Skip to main content

Full text of "USPTO Patents Application 09804625"

See other formats


WORLD INTELLECTUAL PROPERTY ORGANIZATION 
International Bureau 




per 

INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) 



(51) International Patent Classification 5 

O07K 15/06, C12N 15/12 
A61K 37/02 



Al 



(11) International Publication Number: 
(43) International Publication Date: 



WO 92/05199 

2 April 1992 (02.04.92) 



(21) International Application Number: PCT/US9 1/07069 

(22) International Filing Date: 26 September 1991 (26.09.91) 



(30) Priority data: 

588,227 



26 September 1990 (26.09.90) US 



(71) Applicant: GENETICS INSTITUTE, INC. IUS/US]; 87 

CambridgePark Drive, Cambridge, MA 02140 (US). 

(72) Inventors: WOZNEY, John, M. ; 59 Old Bolton Road, 

Hudson, MA 01749 (US). ROSEN, Vicki, A. ; 127 Kil- 
syth Road, Brookline, MA 02146 (US). WANG, Eliza- 
beth, A. ; 136 Wolf Rock Road, Carlisle, MA 01741 
(US). CELESTE, Anthony, J. ; 86 Packard Street, Hud- 
son, MA 01479 (US). 



(74) Agents: KAPINOS, Ellen, J. et al.; Genetics Institute, Inc., 
87 CambridgePark Drive, Cambridge, MA 02140 (US). 



(81) Designated States: AT (European patent), BE (European 
patent), CA, CH (European patent), DE (European pa- 
tent), DK (European patent), ES (European patent), FR 
(European patent), GB (European patent), GR (Euro- 
pean patent), IT (European patent), JP, LU (European 
patent), NL (European patent), SE (European patent). 



Published 

With international search report. 
Before the expiration of the time limit for amending the 
claims and to be republished in the event of the receipt of 
amendments. 



(54) Title: BMP-5 DERIVATIVES 



(57) Abstract 

Purified BMP-5 protein derivatives comprising parts of human BMP-5 protein and processes for producing them are dis- 
closed. The proteins may be used in the treatment of bone and/or cartilage defects and in wound healing and related tissue re- 
pair. 



FOR THE PURPOSES OF INFORMATION ONLY 



Codes used to identify Stales party to the PCT on the front pages of pamphlets publishing international 
applications under the PCT. 



AT 


Austria 


BS 


Spain 


MC 


Madagascar 


AU 


Australia 


Fl 


Finland 


ML 


Mali 


BB 


Barbados 


PR 


France 


MN 


Mongolia 


BE 


Belgium 


CA 


Canon 


MR 


Mauritania 


BP 


Burkina Faso 


GB 


United Kingdom 


MW 


Malawi 


BC 


Bulgaria 


CN 


Guinea 


NL 


Netherlands 


BJ 


Benin 


CR 


Greece 


NO 


Norway 


BR 


Brazil 


HU 


Hungary 


PL 


Poland 


CA 


(Canada 


IT 


Italy 


RO 


Romania 


CP 


Central African Republic 


JP 


Japan 


SO 


Sudan 


CC 


Congo 


KP 


Democratic People's Republic 


SE 


Sweden 


CH 


Switzerland 




of Korea 


SN 


Senegal 


CI 


Cote d'Uoiic — 


KR 


Republic of Korea 


SU+ 


Soviet Union 


CM 


Cameroon 


LI 


Liechtenstein 


TO 


Chad 


CS 


Czechoslovakia 


LK 


Sri Lanka 


TG 


Togo 


DC* 


Germany 


LU 


Luxembourg 


US 


United States of America 


DK 


Denmark 


MC 


Monaco 







+ Any designation of "SU" has effect in the Russian Federation. It is not yet known whether 
any such designation has effect in other States of the former Soviet Union. 



WO 92/05199 



PCT/US91/07069 



1 

BMP-5 DERIVATIVES 



The present invention relates to a family of purified 
proteins, termed BMP-5 proteins (wherein BMP is bone morphogenic 
protein) , which exhibit the ability to induce cartilage and/or bone 
formation and processes for obtaining them. These proteins may be 
used to induce bone and/ or cartilage formation and in wound healing 
and tissue repair. 

The invention provides human BMP-5 proteins, substantially 
free from other proteins with which they are co-produced, 
comprising the amino acid sequence set forth in Table III from 
amino acid # 323 (Asn, Gin, Asn) to amino acid #454 (ending with 
Gly, Cys, His) . This amino acid sequence #323 to #454 is encoded 
by the DNA sequence of Table III from nucleotide # 1665 to 
nucleotide # 2060. The mature BMP-5 dimer may be further 
characterized by an apparent molecular weight of approximately 
28,000-38,000 daltons as determined by sodium dodecyl sulfate 
polyacrylamide gel electrophoresis (SDS-PAGE) . Under reducing 
conditions in SDS-PAGE the mature subunit electrophoreses with a 
molecular weight of approximately 18,000 - 22,000 daltons. These 
proteins are capable of stimulating, promoting, or otherwise 
inducing cartilage and/ or bone formation. 

The invention further provides bovine BMP-5 proteins 
comprising the amino acid sequence set forth in Table I from #9 to 
amino acid #140. The amino acid sequence from #9 to #140 is 
encoded by the DNA sequence from nucleotide # 32 to #427 of Table 
I. These proteins may be further characterized by an apparent 
molecular weight of 28,000 - 30,000 daltons as determined by sodium 
dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) . 
Under reducing conditions in SDS-PAGE the protein electrophoreses 
with a molecular weight of approximately 14,000-20,000 daltons. It 
is contemplated that these proteins are capable of inducing 
cartilage and/or bone formation. 



WO 92/05199 



PCT/US91/07069 



2. 

Human BMP-5 proteins of the invention may be produced by 
culturing a cell transformed with a DNA sequence containing the 
nucleotide sequence the same or substantially the same as the 
nucleotide sequence shown in Table III comprising nucleotide # 699 
to nucleotide # 2060. BMP-5 proteins comprising the amino acid 
sequence the same or substantailly the same as shown in Table III 
from amino acid #323 to #454 are recovered isolated and purified 
from the culture media. 

Bovine proteins of the invention may be produced by culturing 
a cell transformed with a DNA sequence containing the nucleotide 
sequence the same or substantially the same as that shown in Table 
I comprising nucleotide #8 through nucleotide #427 and recovering 
and purifying from the culture medium a protein containing the 
amino acid sequence or a portion thereof as shown in Table I 
comprising amino acid #9 to amino acid #140. 

The invention further provides a method wherein the proteins 
described above are utilized for obtaining related human protein/s 
or other mammalian cartilage and/or bone growth protein/s. Such 
methods are known to those skilled in the art of genetic 
engineering. One method for obtaining such proteins involves 
utilizing the human BMP-5 coding sequence or portions thereof from 
nucleotide # 699 - # 2060 as a probe for screening human genomic 
and/or cDNA libraries to isolate the human genomic and/or cDNA 
sequence. Additional methods known in the art may employ the 
bovine and human BMP-5 proteins of the invention to obtain other 
mammalian BMP-5 cartilage and/or bone formation proteins. 

Having identified the nucleotide sequences the proteins are 
produced by culturing a cell transformed with the DNA identified in 
the method described above which DNA hybridizes under stringent 
conditions to the bovine BMP-5 nucleotide sequence substantially as 
shown in Table I or the human BMP-5 nucleotide sequence 
substantially as shown in Table III and which encodes a protein 
exhibiting cartilage and/or bone formation activity. The expressed 
proteins are recovered and purified from the culture media. The 
purified BMP-5 proteins are substantially free from other 



WO 92/05199 



PCT/US91/07069 



3 

proteinaceous materials with which they are co-produced, as well as 
from other contaminants. The BMP-5 proteins of the invention 

are characterized by the ability to promote, stimulate or otherwise 
induce the formation of cartilage and/or bone. It is further 
contemplated that the ability of these proteins to induce the 
formation of cartilage and/or bone may be exhibited by the ability 
to demonstrate cartilage and/or bone formation activity in the rat 
bone formation assay described below. It is further contemplated 
that the proteins of the invention may demonstrate activity in this 
rat bone formation assay at a concentration of 10/ig - SOO^g/gram of 
bone. More particularly, it is contemplated these proteins may be 
characterized by the ability of Ipg of the protein to score at 
least +2 in the rat bone formation assay described below using 
either the original or modified scoring method. 

Another aspect of the invention provides pharmaceutical 
compositions containing a therapeutically effective amount of a 
BMP-5 protein of the invention in a pharmaceutically acceptable 
vehicle or carrier. The compositions of the invention may be used 
to induce bone and/ or cartilage formation. These compositions may 
also be used for wound healing and tissue repair. Further 
compositions of the invention may include in addition to a BMP-5 
protein of the present invention at least one other therapeutically 
useful agent such as the proteins designated BMP-1, BMP-2A and -2B, 
BMP-3, BMP-6, and BMP-7 disclosed respectively in co-owned U.S. 
patent applications Serial No. 179,101, Serial No. 179,100, and 
Serial No. 179,197, Serial No. 370,544, and Serial No. 370,549. 
These proteins may act in concert with or perhaps synergistically 
with one another. Other therapeutically useful agents may include 
growth factors such as epidermal growth factor (EGF) , fibroblast 
growth factor (FGF) , transforming growth factors (TGF-a and TGF-0) , 
and platelet derived growth factor (PDGF) . 

The compositions of the invention may also include an 
appropriate matrix, for instance, for delivery and/or support of 
the composition and/or providing a surface for bone and/or 
cartilage formation. The matrix may provide slow release of the 



WO 92/05199 



PCT/US91/07069 



4 

BMP-5 proteins and/or the appropriate environment for presentation 
of the BMP-5 proteins of the invention. 

The compositions may be employed in methods for treating a 
number of bone and/or cartilage defects, and periodontal disease. 
They may also be employed in methods for treating various types of 
wounds and in tissue repair. These methods, according to the 
invention, entail administering to a patient needing such bone 
and/or cartilage formation, wound healing or tissue repair, a 
therapeutically effective amount of a protein of the invention. 
These methods may also entail the administration of a protein of 
the invention in conjunction with at least one of the "BMP" 
proteins disclosed in the co-owned applications described above. 
In addition, these methods may also include the administration of 
a protein of the invention with other growth factors including EGF, 
FGF, TGF-a, TGF-0, and PDGF. 

Still a further aspect of the invention are DNA sequences 
coding for expression of a protein of the invention. Such 
sequences include the sequence of nucleotides in a 5 1 to 3' 
direction illustrated in Table I or Table III or DNA sequences 
which hybridize under stringent conditions with the DNA sequence of 
Table I or Table III and encode a protein demonstrating ability to 
indube cartilage and/or bone formation as in the rat bone formation 
assay described below. It is contemplated that these proteins may 
demonstrate activity in this assay at a concentration of lo^g - 
500/ig/gram of bone. More particularly, it is contemplated that 
these proteins demonstrate the ability of l^g of the protein to 
score at least +2 in the rat bone formation assay using either the 
original or modified scoring method. Finally, allelic or other 
variations of the sequences of Table I and III whether such 
nucleotide changes result in changes in the peptide sequence or 
not, are also included in the present invention. 

A further aspect of the invention provides a vector containing 
a DNA sequence as described above in operative association with an 
expression control sequence therefor. These vectors may be 
employed in a novel process for producing a protein of the 



WO 92/05199 



PCI7US91/07069 



5 

invention in which a cell line transformed with a DNA sequence 
directing expression of a protein of the invention in operative 
association with an expression control sequence therefor, is 
cultured in a suitable culture medium and a protein of the 
invention is recovered and purified therefrom. This claimed 
process may employ a number of known cells, both prokaryotic and 
eukaryotic, as host cells for expression of the polypeptide. The 
recovered BMP protiens are purified by isolating them from other 
proteinaceous materials with which they are co-produced as well as 
from other contaminants. 

Other aspects and advantages of the present invention will be 
apparent upon consideration of the following detailed description 
and preferred embodiments thereof. 

Detailed Description of the Invention 

Purified human BMP-5 proteins are produced by culturung a host 
cell transformed with the DNA sequence of Table III. The expressed 
BMP-5 proteins are isolated and purified from the culture media. 
The purified human BMP-5 proteins are characterized by comprising 
an amino acid sequence as shown in Table III from amino acid #323 
to #454. These purified BMP-5 human cartilage/bone proteins of the 
present invention may be produced by culturing a host cell 
transformed with a DNA sequence comprising the DNA sequence as 
shown in Table III from nucleotide # 699 to nucleotide # 2060 or 
substantially homologous sequences operatively linked to a 
heterologous regulatory control sequence and recovering and 
purifying from the culture medium a protein comprising the amino 
acid sequence as shown in Table u III from amino acid # 323 to amino 
acid # 454 or a substantially homologous sequence. 

In further embodiments the DNA sequence comprises the 
nucleotides encoding amino acids #323-#454 of Table III. BMP-5 
proteins may therefore be produced by culturing a host cell 
transformed with a DNA sequence comprising the DNA sequence as 
shown in Table III from nucleotide # 1665 to nucleotide # 2060 or 
substantially homologous sequences operatively linked to a 



WO 92/05199 



PCT/US91/07069 



6 

heterologous regulatory control sequence and recovering and 
purifying from the culture medium a protein comprising the amino 
acid sequence as shown in Table III from amino acid # 323 to amino 
acid # 454 or a substantially homologous sequence. The purified 
human BMP-5 proteins are substantially free from other 
proteinaceous materials with which they are co-produced , as well as 
from other contaminants . 

Purified BMP-5 bovine cartilage/bone proteins of the present 
invention are produced by culturing a host cell transformed with a 
DNA sequence comprising the DNA sequence as shown in Table I from 
nucleotide # 8 to nucleotide # 578 or substantially homologous 
sequences and recovering and purifying from the culture medium a 
protein comprising the amino acid sequence as shown in Table I from 
amino acid # 9 to amino acid # 140 or a substantially homologous 
sequence. The purified BMP-5 bovine proteins of the invention are 
substantially free from other proteinaceous materials with which 
they are co-produced, as well as from other contaminants. 

BMP-5 proteins are further characterized by the ability to 
demonstrate cartilage and/or bone formation activity. This 
activity may be demonstrated, for example, in the rat bone 
formation assay as described in Example III. it is further 
contemplated that these proteins demonstrate activity in the assay 
at a concentration of 10/*g - SOO^g/gram of bone formed. The 
proteins may be further characterized by the ability of l/*g to 
score at least +2 in this assay using either the original or 
modified scoring method described below. 

The mature BMP-5 dimer may be further characterized by an 
apparent molecular weight of approximately 28,000-38,000 daltons as 
determined by sodium dodecyl sulfate polyacrylamide gel 
electrophoresis (SDS-PAGE) . Under reducing conditions in SDS-PA<3E 
the mature sub-unit electrophoreses with a molecular weight of 
approximately 18,000 - 22,000 daltons. 

The proteins provided herein also include factors encoded by 
the sequences similar to those of Table I and Table III but into 
which modifications are naturally provided (e.g. allelic variations 



WO 92/05199 



PCT/US91/07069 



7 

in the nucleotide sequence which may result in amino acid changes 
in the polypeptide) or deliberately engineered. Similarly, 
synthetic polypeptides which wholly or partially duplicate 
continuous sequences of the amino acid residues of Table I or Table 
III are encompassed by the invention. These sequences, by virtue 
of sharing primary, secondary, or tertiary structural and 
conformational characteristics with other cartilage/bone proteins 
of the invention may possess bone and/or cartilage growth factor 
biological properties in common therewith. Thus, they may be 
employed as biologically active substitutes for naturally-occurring 
proteins in therapeutic processes. 

Other specific mutations of the sequences of the proteins of 
the invention described herein may involve modifications of a 
glycosylation site. These modification may involve O-linked or N- 
linked glycosylation sites. For instance, the absence of 
glycosylation or only partial glycosylation at asparagine-linked 
glycosylation sites results from amino acid substitution or 
deletion at any asparagine-linked glycosylation recognition site 
present in the sequences of the proteins of the invention, for 
example, as shown in Table I or Table III. The asparagine-linked 
glycosylation recognition sites comprise tripeptide sequences which 
are specifically recognized by appropriate cellular glycosylation 
enzymes. These tripeptide sequences are either asparagine-X- 
threonine or asparagine-X-serine, where X is usually any amino 
acid. A variety of amino acid substitutions or deletions at one or 
both of the first or third amino acid positions of a glycosylation 
recognition site (and/or amino acid deletion at the second 
position) results in non-glycosylation at the modified tripeptide 
sequence. Expression of such altered nucleotide sequences produces 
variants which are not glycosylated at that site. 

The present invention also encompasses the novel DNA 
sequences, free of association with DNA sequences encoding other 
proteinaceous materials, and coding on expression for the proteins 
of the invention. These DNA sequences include those depicted in 
Tables I and III in a 5 1 to 3 » direction. Further included are 



WO 92/05199 



PCT/US91/07069 



those sequences which hybridize under stringent hybridization 
conditions [see, T. Maniatis et al, Molecule n^-,- ng , a Tj ,w.«.,~. 
ManuaU, cold Spring Harbor Laboratory (1982) , pages 387 to 389] to 
the DNA sequence of Table 1 or Table in and demonstrate cartilage 
and/or bone formation activity in the rat bone formation assay. An 
example of one such stringent hybridization condition is 
hybridization at 4 x SSC at 65°c, followed by a washing in o.i x 

hvL^- "I. 0 hOUr ' « exemplary stringent 

hybridization condition is in 50% formamide, 4 x SCC at 42°C 

Similarly, DNA sequences which encode proteins similar to the 
protein encoded by the sequence of Table I or Table III, but which 
differ in codon sequence due to the degeneracies of the genetic 
code or allelic variations (naturally-occurring base changes in the 
species population which may or may not result in an amino acid 
change) also encode the proteins of the invention described 
herein. Variations in the DNA sequences of Table 1 and Table Hi 
which are caused by point mutations or by induced modifications 

a^t 1115 ^??/ 011 ' deleti ° n ' ^ to enhance the 

activity, half-life or production of the polypeptides encoded 

thereby are also encompassed in the invention. 

in a further aspect, the invention provides a method for 

obtaining related human proteins or other mammalian BMP-s proteins 
one method for obtaining such proteins entails, for instance,' 
utilizing the human BMP-5 coding sequence disclosed herein to probe 
a human genomic library using standard techniques for the human 
gene or fragments thereof. Sequences thus identified may also be 
used as probes to identify a human cell ii„ e or tissue which 
synthesizes the analogous carti-lage/bone protein. A cDNA library 
is synthesized and screened with probes derived from the human or 
bovine coding sequences. The human sequence thus identified is 
transformed into a host cell, the host cell is cultured and the 
protein recovered, isolated and purified from the culture medium. 
The purified protein is predicted to exhibit cartilage and/or bone 
formation activity in the rat bone formation assay of Example III 
Another aspect of the present invention provides a novel 



WO 92/05199 



PCT/US91/07069 



9 

method for producing the proteins of the invention. The method of 
the present invention involves culturing a suitable cell line, 
which has been transformed with a DNA sequence coding for 
expression of a protein of the invention, under the control of 
known regulatory sequences. Regulatory sequences include promoter 
fragments, terminator fragments and other suitable sequences which 
direct the expression of the protein in an appropriate host cell. 
Methods for culturing suitable cell lines are within the skill of 
the art. The transformed cells are cultured and the BMP-5 proteins 
expressed thereby are recovered and purified from the culture 
medium using purification techniques known to those skilled in the 
art. The purified BMP-5 proteins are substantially free from other 
proteinaceous materials with which they are co-produced, as well as 
other contaminants. Purified BMP-5 proteins are substantially free 
from materials with which the proteins of the invention exist in 
nature . 

Suitable cells or cell lines may be mammalian cells, such as 
Chinese hamster ovary cells (CHO) . The selection of suitable 
mammalian host cells and methods for transformation, culture, 
amplification, screening and product production and purification 
are known in the art. See, e.g., Gething and Sambrook, Nature, 
293 ;*620-625 (1981), or alternatively, Kaufman et al, Mol. cell. 
Biol. . 5(7) : 1750-1759 (1985) or Howley et al, U.S. Patent 
4,419,446. Other suitable mammalian cell lines are the monkey 
COS-1 cell line and the CV-1 cell line. 

Bacterial cells may also be suitable hosts. For example, the 
various strains of E. coli (e.g., HB101, MC1061) are well-known as 
host cells in the field of biotechnology. Various strains of 
B. subtil is . Pseudomonas . other bacilli and the like may also be 
employed in this method. 

Many strains of yeast cells known to those skilled in the art 
may also be available as host cells for expression of the 
polypeptides of the present invention. Additionally, where 
desired, insect cells may be utilized as host cells in the method 
of the present invention. See, e.g. Miller et al, Genetic 



WO 92/05199 



PCT/US91/07069 



10 

gngj.neer4.ng, £: 277-298 (Plenum Press 1986) and references cited 
therein. 

Another aspect of the present invention provides vectors for 
use in the method of expression of the proteins of the invention. 
The vectors contain the novel DNA sequences described above which 
code for the novel cartilage/bone proteins of the invention. 
Additionally the vectors also contain appropriate expression 
control sequences permitting expression of the protein sequences. 
Alternatively, vectors incorporating truncated or modified 
sequences as described above are also embodiments of the present 
invention and useful in the production of the proteins of the 
invention. The vectors may be employed in the method of 
transforming cell lines and contain selected regulatory sequences 
in operative association with the DNA coding sequences of the 
invention which are capable of directing the replication and 
expression thereof in selected host cells. Useful regulatory 
sequences for such vectors are known to those skilled in the art 
and may be selected depending upon the selected host cells. Such 
selection is routine and does not form part of the present 
invention. Host cells transformed with such vectors and progeny 
thereof for use in producing cartilage/bone . proteins are also 
provided by the invention. 

One skilled in the art can construct mammalian expression 
vectors by employing the DNA sequences of the invention and known 
vectors, such as pCD [Okayama et al., Mol. Cell Biol. . 2:161-1-70 
(1982) ] and pJL3, pJL4 [Gough et al., EMBO J. r 4:645-653 (1985)]. 

Similarly, one skilled in the art could manipulate the 
sequences of the invention *by eliminating or replacing the 
mammalian regulatory sequences flanking the coding sequence with 
bacterial sequences to create bacterial vectors for intracellular 
or extracellular expression by bacterial cells. For example, the 
coding sequences could be further manipulated (e.g. ligated to 
other known linkers or modified by deleting non-coding sequences 
there-from or altering nucleotides therein by other known 
techniques) . The modified coding sequence could then be inserted 



WO 92/05199 



PCI7US91/07069 



11 

into a known bacterial vector using procedures such as described in 
T. Taniguchi et al., *»™"- w»tl Acad. Sci. USA, 77:5230-5233 
(1980) . This exemplary bacterial vector could then be transformed 
into bacterial host cells and a protein of the invention expressed 
thereby. For a strategy for producing extracellular expression of 
a cartilage and/or bone protein of the invention in bacterial 
cells., see, e.g. European patent application EPA 177,343. 

Similar manipulations can be performed for the construction of 
an insect vector [See, e.g. procedures described in published 
European patent application 155,476] for expression in insect 
cells. A yeast vector could also be constructed employing yeast 
regulatory sequences for intracellular or extracellular expression 
of the factors of the present invention by yeast cells. [See, 
e.g., procedures described in published PCT application W08 6/0063 9 
and European patent application EPA 123,289]. 

A method for producing high levels of a protein of the 
invention from mammalian cells involves the construction of cells 
containing multiple copies of the heterologous gene encoding 
proteins of the invention. The heterologous gene may be linked to 
an amplifiable marker, e.g. the dihydrofolate reductase (DHFR) gene 
for which cells containing increased gene copies can be selected 
for propagation in increasing concentrations of methotrexate (MTX) 
according to the procedures of Kaufman and Sharp, J. Ko\. Biol. , 
159:601-629 (1982) . This approach can be employed with a number of 
different cell types. 

For instance, a plasmid containing a DNA sequence for a 
protein of the invention in operative association with other 
plasmid sequences enabling expression thereof and the DHFR 
expression plasmid pAdA26SV(A)3 [Kaufman and Sharp, Mol. Cell, 
B j ol 2:1304 (1982)] may be co-introduced into DHFR-deficient CH0 
cells, DUKX-BII, by calcium phosphate coprecipitation and 
transfection, electroperation or protoplast fusion. -DHFR 
expressing transformants are selected for growth in alpha media 
with dialyzed fetal calf serum, and subsequently selected for 
amplification by growth in increasing concentrations of MTX 



WO 92/05199 



PCT/US91/07069 



12 

(sequential steps in 0.02, 0.2, 1.0 and 5uM MTX) as described in 
Kaufman et al., Mol Cell Biol. . 5:1750 (1983). Protein expression 
should increase with increasing levels of MTX resistance. 
Transformants are cloned, and the proteins of the invention are 
recovered, isolated, and purified from the culture medium. 
Characterization of expressed proteins may be carried out using 
stnadard techniques. For instance, characterization may include 
pulse labeling with [35 s ] methionine or cysteine, or polyacrylamide 
gel electrphoresis. Biologically active protein expression is 
monitored by the Rosen-modified Sampath - Reddi rat bone formation 
assay described above in Example III. Similar procedures can be 
followed to produce other related proteins. 

A protein of the present invention, which induces cartilage 
and/or bone formation in circumstances where bone and/or cartilage 
is not normally formed, has application in the healing of bone 
fractures and cartilage defects in humans and other animals. Such 
a preparation employing a protein of the invention may have 
prophylactic use in closed as well as open fracture reduction and 
also in the improved fixation of artificial joints. De novo bone 
formation induced by an osteogenic agent contributes to the repair 
of congenital, trauma induced, or oncologic resection induced 
craniofacial defects, and also is useful in cosmetic plastic 
surgery. A protein of the invention may be used in the treatment 
of periodontal disease, and in other tooth repair processes. Such 
agents may provide an environment to artract bone-forming cells, 
stimulate growth of bone-forming cells or induce differentiation of 
progenitors of bone-forming cells. A variety of osteogenic, 
cartilage- inducing and bone inducing factors have been described. 
See, e.g. European patent applications 148,155 and 169,016 for 
discussions thereof. 

The proteins of the invention may also be used in wound 
healing and related tissue repair. The types of wounds include, 
but are not limited to burns, incisions and ulcers. (See, e.g. PCT 
Publication WO84/01106 for discussion of wound healing and related 
tissue repair) . 



WO 92/05199 



PCT/US91/07069 



13 

A further aspect of the invention includes a therapeutic 
method and composition for repairing fractures and other conditions 
related to bone and/ or cartilage defects or periodontal diseases. 
In addition, the invention comprises therapeutic methods and 
compositions for wound healing and tissue repair. Such 
compositions comprise a therapeutically effective amount of at 
least one of the BMP-5 proteins of the invention in admixture with 
a pharmaceutically acceptable vehicle, carrier or matrix. 

It is expected that the proteins of the invention may act in 
concert with or perhaps synergistically with one another or with 
other related proteins and growth factors. Therapeutic methods and 
compositions of the invention therefore comprise one or more of the 
proteins of the present invention. Further therapeutic methods and 
compositions of the invention therefore comprise a therapeutic 
amount of at least one protein of the invention with a therapeutic 
amount of at least one of the other "BMP" proteins , BMP-1, BMP-2 
(BMP-2A, BMP-2 Class I), BMP-3, BMP-4 (BMP-2B, BMP-2 Class II), BMP- 
6, and BMP-7 disclosed in co-owned and co-pending U.S. applications 
described above. Such methods and compositions of the invention 
may comprise proteins of the invention or portions thereof in 
combination with the above-mentioned "BMP" proteins or portions 
thereof. Such combination may comprise individual separate 
molecules from each of the proteins or heteromolecules such as 
heterodimers formed by portions of the respective proteins. For 
example, a method and composition of the invention may comprise a 
protein of the invention or a portion thereof linked with a portion 
of a "BMP" protein to form a heteromolecule. 

Further therapeutic methods and compositions of the invention 
comprise the proteins of the invention or portions, thereof in 
combination with other agents beneficial to the treatment of the 
bone and/or cartilage defect, wound, or tissue in question. These 
agents include various growth factors such as epidermal growth 
factor (EGF) , fibroblast growth factor (FGF) , platelet derived 
growth factor (PDGF) , transforming growth factors (TGF-a and TGF- 
p) , k-f ibroblast growth factor (kFGF) , parathyroid hormone (PTH) , 



WO 92/05199 



PCT/US91/07069 



leukemia inhibitory factor (LIF/HILDA DIA) and insulin-like growth 
factors (IGF-I and IGF-II) . Portions of these agents may also be 
used in compositions of the invention. 

The preparation and formulation of such physiologically 
acceptable protein compositions, having due regard to pH, 
isotonicity, stability and the like, is within the skill of the 
art. The therapeutic compositions are also presently valuable for 
veterinary applications due to the apparent lack of species 
specificity in cartilage and bone growth factor proteins. Domestic 
animals and thoroughbred horses in addition to humans are desired 
patients for such treatment with the proteins of the present 
invention. 

The therapeutic method includes administering the composition 
topically, systematically, or locally as an implant or device. 
When administered, the therapeutic composition for use in this 
invention is, of course, in a pyrogen- free, physiologically 
acceptable form. Further, the composition may desirably be 
encapsulated or injected in a viscous form for delivery to the site 
of cartilage and/or bone or tissue damage. Topical administration 
may be suitable for wound healing and tissue repair. Preferably 
for bone and/or cartilage formation, the composition would include 
a matrix capable of delivering the cartilage/bone proteins of the 
invention to the site of bone and/ or cartilage damage, providing a 
structure for the developing bone and cartilage and optimally 
capable of being resorbed into the body. The matrix may provide 
slow release of the BMP proteins or other factors comprising the 
composition. Such matrices may be formed of materials presently in 
use for other implanted medical* applications. 

The choice of matrix material is based on biocompatibility, 
biodegradability, mechanical properties, cosmetic appearance and 
interface properties. The particular application of the 
compositions of the invention will define the appropriate 
formulation. Potential matrices for the compositions may be 
biodegradable and chemically defined calcium sulfate, 
tricalciumphosphate, hydroxyapatite, polylactic acid and 



WO 92/05199 



PCT/US91/07069 



15 



polyanhydrides. Other potential materials are biodegradable and 
biologically well defined, such as bone or dermal collagen. 
Further matrices are comprised of pure proteins or extracellular 
matrix components. Other potential matrices are nonbiodegradable 
5 and chemically defined, such as sintered hydroxyapatite , bioglass, 

aluminates, or other ceramics. Matrices may be comprised of 
combinations of any of the above mentioned types of material, such 
as polylactic acid and hydroxyapatite or collagen and 
tricalciumphosphate. The bioceramics may be altered in 

10 composition, such as in calcium-aluminate-phosphate and processing 

to alter pore size, particle size, particle shape, and 

biodegradability. 

The dosage regimen will be determined by the attending 
physician considering various factors which modify the action of 

15 the proteins of the invention. Factors which may modify the action 

of the proteins of the invention include the amount of bone weight 
desired to be formed, the site of bone damage, the condition of the 
damaged bone, the size of a wound, type of damaged tissue, the 
patient's age, sex, and diet, the severity of any infection, time 

20 of administration and other clinical factors. The dosage may vary 

with the type of matrix used in the reconstitution and the type or 
types- of bone and/or cartilage proteins present in the composition. 
The addition of other known growth factors, such as EGF, PDGF, TGF- 
a, TGF-/J , and IGF-I to the final composition, may also effect the 

25 dosage. 

Progress can be monitored by periodic assessment of cartilage 
and/or bone growth and/or repair. The progress can be monitored, 
for example, using x-rays, histomorphometric determinations and 
tetracycline labeling . 
.30 The following examples illustrate practice of the present 

invention in recovering and characterizing bovine cartilage and/or 
bone proteins of the invention and employing these proteins to 
recover the corresponding human protein or proteins and 
expressing the proteins via recombinant techniques. 

35 



in 



WO 92/05199 



PCT/US91/07069 



16 

EXAMPLE I 

Isolation of B ovine Cartilage /Bone Inductive Protg-iw 

Ground bovine bone powder (20-120 mesh, Helitrex) is prepared 
according to the procedures of M. R. Urist et al., Proc. Natl 
Acad. Sci USA, 70:3511 (1973) with elimination of some extraction 
steps as identified below. Ten kgs of the ground powder is 
demineralized in successive changes of 0.6N 

HC1 at 4*1 C over a 48 hour period with vigorous stirring. The 
resulting suspension is extracted for 16 hours at S C with 50 
liters of 2M CaCl 2 and lOmM ethylenediamine-tetraacetic acid 
[EDTA] , and followed by extraction for 4 hours in 50 liters of 0.5M 
EDTA. The residue is washed three tines with distilled water 
before its resuspension in 20 liters of 4M guanidine hydrochloride 
[GuCl], 20mM Tris (pH 7.4), UnM N-ethylmaleimide, lmM 
iodoacetamide, UnM phenylmethylsulfonyl fluorine as described in 
Clin. Orthop. Rel, Res. , 171: 213 (1982) . After 16 to 20 hours the 
supernatant is removed and replaced with another 10 liters of GuCl 
buffer. The residue is extracted for another 24 hours. 

The crude GuCl extracts are combined, concentrated 
approximately 20 times on a Pellicon apparatus with a 10,000 
molecular weight cut-off membrane, and then dialyzed in 50mM Tris, 
O.lM-NaCl, 6M urea (pH7.2), the starting buffer for the first 
column. After extensive dialysis the protein is loaded on a 4 
liter DEAE cellulose column and the unbound fractions are 
collected. 

The unbound fractions are concentrated and dialyzed against 
50mM NaAc, 50mM Nacl (pH 4.6) in 6M urea. The unbound fractions, 
are applied to a carboxymethyl Cellulose column. Protein not bound 
to the column is removed by extensive washing with starting buffer, 
and the material containing protein having bone and/or cartilage 
formation activity as measured by the Rosen-modified Sampath - 
Reddi assay (described in Example III below) desorbed from the 
column by 50mM NaAc, 0.25mM NaCl, 6M urea (pH 4.6). The protein 
from this step elution is concentrated 20- to 40- fold, then 
diluted 5 times with 80mM KP0 4 , 6M urea (pH6.0). The pH of the 



WO 92/05199 



PCT/US91/07069 



17 

solution is adjusted to 6.0 with 500mM K 2 HP0 4 . The sample is 
applied to an hydroxy 1 apatite column (LKB) equilibrated in 80mM 
KP0 4 , 6M urea (pH6.0) and all unbound protein is removed by washing 
the column with the same buffer. Protein having bone and/or 
5 cartilage formation activity is eluted with lOOmM KP0 4 (pH7.4) and 

6M urea. 

The protein is concentrated approximately 10 times, and solid 
NaCl added to a final concentration of 0.15M. This material is 
applied to a heparin - Sepharose column equilibrated in 50mM KP0 4 , 

10 150mM NaCl, 6M urea (pH7.4) . After extensive washing of the column 

with starting buffer, a protein with bone and/or cartilage 
inductive activity is eluted by 50mM KP0 4 , 700mM NaCl, 6M urea 
(pH7.4). This fraction is concentrated to a minimum volume, and 
0.4ml aliguots are applied to Superose 6 and Superose 12 columns 

15 connected in series , equilibrated with 4M GuCl, 20mM 

Tris (pH7.2) and the columns developed at a flow rate of 
0.25ml/min. The protein demonstrating bone and/or cartilage 
inductive activity corresponds to an approximate 30,000 dalton 
protein. 

20 The above fractions from the superose columns are pooled, 

dialyzed against 50mM NaAc, 6M urea (pH4.6), and applied to a 
Pharmacia MonoS HR column. The column is developed with a gradient 
to 1.0M NaCl, 50mM NaAc, 6M urea (pH4.6). Active bone and/or 
cartilage formation fractions are pooled. The material is applied 

25 to a 0.46 x 25cm Vydac C4 column in 0.1% TFA and the column 

developed with a gradient to 90% acetonitrile, 0.1% TFA (31.5% 
acetonitrile, 0.1% TFA to 49.5% acetonitrile, 0.1% TFA in 60 
minutes at 1ml per minute) . Active material is eluted at 
approximately 40-44% acetonitrile. Fractions were assayed for 
; 30 cartilage and/or bone formation activity. The active material from 

the C4 reverse phase column is further fractionated on a MonoQ 
column. The protein is dialyzed against 6M urea, 25mM 
diethanolamine, pH 8.6 and then applied to a 0.5 by 5 cm MonoQ 
column (Pharmacia) which is developed with a gradient of 6M urea, 

35 ' 25mM diethanolamine, pH 8.6 and 0.5 M NaCl, 6M urea, 25mM 



WO 92/05199 



PCT/US91/07069 



18 

diethanolamine, pH 8.6. Fractions are brought to pH3.0 with 10% 
trifluoroacetic acid (TFA) . 

Aliquot s of the appropriate fractions are iodinated by one of 
the following methods: P. J. McConahey et al, Int. Arch. Allergy f 
5 29:185-189 (1966); A. E. Bolton et al, Biochem J . . 133:529 (1973); 

and D. F. Bowen-Pope, J. Biol. Chem. , 237:5161 (1982). The 
iodinated proteins present in these fractions are analyzed by SDS 
gel electrophoresis. 

10 EXAMPLE II 

Characterization of Bovine Cartilage/Bone Inductive Factor 

A. Molecular Weight 

Approximately 5^g protein from Example I in 6M urea, 25mM 

diethanolamine, pH 8.6, approximately 0.3 M NaCl is made 0.1% with 
15 respect to SDS and dialyzed against 50 mM tris/HCl 0.1% SDS pH 7.5 

for 16 hrs. The dialyzed material is then electrophorectically 

concentrated against a dialysis membrane [Hunkapillar et al Meth. 

Enzvmol. 91: 227-236 (1983)] with a small amount of I 125 labelled 

counterpart. This material (volume approximately 100/*1) is loaded 
20 onto a 12% poly aery 1 amide gel and subjected to SDS-PAGE [Laemmli, 

U.K. Nature , 227:680-685 (1970)] without reducing the sample with 

dithiothreitol. The molecular weight is determined relative to 

prestained molecular weight standards (Bethesda Research Labs) . 

Following autoradiography of the unfixed gel the approximate 
25 28,000-30,000 dalton band is excised and the protein 

electrophoretically eluted from the gel (Hunkapillar et al supra ) . 

Based on similar purified bone fractions as described in the <co- 

pending "BMP" applications 

described above wherein bone and/or cartilage activity is found in 
30 the 28,000-30,000 region, it is inferred that this band comprises 

bone and/ or cartilage inductive fractions. 



35 



B. Subunit Characterization 

The subunit composition of the isolated bovine bone protein is 
also determined. The eluted protein described above is fully 



WO 92/05199 



PCT/US91/07069 



19 

reduced and alkylated in 2% SDS using iodoacetate and standard 
procedures and reconcentrated by electrophoretic packing. The 
fully reduced and alkylated sample is then further submitted to 
SDS-PAGE on a 12% gel and the resulting approximate 14,000-20,000 
dalton region having a doublet appearance located by 
autoradiography of the unfixed gel. A faint band remains at the 
28,000-30,000 region. Thus the 28,000-30,000 dalton protein yields 
a broad region of 14,000-20,000 which may otherwise also be 
interpreted and described as comprising two broad bands of 
approximately 14,000-16,000 and 16,000-20,000 daltons. 

EXAMPLE III 

Rosen Modified Sampath-Reddi Assay 

A modified version of the rat bone formation assay 
described in Sampath and Reddi, Proc. Natl. Acad. Sci. U.S.A. , 
80:6591-6595 (1983) is used to evaluate bone and/or cartilage 
activity of the proteins of the invention. This modified assay is 
herein called the Rosen-modified Sampath-Reddi assay. The ethanol 
precipitation step of the Sampath-Reddi procedure is replaced by 
dialyzing (if the composition is a solution) or diafiltering (if 
the composition is a suspension) the fraction to be -assayed against 
water. The solution or suspension is then redissolved in 0.1 % 
TFA, and the resulting solution added to 20mg of rat matrix. A 
mock rat matrix sample not treated with the protein serves as a 
control. This material is frozen and lyophilized and the resulting 
powder enclosed in #5 gelatin capsules. The capsules are implanted 
subcutaneously in the abdominal thoracic area of 21 - 49 day old 
male Long Evans rats. The implants are removed after 5-21 days. 
Half of each implant is used for alkaline phosphatase analysis 
[See, A. H. Reddi et al., Proc. Nat l Acad Sci.. 69:1601 (1972)]. 

The other half of each implant is fixed and processed for 
histological analysis. Glycolmethacrylate sections (l#on) are 
stained with Von Kossa and acid fuschin or toluidine blue to score 
the amount of induced bone and cartilage formation present in each 



WO 92/05199 



PCI7US91/07069 



20 

implant. The terms +1 through +5 represent the area of each 
histological section of an implant occupied by new bone and/or 
cartilage cells and newly formed bone and matrix. Two scoring 
methods are herein described. The first describes the original 
scoring method while the second describes the later adopted scoring 
method. A score of +5 indicates that greater than 50% of the 
implant is new bone and/or cartilage produced as a direct result of 
protein in the implant. A score of +4, +3, +2 and +1 would 
indicate that greater than 40%, 30%, 20% and 10% respectively of 
the implant contains new cartilage and/or bone. The scoring method 
later adopted (which hereinafter may be referred to as the 
"modified" scoring method) is as follows: Three non-adjacent 
sections are evaluated from each implant and averaged. "+/"" 
indicates tentative indentification of cartilage or bone; "+l" 
indicates >10% of each section being new cartilage or bone; "+2", 
>25%; "+3", >50%; "+4", -75%; »+5», >80%. A »-" indicates that the 
implant is not recovered. The scores of the individual implants 
are tabulated to indicate assay variability. It is 

contemplated that the dose response nature of the cartilage and/or 
bone inductive protein containing samples of the matrix samples 
will demonstrate that the amount of bone and/or cartilage formed 
increases with the amount of cartilage/bone inductive protein in 
the sample. It is contemplated that the control samples will not 
result in any bone and/or cartilage formation. 

As with other cartilage and/or bone inductive proteins such as 
the above-mentioned "BMP" proteins, the bone and/or cartilage 
formed is expected to be physically confined to the space occupied 
by the matrix. Samples are also analyzed by SDS gel 
electrophoresis and isoelectric focusing followed by . autoradiog- 
raphy. The activity is correlated with the protein bands and pi. 

To estimate the purity of the protein in a particular fraction an 
extinction coefficient of 1 OD/mg-cm is used as an estimate for 
protein and the protein is run on SDS-PAGE followed by silver 
staining or radioiodination and autoradiography. 



WO 92/05199 



PCT/US91/07069 



21 

EXAMPLE IV 

Bovine BMP- 5 Protein Composition 

The gel slice of the approximate 14,000-20,000 dalton region 
described in Example IIB is fixed with methanol-acetic acid-water 
us ing standard procedures , briefly rinsed with water , then 
neutralized with 0.1M ammonium bicarbonate. Following dicing the 
gel slice with a razor blade, the protein is digested from the gel 
matrix by adding 0.2 /ig of TPCK-treated trypsin (Worthington) and 
incubating the gel for 16 hr. at 37 degrees centigrade. The 
resultant digest is then subjected to RPHPLC using a C4 Vydac 
RPHPLC column and 0.1% TFA-water 0.1% TFA water-acetonitrile 
gradient. The resultant peptide peaks were monitored by UV 
absorbance at 214 and 280 nm and subjected to direct amino terminal 
amino acid sequence analysis using an Applied Biosystems gas phase 
seguenator (Model 4 7 OA) . One tryptic fragment is isolated by 
standard procedures having the following amino acid sequence as 
represented by the amino acid standard three-letter symbols and 
where "Xaa" indicates an unknown amino acid the amino acid in 
parentheses indicates uncertainty in the sequence: 

Xaa-His-Glu-Leu-Tyr-Val-Ser-Phe- (Ser) 

The following four oligonucleotide probes are designed on the 
basis of the amino acid sequence of the above-identified tryptic 
fragment and synthesized on an automated DNA synthesizer. 

PROBE #1: GTRCTYGANATRCANTC 

PROBE #2: GTRCTYGANATRCANAG 

PROBE #3: GTRCTYAAYATRCANTC 

PROBE #4: GTRCTYAAYATRCANAG 

The standard nucleotide symbols in the above identified probes 
are as follows: A, adenine; C,cytosine; G, guanine; T, thymine; N, 



WO 92/05199 



PCT/US91/07069 



22 

adenine or cytosine or guanine or thymine; R, adenine or guanine; 
and Y, cytosine or thymine. 

Each of the probes consists of pools of oligonucleotides. 
Because the genetic code is degenerate (more than one codon can 
code for the same amino acid) , a mixture of oligonucleotides is 
synthesized that contains all possible nucleotide sequences 
encoding the amino acid sequence of the tryptic. These probes are 
radioactively labeled and employed to screen a bovine cDNA library 
as described below. 

Poly (A) containing RNA is isolated by oligo(dT) cellulose 
chromatography from total RNA isolated from fetal bovine bone cells 
by the method of Gehron-Robey et al in Current Advances in 
Skeletooenesis , Elsevier Science Publishers (1985) . The total RNA 
was obtained from Dr. Marion Young, National Institute of Dental 
Research, National Institutes of Health. A cDNA library is made in 
lambda gtlO (Toole et al supra ) and plated on 50 plates at 8000 
recombinants per plate. These recombinants (400,000) are screened 
on duplicate nitrocellulose filters with a combination of Probes 1, 
2, 3, and 4 using the Tetramethyl ammonium chloride (TMAC) 
hybridization procedure [see Wozney et al Science . 242 : 1528-1534 
(1988)]. Twenty-eight positives are obtained and are replated for 
secohdaries. Duplicate nitrocellulose replicas again are made. 
One set of filters are screened with Probes 1 and 2 ; the other with 
Probes 3 and 4. Six positives are obtained on the former, 21 
positives with the latter. One of the six, called HEL5, is plague 
purified, a phage plate stock made, and bacteriophage DNA isolated. 
This DNA is digested with EcoRI and subcloned into H13 and pSP65 
(Promega Biotec, Madison, Wisconsin) [Melton, et al., Nucl. Acids 
Res. 12 :7035-7056 (1984) ] . The DNA sequence and derived amino acid 
sequence of this fragment is shown in Table I. 

DNA sequence analysis of this fragment in M13 indicates that 
it encodes the desired tryptic peptide sequence set forth above, 
and this derived amino acid sequence is preceded by a basic residue 
(Lys) as predicted by the specificity of trypsin. The underlined 
portion of the sequence in Table I from amino acid #42 to #48 



WO 92/05199 



PCT/US91/07069 



23 

corresponds to the tryptic fragment identified above f rom which the 
oligonucleotide probes are designed. The derived amino acid 
sequence Ser-Gly-Ser-His-Gln-Asp-Ser-Ser-Arg as set forth in Table 
I from amino acid #15 to #23 is noted to be similar to a tryptic 
fragment sequence Ser-Thr-Pro-Ala-Gln-Asp-Val-Ser-Arg found in the 
28,000 - 30,000 dalton purified bone preparation as described in 
the "BMP" co-pending applications mentioned above. This fragment 
set forth in Table I is a portion of the DNA sequence which encodes 
a bovine BMP-5 protein of the invention. The DNA sequence 
indicates an open reading frame from the 5' end of the clone of 420 
base pairs, encoding a partial peptide of 140 amino acid residues 
(the first 7 nucleotides are of the adaptors used in the cloning 
procedure) . An in-f rame stop codon (TAA) indicates that this clone 
encodes the carboxy-terminal part of the bovine BMP-5 
cartilage/bone protein of the invention. 



WO 92/05199 



PCT/US91/07069 



24 
TABLE I 



TCTAGAGGTGAGAGCAGCCAACAAGAGAAAAAATCAAAACCGCAATAAATCCG6CTCTCAT 6 1 
LeuGluValArgAlaAlaAsnLysArgLysAsnGlnAsnArqAsnLv sSerGlvSerHig 
C 1 ) (15) 

62 CAGGACTCCTCTAGAATGTCCAGTGTTGGAGATTATAACACCAGTGAACAAAAACAAGCC 121 

GlnAspSerSerArgMetSerSerValGlyAspTyrAsnThrSerGluGlnLysGlnAla 
(23) 

122 TGTAAAAAG(^TGAACTCTATGTGAGTTTCCGGGATCTGGGATGGCAGGACTGGATTATA 181 
CysLvsLvsHisGluLeuTv rValSerPheA T-qaspT,oiir;i yn^-pci nPiTTrpIldlc 
(42) 

182 GCACCAGAAGGATATGCTGCATTTTATTGTGATGGAGAATGTTCTTTTCCACTCAATGCC 241 
AlaProGluGlyTyrAlaAlaPheTyrCysAspGlyGluCysSerPheProLeuAsnAla 

242 CATATGAATGCCACCAATCATGCCATAGTTCAGACTCTGGTTCACCTGATGTTTCCTGAC 301 
HisMetAsnAlaThrAsnHisAlalleValGlnThrLeuValHisLeuMetPheProAsp 

302 CACGTACCAAAGCCTTGCTGCGCGACAAACAAACTAAATGCCATCTCTGTGTTGTACTTT 361 
HisValProLysProCysCysAlaThrAsnLysLeiiAsnAlalleSerValLeuTyrPhe 

362 GATGACAGCTCCAATGTCATTTTGAAAAAGTACAGAAATATGGTCGTGCGTTCGTGTGGT 421 
AspAspSerSerAsnVallleLeuLysLysTyrArgAsnMetValValArgSerCysGly 

422 TGCCACTAATAGTGCATAATAATGGTAATAAGAAAAAAGATCTGTATGGAGGTTTATGA 481 
CysHisEnd 

(140) 

481 CTACAATAAAAAATATCTTTCGGATAAAAGGGGAATTTAATAAAATTAGTCTGGCTCATT 540 
541 TCATCTCTGTAACCTATGTACAAGAGCATGTATATAGT 578 



WO 92/05199 



PCT/US91/07069 



25 

The remaining positive clones isolated with probes #1, §2, #3, 
and #4 described above are screened with HEL5 and a further clone 
is identified that hybridizes under reduced hybridization 
conditions [5x SSC, 0.1% SDS, 5X Denhardt f s, 100 Ig/ml salmon sperm 
DNA standard hybridization buffer (SHB) at 65#C, wash in 2XSSC 0.1% 
SDS at 65#C]. This clone is plaque purified, a phage plate stock 
made and bacteriophage DNA isolated. The DNA sequence and derived 
amino acid sequence of a portion of this clone is shown in Table 
II. This sequence represents the DNA sequence encoding a BMP -6 
cartilage/bone protein. 

The first underlined portion of the sequence in Table II from 
amino acid #97 - amino acid # 105 corresponds to the tryptic 
fragment found in the 28/000-30/000 dalton purified bovine bone 
preparation (and its reduced form at approximately 18,000-20,000 
dalton reduced form) as described in the "BMP" co-pending 
applications mentioned above. The second underlined sequence in 
Table II from amino acid # 124 - amino acid #130 corresponds to the 
tryptic fragment identified above from which the oligonucleotide 
probes are designed. 

The DNA sequence of Table II indicates an open reading frame 
of 666 base pairs starting from the 5 f end of the sequence of Table 
II, encoding a partial peptide of 222 amino acid residues. An in- 
frame stop codon (TGA) indicates that this clone encodes the 
carboxy-terminal part of a bovine BMP-6 protein of the invention. 
Based on knowledge of other BMP proteins and other proteins in the 
TGF-b family, it is predicted that the precursor polypeptide would 
be cleaved at the three basic residues (ArgArgArg) to yield a 
mature peptide beginning with residue 90 or 91 of the sequence of 
Table II. 



WO 92/05199 



PCT/US91/07069 



26 



TABLE II 



CTG CTG GGC ACG CGT GCT GTG TGG GCC TCA GAG Gel GGC TGG CTG GAG TTT GAC 
Leu Leu Gly Thr Arg Ala Val Trp Ala Ser Glu Ala Gly Trp EeS Gin ™ Sp 

63 72 81 90 ga me 

mu G GCC A 5 C AGC ** C CTG TCG GTC CTG ACT CCG CAG CAC AAC ATG GGG CTG 
lie Thr Ala Thr Ser Asn Leu Trp Val Leu Thr Pro Gin lis ]2n ME? Su 

117 126 135 144 ic-s 

CAG CTG AGC GTG GTC ACG CGT GAT GGG CTC AGC ATC AGC CCT GGG GCC GCG GGC 
Gin Leu ser Val Val Thr Arg Asp Gly Leu Ser He Ser Pro Gly Ala AU S£ 

!71 180 189 198 om our 

v^f ??° AGG GAC 660 CCC TAC GAC *** OB CCC TTC ATG GTG GCC TTC TTC 
Leu Val Gly Arg Asp Gly Pro Tyr Asp Lys Gin Pro Phe MET Val Sa pS Phe 

225 234 243 252 

279 288 297 306 -*vk 

25 ES f 6G i* 0 ^ 6C TCC ACC CCG 600 G ^C GTG TCG IH GCC TCC III 

Gin Gin Ala Arg Asn Arg Ser Thr Pro Ala qi„ ^ v a1 c ^ ,™ G £ Ser Ser 

333 342 351 „«n 369 3?8 



387 396 * U3 423 432 



441 450 
GCC AAC TAC TGT 
Ala Asn Tyr Cys 

495 504 



351 
CTG 
Leu 


AAG 
Lys 


ACG 
Thr 


360 
GCC 
Ala 


TGC 
Cys 


CGG 
Arg 


405 
TGG 
Trp 


CAG GAC 
Gin Asp 


414 

TGG ATC 
Trp He 


ATT 
He 


459 
GAA 
Glu 


TGT 
Cys 


TCG 
Ser 


468 
TTC 
Phe 


CCT 
Pro 


CTC 
Leu 


513 
CAG 
Gin 


ACC 
Thr 


CTG 
Leu 


522 
GTT 
Val 


CAC 
His 


CTC 
Leu 



477 486 



531 540 



WO 92/05199 



PCT/US91/07069 



27 

TABLE II 
(cont.) 

549 558 567 576 585 594 

TAC GTC CCC AAA CCG TGC TGC GCG CCC ACG AAA CTG AAC GCC ATC TCG GTG CTC 
Tyr Val Pro Lys Pro Cys Cys Ala Pro Thr Lys Leu Asn Ala lie Ser Val Leu 

603 612 621 630 639 648 

TAC TTC GAC GAC AAC TCC AAT GTC ATC CTG AAG AAG TAC CGG AAC ATG GTC GTA 
Tyr Phe Asp Asp Asn Ser Asn Val lie Leu Lys Lys Tyr Arg Asn MET Val Val 

657 666 676 686 696 706 

CGA GCG TGT GGG TGC CAC TGACTCGGGG TGAGTGGCTG GGGACGCTGT GCACACACTG 
Arg Ala Cys Gly Cys His 

(222) 

716 726 736 746 756 766 

CCTGGACTCC TGGATCACGT CCGCCTTAAG CCCACAGAGG CCCCCGGGAC ACAGGAGGAG 

776 786 796 806 816 826 

ACCCCGAGGC CACCTTCGGC TGGCGTTGGC CTTTCCGCCC AACGCAGACC CGAAGGGACC 

836 846 856 866 876 886 

CTGTCCGCCC CTTGCTCACA CCGTGAGCGT TGTGAGTAGC CATCGGGCTC TAGGAAGCAG 



CACTCGAG 



WO 92/05199 



PCT/US91/07069 



28 

EXAMPLE V 

Human BMP-5 Proteins 

Human cell lines which synthesize BMP-5 and/or BMP- 6 mRNAs are 
identified in the following manner. RNA is isolated from a variety 
5 of human cell lines, selected for poly (A) -containing RNA by 

chromatography on oligo(dT) cellulose, electrophoresed on a 
formaldehyde- agarose gel, and transferred to nitrocellulose. A 
nitrocellulose replica of the gel is hybridized to a single 
stranded M13 32 P-labeled probe corresponding to the above mentioned 

10 BMP-5 EcoRI-Bglll fragment containing nucleotides 1-465 of the 

sequence of Table I. A strongly hybridizing band is detected in 
the lane corresponding to the human osteosarcoma cell line U-20S 
RNA. Another nitrocellulose replica is hybridized to a single 
stranded M13 32 P-labeled probe containing the Pstl-Smal fragment of 

15 bovine BMP-6 (corresponding to nucleotides 106-261 of Table II) . 

It is found that several RNA species in the lane corresponding to 
U-20S RNA hybridize to this probe. 

A cDNA library is made in the vector lambda ZAP (Stratagene) 
from U-20S poly (A) -containing RNA using established techniques 

20 (Toole et al.). 750,000 recombinants of this library are plated 

and duplicate nitrocellulose replicas made. The Smal fragment of 
bovine BMP-6 corresponding to nucleotides 259-751 of Table II is 
labeled by nick-translation and hybridized to both sets of filters 
in SHB at 65°. One set of filters is washed under stringent 

25 conditions (0.2X SSC, 0.1% SDS at 65°), the other under reduced 

stringency conditions (IX SSC, 0.1% SDS at 65°). Many duplicate 
hybridizing recombinants (approximately 162) are noted. 24 are 
picked and replated for secondaries. Three nitrocellulose replicas 
are made of each plate. One is hybridized to the BMP-6 Smal probe, 

30 one to a nick-translated BMP-6 Pstl-SacI fragment (nucleotides 106- 

378 of Table II) , and the third to the nick-translated BMP-5 3&al 
fragments (nucleotides 1-76 of Table I) . Hybridization and washes 
are carried out under stringent conditions. 

17 clones that hybridized to the third probe more strongly 

35 than to the second probe are plaque purified. DNA sequence 



WO 92/05199 



PCT/US9 1/07069 



29 

analysis of one of these, U2-16, indicated that it encodes human 
BMP-5. U2-16 was deposited with the American Type Culture 
Collection (ATCC) , Rockville, Maryland on June 22, 1989 under 
accession number ATCC 68109. U2-16 contains an insert of 
approximately 2.1 Kb. The DNA sequence and derived amino acid 
sequence of U2-16 is shown below in Table III. This clone is 
expected to contain all of the nucleotide sequence necessary to 
encode the BMP-5 proteins. The cDNA sequence of Table III contains 
an open reading frame of 1362 bp, encoding a protein of 454 amino 
acids, preceded by a 5» untranslated region of 700 bp with stop 
codons in all frames, and contains a 3 r untranslated region of 90 
bp following the in frame stop codon (TAA) . 

This protein of 454 amino acids has a molecular weight of 
approximately 52,000 kd as predicted by its amino acid sequence, 
and is contemplated to represent the primary translation product. 
Based on knowledge of other BMP proteins and other proteins within 
the TGP-b family, cleavage of the precursor polypeptide may occur 
after the tribasic peptide Lys Arg Lys yielding a 132 amino acid 
mature peptide beginning with amino acid # 323 n Asn H . However, the 
presence of di- or tribasic amino acid sequence is not an absolute 
requirement for proteolytic processing, as a number of prohormones 
are. .known to be processed after single arginines which conform to 
a consensus cleavage sequence arginine-X-X-arginine . it is 
therefore contemplated that the precursor polypeptide is 
proteolytically processed after the Arg-Ser-Val-Arg sequence 
yielding a polypeptide comprising 138 amino acids from amino acid 
#317 (Ala) to #454 (His) as shown in Table III with a calculated 
molecular weight of 15.6 kD.-> The processing of BMP-5 into the 
mature form is expected to involve dimerization and removal of the 
N-terminal region in a manner analogous to the processing of the 
related protein TGF-,8 [L.E. Gentry, et al., Molec. & cell. Biol. 
8.:4162 (1988); R. Dernyck, et al., Nature 316 ; 701 (1985)]. 

It is contemplated therefore that the mature active species of 
BMP-5 comprises a homodimer of 2 polypeptide subunits each subunit 
comprising amino acid #323 - #454 with a predicted molecular weight 



WO 92/05199 



PCT/US9I/07069 



30 

of approximately 15,000 daltons. Further active BMP-5 species are 
contemplated, for example, proprotein dimers or proprotein subunits 
linked to mature subunits. Additional active species may comprise 
amino acid #329 - #454 such species including homologous the 
tryptic sequences found in the purified bovine material. Also 
contemplated are BMP-5 proteins comprising amino acids #353 - #454 
thereby including the first conserved cysteine residue 

The underlined sequence of Table III from amino acid #329 to 
#337 Ser-Ser-Ser-His-Gln-Asp-Ser-Ser-Arg shares homology with the 
bovine sequence of Table I from amino acid #15 to #23 as discussed 
above in Example IV. Each of these sequences shares homology with 
a tryptic fragment sequence Ser-Thr-Pro-Ala-Gln-Asp-Val-Ser-Arg 
found in the 28,000 - 30,000 dalton purified bone preparation (and 
its reduced form at approximately 18,000 - 20,000 daltons) as 
described in the "BMP" co-pending applications mentioned above. 

The underlined sequence of Table III from amino acid #356 to 
#362 His-Glu-Leu-Tyr-Val-Ser-Phe corresponds to the tryptic 
fragment identified in the bovine bone preparation described above 
from which the oligonucleotide probes are designed. 



WO 92/05199 



PCT/US91/07069 



31 

TABLE III 

Human 

10 20 30 40 50 

CTGGTATATT TGTGCCTGCT GGAGGTGGAA TTAACAGTAA GAAGGAGAAA 

60 70 80 90 100 

GGGATTGAAT GGACTTACAG GAAGGATTTC AAGTAAATTC AGGGAAACAC 

110 120 130 140 150 

ATTTACTTGA ATAGTACAAC CTAGAGTATT ATTTTACACT AAGACGACAC 

160 170 180 190 200 

AAAAGATGTT AAAGTTATCA CCAAGCTGCC GGACAGATAT ATATTCCAAC 

210 220 230 240 250 

ACCAAGGTGC AGATCAGCAT AGATCTGTGA TTCAGAAATC AGGATTTGTT 

260 270 280 290 300 

TTGGAAAGAG CTCAAGGGTT GAGAAGAACT CAAAAGCAAG TGAAGATTAC 

310 320 330 340 350 

TTTGGGAACT ACAGTTTATC AGAAGATCAA CTTTTGCTAA TTCAAATACC 

360 370 380 390 400 

AAAGGCCTGA TTATCATAAA TTCATATAGG AATGCATAGG TCATCTGATC 

410 420 430 440 450 

AAATAATATT AGCCGTCTTC TGCTACATCA ATGCAGCAAA AACTCTTAAC 

460 470 480 490 500 

AACTGTGGAT AATTGGAAAT CTGAGTTTCA GCTTTCTTAG AAATAACTAC 

- 510 520 530 540 550 

TCTTGACATA TTCCAAAATA TTTAAAATAG GACAGGAAAA TCGGTGAGGA 

560 570 580 590 600 

TGTTGTGCTC AGAAATGTCA CTGTCATGAA AAATAGGTAA ATTTGTTTTT 

610 620 630 640 650 

TCAGCTACTG GGAAACTGTA CCTCCTAGAA CCTTAGGTTT TTTTTTTTTT 

660 670 686 690 700 

AAGAGGACAA GAAGGACTAA AAATATCAAC TTTTGCTTTT GGACAAAA 



WO 92/05199 



PCT/US91/07069 



32 



TABLE III (a) 

701 710 719 728 737 

ATG CAT CTG ACT GTA TTT TTA CTT AA6 GGT ATT GTG GGT TTC CTC 

MET His Leu Thr Val Phe Leu Leu Lys Gly lie Val Gly Phe Leu 

746 755 764 773 782 

TGG AGC TGC TGG GTT CTA GTG GGT TAT GCA AAA GGA GGT TTG GGA 

Trp ser Cys Trp Val Leu Val Gly Tyr Ala Lys Gly Gly Leu Gly 

791 800 809 818 827 

GAC AAT CAT GTT CAC TCC AGT TTT ATT TAT AGA AGA CTA CGG AAC 

Asp Asn His Val His Ser Ser Phe He Tyr Arg Arg Leu Arg Asn 

836 845 854 863 872 

CAC GAA AGA CGG GAA ATA CAA AGG GAA ATT CTC TCT ATC TTG GGT 

His Glu Arg Arg Glu He Gin Arg Glu He Leu Ser He Leu Gly 

881 890 899 908 917 

TTG CCT CAC AGA CCC AGA CCA TTT TCA CCT GGA AAA ATG ACC AAT 

Leu Pro His Arg Pro Arg Pro Phe Ser Pro Gly Lys Gin Ala Ser 

926 935 944 953 962 

CAA GCG TCC. TCT GCA CCT CTC TTT ATG CTG GAT CTC TAC AAT GCC 

Ser Ala Pro Leu Phe MET Leu Asp Leu Tyr Asn Ala MET Thr Asn 

971 980 989 998 1007 

GAA GAA AAT CCT GAA GAG TCG GAG TAC TCA GTA AGG GCA TCC TTG 

Glu Glu Asn Pro Glu Glu Ser Glu Tyr Ser Val Arg Ala Ser Leu 

1016 s 1025 1034 1043 1052 

GCA GAA GAG ACC AGA GGG GCA AGA AAG GGA TAC GCA GCC TCT CCC 
Ala Glu Glu Thr Arg Gly Ala Arg Lys Gly Tyr Pro Ala Ser Pro 

1061 1070 1079 1088 1097 

AAT GGG TAT CCT CGT CGC ATA CAG TTA TCT CGG ACG ACT CCT CTG 
Asn Gly Tyr Pro Arg Arg He Gin Leu Ser Arg Thr Thr Pro Leu 

1106 1115 1124 1133 1142 

ACC ACC CAG AGT CCT CCT CTA GCC AGC CTC CAT -GAT ACC AAC TTT 
Thr Thr Gin Ser Pro Pro Leu Ala Ser Leu His Asp Thr Asn Phe 

1151 1160 1169 1178 1187 

CTG AAT GAT GCT GAC ATG GTC ATG AGC TTT GTC AAC TTA GTT GAA 
Leu Asn Asp Ala Asp MET Val MET Ser Phe Val Asn Leu Val Glu 

1196 1205 1214 1223 1232 

AGA GAC AAG <3AT TTT TCT CAC CAG CGA AGG CAT TAC AAA GAA TTT 
Arg Asp Lys Asp Phe Ser His Gin Arg Arg His Tyr Lys Glu Phe 



WO 92/05199 



PCT/US91/07069 



33 



TABLE 111(b) 

1241 1250 1259 1268 1277 

CGA TTT GAT CTT ACC CAA ATT CCT CAT GGA GAG GCA GTG ACA GCA 
Arg Phe Asp Leu Thr Gin lie Pro His Gly Glu Ala Val Thr Ala 

1286 1295 1304 1313 1322 

GCT GAA TTC CGG ATA TAC AAG GAC CGG AGC AAC AAC CGA TTT GAA 
Ala Glu Phe Arg lie Tyr Lys Asp Arg Ser Asn Asn Arg Phe Glu 

1331 1340 1349 1358 1367 

AAT GAA ACA ATT AAG ATT AGC ATA TAT CAA ATC ATC AAG GAA TAC 
Asn Glu Thr lie Lys lie Ser lie Tyr Gin lie lie Lys Glu Tyr 

1376 1385 1394 1403 1412 

ACA AAT AGG GAT GCA GAT CTG TTC TTG TTA GAC ACA AGA AAG GCC 
Thr Asn Arg Asp Ala Asp Leu Phe Leu Leu Asp Thr Arg Lys Ala 

1421 1430 1439 1448 1457 

CAA GCT TTA GAT GTG GGT TGG CTT GTC TTT GAT ATC ACT GTG ACC 
Gin Ala Leu Asp Val Gly Trp Leu Val Phe Asp lie Thr Val Thr 

1466 1475 1484 1493 1502 

AGC AAT CAT TGG GTG ATT AAT CCC CAG AAT AAT TTG GGC TTA CAG 
Ser Asn His Trp Val lie Asn Pro Gin Asn Asn Leu Gly Leu Gin 

1511 1520 1529 1538 1547 

CTC TGT GCA GAA ACA GGG GAT GGA CGC AGT ATC AAC GTA AAA TCT 
Leu Cys Ala Glu Thr Gly Asp Gly Arg Ser He Asn Val Lys Ser 

1556 1565 1574 1583 1592 

GCT* GGT CTT GTG GGA AGA CAG GGA CCT CAG TCA AAA CAA CCA TTC 
Ala Gly Leu Val Gly Arg Gin Gly Pro Gin Ser Lys Gin Pro Phe 

1601 1610 1619 1628 1637 

ATG GTG GCC TTC TTC AAG GCG AGT GAG GTA CTT CTT CGA TCC GTG 
MET Val Ala Phe Phe Lys Ala Ser Glu Val Leu Leu Arg Ser Val 

1646 1655 1664 1673 1682 

AGA GCA GCC AAC AAA CGA AAA AAT CAA AAC CGC AAT AAA TCC AGC 
Arg Ala Ala Asn Lys Arg Lys Asn Gin Asn Arg Asn Lys Ser Ser 

(329) 

1691 1700 1709 1718 1727 

TCT CAT CAG GAC TCC TCC AGA ATG TCC AGT GTT GGA GAT TAT AAC 
Ser His Gin Asp Ser Ser Arg MET Ser Ser Val Gly Asp Tyr Asn 

(337) 



WO 92/05199 



PCT/US91/07069 



34 



TABLE III(C) 

1736 1745 1754 1763 1772 

ACA AGT GAG CAA AAA CAA GCC TGT AAG AAG CAC GAA CTC TAT GTG 
Thr Ser Glu Gin Lys Gin Ala Cys Lys Lys His Glu Leu Tyr Val 

(356) 

1781 1790 1799 1808 1817 

AGC TTC CGG GAT CTG GGA TGG CAG GAC TGG ATT ATA GCA CCA GAA 
Ser Phe Arg Asp Leu Gly Trp Gin Asp Trp lie lie Ala Pro Glu 
(362) 

1826 1835 1844 1853 1862 

GGA TAC GCT <3CA TTT TAT TGT GAT GGA GAA TGT TCT TTT CCA CTT 
Gly Tyr Ala Ala Phe Tyr Cys Asp Gly Glu Cys Ser Phe Pro Leu 

1871 1880 1889 1898 1907 

AAC GCC CAT ATG AAT GCC ACC AAC CAC GCT ATA GTT CAG ACT CTG 
Asn Ala His MET Asn Ala Thr Asn His Ala He Val <51n Thr Leu 

1916 1925 1934 1943 1952 

GTT CAT CTG ATG TTT CCT GAC CAC GTA CCA AAG CCT TGT TGT GCT 
Val His Leu MET Phe Pro Asp His Val Pro Lys Pro Cys Cys Ala 

1961 1970 1979 1988 1997 

CCA ACC AAA TTA AAT GCC ATC TCT GTT CTG TAC TTT GAT GAC AGC 
Pro Thr Lys Leu Asn Ala lie Ser Val Leu Tyr Phe Asp Asp Ser 

2006 2015 2024 2033 2042 

TCC AAT GTC ATT TTG AAA AAA TAT AGA AAT ATG GTA GTA CGC TCA 
Ser Asn Val He Leu Lys Lys Tyr Arg Asn MET Val Val Arg Ser 

(450) 

2051 2060 2070 2080 2090 2100 

TGT GGC TGC CAC TAATATTAAA TAATATTGAT AATAACAAAA AGATCTGTAT 
Cys Gly Cys His 

2110 2120 2130 2140 2150 

TAAGGTTTAT GGCTGCAATA AAAAGCATAC TTTCAGACAA ACAGAAAAAA AAA 



WO 92/05199 



PCT/US91/07069 



35 

The invention encompasses the corresponding bovine and 
human BMP-5 genomic sequences. These genes can be isolated 
using the cDNA sequences set forth in Table I and Table III as 
probes to screen genomic libraries using techniques known to 
those skilled in the art. 

When the tryptic sequence His-Glu-Leu-Tyr-Val-Ser-Phe- 
(Ser) described above was identified, it was noted to be 
similar to the sequence His-Pro-Leu-Tyr-Val-Asp-Phe-Ser found 
in the bovine and human cartilage/bone protein BMP- 2 A sequence, 
for instance as described in co-pending U.S. application Serial 
No. 179,100. Human BMP-5 shares homology with other BMP 
molecules as well as other members of the TGF-b superfamily of 
molecules. The cysteine-rich carboxy-terminal 102 amino acids 
residues of human BMP-5 shares the following homologies with 
BMP proteins disclosed in copending applications described 
above: 61% identity with BMP-2; 43% identity with BMP-3, 59% 
identity with BMP-4; 91% identity with BMP-6; and 88% identity 
with BMP-7. Human BMP-5 further shares the following 
homologies: 38% identity with TGF-j93; 37% identity with TGF- 
b2; 36% identity with TGF-bl; 25% identity with Mullerian 
Inhibiting Substance (MIS) , a testicular glycoprotein that 
causes regression of the Mullerian duct during development of 
the male embryo; 25% identity with inhibin a; 38% identity with 
inhibin b B ; 45% identity with inhibin b A ; 56% identity with 
Vgl, a Xenopus factor which may be involved in mesoderm 
induction in early embryogenesis (Lyons, et al., PNAS USA 
86:4554-4558 (1989)]; and 57% identity with Dpp the product of 
the Drosophila decapentaplegic locus which is required for 
dorsal -ventral specification in early embryogenesis and is 
involved in various other developmental processes at later 
stages of development [Padgett, et al., Nature 325:81-84 
(1987)]. 

The procedures described above and additional methods 
known to those skilled in the art may be employed to isolate 
other related proteins of interest by utilizing the bovine or 



WO 92/05199 



PCT/US91/07069 



36 

human proteins as a probe source. Such other proteins may find 
similar utility in, inter alia, fracture repair, wound healing 
and tissue repair. 

EXAMPLE VI 

Express ion of the BMP- 5 Proteins 

In order to produce bovine, human or other mammalian 
proteins of the invention, the DNA encoding it is transferred 
into an appropriate expression vector and introduced into 
mammalian cells or other preferred eukaryotic or prokaryotic 
hosts by conventional genetic engineering techniques. It is 
contemplated that the preferred expression system for 
biologically active recombinant human proteins of the invention 
may be stably transformed mammalian cells. For transient 
expression, the cell line of choice is SV40 transformed 
African green monkey kidney COS-1 or COS-7 which typically 
produce moderate amounts of the protein encoded within the 
plasmid for a period of 1-4 days. For stable high level 
expression, it is further contemplated that the preferred 
mammalian cells will be Chinese hamster ovary (CHO) cells. 

The transformed host cells are cultured and the BMP-5 
protein expressed thereby is recovered, isolated and purified. 
Characterization of expressed proteins is carried out using 
standard techiques. For example, characterization may include 
pulse labeling with [ 3 5 s ] methionine or cysteine and analysis 
by polyacrylamide electrphoresisThe recombinantly expressed 
BMP-5 proteins are free of proteinaceous materials with which 
they are co-produced and with which they ordinarily are 
associated in nature, as well as from other contaminants, such 
as materials found in the culture media. 

In order to express biologically active human BMP-5 a 
selected host cell is transformed, using techniques known to 
those skilled in the art of genetic engineering, with a DNA 
sequence encoding human BMP-5 protein. The DNA comprises the 
nucleotide sequence from nucleotide #1665 to #2060 set forth in 



WO 92/05199 



PCI7US91/07069 



37 

Table III encoding amino acid #323 to #454. The DNA may 
comprise the DNA sequence from nucleotide # 699 to # 2060 set 
forth in Table III. The transformed host cells are cultured 
and the BMP-5 protein comprising the amino acid sequence from 
amino acid # 323 to amino acid # 454 set forth in Table III is 
expressed. The expressed protein is recovered, isolated and 
purified from the culture and culture medium. The purified 
protein is substantially free from other proteinaceous 
materials with which it is co-produced, and from other 
contaminants. 

A. Vector Construction 

As described above, numerous expression vectors known in 
the art may be utilized in the expression of BMP proteins of 
the invention. The vector utilized in the following examples 
are pMT21, a derivitive of pMT 2 , and pEMC2£l derived from pMT21 
though other vectors may be suitable in practice of the 
invention. 

pMT 2 is derived from pMT2-VWF, which has been deposited 
with the American Type Culture Collection (ATCC) , Rockville, MD 
(USA) under accession number ATCC 67122 under the provisions of 
the Budapest Treaty. EcoRI digestion excises the cDNA insert 
present in pMT-VWF, yielding pMT2 in linear form which can be 
ligated and used to transform Coli HB 101 or DH-5 to 
ampicillin resistance. Plasmid pMT2 DNA can be prepared by 
conventional methods. 

pMT21 is then constructed using loopout/in mutagenesis 
[Morinaga, etal., Biotechnology 84; 63 6 (1984)]. This removes 
bases 1075 to 1170 (inclusive) . In addition it inserts the 
following sequence: 5* TCGA 3'. This sequence completes a new 
restriction site, Xhol. This plasmid now contains 3 unique 
cloning sites PstI, EcoRI, and Xhol. 

In addition, pMT21 is digested with EcoRV and Xhol, 
treating the digested DNA with Klenow fragment of DNA 
polymerase I and ligating Clal linkers (NEBio Labs, CATCGATG) . 



WO 92/05199 



PCT/US91/07069 



38 

This removes bases 2171 to 2420 starting from the Hindlll site 
near the SV40 origin of replication and enhancer sequences of 
pMT2 and introduces a unique Cla I site, but leaves the 
adenovirus VAI gene intact. 

PEMC2/91 is derived from pMT21. pMT21 is cut with 
EcoRl and Xhol which cleaves the plasmid two adjacent cloning 
sites situated after the igG intron. An EMCV fragment of 508 
base pairs is cut from pH^ECAT^ [S.K. Jong, et al., J. virol. 
§1: 1651-1660 (1989)] with the restriction enzymes EcoRl and 
Tagal. A pair of oligonucleotides 68 nucleotides cga 
ggttaaaaaa cgtctaggcc ccccgaacca cggggacgtg gttttccttt 
gaaaaacacg attgc in length are synthesized to duplicate the 
EMCV sequence up to the ATG. The ATG is changed to an ATT, and 
a C is added, creating a Xhol site at the 3 » end. A tag* I site 
is situated at the 5* end. Ligation of the MT21 EcoRl to Xhol 
fragment to the EMCV EcoRl to Tag* I fragment and to the 
Tagatl/Xhol oligonucleotides produces the vector EMC§B1. This 
vector contains the SV40 origin of replication and enhancer, 
the adenovirus major late promoter, a cDNA copy of the majority 
of the adenovirus tripartite leader sequence, a small hybrid 
intervening sequence, an SV40 polyadenylation signal and the 
dadenovirus VA 1 gene, DHFR and B-lactamase markers and an EMC 
sequence, in appropriate relationships to direct the high level 
expression of the desired cDNA in mammalian cells. 

B. BMP^5 Vector Construction 

A derivative of the BMP-5 cDNA sequence set forth in Table 
III comprising the the nucleotide sequence from nucleotide #699 
to #2070 is specifically amplified. The oligonucleotides 
CGACCTGCAGCCACCATGCATCTGACTGTA and TGCCTGCAGTTTAATATTAGTGGCAGC 

are utilized as primers to allow the amplification of 
nucleotide sequence #699 to #2070 of Table III from the insert 
of clone U2 -16 described above in Example V. This procedure 
introduces the nucleotide sequence CGACCTGCAGCCACC immediately 
preceeding nucleotide #699 and the nucleotide sequence 



WO 92/05199 



PCT/US91/07069 



39 

CTGCAGGCA immediately following nucleotide #2070. The addition 
of these sequences results in the creation of PstI restriction 
endonuclease recognition sites at both ends of the amplified 
DNA fragment. The resulting amplified DNA product of this 
procedure is digested with the restriction endonuclease PstI 
and subcloned into the PstI site of the pMT2 derivative pMT21 
described above- The resulting clone is designated H5/5/pMT. 

The insert of H5/5/pMT is excised by PstI digestion and 
subcloned into the plasmid vector pSP65 at the PstI site 
resulting in BMP5/SP6 . BMP5/SP6 and U2-16 are digested with 
the restriction endonucleases Nsil and Ndel to excise the 
portion of their inserts corresponding to nucleotides #704 to 
#1876 of Table III. The resulting 1173 nucleotide Nsil-Ndei 
fragment of clone U2-16 is ligated into the Nsil-Ndei site of 
BMP5/SP6 from which the corresponding 1173 nucleotide Nsil-Ndei 
fragment had been removed. The resulting clone is designated 
BMP5mix/SP64 . . 

Direct DNA sequence analysis of BMP5mix/SP64 is performed 
to confirm identity of the nucleotide sequences produced by the 
amplification to those set forth in Table III. The clone 
BMP5mix/SP64 is digested with the restriction endonuclease PstI 
resulting in the excision of an insert comprising the 
nucleotides #699 to #2070 of Table III and the additional 
sequences containing the PstI recognition sites as described 
above. The resulting 1382 nucleotide PstI fragment is 
subcloned into the PstI site of the pMT2 derivative pMT21 and 
pEMC2£l. These clones are designated BMP5mix/pMT21#2 and 
BMp5mix/EMC#ll. 

Example VII 

Transient COS Cell Expression 

To obtain transient expression of BMP-5 proteins a vector 
containing the cDNA for BMP-5, BMP5mix/pMT21#2 / is transfected 
into COS-1 cells using the electroporation method. Other 



WO 92/05199 



PCT/US91/07069 



40 



suitable trans fection methods include DEAE-dextran, and 
lipofection. Approximately 48 hours later, cells are analysed 
for expression of both intracellular and secreted BMP-5 protein 
by metabolic labelling with [ 35 S] methionine and polyacrylamide 
gel electrophoresis. Intracellular BMP is analyzed in cells 
which are treated with tunicamycin, an inhibitor of N-linked 
glycosylation. in tunicamycin-treated cells, the 

nonglycosylated primary translation product migrates as a 
homogeneous band of predictable size and is often easier to 
discern in polyacrylamide gels than the glycosylated form of 
the protein. in each case, intracelluar protein in 
tunicamycin-treated cells is compared to a duplicate plate of 
transfected, but untreated COS-1 cells. 

The results demonstrate that intracellular forms of BMP-5 
of approximately 52 Kd and 57 Kd are made by COS cells. The 52 
Kd protein is the size predicted by the primary sequence of the 
the BMP-5 cDNA clone. Following treatment of the cells with 
tunicamycin, only the 52 Kd form of BMP-5 is made, suggesting 
that the 57 Kd protein is a glycosylated derivative of the 52 
Kd primary translation product. The 57 Kd protein is secreted 
into the conditioned medium and is apparently not efficiently 
processed by COS— 1 cells into the pro and mature peptides. 

Example VIII 

CHO Cell Expression 

DHFR deficient CHO cells (DUKX Bll) are transfected by 
electroporation with BMP-5 expression vectors described above, 
and selected for expression of DHFR by growth in nucleoside- 
free media. Other methods of transfection, including but not 
limited to CaP0 4 precipitation, protoplast fusion, 
microinjection, and lipofection, may also be employed. in 
order to obtain higher levels of expression more expediently, 
cells may be selected in nucleoside-free media supplemented 
with 5 nM, 20 nM or 100 nM MTX. Since the DHFR selectable 
marker is physically linked to the BMP-5 cDNA as the second 



WO 92/05199 



PCT/US91/07069 



41 

gene of a bicistronic coding region, cells which express DHFR 
should also express the BMP-5 encoded within the upstream 
cistron. Either single clones, or pools of combined clones, 
are expanded and analyzed for expression of BMP protein. Cells 
are selected in stepwise increasing concentrations of MTX (5 
nM, 20 nM, 100 nM, 500 nM, 2 uM, 10 uM, and 100 uM) in order 
to obtain cell lines which contain multiple copies of the 
expression vector DNA by virtue of gene amplification, and 
hence secrete large amounts of BMP-5 protein. 

Using standard techniques cell lines are screened for 
expression of BMP-5 RNA, protein or activity, and high 
expressing cell lines are cloned or recloned at the appropriate 
level of selection to obtain a more homogeneous population of 
cells. The resultant cell line is then further characterized 
for BMP-5 DNA sequences, and expression of BMP-5 RNA and 
protein. Suitable cell lines can then be used for producing 
recombinant BMP protein. 

The BMP-5 vector BMP5mix/pMT21#2 and BMP5mix/EMC#ll 
described above are transfected into CHO cells by 
electroporation, and cells are selected for expression of DHFR 
in nucleoside free medium. Clonal cell lines are obtained from 
individual colonies and are subsequently selected stepwise for 
resistence to MTX, and are analyzed for secretion of BMP-5 
proteins. In some cases cell lines may be maintained as pools 
and cloned at later stages of MTX selection. One particular 
cell line further described, is designated 5E10 is sequentially 
selected for resistence to .02uM, O.lmM, 0.5uM and 2.0uM MTX to 
obtain amplified expression of BMP-5 • 

The amount of BMP-5 recovered in conditioned medium from 
5E10 and other cell lines that express BMP-5 can be increased 
by including heparin, suramin, dextran sulfate, pectic acid, 
sodium sulfate, or related compounds in the growth medium. 

As described in Example V. the cDNA for BMP-5 encodes a 
protein of approximately 52 kD. Following processing within 
the cell that includes, but may not be limited to, propeptide 



WO 92/05199 



PCT/US91/07069 



42 

cleavage, glycosylation, and dimer or multimer formation, 
multiple BMP-5 peptides are produced. There are at least 4 
candidate peptides for processed forms of the BMP-5 protein 
discernable following SDS PAGE under reducing conditions; a 
peptide of approximately 65kD, a peptide of approximately 35kD, 
and a doublet of approximately 22 kD molecular weight. Other 
less abundant BMP-5 peptides may also be present. By 
comparison to the processing of other related BMP molecules and 
the related protein TGF-beta, the 65 Kd protein likely 
represents unprocessed BMP-5, the 35 Kd species represents the 
propeptide, and the 22 Kd doublet represents the mature 
peptide. 

Material from a BMP-5 cell line is analyzed in a 2- 
dimensional gel system. In the first dimension, proteins are 
electrophoresed under nonreducing conditions. The material is 
then reduced, and electrophoresed in a second polyacrylamide 
gel. Proteins that form disul fide-bonded dimers or multimers 
will run below a diagonal across the second reduced gel. 
Results from analysis of BMP-5 protein indicates that a 
significant amount of the mature BMP-5 peptides can form 
homodimers of approximately 30-35 kD that reduce to the 22 kD 
doublet observed in one dimensional reduced gels. A fraction 
of the mature peptides are apparently in a disul fide-bonded 
complex with the pro peptide. The amount of this complex is 
minor relative to the mature homodimer. In addition, some of 
the unprocessed protein can apparantly form homodimers or 
homomultimers . 

EXAMPLE IX 

Purification and Biolog ical Activity of Expressed BMP-5 
Proteins 

To measure the biological activity of the expressed BMP-5 
proteins obtained in Example VIII above, the BMP-5 proteins are 
recovered from the culture media and purified by isolating them 
from other proteinaceous materials with which they are co- 



WO 92/05199 



PCI7US91/07069 



43 

produced, as well as from other contaminants. BMP-5 proteins 
may be partially purified on a Heparin Sepharose column and 
further purified using standard purification techniques known 
to those skilled in the art. The BMP-5 protein is mixed with 
5 20 mg of rat matrix and then assayed for in vivo bone and/ or 
cartilage formation activity by the Rosen-modified Sampath - 
Reddi assay. A mock transfection supernatant fractionation is 
used as a control. 

The implants containing rat matrix to which specific 

10 amounts of human BMP-5 proteins of the invention have been 
added are removed from rats after approximately seven days and 
processed for histological evaluation. Representative sections 
from each implant are stained for the presence of new bone 
mineral with von Kossa and acid fuschin, and for the presence 

15 of cartilage-specific matrix formation using toluidine blue. 
The types of cells present within the section, as well as the 
extent to which these cells display phenotype are evaluated and 
scored as described in Example III. 

20 A. Purification of BMP-5 Proteins 

(1) As one example of BMP-5 purification 4 ml of the 
collected post transfection conditioned medium supernatant from 
one 100 mm culture dish is concentrated approximately 10 fold 
by ultrafiltration on a YM 10 membrane and then dialyzed 

25 against 20mM Tris, 0.15 M NaCl, pH 7.4 (starting buffer) . This 
material is then applied to a 1.1 ml Heparin Sepharose column 
in starting buffer. Unbound proteins are removed by an 8 ml 
wash of starting buffer, and bound proteins, including proteins 
of the invention, are desorbed by a 3-4 ml wash of 20 mM Tris, 

30 2.0 M NaCl, pH 7.4. 

The proteins bound by the Heparin column are concentrated 
approximately 10-fold on a Centricon 10 and the salt reduced by 
diafiltration with 0.1% trifluoroacetic acid. 

Further purification may be achieved by preparative 

35 NaDodS0 4 /PAGE [Laemmli, Nature 227:680-685 (1970)]. For 



WO 92/05199 



PCI7US91/07069 



44 

instance, approximately 300 pg of protein is applied to a 1.5- 
mm-thick 12.5% gel: recovery is estimated by adding L- 
[ 35 S]methionine-labeled BMP protein purified over heparin- 
Sepharose as described above. Protein may be visualized by 
copper staining of an adjacent lane [Lee, et al., Anal, 
Biochem, 166:308-312 (1987)]. Appropriate bands are excised 
and extracted in 0.1% NaDodSO 4 /20 mM Tris, pH 8.0. The 
supernatant may be acidified with 10% CF 3 COOH to pH 3 and the 
proteins are desalted on 5.0 x 0.46 cm Vydac C 4 column (The 
Separations Group, Hesperia, CA) developed with a gradient of 
0.1% CF3COOH to 90% acetonitrile/0.1% CFF3COOH. 

(2) In another example, soluble heparin (lOOug/ml) is 
removed from of BMP-5 protein in conditioned media from 5E10(2) 
2.0MTX (described above) using butyl TSK hydrophobic 
interactive chrmatography (HIC) . The conditioned media is 
brought to 2M NaCl by addition of solid NaCl. The conditioned 
media is then loaded on butyl TSK equilabrated in 2M NaCl, 50mM 
Tris, pH 7.4 washed with 0 M NaCl, 50mM Tris, Ph 7.4, followed 
by elution with 1% Np-40, 6M urea, 50mM Tris, pH 7.4 resulting 
in approximately 98% removal of soluble heparin. 

The resulting material is then subjected to heparin 
sepharose chromatography. The material is directly loaded onto 
a heparin column equilabrated in 50mM Tris, 6M urea, 0M NaCl, 
washed and eluted with a gradient of 0-2M NaCl. This material 
is analyzed by western blot and the BMP-5 containing fractions 
(0.3 - 0.8 M NaCl) are pooled. The antibody is directed 
against the C-terminal presumed mature portion. Proteins of 
35-40 kD non-reduced , 20-22 kD reduced, and higher molecular 
weight dimers are observed. 

The BMP-5 containing fractions are concentrated and 
diafiltered to bring the sample to 0.1% TFA loaded onto a 
reverse phase column and eluted with a gradient from 30% to 60% 
B (A=.l% TFA; B = .1% TFA in 90% acetonitrile) in 75 min at 
Unl/min. SDS-PAGE analysis reveals several molecular weight 



WO 92/05199 



PCT/US91/07069 



45 

species of BMP-5 proteins which are further described below. 
The mature species which is contemplated to comprise a 
homodimer of amino acids #317-#454 as shown in Table III 
comprises approximately 46-49% of the resulting molecular 
weight species. 

B. Characterization of BMP-5 Proteins 

One dimensional Western blot analysis reveals several 
molecular weight species including 98kDa, 72kDa 50kDa and 35- 
40kDa. Upon reduction the following species are seen 683cDA, 
43kDa and 20-22 kDA. The non-reduced 98kDa species is 
contemplated to comprise a homodimer of two 50kDa subunits each 
comprising amino acids #28 # 454 as shown in Table III. The 
72kDa species is contemplated to comprise a heterodimer of a 
50kDa subunit (comprising amino acids #28- #454 of Table III as 
described above) and a 20kDa subunit comprising amino acids 
#317 - #454 as shown in Table III. The 35-40kDa species is 
contemplated to represent the mature species comprising a 
homodimer of two 20 kDa subunits each comprising amino acids 
#317 - #454 as shown in Table III. 

C. BMP-5 Activity 

BMP-5 (containing lOOug/ml soluble heparin) purified in a 
preliminary experiment over octyl-sepharose (HIC) [see 
description below] then over heparin sepharose in a manner 
similar to the butyl then heparin . steps described above is 
mixed with 20 mg rat matrix and implanted for 10 days according 
to the rat ectopic assay described above in Example III. 
Approximately 1-3 ug BMP-5 protein from the heparin sepharose 
step results in the formation of cartilage and bone. The 
octyl-sepharose purification step is carried out by adding 
solid (NH 4 ) 2 S0 4 to BMP— 5 conditioned media containing lOOug/ml 
soluble heparin to a final concentration of 1M. This is loaded 
onto a column of octly-sepharose eguilabrated in 1M (NH 4 ) 2 S0 4 , 
50mM Tris pH 7.4. The column is washed with starting buffer 



WO 92/05199 



PCT/US91/07069 



46 

then with 50mM Tris pH 7.4 and eluted with 50mM Tris, 6M urea, 
0.2% octly glucoside pH 7.4. Purification over heparin 
sepharose is by step gradient, washed with 50mM Tris, 0.15M 
NaCl, 6M urea pH 7.4, eluted with 50mM Tris, 2M NaCl, 6M urea 
pH 7.4. The material implanted is 2M NaCl. 

The foregoing descriptions detail presently preferred 
embodiments of the present invention. Numerous modifications 
and variations in practice thereof are expected to occur to 
those skilled in the art upon consideration of these descrip- 
tions. Those modifications and variations are believed to be 
encompassed within the claims appended hereto. 



WO 92/05199 



PCT/US91/07069 



47 

What is claimed is: 

1. A purified human BMP-5 protein comprising the amino acid 
sequence from amino acid #323 to amino acid #454 as shown in 
Table III. 

2. A BMP-5 protein of claim 1 comprising the amino acid 
sequence from amino acid #317 to #454 as shown in Table III. 

3. A purified human BMP-5 protein produced by the steps of 

(a) culturing a cell transformed with a DNA sequence 
comprising the DNA sequence of Table III from 
nucleotide # 1665 to # 2060 or a sequence 
substantially homologous thereto; and 

(b) recovering from said culture medium a protein 
comprising the amino acid sequence from amino acid # 
323 to amino acid # 454 as shown in Table III or a 
sequence substantially homologous thereto. 

4 . A purified human BMP-5 protein produced by the steps of 

(a) culturing a cell transformed with a DNA sequence 
comprising the DNA sequence of Table III from 
nucleotide # 699 to # 2060 or a sequence substantially 
homologous thereto; and 

(b) recovering from said culture medium a protein 
comprising the amino acid sequence from amino acid #323 to 
amino acid # 454 as shown in Table III or a sequence 
substantially homologous thereto. 

5. A purified BMP-5 protein produced by the steps of 

(a) culturing a cell transformed with a DNA 
sequence which hybridizes to the DNA sequence of 
Table III under stringent hybridization conditions; 
and 

(b) recovering from said culture medium a protein 



WO 92/05199 



PCT/US91/07069 



48 

characterized by the ability to induce cartilage 
and/or bone formation in the Rosen-modified Sampath- 
Reddi assay. 

6 . A protein of claim 1 further characterized by the ability 
to demonstrate cartilage and/or bone formation. 

7. A protein "of claim 4 further characterized by the ability 
of l M g of said protein to score at least +2 in the Rosen- 
modified Sampath-Reddi assay. 

8. A DNA sequence encoding a protein of claim 1. 

9. A DNA sequence encoding a protein of claim 4. 

10. A host cell transformed with a DNA of claim 6. 

11. A method for producing a purified BMP-5 protein said 
method comprising the steps of 

(a) culturing in a suitable culture medium cells 
transformed with a DNA sequence comprising the DNA 
sequence from nucleotide # 699 to # 2060 of Table 
III; and 

(b) isolating and purifying said protein from said 
culture medium. 

12. a pharmaceutical composition comprising an effective 
amount of a protein of claim 1 in admixture with a 
pharmaceutically acceptable vehicle. 

13. A pharmaceutical formulation for 4x>ne and/or cartilage 
formation comprising an effective amount of a protein of claim 
1 in a pharmaceutically acceptable vehicle. 

14. A composition of claim 12 further comprising a matrix for 



WO 92/05199 



PCT/US91/07069 



49 

supporting said composition and providing a surface for bone 
and/or cartilage growth. 

15. The composition of claim 14 wherein said matrix comprises 
a material selected from the group consisting of 
hydroxyapatite, collagen, polylactic acid and tricalcium 
phosphate . 

16. A method for inducing bone and/ or cartilage formation in a 
patient in need of same comprising administering to said 
patient an effective amount of the composition of claim 13. 

17. A pharmaceutical composition for wound healing and tissue 
repair said composition comprising an effective amount of the 
protein of claim 1 in a pharmaceutically acceptable vehicle. 

18. A method for treating wounds and/or tissue repair in a 
patient in need of same comprising administering to said 
patient an effective amount of the composition of claim 12. 

19. An isolated DNA sequence encoding a BMP-5 protein said DNA 
sequence comprising substantially the nucleotide sequence or a 
portion thereof selected from the group consisting of: 

(a) nucleotide # 699 through nucleotide # 2060 of Table 
III; and 

(b) sequences which 

(1) hybridize to sequence (a) under stringent 
hybridization conditions; and 

(2) encode a protein characterized by the ability 6 
1/ig of said protein having the ability to score at 
least +2 in the Rosen-modified Sampath-Reddi assay. 

20. A vector comprising a DNA sequence of Claim 19 in 
operative association with an expression control sequence 
therefor. 



WO 92/05199 



PCT/US91/07069 



50 

21. A host cell transformed with a DNA sequence of Claim 19. 

22. A method for producing a BMP-5 protein, said method 
comprising the steps of 

(a) culturing in a suitable culture medium said 
transformed host cell of claim 21; and 

(b) isolating and purifying said bone and/or 
cartilage inductive protein from said culture 
medium. 



INTERNATIONAL SEARCH REPORT 

International Application No PCT/US 91/07069 

I. CLASSIFICATION OF SUBJECT MATTER <U several classification symbols apply, indicate all)* 

According to International Patent Classification (IPC) or to both National Classification and IPC 

IPC5: C 07 K 15/06, C 12 N 15/12, A 61 K 37/02 

II. FIELDS SEARCHED _ 



Minimum Documentation Searched 7 



Classification System 


Classification Symbols 


IPC5 


C 07 K; C 12 N; A 61 K 



Documentation Searched other than Minimum Documentation 
to the Extent that such Documents are Included in Fields Searched 8 



HI. DOCUMENTS CONSIDERED TO BE RELEVANT 9 



Category 



Citation of Document, 11 with indication, where appropriate, of the relevant passages 1 



Relevant to Claim No. 13 



p,x 



WO, Al, 9011366 (GENETICS INSTITUTE, INC.) 
4 October 1990, see page 45 - page 48; 
claim 1 



WO, Al, 8910409 (GENETICS INSTITUTE, INC.) 
2 November 1989, 
see the whole document 



WO, Al, 8800205 (GENETICS INSTITUTE, INC.) 
14 January 1988, 
see the whole document 



1-15,17, 
19-22 



1-15,17, 
19-22 



1-15,17, 
19-22 



* Special categories of cited documents: 10 

"A' document defining the general state of the art which is not 
considered to be of particular relevance 

"E* earlier document but published on or after the international 
filing date 

"L* document which may throw doubts on priority claim(s) or 
which is cited to establish the publication. dale of another 
citation or other special reason (as specified) 

*0* document referring to an oral disclosure, use, exhibition or 
other means 

'P* document published prior to ttje international filing date but 
later than the priority date claimed 



*T* later dopument published after the international filing date 
or priority date and not tn conflict with the application but 
cited to understand the principle or theory underlying the 
invention 

*X* document of particular relevance, the claimed, invention 
cannot be considered novel or cannot be considered to 
involve an inventive step 

•Y* document of particular relevance, the claimed invention 
cannot be considered to involve an inventive step when the 
document is combined, with pne or more other such docu- 
ments, such combination being obvious to a person skilled 
in the art. 

document member of the same patent family 



IV. CERTIFICATION 



Date of the Actual Completion of the international Search 

20th February 1992 



Date of Mailing of this International Search Report 

0 5 MAR 1992 



authorized Officer "E " ~ 



International Searching Authority 



EUROPEAN PATENT OFFICE 



Signature of Authorized 

Mme 



orm PdT/lSA/210 (second sheet) (January 1885) 



IntemBtioftft! Application No. PCT/US 91/07069 



III. DOCUMENTS CONSIDERED TO BE RELEVANT (CONTINUED FROM THE SECOND SHEET) 


Category * 


Citation of Document, with indication, where appropriate, of the relevant passages 


Relevant to Claim No 


A 


US, A, 4789732 (URIST) 6 December 1988, 
see the whole document 


1-15,17, 
19-22 


A 


EP, A2, 0212474 (UNIVERSITY OF CALIFORNIA) 
4 March 1987, 
see the whole document 


1-15,17, 
19-22 


P.X 


PROC.NATL.ACAD.SCI., vol. 87, 1990, Anthony J. 

Celeste et al: "Identification of transforming 
growth factor beta family members present in 
bone- inductive protein purified from bovine 
bone 11 , ; figure 2 


1-15,17, 
19-22 


A 


Dialog Information Services, File 154, Medline 85-92 
Dialog accession no. 07827756, Wozney JM: "Bone mor- 
phogenetic proteins", Prog Growth Factor Res 1989, 
1 (4) p 267-80 


1-15,17, 
19-22 



For. PCT/ISA/Z10 (extra srtaaO (January 19653 



FURTHER INFORMATION CONTINUED FROM THE SECOND SHEET 



International Application No. PCT/ US91 707069 



V.E3 OBSERVATION WHERE CERTAIN CLAIMS WERE FOUND UNSEARCHABLE 



becaust they relate to subject matter not required to be searched by this 



This international search report has not been established in respect of certain claims under Article 17{2){a) for the following reasons: 

1 [3 Claim numbers 16, 18 

Authonty, namely: 

See PCT Rule 39.1(iv) 

Methods for treatment of the human or animal body by 
surgery or therapy, as well as diagnostic methods 



*' ^ ^Tth n eTresc*nbed requirements to such an extent that no meanintfullnTern^ out, specifically. 



because they relate to parts of the International application that do not comply 



□ 



Claim numbers 

the second and third sentences of PCT Rule 6.4(a). 



because they are dependent claims and are not drafted in accordance with 



VlD OBSERVATIONS WHERE UNITY OF INVENTION IS LACKING 3 



This International Searching Authonty found multiple Inventions in this International application as fellows: 



1. □ As alt required additional search fees were timely paid by the applicant, this International search report covers all se.rchabl. claims 

of the International application 

2. □ As only some of the requ.red additional search fees were timely P^^y^pplicant international search report covers only 

those claims of the International application for which fees were paid, specifically claims. 

3 □ No required additional search fees were timely paid by the applicant. Consequently, this international search report is restricted to 
the invention first mentioned in the claims; it is covered by claim numbers: 



4. □ As all searchable claims could be searched without effort justifying an additional fee. the International Searching Authority did not 

invite payment of any additional fee. 
Remark on Protest 



OThe additional search fees ware accompanied by applicant's protest. 
I I No protest accompanied the payment of additional search fats. 



Form PCT/ISAV210«supplementai sheet {2)) - P94126 05/91 



ANNEX TO THE INTERNATIONAL SEARCH REPORT 

ON INTERNATIONAL PATENT APPLICATION NO.PCT/US 91/07069 

SA 52105 

This annex lists the patent family members relating to the patent documents cited in the above-mentioned international search report 

The members are as contained in the European Patent Office EOF file on 30/12/91 

The European Patent office is in no way liable for theseparttculars which are merely given for the purpose of information. 



Patent document 


Publication 


Patent family 


Publication 


cited In search report 


date 


members) 


date 


W0-A1- 9011366 


04/10/90 


AU-D- 5357790 


22/10/90 






EP-A- 0429570 


05/06/91 



W0-A1- 8910409 02/11/89 AU-D- 3448789 24/11/89 

EP-A- 0408649 23/01/91 
JP-T- 3503649 15/08/91 



W0-A1- 8800205 14/01/88 



AU-B- 


613314 


01/08/91 


AU-D- 


7783587 


29/01/88 


EP-A- 


0313578 


03/05/89 


JP-T- 


2500241 


01/02/90 


US-A- 


5013649 


07/05/91 


US-A- 


4877864 


31/10/89 



US-A- 4789732 


06/12/88 


US-A- 


4294753 


13/10/81 






US-A- 


4761471 


02/08/88 






US-A- 


4455256 


19/06/84 






US-A- 


4619989 


28/10/86 






US-A- 


4795804 


03/01/89 


EP-A2- 0212474 


04/03/87 


JP-A- 


62111933 


22/05/87 






US-A- 


4795804 


03/01/89 



For more details about this annex : see Official Journal of the European patent O If ice, No. 12/82 
EPO FORM P0479 



This Page is Inserted by IFW Indexing and Scanning 
Operations and is not part of the Official Record 

BEST AVAILABLE IMAGES 

Defective images within this document are accurate representations of the original 
documents submitted by the applicant. 

Defects in the images include but are not limited to the items checked: 

□ BLACK BORDERS 

□ IMAGE CUT OFF AT TOP, BOTTOM OR SIDES 
□(faded TEXT OR DRAWING 

^ BLURRED OR ILLEGIBLE TEXT OR DRAWING 

□ SKEWED/SLANTED IMAGES 

□ COLOR OR BLACK AND WHITE PHOTOGRAPHS 

□ GRAY SCALE DOCUMENTS 

□ LINES OR MARKS ON ORIGINAL DOCUMENT 

□ REFERENCE(S) OR EXHIBIT(S) SUBMITTED ARE POOR QUALITY 

□ OTHER: ' 

IMAGES ARE BEST AVAILABLE COPY. 
As rescanning these documents will not correct the image 
problems checked, please do not report these problems to 
the IFW Image Problem Mailbox.