu 2u G?y lly HI 



477 



sll l^l f r GGG AAC AAA AAA GTC GCC GAG ATT CAG 

Ser HIS Ala Ser Leu He Pro Glu Thr Gly Lys Lys Lys Val Ala Glu lie Gin 

522 537 

G?5 nil lit r?^ r?* f^*" f*^^ ^""^ CTC CTG CGG GAC TTC 

Gly His Ala Gly Gly Arg Arg Ser Gly Gin Ser His Glu Leu Leu Arg Asp Phe 

5*2 597 g2^2 

r^": f f^"^ ^ ^"^^ TTT GGG CTG CGC CGC CGC CCG CAG CCT AGC AAG 

Glu Ala Thr Leu Leu Gin MET Phe Gly Leu Arg Arg Arg Pro Gin Pro Ser ijs 

gy* 

ser 111 vl^ ^"^^ ^^"^ ^ CGG CTT CAG TCT GGG GAG 

Ser Ala Val He Pro Asp Tyr MET Arg Asp Leu Tyr Arg Leu Gin Ser Gly Glu 



SUBSTITUTE SHEET 



wo 93/09229 



5/32 



PCr/US92/09430 



FIGURE 2B 



6B7 702 717 732 

GAG GAG GAA GAG CAG ATC CAC AGC ACT GGT CTT GAG TAT CCT GAG CGC CCG GCC 
Glu Glu Glu Glu Gin lie His Ser Thr Gly Leu Glu Tyr Pro Glu Arg Pro Ala 

747 762 777 

AGC CGG GCC AAC ACC GTG AGG AGC TTC CAC CAC GAA GAA CAT CTG GAG AAC ATC 
Ser Arg Ala Asn Thr Val Arg Ser Phe His His Glu Glu His Leu Glu Asn lie 

792 807 822 837 

CCA GGG ACC AGT GAA AAC TCT GCT TTT CGT TTC CTC TTT AAC CTC AGC AGC ATC 

Pro Gly Thr Ser Glu Asn Ser Ala Phe Arg Phe Leu Phe Asn Leu Ser Ser He 

852 867 882 897 

CCT GAG AAC GAG GTG ATC TCC TCT GCA GAG CTT CGG CTC TTC CGG GAG CAG GTG 
Pro Glu Asn Glu Val He Ser Ser Ala Glu Leu Arg Leu Phe Arg Glu Gin Val 

912 927 942 

GAC CAG GGC CCT GAT Tpc GAA AGG GGC TTC CAC CGT ATA AAC ATT TAT GAG GTT 
Asp Gin Gly Pro Asp Trp Glu Arg Gly Phe His Arg He Asn He Tyr Glu Val 

957 972 987 1002 

ATG AAG CCC CCA GCA GAA GTG GTG CCT GGG CAC CTC ATC ACA CGA CTA CTG GAC 
MET Lys Pro Pro Ala Glu Val Val Pro Gly His Leu He Thr Arg Leu Leu Asp 

1017 1032 1047 

ACG AGA CTG GTC CAC CAC AAT GTG ACA CGG TGG GAA ACT TTT GAT GTG AGC CCT 
Thr Arg Leu Val His His Asn Val Thr Arg Trp Glu Thr Phe Asp Val Ser Pro 

1062 1077 1092 1107 

GCG GTC CTT CGC TGG ACC CGG GAG AAG CAG CCA AAC TAT GGG CTA GCC ATT GAG 

Ala Val Leu Arg Trp Thr Arg Glu Lys Gin Pro Asn Tyr Gly Leu Ala He Glu 

1122 1137 1152 1167 

GTG ACT CAC CTC CAT CAG ACT CGG ACC CAC CAG GGC CAG CAT GTC ACG ATT AGC 
Val Thr His Leu His Gin Thr Arg Thr His Gin Gly Gin His Val Arg He Ser 

1182 1197 1212 

CGA TCG TTA CCT CAA GGG AGT GGG AAT TGG GCC CAG CTC CGG CCC CTC CTG GTC 
Arg Ser Leu Pro Gin Gly Ser Gly Asn Trp Ala Gin Leu Arg Pro Leu Leu Val 

1227 1242 1257 1272 

ACC TTT GGC CAT GAT GGC CGG GGC CAT GCC TTG ACC CGA CGC CGG AGG GCC AAG 
Thr Phe Gly His Asp Gly Arg Gly His Ala Leu Thr Arg Arg Arg Arg Ala Lys 

1287 1302 1317 

CGT AGC CCT AAG CAT CAC TCA CAG CGG GCC AGG AAG AAG AAT AAG AAC TGC CGG 
Arg Ser Pro Lys His His Ser Gin Arg Ala Arg Lys Lys Asn Lys Asn Cys Arg 
(293) 



SUBSTITUTE SHEET 



wo 93/09229 



6/32 



PCT/LIS92/09430 



FIGURE 2C 



1332 1347 1362 1377 

CGC CAC TCG CTC TAT GTG GAC TTC AGC GAT GTG GGC TGG AAT GAC TGG ATT GTG 

Arg His Ser' Leu Tyr Val Asp Phe Ser Asp Val Gly Trp Asn Asp Trp lie Val 

1392 1407 1422 1437 

GCC CCA CCA GGC TAC CAG GCC TTC TAC TGC CAT GGG GAC TGC CCC TTT CCA CTG 
Ala Pro Pro Gly Tyr Gin Ala Phe Tyr Cys His Gly Asp Cys Pro Phe Pro Leu 

1452 1467 1482 

GCT GAC CAC CTC AAC TCA ACC AAC CAT GCC ATT GTG CAG ACC CTG GTC AAT TCT 
Ala Asp His Leu Asn Ser Thr Asn His Ala He Val Gin Thr Leu Val Asn Ser 

1497 1512 1527 1542 

GTC AAT TCC AGT ATC CCC AAA GCC TGT TGT GTG CCC ACT GAA CTG AGT GCC ATC 
Val Asn Ser Ser He Pro Lys Ala Cys Cys Val Pro Thr Glu Leu Ser Ala He 

1557 1572 1587 

TCC ATG CTG TAC CTG GAT GAG TAT GAT AAG GTG GTA CTG AAA AAT TAT CAG GAG 
Ser MET Leu Tyr Leu A^gp Glu Tyr Asp Lys Val Val Leu Lys Asn Tvr Gin Glu 

1602 1617 (408) 1636 1646 1656 

ATG GTA GTA GAG GGA TGT GGG TGC CGC TGAGATCAGG CAGTCCTTGA GGATAGACAG 
MET Val Val Glu Glv Cys Gly Cys Arg 

1666 1676 1686 1696 1706 1716 1726 

ATATACACAC CACACACACA CACCACATAC ACCACACACA CACGTTCCCA TCCACTCACC CACACACTAC 



1736 1746 1756 1766 1776 1786 1796 

ACAGACTGCT TCCTTATAGC TGGACTTTTA TTTAAAAAAA AAAAAAAAAA AATGGAAAAA ATCCCTAAAC 



1806 1816 1826 1836 1846 1856 1866 

ATTCACCTTG ACCTTATTTA TGACTTTACG TGCAAATGTT TTGACCATAT TGATCATATA TTTTGACAAA 



1876 1886 1896 1906 1916 1926 1936 

ATATATTTAT AACTACGTAT TAAAAGAAAA AAATAAAATG AGTCATTATT TTAAAAAAAA AAAAAAAACT 



1946 

CTAGAGTCGA CGGAATTC 



SUBSTITUTE SHEET 



wo 93/09229 



7/32 



PCT/US92/09430 



FIGURE 3A 



10 20 30 40 50 

GTGACCGAGC GGCGCGGACG GCCGCCTGCC CCCTCTGCCA CCTGGGGCGG 



60 70 80 90 99 

TGCGGGCCCG GAGCCCGGAG CCCGGGTAGC GCGTAGAGCC GGCGCG ATG 

MET 
(1) 

108 117 126 135 144 

CAC GTG CGC TCA CTG CGA GCT GCG GCG CCG CAC AGC TTC GTG GCG 
His Val Arg Ser Leu Arg Ala Ala Ala Pro His Ser Phe Val Ala 

153 .162 171 180 189 

CTC TGG GCA CCC CTG TTC CTG CTG CGC TCC GCC CTG GCC GAC TTC 
Leu Trp Ala Pro Leu Phe Leu Leu Arg Ser Ala Leu Ala Asp Phe 

198 207 216 225 234 

AGC CTG GAC AAC GAG GTG CAC TCG AGC TTC ATC CAC CGG CGC CTC 
Ser Leu Asp Asn Glu Val His Ser Ser Phe He His Arg Arg Leu 

243 252 261 270 279 

CGC AGC CAG GAG CGG CGG GAG ATG CAG CGC GAG ATC CTC TCC ATT 
Arg Ser Gin Glu Arg Arg Glu MET Gin Arg Glu He Leu Ser He 

288 297 306 315 324 

TTG GGC TTG CCC CAC CGC CCG CGC CCG CAC CTC CAG GGC AAG CAC 
Leu Gly Leu Pro His Arg Pro Arg Pro His Leu Gin Gly Lys His 

333 342 351 360 369 

AAC TCG GCA CCC ATG TTC ATG CTG GAC CTG TAC AAC GCC ATG GCG 
Asn Ser Ala Pro MET Phe MET Leu Asp Leu Tyr Asn Ala MET Ala 

378 387 396 405 414 

GTG GAG GAG GGC GGC GGG CCC GGC GGC CAG GGC TTC TCC TAC CCC 
Val Glu Glu Gly Gly Gly Pro Gly Gly Gin Gly Phe Ser Tyr Pro 

423 432 441 450 459 

TAC AAG GCC GTC TTC AGT ACC CAG GGC CCC CCT CTG GCC AGC CTG 
Tyr Lys Ala Val Phe Ser Thr Gin Gly Pro Pro Leu Ala Ser Leu 

468 477 486 495 504 

CAA GAT AGC CAT TTC CTC ACC GAC GCC GAC ATG GTC ATG AGC TTC 
Gin Asp Ser His Phe Leu Thr Asp Ala Asp MET Val MET Ser Phe 

513 522 531 540 549 

GTC AAC CTC GTG GAA CAT GAC AAG GAA TTC TTC CAC CCA CGC TAC 
Val Asn Leu Val Glu His Asp Lys Glu Phe Phe His Pro Arg Tyr 



SUBSTITUTE SHEET 



wo 93/09229 



8/32 



PCT/US92/09430 



FIGURE 3B 



558 567 576 585 594 

CAC CAT CGA GAG TTC CGG TTT GAT CTT TCC AAG ATC CCA GAA GGG 
His His Arg Glu Phe Arg Phe Asp Leu Ser Lys lie Pro Glu Gly 

603 612 621 630 639 

GAA GCT GTC ACG GCA GCC GAA TTC CGG ATC TAC AAG GAC TAC ATC 
Glu Ala Val Thr Ala Ala Glu Phe Arg lie Tyr Lys Asp Tyr lie 

648 657 666 675 684 

CGG GAA CGC TTC GAC AAT GAG ACG TTC CGG ATC AGC GTT TAT CAG 
Arg Glu Arg Phe Asp Asn Glu Thr Phe Arg lie Ser Val Tyr Gin 

693 702 711 720 729 

GTG CTC CAG GAG CAC TTG GGC AGG GAA TCG GAT CTC TTC CTG CTC 
Val Leu Gin Glu His Leu Gly Arg Glu Ser Asp Leu Phe Leu Leu 

738 747 756 765 774 

GAC AGC CGT ACC CfPC TGG GCC TCG GAG GAG GGC TGG CTG GTG TTT 
Asp Ser Arg Thr Leu Trp Ala Ser Glu Glu Gly Trp Leu Val Phe 

' 783 792 801 810 819 

GAC ATC ACA GCC ACC AGC AAC CAC TGG GTG GTC AAT CCG CGG CAC 
Asp He Thr Ala Thr Ser Asn His Trp Val Val Asn Pro Arg His 

828 837 846 855 864 

AAC CTG GGC CTG CAG CTC TCG GTG GAG ACG CTG GAT GGG CAG AGC 
Asn Leu Gly Leu Gin Leu Ser Val Glu Thr Leu Asp Gly Gin Ser 

873 882 891 900 909 

ATC AAC CCC AAG TTG GCG GGC CTG ATT GGG CGG CAC GGG CCC CAG 
He Asn Pro Lys Leu Ala Gly Leu He Gly Arg His Gly Pro Gin 

918 927 936 945 954 

AAC AAG CAG CCC TTC kTG GTG GCT TTC TTC AAG GCC ACG GAG GTC 
Asn Lys Gin Pro Phe MET Val Ala Phe Phe Lys Ala Thr Glu Val 

963 972 981 990 999 

CAC TTC CGC AGC ATC CGG TCC AC<; GGG AGC AAA CAG CGC AGC CAG 

His Phe Arg Ser He Arg Ser Thr Gly Ser Lys Gin Arg Ser Gin 

(293) 

1008 1017 1026 1035 1044 

AAC CGC TCC AAG ACG CCC AAG AAC CAG <;AA GCC CTG CGG ATG GCC 

Asn Arg Ser Lys Thr Pro Lys Asn Gin Glu Ala Leu Arc MET Ala 

1053 1062 1071 1080 1089 

AAC GTG GCA GAG AAC A^C AGC AGC GAC CAG ACG CAG GCC TGT AA<3 
Asn Val Ala Glu Asn Ser Ser Ser Asp Gin Arg Gin Ala Cys Lys 



SUBSTITUTE SHEET 



wo 93/09229 



9/32 



PCT/US92/09430 



FIGURE 3C 



1098 1107 1116 1125 t, , >, 

S?f "TTC GAC CTG GGC TGG CAG GaJ 

HIS Glu Tyr Val SPr PhP Arg Asp Leu Gly Trp Gin Asp 

?rD nf^Tf ff^ S'^'S?* ''^^'^'^ -^^^"1? TGT GAG^GGG 

Trp lie He Ala Pro Glu Gly Tyr Ala Ala Tyr Tyr Cys Glu Gly 

1197 1206 1215 ittA 

GAG TGT GCC TTC CCT CTG AAC TCC TAG ATG AAC GCC ACC AAC clJ 

Glu cys Ala Phe Pro Leu Asn Ser Tyr MET Asn Ala Hil 

GCC ATC GTG CAG ACG^CTG GTC CAC^Jc ATC AAC^cS GAA ACG^G^G 
Ala lie val Gin Thr Leu Val His Phe He Asn Pro 1?^ sit vll 

P^S ?Ag'cc? TGC TGt"?g CCC ACg"1g CTC AAt"?c ATC TCC^lic 
Pro Lys Pro Cys Cys Ala Pro Thr Gin Leu Asn Ala He llr vll 

CTC TAc"t? gat GAc"gC TCC AAc"Jc ATC CTG^IIg AAA TAC^lll 
Leu Tyr Phe Asp Asp Ser Ser Asn Val He Leu ^s £^ Tyr irg 

^^^^ 1377 1386 1399 

^n ^5 S=? Slf f''^ tagctcc??c 
Asn met Val Val Arg Ala Cys Gly Cys His 

(431) 

^409 1419 1429 ,430 ^ 

GAGAATTCAG ACCCTTTGGG GCCAAGTTTT TCTGGATCCT CCATTGGTC 



SUBSTITUTE SHEET 



wo 93/09229 



10/32 



PCr/US92/09430 



nGURE4A 



10 20 30 40 50 

CGACCATGAG AGATAAGGAC TGAGGGCCAG GAAGGGGAAG CGAGCCCGCC 

60 70 80 90 100 

GAGAGGTGGC GGGGACTGCT CACGCCAAGG GCCACAGCGG CCGCGCTCCG 

110 120 130 140 150 

GCCTCGCTCC GCCGCTCCAC GCCTCGCG6G ATCCGCGGGG GCAGCCCGGC 

159 168 177 186 195 

CGGGC6GGG ATG CCG GGG CTG GGG CGG AGG GCG CAG TGG CTG TGC 

MET Pro Gly Leu Gly Arg Arg Ala Gin Trp Leu Cys 
(1) 

204 213 222 231 240 

TGG TGG TGG GGG CTG CTG TGC AGC TGC TGC GGG CCC CCG CCG CTG 
Trp Trp Trp Gly Leu Leu Cys Ser Cys Cys Gly Pro Pro Pro Leu 



249 258 267 276 285 

CGG CCG CCC TTG CCC GCT GCC GCG GCC GCC GCC GCC GGG GGG CAG 
Arg Pro Pro Leu Pro Ala Ala Ala Ala Ala Ala Ala Gly Gly Gin 



294 303 312 321 330 

CTG CTG GGG GAC GGC GGG AGC CCC GGC CGC ACG GAG CAG CCG CCG 
Leu Leu Gly Asp Gly Gly Ser Pro Gly Arg Thr Glu Gin Pro Pro 



339 348 357 366 375 

CCG TCG CCG CAG TCC TCC TCG GGC TTC CTG TAC CGG CGG CTC AAG 
Pro Ser Pro Gin Ser Ser Ser Gly Phe Leu Tyr Arg Arg Leu Lys 



384 393 402 411 420 

ACG CAG GAG AAG CGG GAG ATG CAG AAG GAG ATC TTG TCG GTG CTG 
Thr Gin Glu Lys Arg Glu MET Gin Lys Glu He Leu Ser Val Leu 



429 438 447 456 465 

GGG CTC CCG CAC CGG CCC CGG CCC CTG CAC GGC CTC CAA CAG CCG 
Gly Leu Pro His Arg Pro Arg Pro Leu His Gly Leu Gin Gin Pro 



SUBSTITUTE SHEET 



wo 93/09229 



11/32 



PCT/US92/09430 



FIGURE 4B 



474 483 492 501 510 

CAG CCC eCG GCG CTC CGG CAG CAG GAG GAG CAG CAG CAG CAG CAG 
Gin Pro Pro Ala Leu Arg Gin Gin Glu Glu Gin Gin Gin Gin Gin 



519 528 537 546 555 

CAG CTG CCT CGC GGA GAG CCC CCT CCC GGG CGA CTG AAG TCC GCG 
Gin Leu Pro Arg Gly Glu Pro Pro Pro Gly Arg Leu Lys Ser Ala 



564 573 582 591 600 

CCC CTC TTC ATG CTG GAT CTG TAC AAC GCC CTG TCC GCC GAC AAC 
Pro Leu Phe MET Leu Asp Leu Tyr Asn Ala Leu Ser Ala Asp Asn 



609 618 627 636 645 

GAC GAG GAC GGG GCG TCG GAG GGG GAG AGG CAG CAG TCC TGG CCC 
Asp Glu Asp Gly Ala Ser Glu Gly Glu Arg Gin Gin Ser Trp Pro 



, 654 663 672 681 690 

CAC GAA GCA GCC AGC TCG TCC CAG CGT CGG CAG CCG CCC CCG GGC 
His Glu Ala Ala Ser Ser Ser Gin Arg Arg Gin Pro Pro Gly Ser 



699 708 717 726 735 

GCC GCG CAC CCG CTC AAC CGC AAG AGC CTT CTG GCC CCC GGA TCT 
Pro Pro Gly Ala Ala His Pro Leu Asn Arg Lys Ser Leu Leu Ala 



744 753 762 771 780 

GGC AGC GGC GGC GCG TCC CCA CTG ACC AGC GCG CAG GAC AGC GCC 
Gly Ser Gly Gly Ala Ser Pro Leu Thr Ser Ala Gin Asp Ser Ala 



789 798 807 816 825 

TTC CTC AAC GAC GCG GAC ATG GTC ATG AGC TTT GTG AAC CTG GTG 
Phe Leu Asn Asp Ala Asp MET Val MET Ser Phe Val Asn Leu Val 



834 843 852 861 870 

GAG TAC GAC AAG GAG TTC TCC CCT CGT CAG <:GA CAC CAC AAA GAG 
Glu Tyr Asp Lys Glu Phe Ser Pro Arg Gin Arg His His Lys Glu 



879 

TTC AAG TTC AAC TTA 
Phe Lys Phe Asn Leu 

924 

GCT GCA ,GAA TTC CGC 
Phe Arg lie Tyr Lys 



888 897 
TCC CAG ATT CCT GAG 
Ser Gin He Pro Glu 

933 942 
ATC TAC AAG GAC TGT 
Asp Cys Val MET Ala 



906 915 
GGT GAG GTG GTG ACG 
Gly Glu Val Val Thr 

951 960 
GTT ATG GGG AGT TTT 
Ala Glu Gly Ser Phe 



SUBSmUTE SHEET 



wo 93/09229 



12/32 



PCT/US92/09430 



FIGURE 4C 



... If^ 978 987 996 1005 

AAA AAC CAA ACT TTT CTT ATC AGC ATT TAT CAA GTC TTA CAG GAG 
Lys Asn Gin Thr Phe Leu He Ser He Tyr Gin Val Leu Gin Glu 



« 

1014 1023 1032 1041 



1050 



S?I ^® CT6 TTT TTG TT6 GAC ACC CGT GTA 

HIS Gin His Arg Asp Ser Asp Leu Phe Leu Leu Asp Thr Arg Val 

^059 1068 1077 1086 1095 

GTA T6G GCC TCA GAA GAA GGC TGG CT6 GAA TTT GAC ATC ACG GCC 
val Trp Ala Ser Glu Glu Gly Trp Leu Glu Phe Asp He Thr Ala 

1104 1113 1122 1131 1140 

ACT AGC AAT CTG TGG GTT GTG ACT CCA CAG CAT AAC ATG GGG CTT 
Thr Ser Asn Leu Trp Val Val Thr Pro Gin His Asn MET Gly Leu 

1149 1158 1167 1176 lias 

CAG CTG -AGC GTG GTG ACA AGG GAT GGA GTC CAC GTC CAC CCC C6A 
Gin Leu ser Val Val Thr Arg Asp Gly Val His Val His Pro Arg 

1194 1203 1212 1221 1230 

f ?f f ^AC GGC CCT TAC GAT AAG CAG CCC 
Ala Ala Gly Leu Val Gly Arg Asp Gly Pro Tyr Asp Lys Gin Pro 

mm« "48 1257 1266 1275 

SJf ^ AST GAG GTC CAC GTG CGC ACC 

Phe MET Val Ala Phe Phe Lys Val Ser Glu Val His Val Arg Thr 

1284 1293 1302 1311 1320 

ShS m CGA CAA CAG AGT CGT AAT GGC 

Thr Arg Ser Ala Ser Ser Arg Arg Arg Gin Gin Ser Arg Asn Arg 

(382) 

1329 1338 1347 1356 1365 

cf^ i^^ ^ GCG CGG GTC TCC AGT GCT TCA GAT 

K^loT"" ^^"^ ^^"^ ^^"^ 

13'* 1383 1392 1401 1410 

e®^ GAA TTG AAA ACA GCC TGC AGG AAG CAT GAG CTG 

Tyr Asn Ser Ser Glu Leu Lys Thr Ala Cys Arg Lys His Glu Leu 

(412) 

1419 1428 1437 1446 145s 

TAT GTG AGT TTC CAA GAC CTG GGA TGG CAG GAC TGG ATC ATT GCA 
Tyr Val Ser PhP Gin Asp Leu Gly Trp Gin Asp Trp He He Ala 



SUBSTITUTE SHEET 



wo 93/09229 



13/32 



PCr/US92/09430 



FIGURE 4D 



1464 1473 1482 1491 1500 

CCC AAG GGC TAT GCT GCC AAT TAC TGT GAT GGA GAA TGC TCC TTC 
Pro Lys Gly Tyr Ala Ala Asn Tyr Cys Asp Gly Glu Cys Ser Phe 

1509 1518 1527 1536 1545 

CCA CTC AAC GCA CAC ATG AAT GCA ACC AAC CAC GCG ATT GTG CAG 
Pro Leu Asn Ala His MET Asn Ala Thr Asn His Ala lie Val Gin 



1554 1563 1572 1581 1590 

ACC TTG GTT CAC CTT ATG AAC CCC GAG TAT GTC CCC AAA CCG TGC 
Thr Leu Val His Leu MET Asn Pro Glu Tyr Val Pro Lys Pro Cys 

1626 1635 
TCG GTT CTT TAC TTT GAT 
Ser Val Leu Tyr Phe Asp 



1644 1653 1662 1671 1680 

GAC AAC TCC AAT GTC ATT CTG AAA AAA TAC AGG AAT ATG GTT GTA 

Asp Asn Ser Asn Val He Leu Lys Lys Tyr Arg Asn MET Val Val 



1689 1698 1708 1718 \ 1728 

AGA GCT TGT GGA TGC CAC TAACTCGAAA CCAGATGCTG GGGACACACA 

Arg Ala Cys Gly Cys His 

(513) 



1738 


1748 


1758 


1768 


1778 


TTCTGCCTTG 


GATTCCTA6A 


TTACATCTGC 


CTTAAAAAAA 


CACGGAA^GCA 


1788 


1798 


1808 


1818 


1828 


CAGTTGGAGG 


TGGGACGATG 


AGACTTTGAA 


ACTATCTCAT 


GCCAGTGCCT 


1838 


1848 


1858 


1868 


1878 


TATTACCCAG 


GAAGATTTTA 


AAGGACCTCA 


TTAATAATTT 


GCTCACTTGG 


1888 


1898 


1908 


1918 


1928 


TAAATGACGT 


GAGTAGTTGT 


TGGTCTGTAG 


CAAGCTGAGT 


TTGGATGTCT 


1938 


1948 


1958 


1968 


1978 


GTAGCATAAG 


GTCTGGTAAC 


TGCAGAAACA 


TAACCGTGAA 


GCTCTTCCTA 


1988 


1998 


2008 


2018 


2028 


CCCTCCTCCC 


CCAAAAACCC 


ACCAAAATTA 


GTTTTAGCTG 


TAGATCAAGC 


2038 


2048 


2058 


2068 


2078 


TATTTGGGGT 


GTTTGTTAGT 


AAATAGGGAA 


AATAATCTCA 


AAGGAGTTAA 


2088 


2098 


2108 


2118 


2128 


ATGTATTCTT 


GGCTAAAGGA 


TCAGCTGGTT 


CAGTACTGTC 


tatcaaa<;gt 



1599 1608 1617 

TGT GCG CCA ACT AAG CTA AAT GCC ATC 
Cys Ala Pro Thr Lys Leu Asn Ala lie 



SUBSTITUTE SHEET 



wo 93/09229 



PCT/US92/09430 



14/32 



FIGURE 4E 



2138 2148 2158 2168 2178 

AGATTTTACA GAGAACAGAA ATCGGGGAAG TGGGGGGAAC GCCTCTGTTC 

2188 2198 2208 2218 2228 

AGTTCATTCC CAGAAGTCCA CAGGACGCAC AGCCCAGGCC ACAGCCAGGG 

2238 2248 2258 2268 2278 

CTCCACGGGG CGCCCTTGTC TCAGTCATTG CTGTTGTATG TTCGTGCTGG 

2288 2298 2308 2318 2328 

AGTTTTGTTG GTGTGAAAAT ACACTTATTT CAGCCAAAAC ATACCATTTC 

2338 2348 2358 2368 2378 

TACACCTCAA TCCTCCATTT GCTGTACTCT TTGCTAGTAC CAAAAGTAGA 

2388 2398 2408 2418 2428 

CTGATTACAC TGRGGTGAGG CTACAAGGGG TGTGTAACCG TGTAACACGT 



2438 2448 2458 2468 2478 

GAAGGCAGTG CTCACCTCTT CTTTACCAGA ACGGTTCTTT GACCAGCACA 

2488 2498 2508 2518 2528 

TTAACTTCTG GACTGCC6GC TCTAGTACCT TTTCAGTAAA GTGGTTCTCT 

2^38 2548 2558 2568' 257R 

GCCTTTTTAC TATACAGCAT ACCACGCCAC AGGGTTAGAaI CCAACGAAGA 

2588 2598 2608 2618 262B 

AAATAAAATG AGGGTGCCCA GCTTATAAGA ATGGTGTTAG GGGGATGAGC 

2638 2648 2658 2668 2678 

ATGCTGTTTA TGAACGGAAA TCATGATTTC CCTGTAGAAA GTGAGGCTCA 

2688 2698 2708 2718 2728 

GATTAAATTT TAGAATATTT TCTAAATGTC TTTTTCACAA TCATGTGACT 



2738 2748 2758 2768 2778 

GGGAAGGCAA TTTCATACTA AACTGATTAA ATAATACATT TATAATCTAC 

2788 2798 2808 2818 2828 

AACTGTTTGC ACTTACAGCT TTTTTTGTAA ATATAAACTA TAATTTATTG 

2838 2848 2858 2868 2878 

TCTATTTTAT ATCTGTTTTG CTGTGGCGTT GGGGGGGGGG CCGGGCTTTT 

2888 2898 2908 2918 

GGGGGGGGGG GTTTGTTTGG GGGGTGTCGT GGTGTGGGCG GGCGG 



SUBSTITUTE SHEET 



wo 93/09229 



15/32 



PCT/US92/09430 



FIGURE 5A 



10 20 30 40 50 

CTGGTATATT TGTGCCTGCT GGAGGTGGAA TTAACAGTAA GAAGGAGAAA 

60 70 80 90 100 

GGGATTGAAT GGACTTACAG GAAGGATTTC AAGTAAATTC AGGGAAACAC 

110 120 130 140 150 

ATTTACTTGA ATAGTACAAC CTAGAGTATT ATTTTACACT AAGACGACAC 

160 170 180 190 200 

AAAAGATGTT AAAGTTATCA CCAAGCTGCC GGACAGATAT ATATTCCAAC 

210 220 230 240 250 

ACCAAGGTGC AGATCAGCAT AGATCTGTGA TTCAGAAATC AGGATTTGTT 

260 270 280 290 300 

TTGGAAAGAG CTCAi^GGGTT GAGAAGAACT CAAAAGCAAG TGAAGATTAC 

310 320 330 340 350 

TTTGGGAACT ACAGTTTATC AGAAGATCAA CTTTTGCTAA TTCAAATACC 

360 370 380 i 390 400 

AAAGGCCTGA TTATCATAAA TTCATATAGG AATGCATAGG TCATCTGATC 

410 420 430 ^ 440 450 

AAATAATATT AGCCGTCTTC TGCTACATCA ATGCAGCAAA AACTCTTAAC 

460 470 480 490 500 

AACTGTGGAT AATTGGAAAT CTGAGTTTCA GCTTTCTTAG AAATAACTAC 

510 520 530 540 550 

TCTTGACATA TTCCAAAATA TTTAAAATAG GACAGGAAAA TCGGTGAGGA 

560 570 580 590 600 

TGTTGTGCTC AGAAATGTCA CTGTCATGAA AAATAGGTAA ATTTGTTTTT 

610 620 630 640 650 

TCAGCTACTG GGAAACTGTA CCTCCTAGAA CCTTAGGTTT TTTTTTTTTT 

660 670 680 690 700 

AAGAGGACAA GAAGGACTAA AAATATCAAC TTTTGCTTTT GGACAAAA 



SUBSTITUTE SHEET 



wo 93/09229 



PCT/US92/09430 



16/32 



FIGURE 5B 



701 710 719 728 737 

ATG CAT CTG ACT GTA TTT TTA CTT AAG GGT ATT GTG GGT TTC CTC 

MET His Leu Thr Val Phe Leu Leu Lys Gly lie Val Gly Phe Leu 

(1) 

746 755 764 773 782 

TGG AGC TGC TGG GTT CTA GTG GGT TAT GCA AAA GGA GGT TTG GGA 

Trp Ser Cys Trp Val Leu Val Gly Tyr Ala Lys Gly Gly Leu Gly 

791 800 809 818 827 

GAC AAT CAT GTT CAC TCC AGT TTT ATT TAT AGA AGA CTA CGG AAC 

Asp Asn His Val ftis Ser Ser Phe lie Tyr Arg Arg Leu Arg Asn 

836 845 854 863 872 

CAC GAA AGA CGG GAA ATA CAA AGG GAA ATT CTC TCT ATC TTG GGT 

His Glu Arg Arg Glu lie Gin Arg Glu lie Leu Ser lie Leii Gly 

i 

881 890 899 908 917 

TTG CCT CAC AGA CCC AGA CCA TTT TCA CCT GGA AAA ATG ACC AAT 

Leu Pro His Arg Pro Arg Pro Phe Ser Pro Gly Lys Gin Ala Ser 

926 935 944 953 962 

CAA GCG TCC TCT GCA CCT CTC TTT ATG CTG GAT CTC TAC AAT GCC 

Ser Ala Pro Leu Phe MET Leu Asp Leu Tyr Asn Ala MET Thr Asn 

971 980 989 998 100*7 

GAA GAA AAT CCT GAA GAG TCG GAG TAC TCA GTA AGG GCA TCC TTG 

Glu Glu Asn Pro Glu Glu Ser Glu Tyr Ser Val Arg Ala Ser Leu 

1016 1025 1034 1043 1052 

GCA GAA GAG ACC AGA GGG GCA AGA AAG GGh TAC CCA GCC TCT CCC 
Ala Glu Glu Thr Arg Gly Ala Arg Lys Gly Tyr Pro Ala Ser Pro 

1061 1070 1079 1088 1097 

AAT GGG TAT CCT CGT CGC ATA CAG TTA TCT CGG ACG ACT CCT CTG 
Asn Gly Tyr Pro Arg Arg lie Gin Leu Ser Arg Thr Thr Pro Leu 

1106 1115 1124 1133 1142 

ACC ACC CAG AGT CCT CCT CTA GCC AGC CTC CAT CAT ACC AAC TTT 
Thr Thr Gin Ser Pro Pro Leu Ala Ser Leu His Asp Thr Asn Phe 

1151 1160 1169 1178 1187 

CTG AAT GAT GCT GAC ATG GTC ATG AGC TTT GTC AAC TTA GTT GAA 
Leu Asn Asp Ala Asp MET Val MET Ser Phe Val Asn Leu Val Glu 

1196 1205 1214 1223 1232 

AGA GAC AAG GAT TTT TCT CAC CAG CGA AGG CAT TAC AAA GAA TTT 
Arg Asp Lys Asp Phe Ser His Gin Arg Arg His Tyr Lys Glu Phe 



SUBSTITUTE SHEET 



wo 93/09229 



17/32 



PCr/US92/09430 



FIGURE 5C 



1241 1250 1259 1268 1277 

CGA TTT GAT CTT ACC CAA ATT CCT CAT GGA GAG GCA GTG ACA GCA 
Arg Phe Asp Leu Thr Gin He Pro His Gly Glu Ala Val Thr Ala 

1286 1295 1304 1313 1322 

GCT GAA TTC CGG ATA TAG AAG GAG CGG AGC AAC AAC CGA TTT GAA 
Ala Glu Phe Arg He Tyr Lys Asp Arg Ser Asn Asn Arg Phe Glu 

1331 1340 1349 1358 1367 

. AAT GAA ACA ATT AAG ATT AGC ATA TAT CAA ATC ATC AAG GAA TAC 
Asn Glu Thr He Lys He Ser He Tyr Gin He He Lys Glu Tyr 

1376 1385 1394 1403 1412 

ACA AAT AGG GAT GCA GAT CTG TTC TTG TTA GAC ACA AGA AAG GCC 
Thr Asn Arg Asp Ala Asp Leu Phe Leu Leu Asp Thr Arg Lys Ala 

1421 1430 1439 1448 1457 

CAA GCT TTA GAT GTG GGT TGG CTT GTC TTT GAT ATC ACT GTG ACC 
Gin Ala Leu Asp Val Gly Trp Leu Val Phe Asp He Thr Val Thr 

•1466 1475 1484 1493 1502 

AGC AAT CAT TGG GTG ATT AAT CCC CAG AAT AAT TTG GGC TTA CAG 
Ser Asn His Trp Val He Asn Pro Gin Asn Asn Leu Gly Leu Gin 

1511 1520 1529 1538 1547 

CTC TGT GCA GAA ACA GGG GAT GGA CGC AGT ATC AAC GTA AAA TCT 
Leu Cys Ala Glu Thr Gly Asp Gly Arg Ser He Asn Val Lys Ser 

1556 1565 1574 1583 1592 

GCT GGT CTT GTG GGA AGA CAG GGA CCT CAG TCA AAA- CAA CCA TTC 
Ala Gly Leu Val Gly Arg Gin Gly Pro Gin Ser Lys Gin Pro Phe 

1601 1610 1619 1628 1637 

ATG GTG GCC TTC TTC AAG GCG AGT GAG GTA CTT CTT CGA TCC GTG 
MET Val Ala Phe Phe Lys Ala Ser Glu Val Leu Leu Arg Ser Val 

1646 1655 1664 1673 1682 

AGA GCA GCC AAC AAA CGA AAA AAT CAA AAC C<;C AAT AAA TCC AGC 
Arg Ala Ala Asn Lys Arg Lys Asn Gin Asn Arg Asn Lys Ser Ser 

(329) 

1691 1700 1709 1718 1727 

TCT CAT CAG GAC TCC TCC AGA ATG TCC AGT GTT GGA GAT TAT AAC 
Ser His Gin Asp Ser Ser Ara MET Ser Ser Val Gly Asp Tyr Asn 

(337) 



SUBSTITUTE SHEET 



wo 93/09229 



PCT/US92/09430 



18/32 



FIGURE 5D 



1736 1745 1754 1763 1772 

ACA AGT GAG CAA AAA CAA GCC TGT AAG AAG CAC GAA CTC TAT GTG 
Thr Ser Glu Gin Lys Gin Ala Cys Lys Lys His Glu Leu Tvr Val 

(356) 

1781 1790 1799 1808 1817 

AGC TTC CGG GAT CTG GGA TGG CAG GAC TGG ATT ATA GCA CCA GAA 
Ser Pl^e Arg Asp Leu Gly Trp Gin Asp Trp lie lie Ala Pro Glu 
(362) 

1826 1835 1844 1853 1862 

GGA TAC GCT GCA TTT TAT TGT GAT GGA GAA TGT TCT TTT CCA CTT 
Gly Tyr Ala Ala Phe Tyr Cys Asp Gly Glu Cys Ser Phe Pro Leu 

1871 1880 1889 1898 1907 

AAC GCC CAT ATG AAT GCC ACC AAC CAC GCT ATA 6TT CAG ACT CTG 
Asn Ala His MET Asn Ala Thr Asn His Ala lie Val Gin Thr Leu 

1916 1925 1934 1943 1952 

GTT CAT CTG ATG TTT CCT GAC CAC GTA CCA AAG CCT TGT TGT GCT 
Val His Leu MET Phe Pro Asp His Val Pro Lys Pro Cys Cys Ala 

1961 1970 1979 1988 1997 * 

CCA ACC AAA TTA AAT GCC ATC TCT GTT CTG TAC TTT GAT GAC AGC 
Pro Thr Lys Leu Asn Ala He Ser Val Leu Tyr Phe Asp Asp Ser 

2006 2015 2024 2033 2042 

TCC AAT GTC ATT TTG AAA AAA TAT AGA AAT ATG GTA GTA CGC TCA 
Ser Asn Val He Leu Lys Lys Tyr Arg Asn MET Val Val Arg Ser 



2051 2060 2070 2080 2090 2100 

TGT 6GC TGC CAC TAATATTAAA TAATATTGAT AATAACAAAA AGATCTGTAT 
Cys Gly Cys His 
(454) 

2110 2120 2130 2140 2150 

TAAGGTTTAT GGCTGCAATA AAAAGCATAC TTTCAGACAA ACAGAAAAAA AAA 



SUBSTITUTE SHEET 



wo 93/09229 ' ^^^^^ PCT/US92/09430 

Figure 6 

(1) 

GAATTCC GAG CCC CAT TGG AAG GAG TTC CGC TTT GAC CTG ACC CAG ATC CCG GCT 
Glu Pro His Trp Lys Glu Phe Arg Phe Asp Leu Thr Gin lie Pro Ala 

(10) 

GGG GAG GCG GTC ACA GCT GCG GAG TTC CGG ATT TAC AAG GTG CCC AGC ATC CAC 
Gly Glu Ala Val Thr Ala Ala Glu Phe Arg He Tyr Lys Val Pro Ser He His 
(20) (30) 

CTG CTC AAC AGG ACC CTC CAC GTC AGC ATG TTC CAG GTG GTC CAG GAG CAG TCC 
Leu Leu Asn Arg Thr Leu His Val Ser Met Phe Gin Val Val Gin Glu Gin Ser 

(40) (50) 

AAC AGG GAG TCT GAC TTG TTC TTT TTG GAT CTT CAG ACG CTC CGA GCT GGA GAC 
Asn Arg Glu Ser Asp Leu Phe Phe Leu Asp Leu Gin Thr Leu Arg Ala Gly Asp 

(60) (70) 

GAG GGC TGG CTG GTG CTG GAT GTC ACA GCA GCC AGT GAC TGC TGG TTG CTG AAG 
Glu Gly Typ Leu Val Leu Asp Val Thr Ala Ala Ser Asp cyc Trp Leu Leu Lys 

(80) 

CGT CAC AAG GAC CTG GGA CTC CGC CTC TAT GTG GAG ACT GAG GAT GGG CAC AGC 
Arg His Lys Asp Leu Gly Lue Arg Leu Tyr Val Glu Thr Glu Asp Gly His Ser 
(90) (100) 

GTG GAT CCT GGC CTG GCC GGC CTG CTG GGT CAA CGG GCC CCA CGC TCC CAA CAG 
Val Asp Pro Gly Leu Ala Gly Leu Leu Gly Gin Arg Ala Pro Arg Ser Gin Gin 
(110) (120) 

CCT TTC GTG GTC ACT TTC TTC AGG GCC AGT CCG AGT CCC ATC CGC ACC CCT CGG 
Pro Phe Val Val Thr Phe Phe Arg Ala Ser Pro Ser Pro He Arg Thr Pro Arg 

(130) (140) 

GCA GTG AGG CCA CTG AGG AGG AGG CAG CCG AAG AAA AGC AAC GAG CTG CCG CAG 
Ala Val Arg Pro Leu Arg Arg Arg Gin Pro Lys Lys Ser Asn Glu Leu Pro Gin 

(150) (160) 

GCC AAC CGA CTC CCA GGG ATC TTT GAT GAC GTC CAC GGC TCC CAC <;GC CGG CAG 
Ala Asn Arg Leu Pro Gly He Phe Asp Asp Val His Gly Ser His Gly Arg Gin 

(170) 

GTC TGC CGT CGG CAC GAG CTC TAC GTC AGC TTC CAG GAC CTT GGC TGG CTG GAC 
Val Cys Arg Arg His Glu Leu Tyr Val Ser Phe Gin Asp Leu Gly Trp Leu Asp 
(180) (190) 

TGG GTC ATC GCC CCC CAA GGC TAC TCA GCC TAT TAC TGT GAG GGG GAG TGC TCC 
Trp Val He Ala Pro Gin Gly Tyr Ser Ala Tyr Tyr Cys Glu Gly Glu Cys Ser 
(200) (210) 

TTC CCG CTG GAC TCC TGC ATG AAC GCC ACC AAC CAC GCC ATC CTG CAG TCC CTG 
Phe Pro Leu Asp Ser Cys Met Asn Ala Thr Asn His Ala He Leu Gin Ser Leu 

(220) (230) 



SUBSTITUTE SHEET 



wo 93/09229 



20/32 

Figure 6 (Con't) 



PCr/US92/09430 



GTG CAC CTG ATG AAG CCA AAC GCA GTC CCC AAG GCG TGC TGT GCA CCC ACC AAG 
Val His Leu Met Lys Pro Asn Ala Val Pro Lys Ala Cys Cys Ala Pro Thr Lys 

(240) (250) 

CTG AGC GCC ACC TCT GTG CTC TAC TAT GAC AGC AGC AAC AAC GTC ATC CTG CGC 
Leu Ser Ala Thr Ser Val Leu Tyr Tyr Asp Ser Ser Asn Asn Val lie Leu Arg 

(260) 

AAG CAC CGC AAC ATG GTG GTC AAG GCC TGC GGC TGC CAC TGAGTCAGCCCGCCCAGC 
Lys His Arg Asn Met Val Val Lys Ala Cys Gly Cys His 
(270) (280) 

CCTACTGCAGCCACCCTTCTCATCTGGATCGGGCCCTGCAGAGGCAGAAAACCCTTAAATGCTGTCACAG 
CTCAAGCAGGAGTGTCAGGGGCCCTCACTCTCGGTGCCTACTTCCTGTCACCCtTCTGGGAATTC 



SUBSTITUTE SHEET 



wo 93/09229 



21/32 



PCT/1US92/09430 



oaeemee© cercsms^^ eecscTAsm ?R?M©s5iiR fe?CR?ei^sa asaasees^ 
e?5ft@ae©se aecsGOcae? swceeesaa AT6?eeee@© iiaeeeegass ?©?ssfiSS2? iae 
9esafta?a§a ssoiRasJiS© saseeee?©^ seaeaeaasa acesseasaa Bssesseaas it© 
w^?2^g?@RRa aa@©fta©aes as©a@2i^?se aaeagssses f@s§8@ggS5 ass^s??? ac© 
?s@e66eags ffeeessee? 6sssff@g?s acee^aaag 0gs@©9@aRa esaaaReas© 390 
essaaei^sea ©s^eefgeR eaasseesss ae^sesMes mse?©^© ascGs^aasa 3@@ 
geesseasa© TTrrceose© qr&srsjs&st ©s^eeaess?? aaaessesee 420 

2as©s@@g@e @@?assasee ee2a?g©a^ eeeeseai^ ©eaaggees? eseeseasr^e 41© 
agsassQsea eaa^saess© ©??6R6gag? eaesaeseae aeaaaaeeag essAegea?© sao 
eoAseaeaes aaeaeaassii secaeseess oea«aaeea? eaeseasfiae aeseeieeea @ee 
ae??ae?8g? eaeaaesa?e ©saeeaeeea ae@a©e?aafi esesffr??© eaeaaeafe© ese 
6©©a9eas@s aaes^ee^ eas^fssee aaje^saees @M?©aji9€e a'SAeeaaae© ?3© 
aegA©©@s®a eaceaeease eesetaeeaa geee^eaae @??@e©eaaa e?as?aags@ 70© 
eeeaaggaes gA^e^ase? geeeescaae aa5?aa?a0a sseea^esae ©§©©a^aaas 8«o 
sseeaeeaee aesseseeee seseeeesse ceseseee?© ©sss&ssee? ea?aaa?e9@ ©e© 
©aseeeessa @eese©©?e? eeee©?A?ea ??@e!^seagg eee©eea©a? ©ssaaaeees ©s© 
eeesesasess a®?ga?esae aeeaeeeeea 6?eR@@eaae 9&se@a?@aa esaaasagiie J03© 
aeasesesea easaees©©© geaegeasra aeeass^ga ae^geaeae eaasggfaes aes© 
caga«a?aeg gsaeasseag ggaaaaeg?© asffggaagg gaaaaseag© ga6@g@aa@a ii^o 
gee?gg?s@a ^sia^e^g© aeeaaaages essaaeegaa ©g^g?^^© eaeg©ae^g 138© 
eaeaeeeeeg aeaaaasage aaaeeagess ggssasagge ggsr^ggeg© esesgaage? aas© 
e§g6ggg@ea aaeaaaaaaa esaeesegas eaeoigsgeeg ggegggeees ©aseaaease isso 
ga^^^e? ssgge^aaa ©gaaeseeeg ggaseaeaee ©ec^gaeea aa«a©g©g§e is©© 
ssg^NSsega @6se@ga©s?a eeeeaeeagg ggaasaaege g®2a§€a§§@ eegaeasaee 144© 
gesgg@s@§s &af§g3@fga eei5«se©§?8 gg@eea©g©@ esasaasges gs^eggaee© is©© 
eeggeeaege aRsaesass^ ssaeeeeaga a©©e@eae@© @g©s@ees@a aeeeeesegg aseo 
e6g@ea@a@a ©eeeaeegg© ©a@e@aa^a esgaeaeesa aeg©a6a?ae ggaea©s@g@ ia§© 
aeeaggeaea aaeeeceaes eggeesBaa© ©eaeaaaee© e©aea@@gag ecseegaaees isee 
©eaeeesea© aaeaeoaoas tseaeeaees a©cggeeag© eesaaaeeee geegascggg if^Q 
agaegeegog gsseegggeee eae§ge?8ae gg©a®€6?©8 ag^s^gsa s«cge©geas aeee 
eeeeeesea© ee^ageeaaa aaeeecAeea aosce©ce^ sggaeeegge egeseeggf? leso 
ccgeoceggg geege^e&g© ggcgggccf© eeggagceee geaggegeg© ©a^aacesgA jsac 

iO iSTOTyTE SIHlEiT 



wo 93/09229 



22/32 



PCr/US92/09430 











G©6Z^O0A©? 


i©89 












3G6@ 










©Gjy^iiAJ^^^ 






















e§ZiiG@€ag^« 
















220Q 












234)© 








ACAeAGCACG 












Z^€?^@@G 
















362© 












2930 












2(S<J© 












3?©© 










GS^G^Zli^S 


37S© 






A€?^eAes@A 






2@2© 












2Qi© 












a§40 








?6G^A^S§© 


AseG^^aee 


3©©© 






SZU^SASA?A 


GA?@@?^^ 




3©@© 
3igQ 








6e©fA6?aGa 




SiiO 








G?5^GAG?@ 




326© 






raj^GGZ^Sii^ 






33©§ 






M@GG^Gli.G 


G8j\?^Gee? 




S3g© 












343© 












34©© 






^Ae@G©eee 




@S©g6GSGGG 














3G6© 















wo 93/09229 



PCT/US92/09430 



23/32 

FIGURE 8 



W-20 ALKALINE PHOSPHATASE: BMP-2 VS. BMP-2/7 




0.6-1 1 1 1 1 1 1 

0.001 0.010 0.100 1.000 10. 000 100.000 1000.00 



BMP (ng/ml) 



SUBSTITUTE SHEET 



wo 93/05229 



PCT/US92/09430 



24/32 



FIGURE 9 

EFFECTS OF BMP-2 AND BMP2/7 ON BGP SYNTHESIS 
BY W-20 CELLS 



BMP-2 




1.00 



10.00 



100.00 1000.00 



BMP (ng/ml) 



SUBSTITUTE SHEET 



wo 93/09229 



PCr/US92/09430 



25/32 



FIGURE 10 

COMPARAISON OF E.Coli BMP-2 AND BMP-2/7: 
W-20-17 ALKALINE PHOSPHATASE 




0.010 0.100 1.000 10.000 100.000 1000.000 



C0NCBMI8ATI0HS (ng/ml) 

* 



SUBSTITUTE SHEET 



wo 93/09229 



26/32 



PCT/US92/09430 



FIGURE llA 



10 20 30 40 50 60 70 

AGATCTIGAA AACAOOCGQG OCACACAOSC aSOGAOCTAC MCTCITTCT CaGOSITGGA GIOGAGAOSG 

80 90 100 110 120 130 140 

CGOOOGCaGC GOOCroaGaG GGTCAGGTOC GOCCaGCItSC TOGGGAftCAG CXCAOCIGK: AGGCTOOGCr 

150 160 170 180 190 200 210 

GGGTCRGOSC AGGAAGTQQG GCTGCSOOGCT ATCIOSCTGC A000QG003C GTOOOOGGCT (XXnXXXSOCC 

220 230 240 250 260 270 280 

TOGOOOCaGC TOGmOGAG TTCAACXnC GGCICX330CX5 O0GGCTOC3T GOGOCITOSC? AGIGICOOGC 

290 300 310 320 (1) 335 

AGOGAOGOOS QGAGOCXSAOS aSOOGOGOGG GEAOCIAGOC AIG GCT GGG GOG AGC AGG CIG CIC 

MET Ala Gly Ala Ser Arg Leu Leu 

350 365 380 395 

TIT CIG TGG CTG QGC TOC TIC TGC GIG ACC CTG GOG CAG GGA GAG AGA COG AAG OCA 

Phe Ifiu Trp Leu Gly Rie Cys Val Ser Leu Ala Gin Gly Glu Arg Pro tys Pro 

410 425 440 455 

OCT TTC OOGGAGCICCGCAAAGCrGIGOCAGGrGACOGCAOG GCa'gGT QGT GGC OOG 
Pro Hie Pro Glu Leu Arg lys Ala Val Pro Gly Asp Arg Thr Ala Gly Gly Gly Pro 

470 485 500 515 

GAC TOO GAG CTG CRG COG CAA GAG AAG GTC TCT GAA CAC AIG CIG OOG CIC TAT GAC 
Asp Ser Glu Leu Gin Pro Gin Asp lys^ Val Ser Glu His MET Leu Arg Leu Tyr Asp 

530 545 560 

AGG TAG AGC AOGGTCCAGGOGGOCOGGACAGGGGGCTOCCIGGAG GGA GGC TOG CAG 
Arg Tyr Ser Thr Val Gin Ala Ala Arg Thr Pro Gly Ser Leu Glu Gly Gly Ser Gin 

575 590 605 620 

OOC TGG GGC OCT OGG CIC CTG OGC GAA GGC AAC AOG GTT OGC AGC TTT OGG GOG GCA 

Pro Tcp Arg Pro Arg Leu Leu Arg Glu Gly Asn Thr Val Arg Ser Phe Arg Ala Ala 

635 650 665 680 

GCA GCA GAA ACT CIT GAA AGA AAA GGA CIG TAT AIC TTC AAT CTG ACA TOG GTA ACC 
Ala Ala Glu Thr Leu Glu Arg lys Gly Lsu Tyr He Phe Asn Leu Thr Ser Leu Thr 

695 710 725 740 

AAGTCrGAAAACAITTTGTCrGOCACACIGTATTrCTGr AIT GGA GAG CIA GGA AAC 
lys Ser Glu Asn He Leu Ser Ala Thr Leu Tyr Phe Cys He Gly Glu Lsu Gly Asn 



^^BSmUTE SHEET 



wo 93/09229 



PCT/US92/09430 



27/32 



FIGURE lie 



1430 1445 (377) 1460 1475 

TGC GOC AOG fiGA TAC CTC AAG GIA GAC ITT GCR GAT ATT GGC TSG ACT GAA TOG AIT 
cys Ala Arg Arg Tyr Leu lys Val Asp Rie Ala Asp lie Glv Trp Ser Glu Tcp He 

1490 1505 1520 1535 

ATC TOC 030 AAG OOC TTT GM" GOC TftT TAT TGC TGT GGA GCA TCC CRG TIC CXX: A3G 
lie Ser Pro lys Ser Rie Asp Ala Tvr Tyrr Cvs Ser Glv Ala Qrs Gin Hie Pro MET 

1550' 1565 1580 1595 

CCA AAG TCP TTG AAG CCA TCA AAT CAT GCT AOC ATC CAG ACT ATA GTG AGA GOT GIG 
lys Ser Leu l ys Pro Ser Asn His Ala Thr He Gin Ser lie Val Arg Ala Val 

1610 1625 1640 1655 

GGG CTC GIT CCT GOG ATT OCT GAG OCT TCC TCT GTA CCA GAA AAG ATG TCC TCA CIC 
Gly Val Val Pro Gly He Pro Glu Pro Qrs Cys Val Pro Glu lys MET Ser Ser Leu 

1670 1685 1700 

ACT ATT TIA TTC TTT GAT GAA AAT AAG AAT Gia. GTG dT AAA CTA TAG OCT AAG ATC 
Ser He l£u Fhe Hie Asp Glu Asn lys Asn Val Val Leu lys Val Tvr Pro Asn MET 

1-715 1730 (472) 1746 1756 1766 1776 

ACA CTA GAG TCT TGC GCT TGC AGA TAAOCIGGCA AAGAACTCAT TTGAAIGCTr AATICAAICT 
Thr Val Glu Ser Cvs Ala cys Arg 

1786 

CTAGAGTCQA CGGAATTC 



SUBSTITUTE SHEET 



wo 93/09229 



28/32 



PCT/US92/09430 



Figure 12 



W.20ALJ<AUNE PHOSPHATASE CH0BMP.?/Bv8.CH0BMP-2 



4 




0.1 1.0 "^0.0 lOO.O 1000.0 

BMP (ng/ml) 



SUBSTITUTE SHEET 



wo 93/09229 



PCT/US92/09430 



29/32 



4» 

FIGURE 13A 



CARTILAGE 




JOA S. 1.0 S.0 25.0 



/xg BMP 



SUBSTITUTE SHEET 



wo 93/09229 



PCr/US92/09430 



30/32 



FIGURE 13B 







o 


4.6- 


u 


CO 


4- 








3.5- 


o 






3- 


o 


2.6- 










2- 




141- 




1- 




0.5- 




0- 



BONE 
10 DAY IMPLANTS 



LEGEND 

BMP-2 
BMP.2/6 



.04 




25.0 



fig BMP 



SUBSTITUTE SHEET 



PCT/US92/09430 



31/32 



FIGURE 14A 



CARTILAGE 
10 DAY IMPLANTS 




fig BMP 



SUBSTITUTE SHEET 



LEGEND 



^ BMP-2 



BMP-d 



wo 93/09229 



PCT/US92/09430 



32/32 



FIGURE 14B 



BONE 
10 DAY IMPLANTS 




•04 2 1^ 5.0 25.0 



MgBMP 



SUBSTITUTE SHEET 



INTERNATIONAL SEARCH REPORT 

lotamatiitBil AppUcatioo No 



PCT/US 92/09430 



I. CLASSinCATION OF SUBJECT MATTUt Of sevoml dissifiatioD symbols ipply, todlcate m!l)' 



AcGordlog to lateroatiDiiaJ Patent Qassifiotlon (IPQ or to both National Qassificatloo and IPC 

Int.Cl. 5 C12N15/12; C12P21/02; A61K37/02; 

C07K15/06 



C12N5/12 



n. nELDS SEARCHED 


Minimum Docunentattoo SearcfaW 


ClassiflcatioD System 


dasnficatloa Symbols 


Int.Cl. 5 


C07K ; C12N ; A61K ; C12P 




Documentation Searched other than Minimum DocumcDtadOD 
to the Extent that such Documents are Included io the Fields Searched' 



m. DOCUMENTS CONSIDERED TO BE RELEVANT^ 



Category* 



Citation of Docomcnt, " with Indication, wbrn ap propriate. of the rderant passages" 



Relevant to Claim No.^ 



wo, A, 9 003 733 (INTERNATIONAL GENETIC 
ENGINEERING, INC.) 
19 April 1990 

see page 16, line 7 - page 17, line 28 
see page 18, line 22 - line 34 
see page 51, line 32 - page 52, line 10; 
figure 12 

see page 62 - page 63; claim 35 

W0,A,9 Oil 366 (GENETICS INSTITUTE, INC.) 

4 October 1990 

cited in the application 

see page 22, line 20 - line 27 

see page 43, line 17 - line 30 



1.4, 

7-14,16, 
23-26 



13-17, 
33,35 



13-16,33 



-/- 



Special categories of dted docnmcots : 

'A' docoment defining the general state of the art which is not 

considered to be of particular rdcvanoe 
*£* earlier docnmcot but published on or after the international 

filing date 

V docnmat which may throw doubts on priority claini(s) or 
which is dted to estafatisb the publication date of another 
citation or other special reason (as spedfled) 

'O* document refcning to an oral disdosnrc, use, cxhlbltlott or 



^p* document published prior to the international filing date but 
later than the priori^ date daimcd 



T* later documcot pufaiishod alter the International filing date 
or priority date and not in conflict with the apobcation but 
dted to understand the prindple or theory underiying the 
invention 

document of particular relevanoa; the daimcd invcotioa 
onnot be considered novel or cannot be considered to 
bivolva an inventive sup 

docuraat of paitiailar rdevance; the dalmed inventioa 
Gumot be considered to involve an inventive step when tho 
document is combined with one or more other such docu- 
ments, such combination bdng obvious to a person skilled 
in the art 

'A' document member of the tame patent fefflily 



IV. ceruhcahon 



Date of the Actual Completion of the International Search 

04 FEBRUARY 1993 



Date of Mailing 



ional Search Report 



International Searching Authority 

EUROPEAN PATENT OFFICE 



Signature of Authorized Officer 

ANDRES S.M. 



Fam PCT/ISA/310 ftMi iMI {Jmmrj 1«BS> 



PCT/US 92/09430 




P.Y 



W0,A,8 910 409 (GENETICS INSTITUTE, INC.) 

2 November 1989 

cited in the application 

see page 7, line 13 - line 15 

see page 8, line 20 - line 29 

PROCEEDINGS OF THE NATIONAL ACADEMY OF 

JSi^sf! Lcf 19S0, WASHINGTON US 
oages 2220 - 2224 ^ . 

WANG. E.A. ET AL. 'Recombinant human bone 
morphogenetic protein induces bone 
formation' 

cited in the application 
see figure IC 

JOURNAL OF BIOLOGICAL CHEMISTRY 
vol. 265, no. 22, 5 August 1990, 
BALTIMORE, MD US 
pages 13198 - 13205 

SAMPATH, T.K. ET AL. 'Bovine osteogenic 
protein is composed of dimers of OP-1 and 
BMP-2A, two members of the transforming 
growth factor-beta superfamily 
see the whole document 

PROCEEDINGS OF THE NATIONAL ACADEMY OF 

5"^^! Z.^li December 1990, WASHINGTON 
US 

oaqes 9843 - 9847 

CELESTE, A.J. ET AL. 'Identification of 
transforming growth factor-beta fa»i«y 
members present in bone-inductive protein 
purified from bovine bone' 
see page 9846, left column, line 13 - 
right column, line 7 

see page 9847, left column, paragraph Z-3 

W0,A,8 909 787 (CREATIVE BIOMOLECULES, 
INC.) 

19 October 1989 

see page 6. line 22 - line 24 

see page 56, paragraphs t5 & Ee 

W0,A,9 118 098 (GENETICS INSTITUTE, INC.) 

28 November 1991 

cited in the application 

see page 12, line 31 - page 13, line 7 



-/-- 



1,4, 

7-12,23, 
25-26 



34,36 



35 

34,36 



34,36 



13,16 



17 



PCT/US 92/09430 

IntcrnitioiuJ Ap^icatlos No 



m. DOCUMENTS CONSIDEatED TO BE KELEVANT (CONTINUED FROM THE SECOND Shu.!} 




Categtwy*' I 


aiatioD of Doaimeot, with ladlatlen. wbare ■ppmpriatt, of tbe idcvuil passigs 


Sdcviiit to daia No. 




JOURNAL OF CELLULAR BIOCHEMISTRY 
Supplement 16F, 1992, page 76, 
abstract W026; WOZNEY, J.M. ET AL.: 
'Regulation of chondrogenesis and 
osteogenesis by the BMP proteins' 
see abstract 

& Keystone Symposium on growth and 
differentiation factors in vertebrate 
development; Keystone, Colorado, USA 
April 3-16, 1992 


1 



F«B PCT/QA/UO CttOn iM) (Jmy IMS) 



ANMPX TO THE INTERNATIONAL SEARCH REPORT 0200430 
WOTESl^ONitL PATENT APPLICATION NO. US 9209430^^ 



Husanoexl 



Patent docmnent 
cited m seardi iqwit 



PubGcatkii 
date 



WO-A-9003733 



19-04-90 



WO-A-9011366 



04-10-90 



WO-A-8910409 



02-11-89 



WO-A-8909787 



19-10-89 



Patent hnaty 



Fublicatiim 



US-A- 
AU-B- 
AU-A- 
CA-A- 
EP-A- 
JP-T- 



5106626 
615810 
4488689 
2000498 
0394418 
4505151 



21-04-92 

10- 10-91 
01-05-90 

11- 04-90 
31-10-90 
10-09-92 



US-A- 
US-A- 
AU-A- 
CA-A- 
EP-A- 
JP-T- 



AU-A- 
EP-A- 
JP-T- 
US-A- 



US-A- 
US-A- 
AU-B- 
AU-A- 
AU-B- 
AU-A- 
EP-A- 
EP-A- 
JP-T- 
JP-T- 
WO-A- 
US-A- 
AU-B- 
AU-A- 
EP-A- 
JP-T- 
WO-A- 
US-A- 
US-A- 
US-A- 



5106748 
5141905 
5357790 
2030518 
0429570 
3505098 



3448789 
0408649 
3503649 
5106748 

4968590 
5011691 

628050 
3444989 

618357 
3530589 
0372031 
0362367 
3500655 
3502579 
8909788 
5108753 

627850 
5174790 
0411105 
3504736 
9010018 
4975526 
5171574 
5162114 



21- 04-92 
25-08-92 

22- 10-90 
29-09-90 
05-06-91 
07-11-91 



24-11-89- 
23-01-91 
15-08-91 
21-04-92 

06-11-90 
30-04-91 

10- 09-92 
03-11-89 
19-12-91 
03-il-89 

13- 06-90 

11- 04-90 

14- 02-91 
13-06-91 
19-10-89 
28-04-92 

03- 09-92 
26-09-90 

06- 02-91 
17-10-91 

07- 09-90 

04- 12-90 

15- 12-92 
10-11-92 



I F«riD»re d«t»b about tbk ■mw : « OIBeW Jownrf of the Stocpett P.t»t OBct. No. 12/t2 



ANNEX TO THE INTERNATIONAL SEARCH REPORT 
ON INTERNATIONAL PATENT APPLICATION NO. ^5 



9209430 
66918 



Hib umex lists the patrat himly membcn rebtinc to the patent dooimeott dtcd in the abovMncotioiied intBiiatiaBal aeardi report. 

Ihe BMmtaers are as coBtaioed in the European Patent Office EDP file on t\inM 

Tte Ei^ean Patent Office is in no way liable ht these paitkadars which are merely given for the purpose of infomaoon. 04/02/93 

Page 2 



g 



Patent docmncot 
dted ID seiFcfa rqioft 



PublicatioD 



Pstcm family 
membcKs) 



PuldieatraD 
date 



WO-A-9118098 ' 28-11-91 None 



% For morv details about this annex : sec Offidai Journal of the European Patent OfBce. No. 12/82 



This Page is Inserted by IFW Indexing and Scanning 
Operations and is not part of tlie Official Record 

BEST AVAILABLE IMAGES 

Defective images within this document are accurate representations of the original 
documents submitted by the applicant. 

Defects in the images include but are not limited to the items checked: 

□ BLACK BORDERS 

□ IMAGE CUT OFF AT TOP, BOTTOM OR SIDES 
□TfADED TEXT OR DRAWING 
[^BLURRED OR ILLEGIBLE TEXT OR DRAWING 

□ SKEWED/SLANTED IMAGES 

□ COLOR OR BLACK AND WHITE PHOTOGRAPHS 

□ GRAY SCALE DOCUMENTS 

□ LINES OR MARKS ON ORIGINAL DOCUMENT 

□ REFERENCE(S) OR EXHIBIT(S) SUBMITTED ARE POOR QUALITY 

□ OTHER: 

IMAGES ARE BEST AVAILABLE COPY. 
As rescanning these documents will not correct the image 
problems checked, please do not report these problems to 
the IFW Image Problem Mailbox.