Skip to main content

Full text of "USPTO Patents Application 09804625"

See other formats


per 



WORLD INTELLECTUAL PROPERTY ORGANIZATION 
International Bureau 




INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) 



(51) International Patent Classification 5 

C07K 15/00, C12N 1/19 
C12P 21/02, C12N 15/62 



Al 



(11) Internationa] Publication Number: 
(43) Internationa] Publication Date: 



WO 92/05198 

2 April 1992 (02.04.92) 



(21) International Application Number: PCT/US91 /06489 

(22) International Filing Date: 13 September 1991 (13.09.91) 



(30) Priority data: 

582,636 



14 September 1990 (14.09.90) US 



(60) Parent Application or Grant 
(63) Related by Continuation 

US 582,636 (C1P) 

Filed on 14 September 1990 (14.09.90) 

(71) Applicant (for all designated States except US): CHIRON 

CORPORATION [US/US]; 4560 Horton Street, Emery- 
ville, CA 94608 (US). 

(72) Inventors; and 

(75) Inventors/Applicants (for US only) : TEKAMP-OLSON, Pa- 
tricia [US/US]; 80 Camino de Herrera, San Anselmo, 
CA 94960 (US). GALLEGOS, Carol, Ann [US/US); 605 
Carmel Avenue, Albany, CA 94706 (US). 



(74) Agents: KAGAN, Sarah, A. et al.; Banner, Birch, McKie 
& Beckett, 1001 G Street, N.W., 11th Floor, Washington, 
DC 20001 (US). 



(81) Designated States: AT (European patent), BE (European 
patent), CA, CH (European patent), DE (European pa 
tent), DK (European patent), ES (European patent), FR 
(European patent), GB (European patent), GR (Euro- 
pean patent), IT (European patent), JP, LU (European 
patent), NL (European patent), SE (European patent), 
US. 



Published 

With international search report. 



(54) Title: EXPRESSION OF MACROPHAGE INDUCIBLE PROTEINS (MIPs) IN YEAST CELLS 



AMINO ACID ALIGNMENT OF MIP-1 HOMOLOGS 



1. hu-MIP-ia 1 HqVSTAALAVLLCT»ULCKO rSAtUAOTPTACCrSYtSHqlPqnriaOYrETSSqCSkPCVirLTKRtBO 

■ IN lltllllll Nil til I I I I I I I I I I I II II It I I I I I I 1 II IIIIIIIII || 

2. mu-MIP-ia 1 MKVSTtALAVtLCTMtLCSOvrSAPyCAOTPTACCrST SRkIPRqFIvDYFETSSl*SqPCV!riT!CRft*0 

II II H I III! I I II I I I I I II I I I I II II I II I I Mill || 

3. mu-MIP-10 1 HKIX:VsAL5LU.LVAArCAPqr5APMC50PPT*CCrSYTS]lqLhltsrVn0yyCTSSLCSkPAVVPLTKA9ltQ 

1 1 1 1 1 mi mill i 1 1 1 1 1 1 1 1 1 1 nun i i i 1 1 Minimi imii mi i 

A. hu-HIP-10 1 IWl^vI£LUlVAArc»P«lSAPMG3DPPT«CCFSYT*^^ 



1. hu-HIF-la 72 vCADptE«WVC*Yv»DLEUA 

in i ill i mi i 

2. au-HXf-ia ?2 ZCAOskEtHVOCYltOUUU 

iii i ti ii nut 

3. mu-HIP-lf 73 ICAnPSEpHVtCYasOLEUI 

It til It II lllll 
4* hu-MlP-lf 73 vCAdPSEttfVqEYvyDLEUI 



(57) Abstract 

Methods for the expression of mammalian MlP-la and MIP-lp are disclosed. Hie methods generally comprise introdu- 
cing into a yeast cell, a DNA molecule capable of directing the expression and if desired the -secretion of either MlP-la or M1P- 
ip. Methods for expression of constructs encoding both MlP-la and MIP-lp are also described. The MIP molecules so produced 
are biologically active. 



FOR THE PURPOSES OF INFORMATION ONLY 



Codes used to identify States party to the PCT on the front pages of pamphlets publishing international 
applications under the PCT. 



AT 


Austria 


es 


Spain 


MC 


Madagascar 


AU 


Australia 


FJ 


Finland 


ML 


Mali 


BB 


Barbados 


FR 


France 


MN 


Mongolia 


BE 


Belgium 


CA 


Gabon 


MR 


Mauritania 


BP 


Burkina Faao 


CB 


United Kingdom 


MW 


Malawi 


BG 


Bulgaria 


CN 


Guinea 


NL 


Netherlands 


BJ 


Benin 


CR 


Greece 


NO 


Norway 


BR 


Brazil 


HU 


Hungary 


PL 


Poland 


CA 


Canada 


IT 


Italy 


RO 


Romania 


CP 


Central African Republic 


JP 


Japan 


SD 


Sudan 


CC 


Congo 


KP 


Democratic People's Republic 


SE 


Sweden 


CH 


Switzerland 




of Korea 


SN 


Senegal 


a 


Cote dlxoiru — 


KR 


Republic of Korea 


su* 


Soviet Union 


CM 


Cameroon 


LI 


Liechtenstein 


TO 


Chad 


cs 


Czechoslovakia 


LK 


Sri Lanka 


TC 


Togo 


DE* 


Germany 


LU 


Luxembourg 


US 


United States of America 


DK 


Denmark 


MC 


Monaco 







+ Any designation of "SU" has effect in the Russian Federation. It is not yet known whether 
any such designation has effect in other States of the former Soviet Union. 



WO 92/05198 



PCT/US91/06489 



1.- 



EXPRESSION OF MACROPHAGE INDUCIBLE 
PROTEINS (MIPS) IN YEAST CELLS 

BACKGROUND OF THE INVENTION 

Macrophage inducible proteins (MIPs) are proteins that are 
produced by certain mammalian cells (for example, macrophages and 
lymphocytes) in response to stimuli such as gram negative bacterial 
lipopolysaccharide and concanavalin A. Thus, the MIP molecules may 
have diagnostic and therapeutic utility for detecting and treating 
infections, cancer, myleopoietic dysfunction and auto-immune diseases. 

Murine MIP-1 is a major secreted protein from 
lipopolysaccharide (LPS)-stimulated RAW 264.7 cells, a murine 
macrophage tumor cell line. It has been purified and found to consist 
of two related proteins MIP-la and MIP-ls (Wolpe et al M 1987 J. Exp. 
Med. 167: 570; Sherry et ah, 1988, J. Exp. Med. 168: 2251). 

The cDNAs for both murine MIP-la and murine MIP-ls have 
been cloned and sequenced (Davatelis et al., 1988, J. Exp. Med. 
167:1939; Sherry et al., op. cit.) The cloning and sequencing of cDNAs 
corresponding to murine MIP-la and MIP-ls have also been 
accomplished (Brown et al., 1989, J. Immun. 142:679; Kwon and 
Weissman, 1989, Proc. Natl. Acad. Sci. USA 86:1963 and by Brown al M 
op. cit.) Both groups isolated these homologs of MIP-la and/or MIP-ls 
from cDNA libraries prepared from RNA of murine helper T-cells that 
had been activated by treatment with concanavalin A. These results 
suggest that MIP-la and MIP-lB may play a role in T-cell activation. 

Several groups have cloned what are likely to be the human 
homologs of MIP-la and MIP-lB. In all cases, cDNAs were isolated 
from libraries prepared against activated T-cell RNA. Thus both Obaru 
et al., (J. Biochem. 99:885, 1986) and Zipfel et al. (J. Immun. 142:1582, 
1989) have reported the cloning of a cDNA that encodes a protein with 
high homology to MIP-la (76%). Similarly, Brown et al, op cit., -Zipfel 



WO 92/05198 



-2- 



PCT/US91/06489 



et al M op. cit.; Lipes et al., (Proc. Natl. Acad. USA 85:9704, 1988) and 
Miller, et al. (J* Immun., 143:2907, 1989) have reported the cloning and 
sequencing of human cDNAs, which predict a protein with high 
homology to MIP-lB (75%). In addition to the above described highly 
homologous proteins, MIP-la and MIP-ls belong to a newly described 
family of related proteins which have immunomodulatory activities 
(see Sherry et al. f op. cit. for a review). 

The definition of the bioactivities of MIP-1 has begun and has 
utilized native MIP-1 and very recently recombinant MIP-la and 
MIP-lB. Purified native MIP-I (comprising MIP-la and MIP-ls 
polypeptides) causes acute inflammation when injected either 
subcutaneously into the footpads of mice or intracisternally into the 
cerebrospinal fluid of rabbits (Wolpe and Cerami, 1989, FASEB J. 
3:2565; Saukkonen, et al., 1990, J. Exp. Med., 171:439). Native MIP-1 
evokes a monophasic fever of rapid onset in rabbits when injected 
intravenously (Davatelis, et al., 1989, Science, 243:1066). In addition to 
these pro-inflammatory properties of MIP-1, which may be direct or 
indirect, MIP-1 has been recovered during the early inflammatory 
phase of wound healing in an experimental mouse model employing 
sterile wound chambers (Fahey, et al M 1990, Cytokine, 2:92). 

MIP-1 may also participate in immune regulation. Antigen and 
nitrogen stimulation of quiescent T cells markedly induces the 
expression of several members of this cytokine superf amily including 
MIP-la, MIP-lB, MIP-2 and IL-8 (Sherry and Cerami, 1991, Curr. Opin. 
Immun., 3:56). MIP-1 has several effects on macrophage function. 
Although not directly cytotoxic for WEH1 tumor cells, MIP-l-treated 
macrophages exhibited enhanced antibody-independent macrophage 
cytotoxic for tumor targets. MIP-1 treatment stimulated proliferation 
of mature tissue macrophages; this effect was synergistic with both 
CSF-1 and GM-CSF. Thioglycollate-elicited peritoneal exudate 
macrophages incubated with native doublet MIP-l expressed TNF and 
IL-ls mRNA, and these inductive effects were enhanced significantly 
when the cells were co-stimulated with IFN-y- Purified preparations of 
the recombinantly-derived MIP-la peptide alone induced TNF and IL-6 
in macrophages, but MIP-1& did not. In fact, as little as two-fold 



WO 92/05198 



-3- 



PCT/US91/06489 



excess MIP-ls blocked TNF-induction by MIP-lo to a significant 
degree. By contrast to these apparent "macrophage activating" 
properties of MIP-1, the cytokine failed to trigger the macrophage 
oxidative burst, or to upregulate the expression of la on the 
macrophage surface. Taken together, these data reveal that MIP-l 
peptides act as autocrine modulators of their cells of origin, and raise 
the possibility that MIP-1 peptides may play a role in modulating 
macrophage responses to inflammatory stimuli in vivo . 

Among the bioactivities defined for native MIP-l and recom- 
binant MlP-la, and MIP-1B are colony stimulating factor promoting 
activity. (Broxmeyer, et al., J. Exp. Med. 170:1583, 1989; Broxmeyer, 
et al. t Blood 76:1110, 1990). Native murine MIP-1 or recombinant 
murine MIP-la but not recombinant MIP-1B have also been found to in- 
hibit the proliferation of less differentiated erythropoietin IL-3 depen- 
dent hematopoietic progenitor cells. (Graham, et al., Nature 344:442, 
1990, Broxmeyer, et al., Blood, 76:1110, 1990.) Due to the necessity for 
quantities of purified factors to pursue definition of bioactivities, and 
the difficulty of isolating these factors from natural sources, it is 
desirable to produce MIP proteins by recombinant DNA technology. 

MIP-1 and some members of the MIP-1 related gene family have 
been expressed by recombinant DNA technology as described below. 
Included as well is background data on members of the MIP-2 gene 
family, the members of which are distantly related to members of the 
MIP-l gene family. Murine MIP-la and MIP-1 8 have been 
independently expressed in COS cells (Graham, et al., op. cit.) LD78 
cDNA (Obaru, et al., op. cit.) which encodes a protein that is likely to 
be the human homolog of murine MIP-la has been expressed in E. coli 
as a carboxyl terminal fusion to human IL-2 as well as in COS cells 
(Yamamura, et al., J. Clin. Invest. 84:1707, 1989). Human 1-309, a 
cDNA that encodes a protein with homology to the MIP-1 family of 
proteins, has been expressed in COS-l cells in order to confirm that it 
encodes a secreted protein (Miller, et al., op. cit.). JE, a cDNA that 
encodes a protein with homology to MIP-la and MIP-1B, has been 
expressed in COS-l cells; it encodes a polypeptide core of about 12 kDa 
(Rollins, et al., 1988, Proc. Natl. Acad. Sci. USA 85:3738). 



WO 92/05198 



PCT/US91/06489 



" 4 " 

KC, a cDNA that encodes a protein with homology to MIP-2, has 
been expressed in COS-l cells to show that it encodes a secreted 
protein (Oguendo et al., 1989, J. Biol. Chem. 264:4133) Connective 
tissue activating peptide-m (CTAP, Mullenbach et al., 1986, J, Biol 
Chem, 261:719) and IP-10, (Luster and Ravetch, 1987, J. Exp. Med. 
166:1084) both members of the MIP-2 gene family, have been expressed 
as an a-factor fusion in yeast and in E. coli , respectively. Maione et 
al M (1990, Science 247:77) expressed human platelet factor 4, (MIP-2 
family) in E. coli as a protein fusion to 35 amino acids of E. coli 
B-glucuronidase. The insoluble fusion must be cleaved with cyanogen 
bromide in order to generate bioactive material. Lindley et al M (1988, 
Proc. Natl. Acad. Sci. USA, 85:9199) have expressed NAF (IL-8), a 
member of the MIP-2 family, in E. coli. After purification and 
renaturation, this recombinant protein was found to have the same 
bioactivity identified for the native molecule. Furuta et al., (1989, J. 
Bio chem. 106:436) have also expressed IL-8 (MDNCF) in E. coli. Lipes, 
et al. (op. cit.) described baculovirus expression of Act-2 cDNA, which 
encodes human MIP-1B. Finally, Gimbrone et al., (1989 Science 
246:1601) have expressed endothelial IL-8 in human 293 cells and have 
shown that the recombinant and natural material have the same 
bioactivity. However, MIP-la and MIP-16 have yet to be expressed in 
yeast cells. 

Thus, there is a need in the art for additional sources of 
mammalian inflammation mediator proteins to provide an economical 
way to obtain useful amounts of the proteins* 
SUMMARY OF THE INVENTION 

It is an object of the invention to provide a DNA molecule which 
is active as a template for producing mammalian macrophage 
inflammatory proteins (MIPs) in yeast. 

It is another object of the invention to provide a yeast cell 
containing a DNA molecule which is active as a template for producing 
mammalian macrophage inflammatory proteins. 

It is yet another object of the invention to provide a method stf 
producing MIP-1 polypeptides. 



WO 92/05198 



-5- 



PCT/US91/06489 



It is still another object of the invention to provide MIP-1 
compositions. 

These and other objects of the invention are provided by one or 
more of the embodiments described below. In one embodiment, a DNA 
molecule is provided which comprises, in order of transcription: (a) a 
transcription regulatory region operative in a yeast; (b) a region which 
encodes a mammalian protein selected from the group consisting of 
MIP-la, and MIP-1 B; said molecule active as a template for producing 
the mammalian protein in yeast. 

In another embodiment of the invention a yeast cell is provided 
which contains a DNA molecule comprising, in order of transcription: 
(a) a transcription regulatory region operative in a yeast; (b) a region 
which encodes a mammalian protein selected from the group consisting 
of MIP-la f and MIP-1B; said molecule active as a template for 
producing the mammalian protein in yeast. 

In still another embodiment of the invention a method is 
provided for producing a MIP polypeptide which comprises: growing a 
yeast cell in a nutrient medium whereby a MIP is expressed, said cell 
having a DNA molecule comprising in order of transcription: (a) a 
transcription regulatory region operative in a yeast; (b) a region which 
encodes a mammalian protein selected from the group consisting of 
MIP-la, and MIP-1B; said molecule active as a template for producing 
the mammalian protein in yeast. 

In still another embodiment of the invention a composition is 
provided which comprises a mammalian protein selected from the 
group consisting of murine MIP-la, murine MIP-1S, human MIP-la and 
human MIP-ls, wherein the MIP is substantially free of non-MIP, 
mammalian proteins, and wherein the MIP is synthesized in a yeast 
cell. 

The present invention thus provides the art with economical 
means to produce mammalian MIP proteins in ample quantities. This 
allows the full range of their bioactivities to be determined, and allows 
their use diagnostically and therapeutically. 



WO 92/05198 



-6- 



PCT/US91/06489 



BRIEF DESCRIPTION OF THE FIGURES 

Figure 1 displays the cDNA sequence and predicted protein 
sequence of human MIP-la. 

Figure 2 displays the cDNA sequence and predicted protein 
sequence of human MIP-1B. 

Figure 3 shows an alignment of the predicted amino acid 
sequences of MIP-1 homologs. 
DETAILED DESCRIPTION OF THE INVENTION 

It is a finding of the present invention that the mammalian MIP 
proteins can be expressed in and secreted from yeast cells. The 
proteins so expressed have biological activity. Thus yeast cells 
transformed with appropriate DNA constructs are suitable sources of 
MIP for therapeutic and investigational purposes. 

MIP-1 is a monokine which acts as a primary negative regulator 
of hematopoietic stem cell proliferation. For example, MIP-1 is known 
to inhibit DNA synthesis in primative hematopoietic cells (CFU-A) 
(Graham, et al., op. cit.). In addition, it enhances proliferation of more 
mature hematopoietic cells, including CFU-GM (Broxmeyer, et al., op. 
cit.) which have been stimulated with GM-CSF. 

According to the findings of the present invention DNA 
molecules and host cells are provided for making MIP-1 proteins in 
yeast. The DNA molecules contain a region which encodes at least one 
mammalian MIP-1 protein. The MIP-1 may be human or murine, for 
example, and may consist of either the a or the s subunit. The MIP-l 
coding region may also encode related proteins such as "muteins." 
These are closely related proteins which have been altered slightly to 
change one or more amino acids of the sequence, for example by 
substitution, deletion or insertion. Preferably less than about 8 amino 
acids have been altered, ususally 4 or less, and more typically 2 or less. 
It may be preferred to make conservative substitutions, i.e., 
exchanging one amino acid for another of similar properties, such as 
charge. Muteins typically retain all of the activity of the parent 
protein, but may have increased stability or other useful properties 
relative to the natural protein. The MIP-1 coding region may also 



WO 92/0S198 



-7- 



PCT/US91/06489 



encode a truncated MIP-l. Typically the truncated protein retains 
activity or unique epitopes of MIP-1. 

The coding region is linked to a transcription regulatory region 
which is operative in a yeast. The transcription regulatory region may 
provide inducible or constitutive expression, as is desired. At a 
minimum, the regulatory region provides a promoter for initiation of 
transcription by RNA polymerase. The regulatory region may be 
derived from any yeast gene having the desired regulatory properties. 
For example, the yeast alcohol dehydrogenase, hexokinase, enolase, 
glyceraldehyde-3-phosphate dehydrogenase, pyruvate decarboxylase, 
phosphofructokinase, glucose-6-phosphate isomerase, 

3-phosphoglycerate mutase, pyruvate kinase, triosephosphate 
isomerase, phosphoglucose isomerase, and glucokinase promoters can 
be used. These promoters are well known in the art. The transcription 
regulatory region is linked to the coding region such that transcription 
from the regulatory region continues through the coding region. When 
the DNA molecule of the invention is present in a yeast cell, MIP 
messenger RNA is made and translated. Expression according to the 
present invention denotes transcription and translation of a DNA 
sequence to produce a MIP protein. 

A yeast promoter is any DNA sequence capable of binding yeast 
RNA polymerase and initiating the downstream (3') transcription of a 
coding sequence (e.g., structural gene) into mRNA. A promoter will 
have a transcription initiation region which is usually placed proximal 
to the 5' end of the coding sequence. This transcription initiation 
region typically includes an RNA polymerase binding site (the "TATA 
Box") and a transcription initiation site. A yeast promoter may aiso 
have a second domain called an upstream activator sequence <UAS), 
which, if present, is usually distal to the structural gene. The UAS 
permits regulated (inducible) expression. Constitutive expression 
occurs in the absence of a UAS. Regulated expression may be either 
positive or negative, thereby either enhancing or reducing 
transcription. 

Yeast is a fermenting organism with an active metabolic 
pathway, therefore sequences encoding enzymes in the metabolic 



WO 92/05198 



-8- 



PCT/US91/06489 



pathway provide particularly useful promoter sequences. Examples 
include alcohol dehydrogenase (ADH) (E.P.O. Pub. No. 284044), enolase, 
glucokinase, glucose-6-phosphate isomerase, glyceraldehyde- » 
3-phosphate-dehydrogenase (GAP or GAPDH), hexokinase, 
phosphofructokinase, 3-phosphoglycerate mutase, and pyruvate kinase 
(PyK) (E.P.O. Pub. No. 329203). The yeast PHQ5 gene, encoding acid 
phosphatase, also provides useful promoter sequences [Miyanohara, et 
al., (1983) Proc. Natl. Acad. Sci. USA 80:1 ] . 

In addition, synthetic promoters which do not occur in nature 
also function as yeast promoters. For example, UAS sequences of one 
yeast promoter may be joined with the transcription activation region 
of another yeast promoter, creating a synthetic hybrid promoter. 
Examples of such hybrid promoters include the ADH regulatory 
sequence linked to the GAP transcription activation region (U.S. Patent 
Nos. 4,876,197; 4,880,734). Other examples of hybrid promoters include 
promoters which consist of the regulatory sequences of either the 
ADH2 . GAL4, GAL10 . or PHQ5 genes, combined with the 
transcriptional activation region of a glycolytic enzyme gene such as 
GAP or PyK (E.P.O. Pub. No. 164556). Furthermore, a yeast promoter 
can include naturally occurring promoters of non-yeast origin that have 
the ability to bind yeast RNA polymerase and initiate transcription. 
See, e.g., Cohen, et al. (1980) Proc. Natl. Acad. Sci. USA 77:1078; 
Henikoff, et al. (1981) Nature . 283:835; Hollenberg, et al M (1981) Curr. 
Topics Microbiol. Immunol. 96:119, Hollenberg, et al., "The Expression 
of Bacterial Antibiotic Resistance Genes in the Yeast Saccharomvces 
cerevisiae ." in: Plasmids of Medical. Environmental and Commercial 
Importance (eds. K.N. Hmmis and A. Puhler); Mercereau-Puigalon, et 
al. (1980) Gene 11:163; Panthier, et al. (1980) Curr. Genet. , 2:109. 

A promoter sequence may be directly linked with the ONA 
molecule encoding MIP, in which case the first amino acid at the 
N-terminus of the recombinant protein will always be a methionine, 
which is encoded by the ATG start codon. If desired, methionine at the 
N-terminus may be cleaved from the protein by in vitro incubation s 
with cyanogen bromide. 



WO 92/05198 



-9- 



PCT/US91/06489 



Fusion proteins provide an alternative to direct expression. 
Typically, a DNA sequence encoding the N-terminal portion of an 
endogenous yeast protein, or other stable protein, is fused to the 5 f end 
of heterologous coding sequences. Upon expression, this construct will 
provide a fusion of the two amino acid sequences. For example, the 
yeast or human superoxide dismutase (SOD) gene, can be linked at the 
5' terminus of a foreign gene and expressed in yeast. The DNA 
sequence at the junction of the two amino acid sequences may or may 
not encode a cleavable site. See, e.g., EPO Pub. No. 196056. Another 
example is a ubiquitin fusion protein. Such a fusion protein is made 
with the ubiquitin "leader" or "pro-" region that preferably retains a 
site for a processing enzyme (e.g. ubiquitin-specific processing 
protease) to cleave the ubiquitin from the foreign protein. Through 
this method, therefore, native foreign protein can be isolated (PCT WO 
88/024066; commonly owned U.S. Patent Application Serial No. 
390,599, filed 7 August 1989, the disclosure of which is incorporated 
herein by reference). 

Alternatively, foreign proteins can also be secreted from the 
cell into the growth media by creating chimeric DNA molecules that 
encode a fusion protein comprised of a leader sequence fragment that 
provide for secretion in yeast and the foreign gene. Preferably, there 
are processing sites (in vivo or in vitro ) encoded between the leader 
fragment and the foreign gene. Preferred in vivo sites include dibasic 
sequences such as lys-lys, arg-arg, lys-arg, and arg-lys. The leader 
sequence fragment typically encodes a signal peptide comprised of 
hydrophobic amino acids which direct the secretion of the protein from 
the cell. DNA encoding suitable signal sequences can be derived 
from genes for secreted yeast proteins, such as the yeast invertase 
gene (E.P.O. Pub. No. 12,873; J.P.O. Pub. No. 62,096,086) and the 
A-factor gene (U.S. Patent No. 4,588,684). Alternatively, leaders of 
non-yeast origin, such as an interferon leader, exist that also provide 
for secretion in yeast (U.S. Patent No. 4,775,622). Concomitant 
cleavage of the signal peptide from the MIP is also desirable. This is 
usually accomplished at a processing site. The processing is preferably 
accomplished in vivo by endogenous yeast enzymes during the process 



WO 92/05198 



- 10- 



PCIYUS91/06489 



of translocation. Alternatively, in vitro processing can be employed 
using non-yeast enzymes or chemical cleavage. 

A preferred class of secretion leaders are those that employ a 
fragment of the yeast alpha-factor gene, which contains both a "pre" 
signal sequence, and a "pro" region. The types of alpha-factor 
fragments that can be employed include the full-length pre-pro alpha 
factor leader (about 83 amino acid residues) as well as truncated 
alpha-factor leaders (typically about 25 to about SO amino acid residues) 
(U.S. Patent Nos. 4,546,082 and 4,870,008; E.P.O. Pub. No. 324274). 
Additional leaders employing an alpha-factor leader fragment that 
provides for secretion include hybrid alpha-factor leaders made with a 
presequence of a first yeast, but a pro-region from a second yeast 
alpha-factor. (See, e.g M PCT WO 89/02463.) 

The DNA molecules of the present invention will typically 
contain termination signals for transcription at the 3' end of the MIP 
protein coding region. This signal can be from any yeast gene, such as 
those used to supply promoters or signal sequences. In addition, the 
DNA molecules will typically contain a replication origin so that the 
DNA molecule can function as an autonomous unit for DNA replication. 
Often the DNA molecule will be in the form of a plasmid, although 
cosmids, viruses and mini-chromosomes can also be used. Often, the 
DNA molecule will be bifunctional, i.e., able to maintain itself in cells 
of two different genera. 

Examples of yeast-bacteria shuttle vectors include YEp24 
[Botstein, et aL, (1979) Gene . 8:17-24], pCl/1 [Brake, et al M (1984) 
Proc. Natl. Acad. Sci. USA . 81:4642-4646], and YRpl7 [Stinchcomb, et 
ah, (1982) J. MoL Biol. . 158:157]. In addition, a replicon may be either 
a high or low copy number plasmid. A high copy number plasmid will 
generally have a copy number ranging from about 5 to about 200, and 
typically about 10 to about 150. A host containing a high copy number 
plasmid will preferably have at least about 10, and more preferably at 
least about 20. Either a high or low copy number vector may be 
selected, depending upon the effect of the vector and the foreign 
protein on the host. See, e.g., Brake, et al M supra . 



WO 92/05198 



-11- 



PCT/US91/06489 



Alternatively, the expression constructs can be integrated into 
the yeast genome with an integrating vector. Integrating vectors 
typically contain at least one sequence homologous to a yeast 
chromosome that allows the vector to integrate, and preferably contain 
two homologous sequences flanking the expression construct. 
Integrations appear to result from recombinations between homologous 
DNA in the vector and the yeast chromosome [Orr- Weaver, et al. 
(1983), Methods in Enzvmol .. 101:228-245]. An integrating vector may 
be directed to a specific locus in yeast by selecting the appropriate 
homologous sequence for inclusion in the vector. See Orr-Weaver, et 
ah, supra . One or more expression constructs may integrate, possibly 
affecting levels of recombinant protein produced [Rine, et al., (1983) 
Proc. Natl. Acad. ScL , USA 80:6750]. The chromosomal sequences 
included in the vector can occur either as a single segment in the 
vector, which results in the integration of the entire vector, or two 
segments homologous to adjacent segments in the chromosome and 
flanking the expression construct in the vector, which can result in the 
stable integration of only the expression construct. 

Typically, extrachromosomal and integrating expression 
constructs may contain selectable markers to allow for the selection of 
yeast strains that have been transformed. Selectable markers may 
include biosynthetic genes such as ADE2, HIS4, LEU2, TRP1 . and URA3 . 
Selectable markers may also include drug resistance genes such as 
ALG7 or a G418 resistance gene, which confer resistance in yeast cells 
to tunicamycin and G418, respectively. In addition, a suitable 
selectable marker may also provide yeast with the ability to grow in 
the presence of toxic substances, such as certain metals. For example, 
the presence of CUPl allows yeast to grow in the presence of copper 
ions [Butt et al. (1987) Microbiol. Rev. 51:351]. 

Expression vectors, either extrachromosomal replicons or 
integrating vectors, have been developed for transformation into many 
yeasts. For example, expression vectors have been developed for inter 
alia, the following yeasts: Candida albicans [Kurtz, et al. (1986) Mol. 
Cell. Biol. . 6:142], Candida maltosa [Kunze, et al. (1985), J. Basic 
Microbiol. . 25:141], Hansenula polvmorpha [Gleeson, et aL, (1986) J. 



WO 92/05198 



-12- 



PCT/US91/06489 



Gen. Microbiol. , 132:3459; Roggenkamp, et al. (1986), MoL Gen. Genet. . 
202:302]. Kluweromvces fragilis [Das, et al., (1984), J. Bacterid. . 
158:1165], Kluvveromvcces lactis [De Louvencourt et al., (1983), J. 
BacterioL . 154:737; Van den Berg, et al., (1990) Bio/Technology . 8:135], 
Pichia guillerimondii [ Kunze et al., (1985), J. Basic Microbiol .. 25:141 ] , 
Pichia pastoris [Cregg, et al., (1985), MoL Cell BioL . 5:3376; U.S. 
Patent Nos. 4,837,148, 4,879,231, and 4,929,555], Saccharomvces 
cerevisiae [Hinnen et al., (1978), Proc. Natl. Acad. Sci. USA . 75:1929; 
Ito, et al., (1983) J. BacterioL . 153:163], Schizosaccharomyces pombe 
[Beach and Nurse (1981), Nature . 300:706], and Yarrowia lipolvtica 
iDavidow, et al., (1985), Curr. Genet. . 10:39-48; Gaillardin, et al. 
(1985), Curr. Genet. . L0:49]. 

In general, DNA encoding a mammalian MIP may be obtained 
from human, murine, or other sources by constructing a cDNA library 
from mRNA isolated from mammalian tissue, and screening with 
labeled DNA probes encoding portions of the human or murine chains in 
order to detect clones in the cDNA library that contain homologous 
sequences. Alternatively, polymerase chain reaction (PCR) 
amplification of the cDNA (from mRNA) and subcloning and screening 
with labeled DNA probes may be used. Clones may be analyzed by 
restriction enzyme analysis and nucleic acid sequencing so as to 
identify full-length clones. If full-length clones are not present in the 
library, fragments can be recovered from the various clones and ligated 
at restriction sites common to the clones to assemble a clone encoding 
a full-length molecule. Any sequences missing from the 5 ! end of the 
cDNA may be obtained by the 3 1 extension of synthetic oligonucleotides 
complementary to MIP sequences using mRNA as a template (the 
primer extension technique.) Alternatively, homologous-sequences may 
be supplied from known cDNAs derived from human or murine 
sequences disclosed herein. 

The practice of the present invention will employ unless 
otherwise indicated, conventional molecular biological, microbiological 
and recombinant DNA techniques, all within the skill of the ordinary 
artisan. Such techniques are set forth in the literature. See, e.g., 
Maniatis, Fritsch & Sambrook, "Molecular Cloning: A Laboratory 



WO 92/05198 



-13- 



PCT/US91/06489 



Manual" (1982); "DNA Cloning: A Practical Approach," Volumes I and 
II (D.N. Glover ed. 1985); "Oligonucleotide Synthesis" (M.J.Gait ed. 

1984) ; "Nucleic Acid Hybridization" (B.D. Hames & S.J. Higgins eds. 

1985) ' "Transcription and Translation" (B.D. Hames 6c S.J. Higgins eds. 
1934); "Animal Cell Culture" (R.I. Freshney ed, 1986); "Immobilized 
Cells and Enzymes: (IRL Press, 1986); B. Perbal, "A Practical Guide to 
Molecular Cloning" (1984). 

As used herein, "yeast" includes ascosporogenous yeasts 
(Endomyceltales), basidiosporogenous yeasts and yeast belonging to the 
Fungi imperfecti (Blastomycetes). The ascosporogenous yeasts are 
divided into two families. Spermophthoraceae and Saccharomyceta- 
ceae. The latter is comprised of four subfamilies, Schizosaccharomy- 
coidaea (e.g., genus Schizosccharomyces), Nadsonioideae, Lipomycoi- 
deae and Saccharomycoideae (e.g., genera Pichia, Kluyveromyces and 
Saccharomyces). The basidiosporogenous yeasts include the genera 
Leucosporidium, Rhodosporidium, Sporidiobolus, Filobasidium and 
Filobasidiella. Yeast belonging to the Fungi Imperfecti are divided into 
two families, Sporobolomycetaceae (e.g., genera Sporobolomyces, 
Bullera) and Cryptococcaceae (e.g., genus Candida). Of particular 
interest to the present invention are species within the genera Pichia, 
Kluyveromyces, Saccharomyces, Schizosaccharomyces and Candida. 
Of particular interest are the Saccharomyces species S. cerevisiae . S. 
carlsbergensis . S. diastaticus . S. douglasii , S. kluyveri . S. norbensis and 
S. ovlformis . Species of particular interest in the genus Kluyveromyces 
include K. lactis . Since the classification of yeast may change in the 
future, for the purposes of this invention, yeast shall be defined as 
described in Biology and Activities of Yeast <F.A. Skinner, S.M. 
Passmore & R. Davenport eds. 1980) (Soc. App. Bacterial. Symp. Series 
No. 9). In addition to the foregoing, those of ordinary skill in the art 
are presumably familiar with the biology of yeast and the manipulation 
of yeast genetics. See, e.g., Biochemistry and Genetics of Yeast (M. 
Bacila, B.L. Horecker & A.O.M. Stoppani^ds. 1978); The Yeasts (A.H. 
Rose & J.S. Harrison eds., 2nd ed. f 1987); The Molecular Biology of the 
Yeast Saccharomyces (Strathern et ah, eds. 1981). The disclosures of 
the foregoing references are incorporated herein by reference. 



WO 92/05198 



PCT/US91/06489 



- 14- 

Yeast cells are transformed with the DNA molecules of the 
present invention according to known techniques for introduction of 
DNA. (See, e.g., Hinnen et al. (1978) PNAS 75:1919-1933 and 
Stinchcomb et. al. EP 45,523.) Methods of introducing exogenous DNA 
into yeast hosts are well-known in the art, and typically include either 
the transformation of spheroplasts or of intact yeast cells treated with 
alkali cations. Transformation procedures usually vary with the yeast 
species to be transformed. See, e.g., Kurtz, et al. (1986), Mol. Cell. 
BioL, 6:142, Kunze, et al. (1985), J. Basic Microbiol. . 25:141, for 
Candida : Gleeson, et al., (1986), J. Gen. Microbiol. . 132:3459. 
Roggenkamp, et al. (1986), Mol. Gen. Genet. . 202:302, for Hansenula : 
Das, et al., (1984), J, BacterioL . 158:1165, De Louvencourt et al., 
(1983), J. BacterioL . 154:1165, Van den Berg, et al., (1990), 
Bio/Technology . 8:135, for Kluweromvces : Cregg, et al., (1985), Mol. 
Cell Biol. . 5:3376, Kunze, et al. (1985), J. Basic Microbiol. . 25:141, U.S. 
Patent Nos. 4,837,148 and 4,929,555, for Pichia : Hinnen, et al. (1978), 
Proc. Natl. Acad. Sci. USA . 75:1929, Ito, et al. (1983), J BacterioL . 
153:163, for Saccharomvces : Davidow, et al., (1985) Curr. Genet. . 
10:39, Gaillardin, et al. (1985), Curr. Genet. . 10:49, for Yarrowia . 

Yeast cells are grown in culture in nutrient media according to 
well known techniques. (See, e.g., American Type Culture Collection 
Media Handbook.) According to the present invention yeast cells which 
"have" a certain DNA molecule contain that molecule stably, that is, 
the DNA is faithfully replicated in the cells. A single yeast cell, 
according to the invention can be transformed with DNA for either/or 
both of the MIP-1 subunits o and 8. Thus monomer, homomers and 
heteromers could be formed in the yeast or in the culture medium. 

The practice of the teachings of the present invention leads to 
compositions containing mammalian MIP-l proteins. These composi- 
tions are substantially free of non-MIP, mammalian proteins, because 
they are produced in yeast cells. "Substantially free" denotes greater 
than about 75% by weight MIP relative to the protein content of the 
entire composition. Preferably, the MIP is greater than about 90% by 
weight, and most preferably the MIP is greater than about 99% by 
weight of the protein of the composition. Indeed, compositions in 



WO 92/05198 



-15- 



PCT/US91/06489 



which the only mammalian protein is an MIP-l are provided by the 
present invention. 

The following examples are provided for illustrative purposes 
and do not limit the scope of the invention. 

EXAMPLES 

Example 1 

This example describes the cloning of murine MIP-la and murine 
MIP-lB coding sequences. 

A cDNA library was constructed from Poly(A) + RNA isolated 
from E. coli lipopolysaccharide-stimulated RAW 264.7 (murine 
macrophage tumor cell line) cells. The cloning of the cDNAs for 
murine MIP-la and murine MIP-lB are described in Davatelis et al., J. 
Exp. Med. 167, 1939-1944 (1988), and Sherry et al. v J. Exp. Med. 168, 
2251-2259 (1988), which are incorporated by reference herein. 

This example describes the cloning of human MIP-la and human 
MIP-18 coding sequences. 

1. Library Construction 

The human monocytic-like cell line U937 was grown to 
confluence and stimulated to differentiate by the addition of phorbol 
12-myristate 13-acetate (PMA) to a final concentration of 5xl<f 8 M. 
After 24 hours in the presence of PMA, lipoplysaccharide was added to 
a final concentration of lug/ml and the cells were incubated for an 
additional 3 hours at 37 °C. Total RNA was prepared essentially as 
described by Cathala et al., (DNA 2: 329, 1983). Poly A+ RNA was 
prepared by a single passage over oligo-dT cellulose, essentially as 
described by Okayama et al. (Methods Enzymol. 154, 3, 1987) and 
Maniatis et al., (Molecular Cloning: A Laboratory manual, Cold Spring 
Harbor Laboratory, 1982). Double-stranded cDNA was prepared by 
standard methods and cloned and packaged into xgtlO. Duplicate 
nitrocellulose filter lifts of the plated library (5.6-7x1 0 5 plaques) were 
pre-hybridized at 52 °C in 50% formamide, SxSSC, SOmM sodium 
phosphate buffer, pH6.5, 0.2% SDS, 2x Denhardt's and 0.25 mg/ml 
sonicated salmon sperm DNA. Filters were then hybridized at 42 °C 
overnight in 50% formamide, SxSSC, 20mM sodium phosphate, pH6.5, 



0.1% SDS, lxDenhardt's, 10% dextran sulfate, 0.1 mg/ml sonicated 
salmon sperm DNA and approximately 500,000 cpm per ml of the 
appropriate 32 P-ATP nick-translated murine cDNA probe. 

2. Screening for Human Humologs to mu-MIP-la, mu-MIP-lB 
In order to screen for human homologs to murine MIP-la and 

MIP-1B, the following two fragments were isolated. For MIP-la, a 236 
bp KpnI-Sall fragment was isolated from pMIP200. (Construction of 
pMIP200 is described below.) This fragment includes all of the murine 
MIP-la mature coding sequence. To screen for homologs to murine 
MIP-ls, a 213 bp Ncol-Sall fragment was isolated from pMIP300. 
(Construction of pMIP300, is described below.) This fragment encodes 
all but the first two amino acids of the murine MIP-1B mature coding 
sequence. 

The DNA fragments were nick translated and 500,000 cpm per 
ml of each nick translated probe was hybridized to the U937 cDNA 
library. Both probes were included in the first round of screening. 
Filters were subjected to three low stringency washes for 30 minutes 
each at room temperature in 2xSSC, 0.1% SDS. 

Many positive clones were identified. Nineteen were chosen for 
a second round of plaque purification. Duplicate filter lifts from these 
plates were independently hybridized, as described above, with either 
the murine MIP-la or the murine MIP-1B cDNA probe. Washes were as 
for the primary screening. This screening showed that under these 
wash conditions it was not possible to distinguish between clones 
homologous to murine MIP-la and MIP-lB. 

3. Determining the Sequence of Human MIPs 

The nucleotide sequence from nine independent phage clones 
was "determined by the dideoxy chain termination method of Sanger et 
al., (Proc. Natl. Acad. Sci. USA 74, 5463 (1977), following -subcloning of 
insert DNA into the M13 phage vector. Two cDNA homologs were 
defined. Based on nucleotide sequence homology to the two murine 
MIP-1 peptides, clones MIP-1 2b, 3a, 4a, 4b and 5b defined the human 
homolog of mu-MIP-la, cDNA hu-MIP-la ( Figure l ): and clones 
MIPl-8a, lib, 13a defined the human homolog to mu-MIP-l£, cDNA 
hu-MIP-lB (Figure 2 ). Assignment of cDNAs as human homologs of 



WO 92/05198 



-17- 



PCT/US91/06489 



murine MIP-la or -10 was based on both nucleotide and amino acid 
homology comparisons. Hu-MIP-la has 68.5% (740 nucleotide overlap) 
homology to mu-MIP-la and 57.8% nucleotide homology (555 nt overlap) 
to mu-MIP-lB. The percentage nucleotide identity of hu-MIP-16 to 
mu-MIP-la and mu-MIP-ls is 59.0% (559 nt overlap) and 72.7% (600 nt 
overlap) respectively. The percent identity of the predicted protein 
sequence of hu-MIP-la to that of mu-MIP-la and mu-MIP-lB is 75.3% 
(93 aa overlap) and 58.2% (91 aa overlap) respectively. Similarly 
hu-MIP-16 has 59.3% (91 aa overlap) and 74.7% (91 aa overlap) amino 
acid sequence identity to mu-MIP-la and mu-MIP-18, respectively. An 
alignment of the predicted amino acid sequences of these MIP-1 
homologs is presented in Figure 3 . 

Hu-MIP-la cDNA is identical to cDNAs LD78 and AT464 isolated 
previously by Obaru et al. t op. cit M and Zipfel et al., op. cit. 
respectively. Hu-MIP-16 cDNA is virtually identical to cDNAs isolated 
by Brown et al., op. cit. Zipfel et al., op. cit., Lipes et aL, op. cit. and 
Miller, et al., op. cit. All of these proteins are members of a newly 
described family of related proteins which appear to function in the 
host response to invasion. (See Sherry et aL, J. Exp. Med. 168: 2251, 
1988, for a review.) 
Example 3 

This example describes the construction of MIP expression 
plasmids. 

a. pYMIP-200 (murine MlP-la) 

This plasmid encodes an alpha factor leader linked to the 
sequence encoding mature murine MIP-la. The MlP-la mature coding 
sequence is derived from the corresponding MIP-la cDNA (Dayatelis et 
al. (1988) J. Exp. Med. 167 1939-1943). The GAPDH promoter 
sequence, the alpha factor leader sequence and the alpha factor 
transcription terminator are derived from plasmid pGAIl, the 
construction of which is described in European patent application 0 324 
274, entitled, "Improved expression and secretion and heterologous 
proteins in yeast employing truncated alpha-factor leader sequences," 
the disclosure of which is expressly incorporated by reference herein. 



WO 92/05198 



-18- 



PCT/US91/06489 



Construction of pYMIP-200 was accomplished as follows. 
Plasmid pBR322/NAP850 which contains a cDNA encoding MIP-la 
cloned in the EcoRl site of pBR322 was digested with Ndel and BsmI 
and the 196 bp fragment encoding all but the first two N-terminal 
amino acids of the mature MIP-la sequence was ligated with the 
following adaptors: 

a) KpnI-Ndel adaptor 

5 1 CCTTGGATAAAAGACCGCCA 3 1 

3 ' CATGGGAACCTATTTTCTCGCGGTAT 5 ' 

b) BsmI + Sail adaptor 

5 1 TGATAGCGTCG 3 ' 

3 " GGACTATCGCAGCAGCT 5 ' 

A (silent mutation, see below) 

The resulting fragment was purified on an acrylamide £el. This 
fragment was then ligated into pGAIl that had been digested with Kpnl 
and Sail and purified on an agarose gel. Following bacterial 
transformation and screening, plasmid pMIP200 was obtained. Upon 
DNA sequencing it was found to have a silent mutation in the 
nucleotide sequence coding for the C-terminal alanine (GCOGCT). 
The BamHI expression cassette from this plasmid was cloned into the 
BamHI site of shuttle vector pAB24 (see European Patent Application 0 
324 274 Al) to generate pYMIP200. pAB24 contains the complete 2u 
sequence (Broach in: Molecular Biology of the Yeast Saccharomyces, 
vol. 1, p. 455 (1981).) 

b. pTMIP-300 (murine MIP-ls) 
This plasmid encodes an alpha factor leader linked to the 
sequence encoding mature murine MIP-18. The sequence .encoding 
MIP-1B is derived from the MIP-lB cDNA (Sherry et al. (1988) J. Exp. 
Med. 168, 2251-2259). The GAPDH promoter sequence, the alpha 
factor leader sequence and the alpha factor transcription terminator 
are derived from plasmid pGAIl which is described above. The cDNA 
encoding MIP-lB was subjected to in vitro mutagenesis to introduce a 
restriction endonuclease site which would facilitate the cloning of the 
MIP-18 coding region into the expression vector. The mutagenic 
primer used was: 

* * * 



WO 92/05198 



-19- 



PCI7US91/06489 



3 ' GTC CCA AG A GGC GGG <5GT ACC CGA GAC -5 ' 
(* refers to nucleotides that are different from those in 
the cDNA sequence) 

This primer introduced a Neol site at the start of the nucleotide 
sequence encoding the mature MlP-ie protein. The EcoRI fragment 
containing the modified MIP-lB cDNA sequence (containing the Ncol 
site) was isolated from the M13 phage RF and cloned into the EcoRI 
site of pBR322 to give plasmid pBR-3-lb/6. This plasmid was cut with 
Bglll and ligated to the following BglH-Sall adaptor which encodes the 
20 carboxyl terminal amino acids of MIP-lB and the stop codon. 

IleCysAlaAsnProSerGluProTrpValThxGluTyrMetSerAspLeuGluLeuAsnOP AM ArgArgArg 
GATCTGTGCTAACCCCAGTGAGCCCTGGGTCACTGAGTACATGAGCGATCTAGAGCTGAACTGATAGCGTCG 

ACACGATTGGGGTCACTCGGGACCCAGTGACTCATGTACTCGCTAGATCTCGACTTGACTATCGCAGCAGCT 

1 EGL2, 50 XBAI 73 SALI, 

Following digestion with Ncol, a 213 bp fragment encoding MIP-ls and 

stop codons was purified by acrylamide gel electrophoresis. 

The vector pGAIl was cut with Kpnl and ligated with the 

following KpnI-Ncol adaptor which encodes the 3 carboxyl terminal 

amino acids of the alpha factor leader, the LysArg processing site and 

the first two amino acids of mature MIP-lB. 

5' - CCTTGGATAAAAGAGCCCC -3* 

3* - CATGGGAAGCTATTTTCTCGGGGGTAC -5' 

The vector was then cut with Sail, and the vector fragment purified by 
agarose gel electrophoresis. The Ncol-Sall vector fragment was ligated 
with the Ncol-Sall MIP-18 coding fragment. The ligated product was 
transformed into E. coli and the clone pMIP300/20 was obtained which 
was found to have the predicted nucleotide sequence. This plasmid was 
digested with BamHI and the resulting 1155 bp fragment including the 
GAPDH promoter sequence, the sequence encoding the alpha factor 
leader-MIP-lB fusion protein and the alpha factor transcription 
terminator was cloned into the BamHI site of pAB24 to five the 
expression plasmid pYMIP300. 

c. PYMIP220 (human MIP-lc) 
This plasmid encodes an alpha factor leader linked to the 
sequence encoding mature hu-MIP-ia. The hu-MIP-la sequence is 



WO 92/05198 



PCT/US91/06489 



-20- 

derived from the xgtlO cDNA clone hMIPl-13a. The GAPDH promoter 
sequence, the alpha factor leader sequence and the alpha factor 
transcription terminator are derived from plasmid pGAIl, the 
construction of which is described in European patent application 
0324-274. The EcoRl insert DNA fragment from a xgtlO clone of 
human MIP-1 was subjected to 30 cycles of polymerase chain reaction 
(PCR) with the following primers. 
5'- primer 

5 ' GAGTGCGGTACCCTTGGATAAAAGAGCATCACTTGCTGCTGACACG 
t |^hu-MIP-la 
Kpnl 

CCGACCGC -3' 

3'- primer 

5 ' GAGTGGGTCGACTCATCAGGCACTCAGCTCCAGGTCGCTGAC -3 1 
+ - - | +hu-MIP-la 
Sail stop 

The amplified DNA was digested with Kpnl and Sail and the 235 
bp fragment encoding the 4 carboxyl terminal amino acids of the alpha 
factor leader, the dibasic processing site, and the entire 70 amino acids 
of mature hu-MIP-la was isolated by acrylamide gel electrophoresis. 
This fragment was then ligated into pGAIl that had been digested with 
Kpnl and Sail and purified on an agarose gel. Following -bacterial 
transformation and screening, plasmid pMIP220 was obtained which 
upon DNA sequencing was found to have the predicted nucleotide 
sequence. This plasmid was digested with BamHI and the resulting 1154 
bp fragment including the GAPDH promoter sequence, the sequence 
encoding the alpha-factor leader/hu-MIP-la fusion protein and the 
alpha factor transcription terminator was cloned into the BamHI site of 
pAB24 to give expression plasmid pYMIP220. 
d. PYMIP320 

This plasmid encodes an alpha factor leader linked to the 
nucleotide sequence encoding mature hu-MIP-le. The mature 
hu-MIP-ie coding sequence is derived from a XgtlO cDNA clone of 
human MIP-lB. The GAPDH promoter sequence, the alpha factor 
leader sequence and the alpha factor transcription terminator are 



WO 92/05198 



PCT/US91/06489 



-21- 

derived from plasmid pGAIl, the -construction of which is described in 
European patent application 0 324 274. The EcoRI insert DNA 
fragment from the xgtlO clone containing the hu-MIP-lB cDNA was 
subjected to 30 cycles of polymerase chain reaction (PCR) with the 
following primers. 

5'- primer 

5 1 GAGTGCGGTACCCTTGGATAAAAGAGCACCAATGGGCTCA 
f |->hu-MIP-lB 
Kpnl 

GACCCTCCCACCGC -3 1 
3'- primer 

5 1 GAGTGCGTCGACTCATCAGTTCAGTTCCAGGTCATACACG -3 ' 
+ - - |*hu-MIP-lB 
Sail stop 

The amplified DNA was digested with Kpnl and Sail and the 232 
bp fragment encoding the 4 carboxyl terminal amino acids of the alpha 
factor leader, the dibasic processing site, the entire 69 amino acids of 
mature hu-MIP-18 was isolated by acrylamide gel electrophoresis* This 
fragment was then ligated into pGAIl that had been digested with Kpnl 
and Sail and purified on an agarose gel. Following bacterial 
transformation and screening, plasmid pMIP320 was obtained which 
upon DNA sequencing was found to have the predicted nucleotide 
sequence. This plasmid was digested with BamHI and the resulting 1143 
bp fragment including the GAPDH promoter sequence, the sequence 
encoding the alpha factor leader/hu-MIP-lB fusion protein and the 
alpha factor transcription terminator was cloned into the BamHI site of 
pAB24 to give expression plasmid pYMIP320. 
Example 4 

This example demonstrates the expression of murine MIP-la and 
-IB and human MIP-la and 1-B. 
Expression of MIP-la 

S. cerevisiae strain MB2-1 (leu2-3, leu2-112, Ms3-ll, his3-15 
ura3A, pep 4A, CAN , cir°) was transformed with plasmid pYMIP200 or 
pYMIP220 by standard procedures and transformants selected for uracil 
prototrophy. Expression was analyzed by inoculation of single colonies 



WO 92/05198 



PCT/US91/06489 



-22- 



of individual transf ormants into leucine selective medium and growing 
at 30° C for "48 hr. or until the culture is saturated. Cultures were 
then centrifuged, cells resuspended in medium lacking uracil and 
diluted 20-fold into uracil selective medium. Cultures were grown for 
approximately 72 h, then harvested and cell-free supernatants 
prepared. 



qs to 500 ml with sterile ddH20 and then autoclave or sterile filter. 



20X supplements 

0.5g powdered leu- supplements 

per 100 ml of sterile ddH20. Autoclave. 



Powdered Leu- Supplements 



0.8g 


Adenine 


0.6g 


Uridine 


0.4g 


L-Tryptophan 


0.4g 


L-Histidine 


0.4g 


L-Arginine 


0.4g 


L-Methionine 


0.6g 


L-Tyrosine 


0.6g 


L-Lysine 


0.96g 


L-Phenylalanine 



Add all components to a coffee grinder and grind until the powder is 
homogenous. 

Ura- Selective media 

500 ml 2% glucose media 

50 ml 10X basal salts 

20 ml 50% glucose 

12.5 ml 20% casamino acids 

2,5 ml 1% adenine 

2.5 ml 1% tryptophan 

5 ml 0.3% of each pantothenic acid and inositol 



Recipes 



Leu- Selective Media 



50 ml 
25 ml 

2 ml 
80 ml 

5 ml 



10X basal salts 
20X leu- supplements 
5% threonine 
50% glucose 

0.3% of each pantothenic acid and inositol 



WO 92/05198 



-23- 



PCT/US91/06489 



Conditioned medium was analyzed for the presence of MIP-la by 
SDS-PAGE followed by coomassie staining and, in the case of the 
murine factor, by immunoblotting. A band was observed on SDS-PAGE 
of murine MIP-la which comigrated with native MIP-1 standard 
(provided by B. Sherry, Rockefeller University) and showed 
immunoreactivity with polyclonal antisera raised against murine MIP-1 
(antisera provided by B. Sherry). A similar sized stained band was 
observed upon expression of human MIP-la. These proteins were 
expressed as 1-5% of the secreted protein. 

Expression of MIP-16 

S. cerevisiae strain MB2-1 was transformed with plasmid 
pYMIP300 or pYMIP320 by standard procedures and transformants 
selected for uracil prototrophy. Expression studies were performed as 
described above for MIP-la. Similar results were obtained for 
expression levels. 

Thus far, recombinant murine MIP-la and MIP-lB have been 
shown to have bioactivity of native MIP-1, i.e., CSF-dependent 
myelopoietic enhancing activity for CFU-GM. 

Table of Deposited Cell Lines 



Name Deposit Date ATCC No. 

MB2-l(pYMIP-200) June 20, 1990 74008 

MB2-l(pYMIP-220) June 20, 1990 74007 

MB2-l(pYMIP-300) June 20, 1990 74006 

MB2-l(pYMIP-320) June 20, 1990 74005 



The above materials have been deposited with the American 
Type Culture Collection, 12301 Parklawn Drive, Rockville, Maryland 
20852 under the accession numbers indicated. These deposits will be 
maintained under the terms of the Budapest Treaty on the International 
Recognition of the Deposit of Micro-organisms for purposes of Patent 
Procedure. These deposits are provided merely as convenience to those 
of skill in the art, and are not an admission that a deposit is required 
under 35 U.S.C. Section 112. The sequence of the polynucleotides 
contained in the deposited materials, as well as the amino acid 
sequence of the polypeptides encoded thereby, are incorporated herein 
by reference and are controlling in the event of any conflict with the 



WO 92/05198 PCT/US91/06489 

-24- 



description of sequences herein- A license may be required to make, 
use or sell the deposited materials, and no such license is hereby 
granted. 



WO 92/05198 



PCT/US91/06489 



ANNEX M3 



-25- 



InUrnttiontl Application No: PCT/ / 



Optt**l SKm4 in €•*»•<«•« « 



MICROORGANISMS 

17 24 

HK lh« mkffr«'B«»t*J* r«Uo* U •« MC« . ■»* ™ th * 1 



A. lOf MTirtCATIOM Q9 DirOSIT • 



N*m« •» <tpc»iUry IftiWwtf** « 

AMERICAN TYPE CULTURE COLLECTION 



T«..i..i«.p«.itt^u.iitMo..o««i«««t ••*«•<"*»»• 12301 Park lawn Drive 

Rock vi lie, Maryland 20852 
United States of America 



Oil* •' 

June 20, 1990 



Acc*tti»A Nvinfctr * 



74QQ8 



S. ADDITIONAL INDICATIONS ■ <U.« tUftk M »ot iPfrlkiW.). TW. IhUkkiIm ta «M»i*v* •» • .tUcfc*! •*»•« Q 



MB2-l(pYMIP-200) 



C. OCSIONATtO STATU rON WHICH INDICATIONS AM MAOS « CM l>* l**k.U~» «<• Nil *UflHfU« 



O. »IFAHATI FUftNISHINS OF INDICATIONS • f»M« Wirt « O 



{AulhoriiW Oflk*} 



CAvthwtt«Ome«t 



Utm t CT,SO/iW MM) 



(Jinusry 1991) 



WO 92/05198 



-26- 



PCT/US91/06489 

ANNEX M3 



■ InUmtttontl AppBcatlen No: PCT/ / 
MICROORGANISMS 

A. lotMTiriCATioN or etroair • 

Kami «t «»»*iiUfy taiiHiiMa • 

AMERICAN TYPE CULTURE COLLECTION 



„.» n n~u^, ^ «* . 123Q1 parklawn Qrive 

Rockville, Maryland 20852 
United States of America 



Data oi 0tMi« * 

June 20, 1990 


AccoaaJe* Nwmoor • 

74007 


AOOITIONAl INDICATIONS ■ ( 


Wat a t( not aoofkaola). TMt lMoun«tioA la co*tlnva4 oa • aapaiala anachotf #*w 





MB2-l(pYMIP-220) 



C. DCtlCNATCO STATIC 9 OH WHICH INDICATIONS A ft I MADt • (Wtfca IMkotloM OTMlWtrf *oaJ«ftOto4 SUto«} 



O. SlfANATt ruANISHlNO Of INDICATIONS 1 0»«»a Mart 0 ooi aopficaMo) 



Tha M«4.caliofla bHoo 1 boiow w* »• a»oo*ia< to Iha IfitaiMOoAoi Swiooo Ulof • |Spo«tf| Itio oom'oI Mtvto ol fro lAolcaflo** 
-Accaiacoo N«mNi ol CaocaM") 



f. fffij *'* (Mil r«c«»*4 «ilK th* •otxMt.OAal aopkcattoA «Mn SI** 00 »a ChOClOO' Or tno r*c»fefnf OAcoJ 



(Avlhortio* OtVo4 
Q Tho Oatt of ioca*o4 (t'om Um aao«co*Q H IfttarootfoftoJ Bi*a*« 10 



(Autho4io4 OSkoO 



(Jamiiry 1991) 



WO 92/05198 



PCT/US91/06489 

ANNEX M3 



-27- 

InttrnatlOMl Application No: PCT/ 





'* 12301 Park! awn Drive 

Rockville, Maryland 20852 
United States of America 


Oat* ol fpo* • 






74006 


>, AOOITIOHAL tKOICATIOWi ' Pm»» H»M « .P»«c«W.J. TWt tMonaUoft Is cc*4Iau*5 OA . MO*f.L «<l«h*d |h*K (J 


MB2-l(pYMIP-3Q0) 



MICROORGANISMS 



A. lOINTlflCATIOM Of OirO»IT» 

r«rth.i Opo.N. W^UftW OA OA 04¥W**4l |H»« (X) 1 



Ham* Ol t>»oi«*nr l»ttHtftJ«* * 

AMERICAN TYPE CULTURE COLLECTION 



C. DIUCWATIO »TATC« »O H WHICH IWPICATIOW AM MAOt > « th» t»rf»t»tlO*. »r. *«t fer •« 0.»l V ~l*0 SUta«> 



I fctefii H Ml 0»»OC*»«S) 



Th* iMicatlfAl Ml** - - _ 
*A<C«tl»Oft Nvmtfi •! D*MM*^ 



(AvthorUorf OffkoO 
Q TM .1 f K .*< 0-»"» th. o»KcoaO »f IM lotomflOMl *• 



(Authoiteo* Officii) 



(Jinuary 



WO 92/05198 



-28- 



PCT/US91/06489 

ANNBX M3 



International Application No: PCT/ / 



MICROORGANISMS 



a. tot NTincAnoN op Ptpooir « 



AMERICAN TYPE CULTURE COLLECTION 



««»tt*tw«»)« 12301 Park! awn Drive 




Rockville, Maryland 20852 




United States of America 






June 20, 1990 


74005 





MB2-l(pYHIP-320) 



OtSICHATCO BTATIB FOR WHICH INDICATIONS AM MAOI • t» tM P*K»U**I •» Ml Wf «««l|fut«« $Utet) 



ft ■ (tarn Mt«a ■ Ml orSctMl 



TM ~*C«»M S KHM fc»*« M twMMRM (• tM bMltlM l«H« tolM • (SMC** U* ftMlftt •« WkitJ»* 



. 0^s..iM . 



(AvtMftiM 0«<4#| 
Q TM «»ta •* rKiiK (tram »• M H U* MmmVwhI «• 

*M . . 



(January 1991) 



WO 92/05198 



-29- 



PCT/US91/06489 



CLAIMS 

1. A DNA molecule comprising in order of transcription; 

(a) a transcription regulatory region operative in a 

yeast; 

(b) a region which encodes a mammalian protein 
selected from the group consisting of MlP-la, and MIP-18. 

2. The DNA molecule of claim 1 wherein region (a) provides 
inducible transcriptional regulation. 

3. The DNA molecule of claim 1 wherein region (a) provides 
constitutive transcriptional regulation. 

4. The DNA molecule of claim 1 further comprising: 

a leader fragment which facilitates secretion of the mammalian 
protein, said fragment covalently linked to region (b). 

5. The DNA molecule of claim 4 wherein the leader 
fragment encodes a yeast alpha-factor leader, 

6. The DNA molecule of claim 4 wherein the leader 
fragment encodes a truncated yeast alpha-factor leader. 

7. The DNA molecule of claim 1 further comprising: 

(c) a terminator region operative in a yeast. 

8. The DNA molecule of claim 1 wherein region (c) is 
derived from a yeast alpha-factor transcription terminator. 

9. The DNA molecule of claim 1 wherein region (b) has been 
mutagenized to introduce a restriction enzyme recognition site. 

10. The DNA molecule of claim 1 further comprising: 

(d) a replication system operative in a yeast. 

11. A yeast cell comprising a DNA molecule according to 
claim i. 

12. A yeast cell comprising a DNA molecule according to 
claim 10. 

13. A yeast cell comprising a DNA molecule according to 
claim 4. 

14. A method for producing a MIP polypeptide which 
comprises: 



WO 92/05198 



PCT/US91/06489 



•30- 

growing a yeast cell according to claim 11 in a nutrient 
medium whereby region (b) is expressed to produce a MIP. 

15. A method for producing a MIP polypeptide which 
comprises: 

growing a yeast cell according to claim 12 in a nutrient 
medium whereby region (b) is expressed to produce a MIP. 

16. A method for producing a MIP polypeptide which 
comprises: 

growing a yeast cell according to claim 13 in a nutrient 
medium whereby region (b) is expressed and secreted to produce a MIP. 

17. The method of claim 16 wherein the leader fragment 
comprises a yeast alpha-factor leader and processing signal. 

18. The method of claim 16 wherein the leader fragment 
comprises a truncated yeast alpha-factor leader. 

19. A composition comprising a mammalian MIP protein 
selected from the group consisting of murine MlP-la, murine MIP-10, 
human MlP-la, and human MIP-10 wherein the MIP is substantially free 
of non-MIP, mammalian proteins. 

20. The composition of claim 19 wherein the MIP is human 
MlP-la, and the composition further comprises human MIP-10. 

21. The composition of claim 19 comprising murine MlP-la 
and murine MIP-10. 



WO 92/05198 



1/3 



PCI7US91/06489 

Figure 1 



Human MIP-la cOMA 

-22 -20 
. Met Gin val Ser Thr Ala Ala Leu 

CCACATTCCGTCACCTGCTCAGAATC ATG CAG GTC TCC ACT GCT GCC CTT 



Ala 
GCT 


Val 
GTC 


Leu 
CTC 


Leu 
CTC 


-10 
Cys 

TGC 


Thr 
ACC 


Met 
ATG 


Ala 

GCT 


Leu 
CTC 


Cys Asn 
TGC AAC 


Gin 

CAG 


Phe 

TTC 


Ser 

TCT 


1 

Ala 

GCA 


Ser 
TCA 


Leu 
CTT 


Ala 

GCT 


Ala 
GCT 


Asp 
GAC 


Thr 
ACG 


Pro 
CCG 


Thr 
ACC 


10 

Ala 

GCC 


Cys Cys 
TGC TGC 


Phe 

TTC 


Ser 
AGC 


Tyr 
TAC 


Thr 
ACC 


Ser 
TCC 


Arg 
CGG 


Gin 
CAG 


20 
Zle 
ATT 


Pro 
CCA 


Gin 
CAG 


Asn 
AAT 


Phe 
TTC 


lie 
ATA 


Ala Asp 
GCT GAC 


Tyr 
TAC 


Phe 
TTT 


30 
Glu 
GAG 


Thr 
ACG 


Ser 
AGC 


Ser 
AGC 


Gin 
CAG 


Cys 
TGC 


Ser 
TCC 


Lys 
AAG 


Pro 
CCC 


40 

Gly Val 
GGT GTC 


lie Phe 
ATC TTC 


Leu 

CTA 


Thr 
ACC 


Lys 
AAG 


Arg 
CGA 


Ser 
AGC 


Arg 
CGG 


Gin 
CAG 


50 
Val 
GTC 


Cys 
TGT 


Ala 
GCT 


Asp 
GAC 


Pro 
CCC 


Ser 
AGT 


Glu Glu 
GAG GAG 


Trp 
TGG 


Val 
GTC 


60 

Gin 
CAG 


Lys 
AAA 


Tyr 
TAT 


Val 
GTC 


Ser 
AGC 


Asp 
GAC 


Leu 

CTG 


Glu 
GAG 


Leu 

CTG 


Ser 
AGT 


70 
Ala 

GCC 


OP 

TGA GGGGTCCAGAAGCTTCGAGG 



CCCAGCGACCTCGGTGGGCCAGTGGGGAGGAGCAGGAGCCTGAGCCTTGGGAACATGCGT 

♦100 • • 

GTGACCTCCACAGCTACCTCTTCTATGGACTGGTTGTTGCCAAACAGCCACACTGTGGGA 

# » • • • +ZUU 
CTCTTCTTAACTTAAATTTTAATTTATTTATACTATTTAGTTTTTGTAATTTATTTTCGA 

# • • * * * 

TTTCACAGTGTGTTTGTGATTGTTTGCTCTGAGAGTTCCCCTGTCCCCTCCCCCTTCCCT 

# • • +300 • * 
CACACCGCGTCTGGTGACAACCGAGTGGCTGTCATCAGCCTGTGTAGGCAGTCATGGCAC 

CAAAGCCACCAGACTGACAAATGTGTATCGGATGCTTTTGTTCAGGGCTGTGATCGGCCT 

+400 

GGGGAAATAATAAAGATGCTCTTTTAAAA 



WO 92/05198 oyo PCT/US91/06489 

2/3 

Figure 2 

Human-MIP-lf* 

-23 -20- 
• • • Met Lys Leu Cys Val 

AGCCTCACCTCTGAGAAAACCTCTTTTCCACCAATACC ATG AAG CTC TGC GTG 

-10 

Thr Val Leu Ser Leu Leu Met Leu Val Ala Ala Phe Cys Ser Pro 
ACT GTC CTG TCT CTC CTC ATG CTA GTA GCT GCC TTC TCC TCT CCA 

1 10 
Ala Leu Ser Ala Pro Met Gly Ser Asp Pro Pro Thr Ala Cys Cys 
GCG CTC TCA GCA CCA ATG GGC TCA GAC CCT CCC ACC GCC TGC TGC 

20 

Phe Ser Tyr Thr Ala Arg Lys Leu Pro Arg Asn Phe Val Val Asp 
TTT TCT TAC ACC GCG AGG AAG CTT CCT CGC AAC TTT GTG GTA GAT 

30 40 

Tyr Tyr Glu Thr Ser Ser Leu Cys Ser Gin Pro Ala Val Val Phe 
TAC TAT GAG ACC AGC AGC CTC TGC TCC CAG CCA GCT GTG GTA TTC 

50 

Gin Thr Lys Arg Ser Lys Gin Val Cys Ala Asp Pro Ser Glu Ser 
CAA ACC AAA AGA AGC AAG CAA GTC TGT GCT GAT CCC AGT GAA TCC 

60 69 
Trp Val Gin Glu Tyr Val Tyr Asp Leu Glu Leu Asn OP 
TGG GTC CAG GAG TAC GTG TAT GAC CTG GAA CTG AAC TGA GCTGCTCA 

• • • • • • 
GAGACAGGAAGTCTTCAGGGAAGGTCACCTGAGCCCGGATGCTTCTCCATGAGACACATC 

• • • +100 • • 

TCCTCCATACTCAGGACTCCTCTCCGCAGTTCCTGTCCCTTCTCTTAATTTAATCTTTTT 

• ••••• 
TATGTGCCGTGTTATTGTATTAGGTGTCATTTCCATTATTTATATTAGTTTAGCCAAAGG 

+200 • • # * 

ATAAGTGTCCTATGGGGATGGTCCACTGTCACTGTTTCTCTGCTGTTGCAAATACATGGA 

• • 

TAACACATTTGATTCTG 



WO 92/05198 PCT/US91/06489 

3/3 Figure 3 

AMINO ACID ALIGNMENT OF MIP-1 HOMOLOGS 



1. hu-MIP-lO 1 MqVSTaAUVLLCTMaLCNQ FSA»laADTPTACCrSYt5RqIPqnFX«DYrETSSqCSkPGViriT10URQ 

I in miiiiii i ii i mi Minium n n n iiinn n niiiini M 

2. mu-MIP-ia 1 MKVSTtALAVLLCTHtLCMOvrSAPyCADTPTACCrSY SRkXPRqFXvDYFETSSLCSqPGVirLTKRnRQ 

ii ii ii i mi i i ii 1 1 iii it ii ii 1 1 ii in i i i mi ii 

3- mu-MIP-lP 1 KKLCVsALSLLLiVAArC«PgrSAPMCSDPPT*CCrSYTS»qLhR*rVfflOyyETSSLCSkPAVVrtTKR9R0 

inn mi nun i i it 1 1 1 1 1 1 1 iniii i i i n imnmi mn in i 

4. hu-MIP-lP a MKWVtvLSLU«LVAArC»P«lSAPMCSOPPT#CCrSYT*RkLpRnrVvDYYETSSLCSqPAVVrqTXRikO 



1. hu-MIP-la 72 vC ADps EftWVOk Yv*DLEL» A 

III I III I III) I 

2. mu-HIP-ia 72 I CAD s k Et WVQEY 1 1 DLELHA 

III I II II Hill 

3. rt>u-MIP-lP 73 ICAnPSEpWVtEYfluDLEU) 

II III It II I It 1 1 

4. hu-MXP-10 73 vCAdPSEjWVqEYvyDLELH 



INTERNATIONAL SEARCH REPORT 

International Application No 



PCT/US 91/06489 



I. CLASSIFICATION OF SUBJECT MATTER (if several classification symbols apply, Indicate all)* 



According to Jnternational Patent Classification (IPC) or to both National Classification and IPC 

Int.Cl. 5 C07K15/00; C12N1/19; C12P21/02; 



C12N15/62 



n. FIELDS SEARCHED 



Minimum Documentation Searched 7 





Classification Synbob 


Int.Cl. 5 


C07K ; C12N 




Documentation Searched other than Minimum Documentation 
to the Extent that such Documents arc Included in the Fields Searched 



m. DOCUMENTS CONSIDERED TO BE RELEVANT* 



Category" 



Cititioo of Document, 11 with Indication, where mppropmtc, cf tht relevant parages' 



Relevant to Cliia No. n 



WO, A, 9 007 009 (THE UNITED STATES OF AMERICA) 28 
June- 1990 

see the whole document 

MOLECULAR AND CELLULAR BIOLOGY 

vol. 10, no. 7, July 1990, WASHINGTON, D.C. 

U.S.A. 

pages 3646 - 3658; 

M. NAKAO ET AL. : 'Structures of human genes 
coding for cytokine LD78 and their expression' 
"Introduction" 
see figure 3 



1-19 



1-19 



° Special categories of cited doaimcno : m 

*A* document defining the general state of the art which is not 

considered to be of particular relevance 
»E* earlier document but published on or after the international 

filing date 

*L" document which may throw doubts on priority daim(s) or 
which is cited to establish the publication date of another 
citation or other special reason (as specified) 

*0* document referring to an oral disclosure, use, exhibition or 
other means 

"P* document published prior to the international filing date but 
later than the priority date claimed 



*T* later document published after the International filing data 
or priority date and not in conflict with the apnUeatioo but 
cited to understand the principle or theory underlying the 
invention 

*X* document of particular relevance; the claimed invention 
cannot be considered novel or cannot be considered to 
Involve an inventive step 

"V document of particular relevance; the claimed invention 
cannot be considered to involve an inventive step when the 
document is combined with one or more other such docu- 
ments, such combination being obvious to a person skilled 
tn the art 

**' document member of the same patent family 



IV. CERTIFICATION 



Date of the Actual Completion of the International Search 

18 DECEMBER 1991 



Date of Mailing of this International Search Report 

0 8 JAN 1992' 



International Searching Authority 

EUROPEAN PATENT OFFICE 



Signature of Authorized Officer 

VAN PUTTEN A.J. 



Pan FCT/1SA/210 Ittc—i tkMt) (Jauaqr >**> 



PCT/US 91/06489 

International Application No 



"m. DOCUMENTS CONSIDERED TO BE RELEVANT (CONTINUED FROM THE SECOND ShECll 






Qtatioo of Document, with todicMioo, wh«« appropriate, of the relevant passages 




X 


PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES 
OF USA. 

vol. 86, March 1989, WASHINGTON US 
pages 1963 - 1967; 

B.S. KWON AND S.M. WEISSMAN: 'cDNA sequences of 
2 Inducible T-cell genes' 
cited 1n the application 
see figure 1 


19 


X 


PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES 
OF USA. 

vol. 85, December 1988, WASHINGTON US 
pages 9704 - 9708; 

M.A. LIPES ETAL.: 'Identification, cloning, and 
characterization of an Immune activation gene' 
cited 1n the application 
see figure 3 


1-19 


X 


JOURNAL OF IMMUNOLOGY. 

vol. 142, no. 2, 15 January 1989, BALTIMORE US 
pages 679 - 687; 

K.D. BROWN ET AL. : 'A family of small Inducible 
nrciteins secreted bv leukocytes are members of a 

new superfarolly that Includes leukocyte and 
fibroblast -derived Inflammatory agents, growth 
factors, and 1nd1ctors of various activation 
nrocesses 1 

dted 1n the application 
"materials and methods" 


19 


V 

A 


EP,A f 0 310 136 (THE ROCKEFELLER UNIVERSITY) 5 
April 1989 

see page 5, Hne 15 - page 5, line 16 


20,21 


P,X 


W0,A,9 104 274 (GENETICS INSTITUTE, INC.; CRC 

TECN0L0GY LTD.) 4 April 1991 

see page 36, line 15 - page 36, Hne 25 


1,11,14 


A 


EP,A,0 324 274 (CHIRON CORPORATION) 19 July 1989 
dted 1n the application 
see the whole document 


1-18 



ram PCT/ISA/210 <«xtn tterf) (Jjuny MS) 



ANNEX TO THE INTERNATIONAL SEARCH REPORT p nfi MQ 
ON INTERNATIONAL PATENT APPLICATION NO. US 9106 ^J Q9 



This „„, ite die patent family members relating to die patent document* cited in the above-mentioned international search report. 

Hie members are as contained in the European Patent Office EDP file on , . _ . :_*—.*«■ 10/19/01 

The Bn-opean Patent Office is in no way liable for these particulars which are merely given for the purpose of information. 18/1Z/91 



Patent document 
cited in search report 



Publication 
date 



Patent funny 
members) 



Publication 



WO-A-9007009 



28-06-90 



AU-A- 
CA-A- 
EP-A- 
JP-T- 



4816090 
2005639 
0449956 
3504331 



10-07-90 
16-06-90 
09-10-91 
26-09-91 



EP-A-0310136 


05-04-89 


AU-A- 


2333688 


27-07-89 


WO-A-9104274 


04-04-91 


None 






EP-A-0324274 


19-07-89 


AU-A- 
JP-A- 


2765088 
2002339 


06-07-89 
08-01-90 



details about this annex : see Official Journal of the European Patent Office, No. 12/82 



This Page is Inserted by IFW Indexing and Scanning 
Operations and is not part of the Official Record 

BEST AVAILABLE IMAGES 

Defective images within this document are accurate representations of the original 
documents submitted by the applicant. 

Defects in the images include but are not limited to the items checked: 

□ BLACK BORDERS 

□ IMAGE CUT OFF AT TOP, BOTTOM OR SIDES 
□f FADED TEXT OR DRAWING 

2^ BLURRED OR ILLEGIBLE TEXT OR DRAWING 

□ SKEWED/SLANTED IMAGES 

□ COLOR OR BLACK AND WHITE PHOTOGRAPHS 

□ GRAY SCALE DOCUMENTS 

□ LINES OR MARKS ON ORIGINAL DOCUMENT 

□ REFERENCE(S) OR EXHIBIT(S) SUBMITTED ARE POOR QUALITY 

□ OTHER: 

IMAGES ARE BEST AVAILABLE COPY. 
As rescanning these documents will not correct the image 
problems checked, please do not report these problems to 
the IFW Image Problem Mailbox.