Skip to main content

Full text of "USPTO Patents Application 09804625"

See other formats


per 



WORLD INTELLECTUAL PROPERTY ORGANIZATION 
International Bureau 




INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY <PCT) 



(51) International Patent Classification 5 : 
A61K 37/02, C07K 3/02, 15/06 
O07K 15/28, C12N 15/00 
G01N 33/567 



Al 



(11) International Publication Number: WO 92/22319 

(43) International Publication Date : 23 December 1 992 (23. 1 2.92) 



(21) Internationa] Application Number: 

(22) International Filing Date: 



PCT/US92/05I99 
18 June 1992(18.06.92) 



(30) Priority data: 
717,316 



18 June 1991 (18.06.91) 



US 



(60) Parent Application or Grant 
(63) Related by Continuation 
US 

Filed on 



717,316 (CIP) 
18 June 1991 (18.06.91) 



(71) Applicant (for all designated States except US): LUDWIG 

INSTITUTE FOR CANCER RESEARCH [US/US]; 
1345 Avenue of the Americas, New York, NY 10105 
(US). 

(72) Inventors; and 

(75) Inventors/Applicants (for US only) : ICHIJO, Hidenori [JP/ 
SE]; MIYAZONO, Kohei [JP/SE]; RONNSTRAND, 
Lars [SE/SEJ; HELLMAN, Ulf fSE/SEl; WERN- 
STEDT, Christer [SE/SEJ; HELDIN, Carl-Henrik [SE/ 
SE]; Biomedical Center, Husargatan 3, S-751 01 Uppsa- 
la (SE). F 



(74) Agent: HANSON, Norman, D.; Felfe & Lynch, 805 Third 
Avenue, New York, NY 10022 (US). 

(81) Designated States: AT (European patent), AU, BB, BE 
(European patent), BF (OAPI patent), BG, BJ (OAPI 
patent), BR, CA, CF (OAPI patent), CG (OAPI patent), 
CH (European patent), CI (OAPI patent), CM (OAPI 
patent), CS, DE (European patent), DK (European pa- 
tent), ES (European patent), FI, FR (European patent), 
GA (OAPI patent), GB (European patent), GN (OAPI 
patent), GR (European patent), HU, IT (European pa- 
tent), JP, KP, KR, LK, LU (European patent), MC (Eu- 
ropean patent), MG, ML (OAPI patent), MR (OAPI pa- 
tent), MW, NL (European patent), NO, PL, RO, RU, 
SD, SE, SE (European patent), SN (OAPI patent), TD 
(OAPI patent), TG (OAPI patent), US. 



Published 

With international search report. 
With amended claims. 



(54) Title: SUBSTANTIALLY PURE RECEPTOR LIKE TGF-pi BINDING MOLECULES AND USES THEREOF 



(57) Abstract 

The invention relates to a family of substantially pure, receptor like TGF-pi binding glycoproteins. These molecules are 
characterized by molecular masses of 160 kd, 70-80 kd, and 30-40 kd as determined by SDS-PAGE, and the ability to bind the 
TGF-pl molecule. This family of molecules is useful in identifying and/or quantifying TGF-01 in a sample, as well as inhibiting 
its effect on cells. Also described are nucleic acid sequences which code for the protein monomer making up the molecules. 



FOR THE PURPOSES OF INFORMATION ONLY 



Codes used lu identify Stales party to ihe PCI* on the fiont pages of pamphlets publishing international 
applications under the PCI*. 



AT 


Austria 


Ft 


(•inland 


Ml 


Mali 


AU 


Australia 


FR 


France 


MN 


Mongolia 


BB 


Barbados 


CA 


tiahon 


MR 


Mauritania 


BE 


Belgium 


GB 


Uniled Kingdom 


MW 


Mdlawi 


BF 


Burfcina Fasu 


CN 


Guinea 


NL 


Netherlands 


BC 


Bulgaria 


CR 


Greece 


NO 


Norway 


Bj 


Benin 


HU 


Hungary 


PL 


Poland 


BR 


Brazil 


IE 


Ireland 


RO 


Romania 


CA 


Canada 


IT 


Italy 


RU 


Russian Federation 


CF 


Central African Republic 


JP 


Japan 


SD 


Sudan 


CC 


Congo 


KF 


Democratic Peopled Republic 


se 


Sweden 


CH 


S wily ci land 




of Korea 


SN 


Senegal 


CI 


Cote d*l voire 


KR 


Republic of Korea 


SU 


Soviet Union 


CM 


Cameroon 


LI 


Liechtenstein 


TD 


Chad 


GS 


Occhusluvalia 


LK 


Sri LiitiLa 


TC 


Togo 


DE 


Germany 


LU 


Luxemburg 


US 


United States of America 


UK 


Denmark 


MC 


Monaco 






ES 


Spain 


MC 


Madagascar 







9 



WO 92/22319 



PCI7US92/0S199 



SUBSTANTIALLY PURE RECEPTOR LIKE TGF-01 
BINDING MOLECULES AND USES THEREOF 

RELATED APPLICATION 

This application is a continuation in part of U.S. 
patent application Serial Number 717,316, filed on June 18, 
1991. 

FIELD OF THE INVENTION 

This invention relates to protein biochemistry. More 
particularly, it relates to molecules which bind to the 
10 substance known as transforming growth factor-Bl ("TGF-Bl" 
hereafter) . The invention also relates to nucleic acid 
sequences coding for the molecule, and uses thereof. 

BACKGROUND AND PRIOR ART 

A family of molecules is referred to as the "TGF-Bs". 
These are 25 kd dimeric proteins which have multi- 
functional effects on growth and differentiation of cells, 
both in vitro and in vivo . See Roberts et al. in Peptide 
Growth Factors And Their Receptors I (Sporn et al., eds., 
pp 419-472; Springer-Verlag, Berlin, 1990); Moses et al., 

20 Cell 63: 245-247 (1990); Massague, Ann. Rev. Cell. Biol. 6: 
597-641 (1990) . The family contains at least three 
different, structurally related members, identified as "Bl, 
B2 and B3". Many other proteins are more distantly 
related, including bone morphogenic proteins, Miillerian 
inhibitory substance, activins, inhibins, and so forth. 

Originally, the TGF-B family of proteins was 
identified as being involved in increasing anchorage 
independent growth of normal rat kidney cells; however, the 
proteins are also recognized as a potent growth inhibitor 

30 for diverse cell types, including hematopoietic cells, 
lymphocytes, epithelial and endothelial cells (Ohta et al., 
Nature 329: 539-541 (1987); Kehri et al., J. Immunol 137: 
3855-3860 (1986); Moses et al., in Cancer Cells 3 
(Feramisco et al., ed; Cold Spring Harbor, New York, 1985); 



WO 92/22319 



PCT/US92/0S199 



2 

pg. 65-71; Baird et al.. Biochem. Biophys. Res. Commun 138: 
476-482 (1986); Frater-Schroder et al., Biochem. Biophys. 
Res. Commun. 137: 295-302 (1986); Heimark et al., Science 
233: 1078-1080 (1986)). The molecules have a dramatic 
effect on accumulation of extracellular matrix proteins 
(Massague, supra ) , and have been implicated in pathogenesis 
glomerulonephritis (Border et al.. Nature 346: 371-374 
(1990)); liver cirrhosis (Castilla et al. , N. Eng. J. Med. 
324: 933-940 (1990)); and pulmonary fibrosis (Khalil et 
10 al., in Clinical Application of TGF-B1 (Bock et al., ed. 

Ciba Foundation Symposium 157, John Willy & Sons, 1991, pg. 
194-211) . 

The TGF-B family interacts with other proteins on 
several levels. One of these is mediation of binding via 
cell surface receptors. The art recognizes three distinct 
high affinity receptors for TGF-Bs, referred to as types I, 
II and III. The first two of these have molecular masses 
of 53 and 70-85 kd, respectively, while the third is 
denoted "betaglycan" because of its proteoglycan like 

20 structure, and is further characterized by a molecular mass 
of 200-400 kd. Massague et al., in Transforming Growth 
Factor-Bs: Chemistry, Biology and Therapeutics (Piez et 
al., eds., Ann. N.Y. Acad. Sci. 593, 1990), pg. 59-72; 
Segarini et al., in Clinical Applications of TGF-B (Bock et 
al., eds. Ciba Foundation Symposium 157, John Wiley & Sons, 
1991, pg 29-50) . The betaglycan molecule is a membrane 
proteoglycan, having a 100-140 kd core protein with unknown 
functional importance, while type I and II receptors appear 
to be involved in transduction of TGF-B cellular effect. 

30 Segarini et al., J. Biol. Chem. 263: 8366-8370 (1988); 

Cheifetz et al., J. Biol. Chem. 263: 16884-16991 (1988); 
Massague et al., supra . Some cell lines express only type 
I receptors and are inhibited by TGF-B1. These include 
hematopoietic progenitor cell lines (Ohta et al., supra) 
and squamous cancer cell lines (Ichiyo et al., Exp. Cell 
Res. 187: 263-269 (1990)). Mutant cell lines of mink 
epithelial cells have been shown to have lost or to have 



WO 92/22319 



PCT/US92/0S199 



3 

anomalous expression of type I and/or type II receptors 
(Boyd et al., J. Biol. Chem. 264: 2272-2278 (1989); Laiho 
et al., J. Biol. Chem. 265: 18518-18524 (1990)). 

Additional binding molecules for TGF-B having 
molecular masses of 60 kd, 85-320 kd, and 400 kd have been 
reported in pituitary tumor cell lines, rat glomeruli, and 
bovine liver cells, respectively, as reported by Cheifetz 
et al., J. Biol. Chem. 263: 17225-17228 (1988); Mackay et 
al., J. Biol. Chem. 265: 9351-9356 (1990); O'Grady et al., 

10 J. Biol. Chem. 266: 8583-8589 (1991). 

On another level, the precursors of TGF-B, especially 
TGF-Bl, interact with protein molecules known as the latent 
TGF-binding protein or "LTBP". The interaction yields a 
high molecular weight, inactive complex which is secreted 
from the cell. This is sometimes referred to as the latent 
TGF-Bl complex. See Miyazono et al., J. Biol. Chem. 263: 
6407-6415 (1988); Pircher et al., Biochem. Biophys. Res. 
Commun. 136: 30-37 (1984); Wakefield et al., J. Cell Biol. 
105: 965-975 (1987). The inactive or latent complexes 

20 contain a non-covalent association of TGF-Bl, a disulphide 
bonded complex of a dimer of N-terminal peptide of TGF-Bl 
precursor and as third component, the LTBP. This third 
component occurs as a molecule with a molecular mass which 
may range from 125-190 kds. Experiments have shown that 
the binding proteins do not inactivate TGF-Bl. 

The molecules discussed supra are sometimes referred 
to as "binding proteins", because they do, in fact bind to 
the TGF-Bl precursor. A fundamental difference between 
these molecules and the molecules of the invention is that 

30 while the prior art molecules may be referred to as 
"synthesis" binders, it is more appropriate to describe the 
invention as involving "effector" binders. The synthesis 
binders are involved in the "packaging" of TGF-Bl in the 
cell, such that it is released for subsequent activities. 
When bound to the prior art molecules, TGFs are essentially 
inert. In contrast, the protein containing molecules of 
the invention may be seen as "effectors" in that TGF-fil 



WO 92/22319 



PCT/US92/05199 



4 

binds directly to these, so as to effect a response 
thereby. This distinction should be kept in mind in 
connection with this application. 

It is an object of the invention to describe these 
substantially pure, receptor like TGF-61 binding protein 
containing molecules, which are characterized by molecular 
masses of 160 kd, 70-80 kd, and 35-40 kd as determined by 
SDS-PAGE, as well as their uses in various processes. The 
ranges are due to the behavior of the species tinder 
10 reducing and non-reducing conditions, as will be seen 
infra. It is also due to the nature of the molecule's 
structure, which is as a monomer, dimer or trimer based 
upon a single peptide- The implication of this structure 
are discussed infra . 

The objects of the invention discussed supra as well 
as others will be seen from the disclosure which follows. 

BRIEF DESCRIPTION OF THE FIGURES 

Figure 1 provides a schematic outline of the purification 
protocol used to isolate the substantially pure receptor 
20 like transforming growth factor Bl binding proteins of the 
invention. 

Figure 2 shows a protein profile of a representative FPLC 
run for the binding proteins of the invention. 

Figure 3 shows SDS gel runs for various fractions prepared 
according to the invention, following affinity cross 
linking with 125 I-TGF-B1. 

Figure 4 depicts "in-gel" ligand binding of fractions 
following FPLC Mono-Q chromatography. 



30 



Figure 5 shows SDS-gel electrophoretic analysis of 
fractions obtained following sepharose chromatography using 
TGF-B1. 



WO 92/22319 



PCT/US92/0S199 



5 

Figure 6 presents analysis of the pH 3.5 elution fraction 
of TGF-Bl Sepharose chromatography , following affinity 
labelling using 125 I-TGF-fll. 

Figure 7 presents an analysis of different TGF-Bl Sepharose 
chromatography fractions using "in-gel M ligand binding* 

Figure 8 is a protein profile of a chromatogram of the pH 
3.5 elution fraction, following acetone precipitation 
concentration . 

Figure 9 is an SDS-gel analysis of various fractions 
10 obtained from Superose 12 chromatography. 

Figure 10 shows analysis of the pure 40 kd component of the 
analysis, using 125 I-TGF-B1 affinity cross linking 
experiments . 

Figure 11 shows in gel binding of the 40 kd receptor like 
binding protein. 

DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS 
Example l 

A protocol originally described by Ronnstrand et al., 
J. Biol. Chem. 262: 2929-2932 (1987) for purifying PDGF 
20 receptor was followed. Briefly, porcine uterus tissue was 
used as starting material for preparation of membranes. 
Differential centrifugation following Ronnstrand f supra r 
was used to obtain the membranes. The membrane proteins 
were then solubilized in Triton X-100 R , and subjected to 
chromatography on wheat germ agglutinin Sepharose and fast 
protein liquid chromatography Mono-Q columns. First, the 
proteins were purified on the wheat germ agglutinin column, 
and the purified material was then applied to an FPLC Mono 
Q column, using increasing concentrations of NaCl. Twenty- 



WO 92/22319 



PCT/US92/05199 



6 

six fractions were taken from the column. Of these, 
fractions 16-20 were pooled and used to purify PDGF 
receptor; the other fractions were stored at -20 °C and used 
as starting material to purify the receptor like binding 
proteins of the invention. Figure 2 shows the 

concentration of NaCl used for each fraction, via the 
dotted line. Fractions 16-20 were used for PDGF 
purif ication . 

Example 2 

10 To remove the receptor like binding proteins from the 

fractions obtained following Example 1, a TGF-B1 Sepharose 
column was prepared. This was accomplished using 
recombinant TGF-B1 purified from conditioned medium of CHO 
cells, transfected with human TGF-61 cDNA. One mg of TGF- 
Bl was coupled to 0.5 g of cyanogen bromide activated 
Sepharose 4B, to yield about 0.67 mg of TGF-Bl/ml of gel. 

Following preparation of the column, fractions 1-15 
and 21-26 from example 1 were thawed, pooled, and dialyzed 
against binding buffer (0.2% Triton X-100 R , 125 mM NaCl, 5 

20 mM KC1, 5mM MgS0 4 , 1.2 mM CaCl 2 , 20 mM HEPES, pH 7.4). 

Twenty-five ml amounts of dialyzed sample were then mixed 
with 2.5 ml of the previously prepared Sepharose beads, and 
the resulting suspension was incubated overnight at 4°C, 
with gentle shaking. The beads were then collected in a 
column which was then washed with 25 ml of binding buffer, 
and then 25 ml of binding buffer with 500 mM NaCl. Bound 
molecules were then eluted with 5 ml of a solution of 0.2% 
Triton X-100 R , 500 mM NaCl, in 100 mM sodium acetate buffer, 
pH 5.5, followed by 5 ml of 0.2% Triton X-100 R , 500 mM NaCl, 

30 and 100 mM acetic acid at pH 3.5, to yield what will be 
referred to as the "pH 3.5 eluate" hereafter. 

Example 3 

The pH 3.5 eluate fractions from f our to six 
chromatography runs, as discussed supra . were pooled and 



WO 92/22319 



PCT/US92/05199 



7 

mixed with four volumes of acetone. The protein portion 
was precipitated at -20 °C for 60 minuties, followed by 
centrifugation at 17,000xg at 4°C for 20 minutes. The 
resulting protein pellets were dried, resuspended in 500 ul 
of 70% formic acid, followed by application to an FPLC 
Super ose 12 column which had been pre-equi libra ted and 
eluted with 70% formic acid at a flow rate of 0.5 ml/min. 
Fractions (250 ul) were collected, and aliguots of 
individual fractions were lyophilized and subjected to 
10 further analysis. 

Example 4 

Fractions obtained following example 2 were examined 

125 

for I-TGF-Bl binding, using affinity cross linking and 

"in gel" binding procedures. 

To do this, 50 ul portions of the individual Mono-Q 

fractions were incubated for three hours at 4°C in the 
presence of l nM of recombinant TGF-Bl labeled with 125 I 

following Frolik et al., J. Biol. Chem. 259: 10995-11000 

(1984), to yield a product with 5xl0 6 cpm/ml. The 
20 incubation took place with fractions that either had been 
dialyzed against the binding buffer described supra . or 
dissolved in it. 

The affinity labeled proteins were then cross-linked 
using 0.14 xnM of disuccinimidyl suberate ("DSS") for 15 
minutes at 4°C. The cross-linking reaction was quenched by 
adding SDS-electrophoresis sample buffer containing 80 mM 
Tris. In this and in following examples, the samples were 
then heated at 95 °C for three minutes in SDS-sample buffer 
which did or did not contain 10 mM dithiothreitol (DTT) . 
JO The samples were then applied to 5-15% SDS-polyacrylamide 
gels following Blobel et al., J. cell Biol. 67: 835-851 
(1975) for electrophoresis, under either reducing or non- 
reducing conditions. Gels were then fixed in 25% methanol, 
7.5% acetic acid, and dried and subjected to 12-days of 



WO 92/22319 



PCT/US92/05199 



8 

autoradiography using Fuji X-ray film. The results of the 
autoradiography are shown in Figure 3. 

Example 5 

Experiments were also carried out to study "in gel" 
binding using radiolabeled TGF-B1. To do this, the method 
described by Murphy et al., Anal. Biochem. 187: 197-201 
(1990) for 125 I heparin, was used with some minor 
modifications. To summarize, 250 ul of individual 
fractions were lyophilized and subjected to non-reducing 

10 SDS gel electrophoresis. Following SDS-gel 

electrophoresis, gels were fixed for 30 minutes in 40% 
methanol, 7% acetic acid, and rinsed several times with 
distilled water. The gels were then incubated overnight 
with 10% ethanol, 10 mM Tris-HCl, pH 7.5 at 4°C with gentle 
shaking, followed by washing for one hour with the same 
buffer. The gels were then incubated for 30 minutes with 
binding buffer containing bovine serum albumin (BSA) at 2 
mg/ml. Gels were then transferred to plastic bags with 10 
ml binding buffer containing 1x10* cpm of 125 I-TGF-B1 and 2 

20 mg/ml of BSA. These bags were sealed and shaken overnight 
at 4°C. Excess 125 I-TGF-B1 was removed, and the gels were 
then washed with 500 ml of binding buffer for 30 minutes, 
followed by two washes with 500 mM binding buffer 
containing 400 mM NaCl. Each wash was for 30 minutes. 
Following this, gels were dried and subjected to 
autoradiography as per example 4, but for three days. 
Figure 4 shows these results. 

In both of examples 4 and 5, 14 C labeled molecular 
weight markers were used as follows: myosin (200 kd) , 

30 phosphorylase B (92.5 kd) bovine serum albumin (69 kd) , 
ovalbumin (46 kd) , carbonic anhydrase (30 kd) , lysozyme 
(14.3 kd) . 

The results from example 4 showed complexes of 
apparent molecular masses of 210,000; 170,000; and 145,000 
kd from most of the fractions, as well as complexes with 



WO 92/22319 



PCT/US92/05199 



9 

molecular masses of 80,000 and 65,000 in fractions 2-10, 
plus one of 53,000 in fractions 10-20. Example 5 (Fig. 4) 
results showed several binding components in the 90-200 kd 
range in fractions 5-26, plus a prominent band of 36 kd in 
fractions 11-26. 

Example 6 

The results obtained in Example 4 gave a pattern which 
was similar to that observed by Seganini et al., J. Biol. 
Chem. 263: 8366-8370 (1988), and Cheifetz et al., J. Biol. 
10 Chem. 263: 16884-16991 (1988), for betaglycan affinity 
labeled with 125 I-TGF-B1. To determine whether either of 
the 210 kd or 170 kd components represented betaglycan, 
samples were again cross linked with 125 I-TGF-B1, and 
digested with heparinase and chondroitinase. The 
references cited to supra had shown that the proteoglycan 
betaglycan shifts to 100-140 kd following such treatments. 
The 210 and 170 kd complexes tested herein showed no such 
movement, strongly suggesting that they did not represent 
betaglycan. 0 

20 Example 7 

Once it had been shown that there was binding activity 
for the proteins of examples 1-6, further purification 
steps were carried out. 

Again referring to the fraction obtained with the 
Mono-Q column, all but fractions 16-20 were combined and 
dialyzed against dialysis buffer as described supra . 
Again, following the protocols described supra the dialyzed 
material was subjected to affinity chromatography using 
immobilized TGF-B1 . Following this, the column was washed 
30 with binding buffer, described supra . then with binding 
buffer at higher ionic strength, i.e., 0.5 M NaCl. 
Following this, two elutions were carried out, first with 
an elution buffer at pH 5.5, and than at pH 3,5 Each 



WO 92/22319 



PCT/US92/05199 



10 

fraction was analyzed on SDS-PAGE, using silver staining in 
the absence and presence of reducing agent. 

The results from these different fractionations are 
shown in Figure 5, where "FT" refers to the flow through 
material, "Wl" to the low ionic strength wash, "W2" to the 
high ionic strength wash, "El" to the elution at pH 5.5, 
and E2 to the elution at pH 3.5. Very little protein 
eluted at pH 5.5, while at pH 3.5 and under non reducing 
conditions, materials eluted which showed apparent 
10 molecular masses of 160, 72, 46 and 36 kilodaltons. When 
this fraction was tested under reducing conditions, species 
of apparent molecular masses of 160, 80, 50 and 40 
kilodaltons were observed. This suggests that four 
separate species were present, having molecular weights of 
160 kd, and ranging from 70-80 kd, 45-50 kd, and 35-40 kd. 

Py*Tnp1 a ft 

The pH 3.5 eluate clearly contained the material of 
interest, and was subjected to further analysis. An 
aliquot of the fraction was lyophilized, redissolved in 

20 binding buffer, and incubated with 1 nM 125 I-TGF-61, 
prepared as described supra . either without or with an 
excess amount of unlabeled TGF-61 (400 nM) . Again, 
following the protocols set forth supra, these materials 
were cross linked with DSS and analyzed via SDS gel 
electrophoresis under reducing conditions. Radiographic 
data from these experiments are presented in Figure 6, and 
show complexes with apparent molecular weights of 170 and 
53 kd. These complexes were associated with 125 I-TGF-fll. 
This radiolabeled molecule has a molecular weight of 12.5 

30 kd under reduced conditions, «o it would appear that the 
binding materials are the 160 and 40 kd species of Example 
7. Components of molecular mass 70-90 kd and 25 kd were 
also found, but there was no observed displacement even 
when 400 fold cold molar excesses of unlabeled TGF-61 were 
used. Also, these bands were found in control lanes where 



WO 92/22319 



PCT/US92/05199 



11 

samples were not present, suggesting free 125 I-TGF-B1 and 
the labeled molecule non-specif ically cross linked to BSA. 

Example 9 

The pH 3.5 fraction was then used for "in gel" ligand 
binding, as were some of the other fractions. 
Specifically, 70 ul of FT, El and E2 fractions were 
subjected to the same protocol for in gel ligand binding as 
described previously. Figure 7 shows these results. Two 
of the three components recognized were identical to 
components found using the affinity labeling experiment of 
Example 8. A third, an 80 kd band, may have been hidden in 
the diffuse 70-90 kd band shown in Figure 6 and discussed 
in Example 8. A fourth component, a 50 kd band, was the 
material present in lowest quantity in the pH 3.5 fraction. 

Example 10 

The foregoing examples showed that there were several 
receptor like binding proteins present. In order to 
separate these, a size separation method was used. 
Specifically, pH 3.5 eluates from four to six TGF-B1 
Sepharose chromatographies were pooled and subjected to 
acetone precipitation, as per Example 2, supra . 
Precipitates were dried, redissolved in 70% formic acid, 
and applied to an FPLC Superose 12 column eluted in 70% 
formic acid. 

The protein profile of this chromatography is shown in 
Figure 8, where three major protein peaks were found at 
fractions 28-31, 32-34, and 44-48. A shoulder was found at 
fractions 36-40. 

Individual fractions 31-48 were then lyophilized and 
analyzed in 10 ul aliquots, using SDS-PAGE under non 
reducing conditions followed by silver staining. These 
results are shown in Figure 9. They show that the 160 kd 
component eluted in a broad peak through fractions 32-42, 
while a 72 kd component eluted in fractions 37-40, and the 
36 kd component in fractions 44-47. This last material was 



WO 92/22319 



PCT/US92/05J99 



12 

apparently homogeneous, and further analysis under reducing 
conditions showed a 40 kd fraction* These results indicate 
that this material is a single chain polypeptide, probably 
containing intra-chain disulphide bonds. The absorbance 
values at 280 nm in Figure 8 suggest that about 12 ug of 
this 40 kd molecule can be purified from 10 kg of tissue. 

Example 11 

The 40 kd molecule was analyzed to test its binding to 
TGF-B1, using the affinity cross-linking protocols set 
10 forth supra . Figure 10 shows that this experiment yielded 
a 62 kd complex under non-reducing conditions, and a 53 kd 
complex when 10 mM of DTT are present. If the molecular 
mass of TGF-B1 under non-reducing and reducing conditions 
are subtracted (25 kd, 12.5 kd) , the resulting figure is 40 
kd. 

Similarly, when "in-gel" binding under non-reducing 
conditions was carried out, a labeled band is found at 36 
kd, as shown in Figure 11. This is the expected value, and 
the results prove that the substantially pure receptor like 
20 binding protein for TGF-B1 having a molecular mass of 36- 
40 kd does bind the molecule when in homogeneous form. 

Example 12 

The initial purification work, as per Example 1, used 
a wheat germ agglutinin column, so it cannot be ruled out 
that the materials of interest are glycoproteins. To that 
end, the molecules of the invention are described as 
"protein containing" because they definitely contain a 
protein component, and may be glycoproteins. Analysis of 
the homogeneous 40 kd component using endoglycosidase F, 
30 using SDS PAGE, silver staining and reducing conditions 
yielded a 35 kd product, so the molecules may be 
glycoproteins . 



WO 92/22319 



PCT/US92/0S199 



13 

Example 13 

Tryptic digestion of the 40 kd material has revealed 
some amino acid data. The following sequences have been 
identified: 

(I) V (D) LV (D) FEGNHQFA 

(II) WGLEGSDKLSILR 

(III) VFGSQLGE 

where P* is hydroxyproline, and a bracketed amino acid means 
the determination is tentative. Sequence III has been used 
to prepare antiserum which specifically binds to all three 
glycoproteins . 

Example 14 

Additional experiments with the proteins described 
supra resulted in the generation of additional tryptic 
fragments. These included the following: 

(1) YLGGSHGSFA 

(2) WGLEGSDKLSILR 

(3) CP*GLP*GAAGP 

(4) DWAAY 

An additional peptide was derived from lysine peptidase 
fragment digestion of a mixture of the 3 glycoproteins 
discussed supra. 

RGFGSQLGEFWLGNDHIHALTAQGTNELXVDLVFEGNHQFA . 
Example 15 

Experiments were carried out to isolate a cDNA 
sequence coding for the protein of interest. In order to 
prepare a specific probe, degenerate oligomers were used 
based upon the peptide sequences presented in Example 13 
and 14, in a polymerase chain reaction ("PCR") using mRNA 
derived from porcine uterus. Specifically the sequences 



WO 92/22319 



PCI7US92/05199 



14 
QLGEFW 

and 

FEGNHQF 

were used to prepare sense and antisense degenerate 
oligomers: 

5' CAA CTN GGN GAA TTT TGG-3' 
G T G C 

(sense) 

5' AAA TTG ATG ATT NCC TTC AAA- 3 ' 
10 G C G G C G 

(antisense) . 

These degenerate oligomers were used in the polymerase 
chain reaction on the mRNA , and this led to the 
amplification of an approximately 100 base pair fragment. 
The 100 base pair fragment was subcloned into bluescript, 
and was then sequenced. 

Example 16 

Synthetic oligonucleotide probes were synthesized 
based on the 100 base pair sequence discussed supra: 

20 5 '-TTC TGG CTG GGG AAC GAC CAC ATC CAC GCC CTG ACG GCC CAG 

GGA-3 ' 

(sense) 

5' GAA GTC CAC GAG GTC CAC CCG GAG CTC ATT GGT TCC CTG GGC 
CGT-3 ' 

(antisense) • 

These probes were labelled with [ 32 7]P and were used to 
screen a cDNA library prepared from mRNA isolated from 
porcine uterus. The cDNA was inserted into XgtlO to form 
the library. The library was transferred onto 

30 nitrocellulose filters which were hybridized to the probes. 



WO 92/22319 



PCT7US92/05199 



15 

The filters were washed with 2xSSC, 0.1% SDS room 
temperature for 15 minutes, followed by O.SxSSC, 0.1% SDS, 
50°C for 20 minutes, and a cDNA clone was isolated. The 
insert was short, so this clone was used to rescreen the 
library, using slightly higher stringency washes from the 
first set of conditions (2xSSC, 0.1% SDS, room temperature 
15 minutes, followed by 0.2xSSC, 0.1% SDS, 60 °C, twenty 
minutes) . 

The isolated cDNA clone was sequenced, and thus is 
10 presented in SEQ ID NO: 5, attached hereto. 

The foregoing experiments demonstrate the existence of 
several receptor like binding proteins for TGF-Bl. The 
term "receptor like" is used to distinguish these molecules 
generically from other molecules which have been referred 
to as "TGF-Bl binding proteins". The previously described 
molecules are substances which are complexed to the TGF- 
Bl molecule intracellular^ and appear to be necessary to 
permit extracellular passage of the TGF-Bl . In contrast, 
there was no evidence of the molecules of this invention 
20 being complexed to TGF-Bl when isolated. As such, they 
show "receptor like" properties, in that they bind to and 
remove TGF-Bl from solution, but "receptor" is generally 
used to refer to a membrane bound material which is 
involved in reception of the target molecule. There is no 
evidence to link the described and claimed molecules of the 
invention to such a role, thus they are referred to as 
"receptor-like" rather than receptors. 

The data derived from the experiments reported herein 
supported the hypothesis that the TGF-Bl binding proteins 
10 described herein are related as monomer, dimer and timer of 
the amino acid sequence described in e.g., SEQ ID NO: 5. 

The molecules appear to be glycoproteins based upon 
their ability to bind to wheat germ agglutinin columns, and 
the size reduction of the 4 0 kd molecule following 
endoglycosidase treatment. 

The three molecules do not appear to have proteoglycan 
structures and are, therefore, clearly distinct from type 



WO 92/22319 



PCI7US92/0S199 



16 

III TGF-B receptor, which is a proteoglycan and is referred 
to as "betaglycan" . Additional comparison to, e.g., 
decorin (Yamaguchi et al. , Nature 346: 281-284 (1990)); a2 
macroglobulin (O'Connor-McCourt, et al., J. Biol. Chem. 
262: 14090-14099 (1987)); and type IV collagen (Paralker et 
al., Dev. Biol. 143: 303-308 (1991)), are not warranted 
because all of these molecules have size and subunit 
compositions different from the molecules described herein, 
and are secreted molecules, unlike those described and 

10 claimed herein. 

The sequence does, however, suggest a structure 
similar to that possessed by tenascin, as well as a 
collagen like domain. 

The ability of these substantially pure receptor like 
TGF-B 1 binding glycoproteins to bind TGF-Bl renders them 
useful in a number of ways. As indicated by the foregoing 
experiments, all three molecules bound to TGF-Bl on a 
column. As such, each can be used as a "probe" to detect 
TGF-Bl in a sample. Contact of the sample with the 

20 purified glycoprotein, followed by analysis for binding 
provides an assay method for TGF-Bl. In addition, the 
ability of the glycoproteins to bind TGF-Bl makes them 
useful as therapeutic agents for preventing the binding of 
TGF-Bl to a cell with an actual receptor, thereby 
inhibiting the effect of the TGF-Bl if a sufficient amount 
of the glycoprotein is added. Other uses for the 
materials, such as an immunogen for production of 
antibodies, will be clear to the artisan and need not be 
set forth here. 

3 0 Isolation of cDNA, as described herein, puts the 

artisan in possession of its complementary structure, as 
the complementary nature of DNA is well known. The 
deciphering of the amino acid sequence and the cDNA 
sequence will be seen to put the artisan in possession of 
the tools to isolate the genomic DNA sequence coding for 
the TGF-Bl binding protein monomer. To the same end, 
conventional techniques of microbioloby may be used to 



WO 92/22319 



PCT/US92/05199 



17 

transfect cells, be they prokaryotic or eukaryotic, with 
the coding DNA (genomic or complementary) . COS cells may 
be mentioned as one example of the type of cell which can 
be so transformed, but other cell types are readily 
accessible to the skilled artisan, and need not be 
discussed further. 

Any cell receptive to transformation with the subject 
nucleic acid sequences will be seen to be capable of coding 
the 35-40 kd monomer. Those cells possessing the means to 

10 dimerize and trimerize the monomers will be capable of 
producing the d- and trimers discussed herein. 

It is well known that nucleic acid sequences can be 
used as probes for those cells which express the binding 
protein. Such antisense sequences may also be used to bind 
to and inhibit the expression of the binding protein when 
this is appropriate. Other uses of these sequences will be 
clear to the skilled artisan. 

The terms and expressions which have been employed are 
used as terms of description and not of limitation, and 

20 there is no intention in the use of such terms and 
expressions of excluding any equivalents of the features 
shown and described or portions thereof, it being 
recognized that various modifications are possible within 
the scope of the invention. 



WO 92/22319 



PCT/US92/05199 



18 

Claims 

1. Isolated nucleic acid molecule which codes for a 
receptor like transforming growth factor Bl binding 
protein molecule. 

2. Isolated nucleic acid molecule complementary to the 
nucleic acid molecule of claim 1. 

3. Isolated nucleic acid molecule of claim 1, wherein 
said molecule is cDNA. 

4. Isolated nucleic acid molecule of claim 1, wherein 
said molecule if mRNA. 

5. Isolated nucleic acid molecule of claim 1, wherein 
said molecule is genomic DNA. 

6. Isolated nucleic acid molecule of claim 3, having the 
sequence set forth in SEQ ID NO: 5. 

7. Isolated cell transfected with the nucleic acid 
molecule of claim l. 

8. The cell of claim 7, wherein said cell is a COS cell. 

9. Substantially pure, receptor like transforming growth 
factor Bl binding protein containing molecule, 
characterized by a molecular weight of from 35-40 kd 
as determined by SDS-PAGE. 

10. Substantially pure, receptor like transforming growth 
factor Bl binding protein containing molecule, 
characterized by a molecular weight of from 75-80 kd 
as determined by SDS-PAGE. 



WO 92/22319 



PCT/US92/05199 



19 

11. Substantially pure, receptor like transforming growth 
factor Bl binding protein containing molecule, 
characterized by a molecular weight of 160 kd as 
determined by SDS-PAGE. 

12. Method for identifying transforming growth factor Bl 
binding protein in a sample, comprising contacting 
said sample to the substantially pure, receptor like 
binding protein containing molecule of claim 9 and 
determining binding to said binding glycoprotein as a 
determination of transforming growth factor 1 in said 
sample. 

13. Method for identifying transforming growth factor Bl 
binding protein in a sample, comprising contacting 
said sample to the substantially pure, receptor like 
binding protein containing molecule of claim 10 and 
determining binding to said binding protein containing 
molecule as a determination of transforming growth 
factor 1 in said sample. 

14. Method for identifying transforming growth factor Bl 
binding protein in a sample, comprising contacting 
said sample to the substantially pure, receptor like 
binding protein containing molecule of claim 11 and 
determining binding to said binding protein containing 
molecule as a determination of transforming growth 
factor Bl in said sample. 

15. Method for inhibiting the effect of transforming 
growth factor Bl on a cell comprising administering an 
amount of the substantially pure, receptor like 
transforming growth factor Bl binding protein 
containing molecule of claim 9 to a subject sufficient 
to inhibit said transforming growth factor Bl. 

16. Method for inhibiting the effect of transforming 
growth factor Bl on a cell comprising administering an 



WO 92/22319 



PCT/US92/0S199 



20 

amount of the substantially pure, receptor like 
transforming growth factor 61 binding protein 
containing molecule of claim 10 to a subject 
sufficient to inhibit said transforming growth factor 
Bl. 

17. Method for inhibiting the effect of transforming 
growth factor Bl on a cell comprising administering an 
amount of the substantially pure, receptor like 
transforming growth factor Bl binding protein 
containing molecule of claim 11 to a subject 
sufficient to inhibit said transforming growth factor 
Bl. 

18. Peptide fragment selected from the group consisting 



of: 




(a) 


V (D ) LV (D) FEGNHQFA 


(b) 


WGLEGSDKLSILR 


(c) 


VFGSQLGE 


(d) 


YLGGSHGSFA 


(e) 


WGLEGSDKLSILR 


(f) 


CP*GLP*GAAGP 


(g) 


DWAAY 


and (h) 


RGFGSQLGEFWLGNDHIHALTAQGTNELXVDLVFEGNHQFA 


where P* 


is hydroxyproline. 


Isolated 


antibody which specifically binds to 



receptor like transforming growth factor Bl binding 



protein molecule. 

20. The antibody of claim 19, wherein said antibody is a 
monoclonal antibody. 

21. The antibody of claim 19 or 20, wherein said antibody 
binds to a receptor like transforming growth factor Bl 



WO 92/22319 



PCT/US92/0S199 



21 

binding protein having molecular weight of from 35- 
40 kd as determined by SDS-PAGE. 

22. The antibody of claim 19 or 20, wherein said antibody 
binds to a receptor like transforming growth factor Bl 
binding protein having molecular weight of from 75- 
80 kd as determined by SDS-PAGE. 

23. The antibody of claim 19 or 20, wherein said antibody 
binds to a receptor like transforming growth factor Bl 
binding protein having molecular weight of from 160 
kd as determined by SDS-PAGE. 



WO 92/22319 



22 



PCT/US92/05199 



AMENDED CLAIMS -ft M , 

[received by the International Bureau on 12 October 1992 (12.10.92) ; 
original claims 1, 9-17 and 19-23 amended ; 
remaining claims unchanged ( 4 pages)] 

1. Isolated nucleic acid molecule which codes for a 
membrane derived, receptor like transforming growth 
factor Bl binding protein molecule. 

2. Isolated nucleic acid molecule complementary to the 
nucleic acid molecule of claim 1. 



3. Isolated nucleic acid molecule of claim 1, wherein 
said molecule is cDNA. 

4. Isolated nucleic acid molecule of claim 1, wherein 
said molecule if mRNA. 

5. Isolated nucleic acid molecule of claim, 1, wherein 
said molecule is genomic DNA. 

6. Isolated nucleic acid molecule of claim 3, having the 
sequence set forth in SEQ ID NO: 5. 

7. Isolated cell transfected with the nucleic acid 
molecule of claim 1. 

8. The cell of claim 7, wherein said cell is a COS cell. 

9. Substantially pure, membrane derived receptor like 
transforming growth factor 61 binding protein 
containing molecule, characterized by a molecular 
weight of from 35-40 kd as determined by SDS-PAGE. 



10. Substantially pure, membrane derived receptor like 
transforming growth factor Bl binding protein 
containing molecule, characterized by a molecular 
weight of from 75-80 kd as determined by SDS-PAGE. 



WO 92/22319 



23 



PCT/US92/0S199 



11. Substantially pure, membrane derived receptor like 
transforming growth factor Bl binding protein 
containing molecule, characterized by a molecular 
weight of 160 Jed as determined by SDS-PAGE. 

12. Method for identifying transforming growth factor Bl 
binding protein in a sample, comprising contacting 
said sample to the substantially pure, membrane 
derived receptor like binding protein containing 
molecule of claim 9 and determining binding to said 
binding glycoprotein as a determination of 
transforming growth factor 1 in said sample. 

13. Method for identifying transforming growth factor Bl 
binding protein in a sample, comprising contacting 
said sample to the substantially pure, membrane 
derived receptor like binding protein containing 
molecule of claim 10 and determining binding to said 
binding protein containing molecule as a determination 
of transforming growth factor 1 in said sample. 

14. Method for identifying transforming growth factor Bl 
binding protein in a sample, comprising contacting 
said sample to the substantially pure, membrane 
derived receptor like binding protein containing 
molecule of claim 11 and determining binding to said 
binding protein containing molecule as a determination 
of transforming growth factor Bl in said sample. 

15. Method for inhibiting the effect of transforming 
growth factor Bl on a cell comprising administering an 
amount of the substantially pure, membrane derived 
receptor like transforming growth factor Bl binding 
protein containing molecule of claim 9 to a subject 
sufficient to inhibit said transforming growth factor 
Bl. 



WO 92/22319 



PCT/US92/0S199 



16. Method for inhibiting the effect of transforming 
growth factor Bl on a cell comprising administering an 
amount of the substantially pure, membrane derived 
receptor like transforming growth factor Bl binding 
protein containing molecule of claim 10 to a subject 
sufficient to inhibit said transforming growth factor 
Bl. 

17. Method for inhibiting the effect of transforming 
growth factor Bl on a cell comprising administering an 
amount of the substantially pure, membrane derived 
receptor like transforming growth factor Bl binding 
protein containing molecule of claim 11 to a subject 
sufficient to inhibit said transforming growth factor 
Bl. 

18. Peptide fragment selected from the group consisting 
of: 



(a) 


V (D) LV (D) FEGNHQFA 


(b) 


WGLEGSDKLSILR 


(c) 


VFGSQLGE 


(d) 


YLGGSHGSFA 


(e) 


WGLEGSDKLSILR 


(f) 


CP*GLP*GAAGP 


(g) 


DWAAY 


(h) 


RGFGSQLGEFWLGNDHIHALTAQGTNELXVDLVFEGNHQFA 


P* 


is hydroxyproline. 



19. Isolated antibody which specifically binds to a 
membrane derived receptor like transforming growth 
factor Bl binding protein molecule. 

20. The antibody of claim 19, wherein said antibody is a 
monoclonal antibody. 



WO 92/22319 



PCT/US92/05199 



21. The antibody of claim 19 or 20, wherein said antibody 
binds to a membrane derived receptor like transforming 
growth factor £1 binding protein having molecular 
weight of from 35-40 kd as determined by SDS-PAGE. 



22. The antibody of claim 19 or 20, wherein said antibody 
binds to a membrane derived receptor like transforming 
growth factor Bl binding protein having molecular 
weight of from 75-80 kd as determined by SDS-PAGE. 

23. The antibody of claim 19 or 20, wherein said antibody 
binds to a membrane derived receptor like transforming 
growth factor Bl binding protein having molecular 
weight of from 160 kd as determined by SDS-PAGE. 



WO 92/22319 



PCT/US92/05199 



1/12 



FIG.1 



Porcine uterus 



I 



Membrane proteins 



WGA-Sepharose chromatography 



I 



FPLC Mono-Q chromatography 

fractions 16-20 



fractions 1-15 
and 21-26 



Purification of PDGF receptor 



TGF-(31-Sepharose chromatography 



I 



FPLC Superose 12 chromatography 



SUBSTITUTE SHEET 



WO 92/22319 



PCI7US92/05199 



2/12 




SUBSTITUTE SHEET 



WO 92/22319 



PCI7US92/05199 



3/12 




WO 92/22319 



PCT/US92/0S199 



4/12 




SUBSTITUTE SHEET 



WO 92/22319 



PCT/US92/05I99 



5/12 

FIG. 5 




WO 92/22319 



PCT/US92/0S199 



6/12 

FIG. 6 




SUBSTITUTE SHEET 



WO 92/22319 



PCI7US92/05199 



7/12 

FIG. 7 



F E1 E2 



kDa 
200 



160 



93 
69 
46 



30 



14 



• < 72 



36 



WO 92/22319 



PCT/US92/05199 



8/12 

FIG. 8 




Fraction No. 0 10 20 30 40 50 60 

HI ' 1- 1 1 

Elution Vol.,ml 0 5 10 15 



SUBSTITUTE SHEET 



WO 92/22319 



PCJ7US92/0S199 




SUBSTITUTE SHEET 



WO 92/22319 



PCT/US92/05199 



10/12 

FIG. 10 




WO 92/22319 



PCI7US92/0S199 



11/12 

FIG. 11 

kDa 
200- 



93- 
69- 
46- 




14- 



SUBSTITUTE SHEET 



WO 92/22319 



PCT/US92/05199 



12/12 

FIG. 12 

gcgatggacacacgcggagtggccgcggccatgaggcccctggtcctgctcgttgccttc 60 
Amd trgvaaamrplvllvaf 

ctgtgcaccgcagccccagccctcgacacctgtccagaggtcaaggtggtgggtctggag 120 
l ctaapaldtcpevkvvgle 

ggctcggacaagctctccatcctccgaggctgcccggggctgcctggagccgcagggccc 180 
gsdkls ilrgcpglpgaagp 

aagggagaggcgggcgccagtggaccgaagggaggacaaggccctcccggagcccctggg 240 
kgeagasgpkggqgppgapg 

gagccaggaccccccgggcccaaaggagaccgaggggagaagggcgagcctggaccaaaa 300 
epg ppgpkgdrgekgepgpk 

ggagagtcttgggaaaccgagcagtgtctcacaggacctcggacct<5caaggagctgctg 360 
gesweteqc ltgprtckell 

accagggggcacattctgagcggctggcacaccatctacctgccagactgccagcccctg 420 
trghilsgwhtiylpdcqpl 

acggtgctgtgtgacatggacacggatggcggggggtggaccgttttccagcgcaggagc 480 
tvlcdmdtdgggwtvfqrrs 

gacgggtcggtggacttctaccgggactgggccgcgtacaagcggggcttcggcagtcag 540 
dgsvdfyrdwaaykrgfgsq 

ctgggagagttctggctggggaacgaccacatccacgccctgacggcccagggaaccaat 600 
lgefwlgndhihaltaqgtn 

gagctccgggtggacctcgtggacttcgagggcaaccaccagtttgccaagtacaggtcc 660 

ELRVDLVDFEGNHQFAKYRS 

TTCCAGGTGGCAGACGAGGCAGAGAAGTACATGCTGGTCCTGGGAGCCTTTGTAGAGGGC 720 
FQVADEAEKYMLVLGAFVEG 

AATGCAGGTGATTCCCTGACGTCCCACAACAACAGCCTGTTCACCACCAAAGACCAGGAC 780 
NAGDSLTSHNNSLFTTKDQD 

AACGACCAGTACGCCTCAAATTGTGCAGTGCTGTACCAGGGAGCCTGGTGGTACAACAGC 840 
ND QYASNCAVLYQGAWWYNS 

TGTCACGTGTCCAACCTGAACGGCCGCTACCTCGGGGGCTCGCACGGGAGCTTTGCAAAC 900 
CHVSNLNGRYLGGSHGSFAN 

GGCGTCAACTGGAGTTCGGGGAAAGGGTACAACTAC^GCTACAAGGTGTC<5GAGATGAAG 960 
GVNWS SGKGYNYSYKVSEMK 

TTTCGGGCCACCTAGGGCGGGACAGTGCTTCCAGAACCCTCCCTGGGGAGGGGCCAGGGG 1020 
F R A T 

GCTCCCGCTCACTATCOGCCCGGGTGTGAAGGGCCACATCCCAACG<:TGGGGGGC«3CCA 1080 
TGCCCTCTGCACCTCCACCAGCTTCCAATCTTCTGTCCCTCTCAGGAGGACAAGAGT<3AC 1140 
CGTTACTCCAGCAACATGTATTCTCAATAAAGACACTTGCTTACCCAAAAAAAAAA 1196 

SUBSTITUTE SHEET 



INTERNATIONAL SEARCH REPORT 



International application No. 
PCT/US92/05199 



I A. CLASSIFICATION OF SUBJECT MATTER 

IPC(5) :A61K 37/02; C07K 3/02, 15/06. 15/28; C12N 15/00; G01N 33/567 

USCL :Pleasc See Extra Sheet. 
According to International Patent Classification (IPC) or to both national classif ication and IPC 
| B. FIELDS SEARCHED " ~ 



Minimum documentation searched (classification system followed by classification symbols) 
U.S. : 436/503, 504; 514/12. 21; 530/324, 327, 328. 331. 350. 351, 395, 388.2, 389.1; 935/4, 11, 70 



Documentation searched other than minimum documentation to the extent that such documents arc included in the fields searched 



Electronic data base consulted during the international search (name of data base and. where practicable, search terms used) 
APS, DIALOG, 

search terms; TGF, beta, receptor, membrane 



C DOCUMENTS CONSIDERED TO BE RELEVANT 



Category 9 



Citation of document, with indication, where appropriate, of the relevant passages 



Relevant to claim No. 



I* 
Y 



I* 
Y 



J. Darnell et al. "Molecular Cell Biology", published 1986 by Scientific American Books, 
Inc. (NY), pages 221 . 222, 260-262. Sec entire document. 

Nature, Vol. 256, issued 07 August 1975, G. Kohlcr et al. "Continuous Cultures Of Fused 
Cells Secreting Antibody Of Predefined Specificity", pages 495-497. especially pages 495 
column 1, and page 497, column 1. 

TheJournal Of Biological Chemistry, Volume 261, No. 1, issued 25 July 1986, S. Cheifetz 
et al., "Cellular Distribution Of Type I and Type n Receptors For Transforming Growth 
Factor-^", pages 9972-9978., especially the Ahstrnrt 

Ceil, Vol. 48. issued 13 February 1987, S. Cheifetz et al., "The Transforming Growth 
Factor-0 System. A Complex Pattern Of Cross-Reactive Ligands And Receptors*, pages 
409-415, especially the Abstract and Figure 5 . 



1-8 



19-23 



10 

1-8,13, 18-20,22 



10 

1-8, 13, 18-20, 22 



[ [x) Further documents are listed in the continuation of Box C. Q See patent family 



annex. 



Special categories of cited documents: 

"A* document defining the general slate of the an which is not considered 

to be part of particular relevance 

'E' earlier document published on or after the international filing dote 

•L* document which may throw doubu on priority clnim(s) or which is 

cited to establish the publication date of another citation or other 
special reason (as specified) 

document referring to an oral disclosure, use. exhibition or other 

document published prior to the international filing date but later than 
the priority date claimed 



bier document published after the international filing date or priority 
date and not m conflict with the application but cited to understand the 
principle or theory underlying the invention 

document of particular relevance; the claimed invention cannot be 
considered novel or cannot be considered to involve an inventive step 
when the document is taken alone 

document of particular relevance; the claimed invention cannot be 
considered to involve an inventive step when the document is 
combined with one or more other such documents, auch combination 
being obvious to a person skilled in the art 



of the s 



family 




I Date of the actual completion of the international search 
01 September 1992 



Date of mailing of the international search report 

14 SEP IBS/ 



| Name and mailing address of the ISA/ 
Commiuioncr of Patents and Trademarks 
Box PCT 

Wiihington, D.C. 20231 
I Facsimile No. NOT APPLICABLE 



Authorized officer 

JEFFREY E. RUSSEL 



Telephone No. (703) 308-0196 



Form PCT/ISA/210 (second sheet)(July 1992)* 



INTERNATIONAL SEARCH REPORT 



..lernational application No. 
PCT/US92/05199 



C (Continuation). DOCUMENTS CONSIDERED TO BE RELEVANT 



Category* 



Citation of document, with indication, where appropriate, of the relevant passages 



Relevant to claim No. 



The Journal Of Biological Chemistry, Vol. 260, No. 5. issued 10 March 1985, J. 
Massague et al. f "Cellular Receptors For Type 0 Transforming Growth Factor", pages 
2636*2645, especially the Abstract. 

Nature, Vol. 338, No. 6211, issued 09 March 1989. K. Miyazono et al., "Role For 
Carbohydrate Structures In TGF-01 f atency", pages 158-160, especially page ,158, 
column I* 



JP, A, 63-150300 (Toa Nenryo Kogyo KK) 22 June 1988, see the Abstract. 



The Journal Of Biological Chemistry, Vol. 263, No. 16, issued 05 June 1988, L. 
Wakefield et al., "Latent Transforming Growth Factor-0 From Human Platelets", pages 
7646*7654, especially the Abstract 

Cell, Vol. 61, issued 15 June 1990. T. Kanzaki et al., "TGF-01 Binding Protein: A 
Component Of The Large Latent Complex Of TGF-01 With Multiple Repeat 
Sequences", pages 1051-1061, especially the Summary, pages 1053, column 2, last 
paragraph, and Figure 4 



10 

1-8, 13, 18-20. 22 



1^9 

4-8, 12, 18-21 



1-8, 12, 18-21 
10 

1-8, 13, 18-20, ! 



1-3-7. 8.11 



4-6, 14, 18-20, 23 



Form PCT/ISA/210 (continuation of second sheet)(July 1992)* 



INTERNATIONAL SEARCH REPORT 



International application No. 
PCT/US92/05199 



A. CLASSIFICATION OF SUBJECT MATTER: 
USCL : 



436/503, 504; 514/12, 21; 530/324, 327, 328, 331, 350, 388.2. 389.1; 935/4, 11, 70 



Form PCT/ISA/210 (extra shcetXJuly 1992)* 



This Page is Inserted by IFW Indexing and Scanning 
Operations and is not part of the Official Record 

BEST AVAILABLE IMAGES 

Defective images within this document are accurate representations of the original 
documents submitted by the applicant. 

Defects in the images include but are not limited to the items checked: 

□ BLACK BORDERS 

□ IMAGE CUT OFF AT TOP, BOTTOM OR SIDES 
□TfaDED TEXT OR DRAWING 

BLURRED OR ILLEGIBLE TEXT OR DRAWING 

□ SKEWED/SLANTED IMAGES 

□ COLOR OR BLACK AND WHITE PHOTOGRAPHS 

□ GRAY SCALE DOCUMENTS 

□ LINES OR MARKS ON ORIGINAL DOCUMENT 

□ REFERENCE(S) OR EXHIBIT(S) SUBMITTED ARE POOR QUALITY 

□ OTHER: . 

IMAGES ARE BEST AVAILABLE COPY. 
As rescanning these documents will not correct the image 
problems checked, please do not report these problems to 
the IFW Image Problem Mailbox.