Skip to main content

Full text of "USPTO Patents Application 09804625"

See other formats


per 



WORLD INTELLECTUAL PROPERTY ORGANIZATION 
International Bureau ■ 




INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCI) 



(51) International Patent Classification 5 

C12P 21/00, A61K 37/36 
C07K 13/00 



Al 



(11) International Publication Number: WO 90/11366 

(43) International Publication Date : 4 October 1 990 (04. 1 0.90) 



(21) International Application Number: PCT/US90/01630 

(22) International Filing Date: 27 March 1990 (27.03.90) 



(30) Priority data: 
329,610 
347,559 
370,544 
370,547 
370,549 
437,409 
438,919 
440,033 



28 March 1989 (28.03.89) US 

4 May 1989(04.05.89) US 

23 June 1989 (23.06.89) US 

23 June 1989(23.06:89) US 

23 June 1989(23.06.89) US 

15 November 1989 (15.11.89) US 

17 November 1989 (17.11.89) US 

7 March 1 990 (07.03.90) US 



(71) Applicant: GENETICS INSTITUTE, INC. [US/US]; 87 
Cambridge Park Drive, Cambridge, MA 02140 (US). 



(72) Inventors: WANG, Elizabeth, A. ; 136 Wolf Rock Road, 
Carlisle, MA 01741 (US). WOZNEY, John, M. ; 59 Old 
Bolton Road, Hudson, MA 01749 (US). ROSEN, Vicki, 
A. ; 344 Marlborough Street, Apartment 4, Boston, MA 
02116 (US). CELESTE, Anthony, J. ; 86 Packard Street 
Hudson, MA 01479 (US). 

(74) Agent: KAPINOS, Ellen, J.; Genetics Institute, Inc., 87 
Cambridge Park Drive, Cambridge, MA 02114 (US). 



33 
7» 



>u 

(81) Designated States: AT (European patent), AU, BE (Euro-/-" 
+ pean patent), CA, CH (European patent), DE (Euro-/ ft 
pean patent), DK (European patent), ES (European pa- 
tent), FR (European patent), GB (European patent), YJ\\ 
(European patent), JP, KR, LU (European patent), NLf ^ 
(European patent), SE (European patent). 3 ' 

•g 

Published 

With international search report. 



(54) Title: OSTEOINDUCTIVE COMPOSITIONS 



(57) Abstract 



Purified BMP-5, BMP-6 and BMP-7 proteins and processes for producing them are disclosed. The proteins may be used in 
the treatment of bone and/or cartilage defects and in wound healing and related tissue repair. 



+ See back of page 



DESIGNATIONS OF "DE n 



Until further notice, any designation of "DE" in any international application 
whose international filing date is prior to October 3, 1990, shall have effect in the 
territory of the Federal Republic of Germany with the exception of the territory of the 
former German Democratic Republic. 







FOR THE PURPOSES OF INFORMATION ONLY 






Codes used to identify States party to the PCT on the front pages of pamphlets publishing international 


applications under the PCT. 










AT 


Austria 


ES 


Spain 


MG 


Madagascar 


AU 


Australia 


Ft 


Finland 


ML 


Malt 


BB 


Barbados 


FR 


Fiance 


MR 


Mauritania 


BE 




GA 


Gabon 


MW 


Malawi 


BF 


Burkina Ftao 


GB 


United Kingdom 


NL 


Netherlands 


BG 


Bulgaria 


HU 


Hungary 


NO 


Norway 


BJ 


Benin 


rr 


ItaJy 


RO 


Romania 


BR 


Brazil 


jp 


Japan 


SD 


Sudan 


CA 


Canada 


KP 


Democratic People's Republic 


SE 


Sweden 


CF 


Central African Republic 




ofKorea 


sg 


Senegal 


CG 


Congo 


ICR 


Republic ofKorea 


su 


Soviet Union 


Qi 


Switzerland 


U 


Uechtenstts 


TO 


Chad 


CM 


Cameroon 


U 


Sri Lanka 


TG 


Togo 


D£ 


Germany. Federal Republic or 


LU 


Luxembourg 
Monaco 


US 


United States of America 


DK 


Denmart 


MC 







WO 90/11366 



PCI7US90/01630 



10 



I 

OSTEOINDUCTIVE COMPOSITIONS 

The present invention relates to 
proteins having utility in the formation of bone 
and/or cartilage. m particular the invention 
relates to a number of families of purified 
proteins, termed BMP-5, BMP-6 and BMP-7 protein 
families (wherein BMP is Bone Morphogenic Protein) 
and processes for obtaining them. These proteins 
aay exhibit the ability to induce cartilage and/or 
bone formation. They may be used to induce bone 
and/or cartilage formation and in wound healing and 
tissue repair. 

The invention provides a family of BMP-5 
15 proteins. Purified human BMP-5 proteins are 
substantially free from other proteins with which 
they are co-produced, and characterized by an amino 
acid sequence comprising from amino acid #323 to 
amino acid #454 set forth in Table in. This amino 
acid sequence #323 to #454 is encoded by the DNA 
sequence comprising nucleotide #1665 to nucleotide 
#2060 of Table in. BMP-5 proteins may be further 
characterized by an apparent molecular weight of 
28,000-30,000 daltons as determined by sodium 
dodecyl sulfate polyacrylamide gel electrophoresis 
(SDS-PAGE) . Under reducing conditions in SDS-PAGE 
the protein electrophoreses with a molecular weight 
of approximately 14,000 - 20,000 daltons. It is 
contemplated that these proteins are capable of 
30 stimulating, promoting, or otherwise inducing 
cartilage and/or bone formation. 

The invention further provides bovine BMP-5 
proteins comprising amino acid #9 to amino acid 
#140 set forth in Table I. The amino acid sequence 



20 



25 



from #9 to #140 is encoded by the DNA sequence 
comprising nucleotide #32 to #427 of Table I. 
These proteins may be further characterized by an 
apparent molecular weight of 28,000 - 30,000 
daltons as determined by sodium dodecyl sulfate 
poly aery 1 amide gel electrophoresis (SDS-PAGE) . 
Under reducing conditions in SDS-PAGE the protein 
electrophoreses with a molecular weight of 
approximately 14,000-20,000 daltons. It is 
contemplated that these proteins are capable of 
inducing cartilage and/or bone formation. 

Human BMP-5 proteins of the invention may be 
produced by culturing a cell transformed with a DNA 
sequence containing the nucleotide sequence the 
same or substantially the same as the nucleotide 
sequence shown in Table III comprising nucleotide 
#699 to nucleotide #2060. BMP-5 proteins 
comprising the amino acid sequence the same or 
substantially the same as shown in Table III from 
amino acid # 323 to amino acid # 454 are recovered, 
isolated and purified from the culture medium. 

Bovine BMP-5 proteins may be produced by 
culturing a cell transformed with a DNA sequence 
containing the nucleotide sequence the same or 
substantially the same as that shown in Table I 
comprising nucleotide #8 through nucleotide #427 
and recovering and purifying from the culture 
medium a protein containing the amino acid sequence 
or a portion thereof as shown in Table I comprising 
amino acid #9 to amino acid #140. 

The invention provides a family of BMP-6 
proteins. Purified human BMP-6 proteins, 
substantially free from other proteins with which 
they are co-produced and are characterized by an 
amino acid sequence comprising acid #382 to amino 



acid #513 set forth in Table IV. The amino acid 
sequence from amino acid #382 to #513 is encoded by 
the DNA sequence of Table IV from nucleotide #13 03 
to nucleotide #1698. These proteins may be further 
characterized by an apparent molecular weight of 
28,000-30,000 daltons as determined by sodium 
dodecyl sulfate poly acryl amide gel electrophoresis 
(SDS-PAGE) . under reducing conditions in SDS-page 
the protein electrophoreses with a molecular weight 
of approximately 14,000 - 20,000 daltons. it is 
contemplated that these proteins are capable of 
stimulating promoting, or otherwise inducing 
cartilage and/or bone formation. 

The invention further provides bovine BMP-6 
proteins characterized by the amino acid sequence 
comprising amino acid #121 to amino acid #222 set 
forth in Table II. The amino acid sequence from 
#121 to #222 is encoded by the DNA sequence of 
Table II from nucleotide #361 to #666 of Table II. 
These proteins may be further characterized by an 
apparent molecular weight of 28,000 - 30,000 
daltons as determined by sodium dodecyl sulfate 
polyacrylamide gel electrophoresis (SDS-PAGE). 
Under reducing conditions in SDS-PAGE the protein 
electrophoreses with a molecular weight of 
approximately 14,000-20,000 daltons. it is 
contemplated that these proteins are capable of 
inducing cartilage and/or bone formation. 

Human BMP-6 proteins of the invention are 
produced by culturing a cell transformed with a DNA 
sequence comprising nucleotide #160 to nucleotide 
#1698 as shown in Table III or a substantially 
similar sequence. BMP-6 proteins comprising amino 
acid #382 to amino acid #513 or a substantially 
similar sequence are recovered, isolated and 



purified from the culture medium. 

Bovine BMP- 6 proteins may be produced by 
culturing a cell transformed with. a DNA comprising 
nucleotide #361 through nucleotide #666 as set 
forth in Table II or a substantially similar 
sequence and recovering and purifying from the 
culture medium a protein comprising amino acid #121 
to amino acid #222 as set forth in Table II. 

The invention provides a family of BMP-7 
proteins. Which includes purified human BMP-7 
proteins, substantially free from other proteins 
with which they are co-produced. Human BMP-7 
proteins are characterized by an amino acid 
sequence comprising amino acid #300 to amino acid 
#431 set forth in Table V. This amino acid 
sequence #300 to #431 is encoded by the DNA 
sequence of Table V from nucleotide #994 to #1389. 
BMP-7 proteins may be further characterized by an 
apparent molecular weight of 28,000-30,000 dal tons 
as determined by sodium dodecyl sulfate 
polyacrylamide gel electrophoresis (SDS-PAGE) . 
Under reducing conditions in SDS-PAGE the protein 
electrophoreses with a molecular weight of 
approximately 14,000 - 20,000 daltons. It is 
contemplated that these proteins are capable of 
stimulating, promoting, or otherwise inducing 
cartilage and/or bone formation. 

Human BMP-7 proteins of the invention may be 
produced by culturing a cell transformed with a DNA 
sequence containing the nucleotide sequence the 
same or substantially the same as the nucleotide 
sequence shown in Table V comprising nucleotide # 
97 to nucleotide #1389. BMP-7 proteins comprising 
the amino acid sequence the same or substantially 
the same as shown in Table V from amino acid #300 



to amino acid #431 are recovered, isolated and 
purified from the culture medium. 

The invention further provides a method 
wherein the proteins described above are utilized 
for obtaining related human protein/s or other 
mammalian cartilage and/or bone formation 
protein/s. such methods are known to those skilled 
in the art of genetic engineering. One method for 
obtaining such proteins involves utilizing the 
human BMP-5, BMP-6 and BMP-7 coding sequences or 
portions thereof to design probes for screening 
human genomic and/or cDNA libraries to isolate 
human genomic and/or cDNA sequences. Additional 
methods within the art may employ the bovine and 
human BMP proteins of the invention to obtain other 
mammalian BMP cartilage and/or bone formation 
proteins. 

Having identified the nucleotide sequences, 
the proteins are produced by cultufing a cell 
transformed with the nucleotide sequence. This 
sequence or portions thereof hybridizes under 
stringent conditions to the nucleotide sequence of 
either BMP-5, BMP-6 or BMP-7 proteins and encodes 
a protein exhibiting cartilage and/or bone 
formation activity. The expressed protein is 
recovered and purified from the culture medium. 
The purified BMP proteins are substantially free 
from other proteinaceous materials with which they 
are co-produced, as well as from other 
contaminants. 

BMP-5, BMP-6 and BMP-7 proteins may be 
characterized by the ability to promote, stimulate 
or otherwise induce the formation of cartilage 
and/or bone formation. It is further contemplated 
that the ability of these proteins to induce the 



6 

formation of cartilage and/or bone may be exhibited 
by the ability to demonstrate cartilage and/or bone 
formation activity in the rat bone formation assay 
described below. It is further contemplated that 
the proteins of the invention demonstrate . activity 
in this rat bone formation assay at a 
concentration of 10/xg - 500/ig/gram of bone formed. 
More particularly, it is contemplated these 
proteins may be characterized by the ability of ipq 
of the protein to score at least +2 in the rat bone 
formation assay described below using either the 
original or modified scoring method. 

Another aspect of the invention provides 
pharmaceutical compositions containing a 
therapeutically effective amount of a BMP-5, BMP-6 
or BMP-7 protein in a pharmaceutical^ acceptable 
vehicle or carrier. Further compositions comprise 
at least one BMP-5, BMP-6 or BMP-7 protein. It is 
therefore contemplated that the compositions may 
contain more than one of the BMP proteins of the 
present invention as BMP-5, BMP-6 and BMP-7 
proteins may act in concert with or perhaps 
synergistically with one another. The compositions 
of the invention are used to induce bone and/or 
cartilage formation. These compositions may also 
be used for wound healing and tissue repair. 

Further compositions of the invention may 
include in addition to a BMP-5, BMP-6 or BMP-7 
protein of the present invention at least one other 
therapeutically useful agent such as the proteins 
designated BMP-1, BMP-2 (also having been 
designated in the past as BMP-2A, BMP-2 Class I) , 
BMP-3 and BMP-4 (also having been designated in the 
past as BMP-2B and BMP-2 Class II) disclosed in co- 
owned International Publication WO88/00205 



published 14 January 1988 and International 
Publication WO89/10409 published 2 November 1989. 
Other therapeutically useful agents include growth 
factors such- as epidermal growth factor (E6F) , 
fibroblast growth factor (FGF) , transforming growth 
factors (TGF-q and TGF-/S) , and platelet derived 
growth factor (PDGF) . 

The compositions of the invention may also 
include an appropriate matrix, for instance, for 
delivery and/or support of the composition and/or 
providing a surface for bone and/or cartilage 
formation. The matrix may proide solw release of 
the BMP protein and/or the appropriate environment 
for presentation of the BMP protein of the 
invention. 

The compositions of the invention may be 
employed in methods for treating a number of bone 
and/or cartilage defects, and periodontal disease. 
They may also be employed in methods for treating 
various types of wounds and in tissue repair. 
These methods, according to the invention,- entail 
administering a composition of the invention to a 
patient needing such bone and/or cartilage 
formation, wound healing or tissue repair. The 
method therefore involves administration of a 
therapeutically effective amount of a protein of 
the invention. These methods may also entail the 
administration of a protein of the invention in 
conjunction with at least one of the "BMP" proteins 
disclosed in the co-owned applications described 
above, m addition, these methods may also include 
the administration of a protein of the invention 
with other growth factors including EGF, FGF, tgf- 
a, TGF-/8, and PDGF. 

Still a further aspect of the invention are 



8 



DNA sequences coding for expression of a protein of 
the invention. Such sequences include the sequence 
of nucleotides in a 5' to 3' direction illustrated 
in Tables I - v or DNA sequences which hybridize 
under stringent conditions with the DNA sequences 
of Tables I - V and encode a protein demonstrating 
ability to induce cartilage and/or bone formation. 
Such cartilage and/ or bone formation may be 
demonstrated in the rat bone formation assay 
described below. It is contemplated that these 
proteins may demonstrate activity in this assay at 
a concentration of 10 /*g - 500 /tg/gram of bone 
formed. More particularly, it is contemplated that 
these proteins demonstrate the ability of l^g of 
the protein to score at least +2 in the rat bone 
formation assay. Finally, allelic or other 
variations of the sequences of Tables I - V whether 
such nucleotide changes result in changes in the 
peptide sequence or not, are also included in the 
present invention. 

A further aspect of the invention provides 
vectors containing a DNA sequence as described 
above in operative association with an expression 
control sequence therefor. These vectors may be 
employed in a novel process for producing a protein 
of the invention in which a cell line transformed 
with a DNA sequence directing expression of a 
protein of the invention in operative association 
with an expression control sequence therefor, is 
cultured in a suitable culture medium and a protein 
of the invention is recovered and purified 
therefrom. This claimed process may employ a 
number of known cells, both prokaryotic and 
eukaryotic, as host cells for expression of the 
polypeptide. The revovered BMP proteins are 



purified by isolating them from other proteinaceous 
materials with which they are co-produced as well 
as from other contaminants. 

Other aspects and advantages of the present 
invention will be apparent upon consideration of 
the following detailed description and preferred 
embodiments thereof. 

Detailed Descriptio n of t hp invention 

Purified human BMP-5 proteins may be produced 
by culturing a host cell transformed with the DNA 
sequence of Table III. The expressed BMP-5 
proteins are isolated and purified from the culture 
medium. Purified human BMP-5 proteins are expected 
to be characterized an amino acid sequence 
comprising amino acid #323 to #454 as shown in 
Table in. Purified BMP-5 human cartilage/bone 
proteins of the present invention are therefore 
produced by culturing a host cell transformed with 
a DNA sequence comprising nucleotide #699 to 
nucleotide #2060 as shown in Table in or 
substantially homologous sequences operatively 
linked to a heterologous regulatory control 
sequence and recovering and purifying from the 
culture medium a protein comprising the amino acid 
sequence as shown in Table III from amino acid 
#323 to amino acid #454 or a substantially 
homologous sequence. 

In further embodiments the DNA sequence 
comprises the nucleotides encoding amino acids #323- 
#454. BMP-5 proteins may therefore be produced by 
culturing a host cell transformed with a DNA 
sequence comprising nucleotide #1665 to nucleotide 
#2060 as shown in Table in or substantially 
homologous sequences operatively linked to a 



10 

heterologous regulatory control sequence and 
recovering and purifying from the culture medium a 
protein comprising amino acid #323 to amino acid 
#454 as shown in Table III or a substantially 
homologous sequence. The purified human BMP-5 
proteins are substantially free from other 
proteinaceous materials with which they are co- 
produced, as well as from other contaminants. 

Purified BMP-5 bovine cartilage/bone proteins 
of the present invention are produced by culturing 
a host cell transformed with a DNA sequence 
comprising the DNA sequence as shown in Table I 
from nucleotide # 8 to nucleotide # 578 or 
substantially homologous sequences and recovering 
and purifying from the culture medium a protein 
comprising the amino acid sequence as shown in 
Table I from amino acid # 9 to amino acid # 14 o or 
a substantially homologous sequence. The purified 
BMP-5 bovine proteins as well as all of the BMP 
proteins of the invention, are substantially free 
from other proteinaceous materials with which they 
are co-produced, as well as from other 
contaminants . 

Purified human BMP-6 proteins may be produced 
by culturing a host cell transformed with the DNA 
sequence of Table IV. The expressed proteins are 
isolated and purified from the culuture medium. 
Purified human BMP-6 proteins of the invention are 
expected to be characterized by an amino acid 
sequence comprising amino acid #382 to #513 as set 
forth in Table IV. These purified BMP-6 human 
cartilage/bone proteins of the present invention 
are therefore produced by culturing a host cell 
transformed with a DNA sequence comprising 
nucleotide #160 to nucleotide #1698 as set forth 



11 



in Table IV or substantially homologous sequence 
operatively linked to a heterologous regulatory 
control sequence and recovering, isolating and 
purifying from the culture medium a protein 
comprising amino acid #382 to amino acid #513 as 
set forth in Table IV or a substantially homologous 
sequence . 

Further embodiments may utilize the DNA 
sequence comrising the nucleotides encoding amino 
acids #382 - #513. Purified human BMP-6 proteins 
may therefore be produced by culturing a host cell 
transformed with the DNA sequence comprising 
nucleotide #1303 to #1698 as set forth in Table IV 
or substantially homologous sequences operatively 
linked to a heterologous regulatory control 
sequence and recovering and purifying from the 
culture medium a protein comprising amino acid #382 
to #513 as set forth in Table IV or a substantially 
homologous sequence. The purified human BMP-6 

proteins are substantially free from other 
proteinaceous materials with which they are co- 
produced, as well as from other contaminants. 

Purified BMP-6 bovine cartilage/bone protein 
of the present invention are produced by culturing 
a host cell transformed with a DNA sequence 
comprising nucleotide #361 to nucleotide #666 as 
set forth in Table II or substantially homologous 
sequences and recovering from the culture medium a 
protein comprising amino acid #121 to amino acid 
#222 as set forth in Table II or a substantially 
homologous sequence. m another embodiment the 
bovine protein is produced by culturing a host cell 
transformed with a sequence comprising nucleotide 
#289 to #666 of Table II and rcovering and 
purifying a protein comprising amino acid #97 to 



12 

amino acid #222. The purified BMP-6 bovine 
proteins are substantially free from other 
proteinaceous materials with which they are co- 
produced, as well as from other contaminants. 

Purified human BMP-7 proteins may. be produced 
by culturing a host cell transformed with the DNA 
sequence of Table V. The expressed proteins are 
isolated and purified from the culture medium. 
Purified human BMP-7 proteins are expected to be 
characterized by an amino acid sequence comprising 
amino acid #300-#43l as shown in Table V. These 
purified BMP-7 human cartilage/bone proteins of the 
present invention are therefore produced by 
culturing a host cell transformed with a DNA 
sequence comprising nucleotide #97 to nucleotide 
#1389 as shown in Table V or substantially 
homologous sequences operatively linked to a 
heterologous regulatory control sequence and 
recovering, isolating and purifying from the 
culture medium a protein comprising the amino acid 
sequence as shown in Table V from amino acid #300 
to amino acid #431 or a substantially homologous 
sequence . 

Further emodiments may utilize the DNA 
sequence comprising the nucleotides encoding amino 
acids #300 - #431. Purified BMP-7 proteins may be 
produced by culturing a host cell transformed with 
a DNA comprising the DNA sequence as shown in Table 
V from nucleotide #994 - #1389 or substantially 
homologous sequences operatively linked to a 
heterologous regualtory control sequence and 
recovering, and purifying from the culture medium a 
protein comprising the amino acid sequence as shown 
in Table V from amino acid #300 to amino acid #431 
or a substantially homologous sequence. The 



13 



purified human BMP-7 proteins are substantially 
free from other proteinaceous materials from which 
they are co-produced, as well as from other 
contaminants . 

BMP-5, BMP-6 and BMP-7 proteins may be further 
characterized by the ability to demonstrate 
cartilage and/or bone formation activity. This 
activity may be demonstrated, for example, in the 
rat bone formation assay as described in Example 
"I. It is further contemplated that these 
proteins demonstrate activity in the assay at a 
concentration of 10 „g - 500 l g/ g ra m of bone 
formed. The proteins may be further characterized 
by the ability of i„g to score at least +2 in this 
assay using either the original or modified scoring 
method descirbed further herein below. 

BMP-5, BMP-6 and BMP-7 proteins may be further 
characterized by an apparent molecular weight of 
28,000-30,000 daltons as determined by sodium 
dodecyl sulfate polyacryl amide gel electrophoresis 
(SDS-PAGE) . under reducing conditions in SDS-PAGE 
the protein electrophoresis with a molecular weight 
of approximately 14,000-20,000 daltons. 

The proteins provided herein also include 
factors encoded by the sequences similar to those 
of Tables I - v but into which modifications are 
naturally provided (e.g. allelic variations in the 
nucleotide sequence which may result in amino acid 
changes in the polypeptide) or deliberately 
engineered. Similarly, synthetic polypeptides 
which wholly or partially duplicate continuous 
sequences of the amino acid residues of Tables I- 
V are encompassed by the invention. These 
sequences, by virtue of sharing primary, secondary, 
or tertiary structural and conformational 



14 

characteristics with other cartilage/bone proteins 
of the invention may possess bone and/or cartilage 
growth factor biological properties in common 
therewith. Thus, they may be employed as 
biologically active substitutes for naturally- 
occurring proteins in therapeutic processes. 

Other specific mutations of the sequences of 
the proteins of the invention described herein 
involve modifications of a glycosylation site. 
These modification may involve O-linked or N-linked 
glycosylation sites. For instance, the absence of 
glycosylation or only partial glycosylation results 
from amino acid substitution or deletion at the 
asparagine-1 inked glycosylation recognition sites 
present in the sequences of the proteins of the 
invention, as shown in Table I - v. The 
asparagine-linked glycosylation recognition sites 
comprise tripeptide sequences which are 
specifically recognized by appropriate cellular 
glycosylation enzymes. These tripeptide sequences 
are either asparagine-X-threonine or asparagine-X- 
serine, where X is usually any amino acid. A 
variety of amino acid substitutions or deletions at 
one or both of the first or third amino acid 
positions of a glycosylation recognition site 
(and/or amino acid deletion at the second position) 
results in non-glycosylation at the modified 
tripeptide sequence. Expression of such altered 
nucleotide sequences produces variants which are 
not glycosylated at that site. 

The present invention also encompasses the 
novel DNA sequences, free of association with DNA 
sequences encoding other proteinaceous materials, 
and coding on expression for the proteins of the 
invention. These DNA sequences include those 



15 



deputed in Tables I - v in a 5- to 3- direction. 
Further included are those sequences which 
hybridize under stringent hybridization conditions 
[see, T. Maniatis et al, Molecule n ^4^ fn 
Laboratory Manna!) ., Cold Spring Harbor Laboratory 
(1982), pages 387 to 389] to the DNA sequence of 
Tables I - V and demonstrate cartilage and/or bone 
formation activity in the rat bone formation assay. 
An example of one such stringent hybridization 
condition is hybridization at [6- 4 x SSC at 65°C 
followed by a washing in 0.1 x SCC at 6 5 o C for an 
hour. Alternatively, an exemplary stringent 
hybridization condition is in 50% formamide 
4 X SCC at 42°C. ' 

Similarly, DNA sequences which encode proteins 
similar to the protein encoded by the sequences of 
Tables l - v, but which differ in codon sequence 
due to the degeneracies of the genetic code or 
allelic variations (naturally-occurring base 
changes in the species population which may or may 
not result in an amino acid change) also encode the 
proteins of the invention described herein. 
Variations in the DNA sequences of Tables I - V 
which are caused by point mutations or by induced 
modifications (including insertion, deletion, and 
substitution) to enhance the activity, half-life or 
production of the polypeptides encoded thereby are 
also encompassed in the invention. 

in a further aspect, the invention provides a 
method for obtaining related human proteins or 
other mammalian BMP-5, BMP-6 and BMP-7 proteins 
One method for obtaining such proteins entails, for 
instance, utilizing the human BMP-5, BMP-6 and BMP- 
7 coding sequence disclosed herein to probe a 
human genomic library using standard techniques for 



16 

the human gene or fragments thereof. Sequences 
thus identified may also be used as probes to 
identify a human cell line or tissue which 
synthesizes the analogous cartilage/bone protein. 
A cDNA library is synthesized and screened with 
probes derived from the human or bovine coding 
sequences. The human sequence thus identified is 
transformed into a host cell, the host cell is 
cultured and the protein recovered, isolated and 
purified from the culture medium. The purified 
protein is predicted to exhibit cartilage and/or 
bone formation activity in the rat bone" formation 
assay of Example III. 

Another aspect of the present invention 
provides a novel method for producing the BMP-5, 
BMP-6 and BMP-7 proteins of the invention. The 
method of the present invention involves culturing 
a suitable cell or cell line, which has been 
transformed with a DNA sequence as described above 
coding for expression of a protein of the 
invention, under the control of known regulatory 
sequences. Regulatory sequences include promoter 
fragments, terminator fragments and other suitable 
sequences which direct the expression of the 
protein in an appropriate host cell. Methods for 
culturing suitable cell lines are within the skill 
of the art. The transformed cells are cultured and 
the BMP proteins expressed thereby are recovered, 
isolated and purified from the culture medium 
using purification techniques known to those 
skilled in the art. The purified BMP proteins are 
substantially free from other proteinaceous 
materials with which they are co-produced, as well 
as other contaminants. Purified BMP proteins of 
the invention are substantially free from 



17 



materials with which the proteins of the invention 
exist in nature. 

Suitable cells or cell lines nay be mammalian 
cells, such as Chinese hamster ovary cells (CHO) . 
The selection of suitable mammalian host cells and 
methods for transformation, culture, amplification, 
screening and product production and purification 
are known in the art. see, e.g., Gething and 
Sambrook, Nature, ziX'. 620-625 (1981) , or 
alternatively, Kaufman et al, Mol. c«n . m.i , 
1(7): 1750-1759 (1985) or Howley et al, U.S. Patent 
4,419,446. other suitable mammalian cell lines 
include but are not limited to the monkey cos-1 
cell line and the CV-1 cell line. 

Bacterial cells may also be suitable hosts. 
For example, the various strains of £. coli (e.g., 
HBloi, MC1061) are well-known as host cells in the 
field of biotechnology. Various strains of 
fi. sabtilis, Pseudomonas, other bacilli and the 
like may also be employed in this method. 

Many strains of yeast cells known to those 
skilled in the art may also be available as host 
cells for expression of the polypeptides of the 
present invention. Additionally, where desired, 
insect cells may be utilized as host cells in the 
method of the present invention. See, e.g. Miller 
et a1 ' genetic Snqin*p r ing, 8:277-298 (Plenum Press 
1986) and references cited therein. 

Another aspect of the present invention 
provides vectors for use in the method of 
expression of the proteins of the invention. The 
vectors contain the novel DNA sequences which code 
for the BMP-5, BMP-6 and BMP-7 proteins of the 
invention. Additionally, the vectors also contain 
appropriate expression control sequences permitting 



18 



expression of the protein sequences. 
Alternatively, vectors incorporating truncated or 
modified sequences as described above are also 
embodiments of the present invention and useful in 
the production of the proteins of the invention. 
The vectors may be employed in the method of 
transforming cell lines and contain selected 
regulatory sequences in operative association with 
the DNA coding sequences of the invention which are 
capable of directing the replication and 
expression thereof in selected host cells. Useful 
regulatory sequences for such vectors are known to 
those skilled in the art and may be selected 
depending upon the selected host cells. Such 
selection is routine and does not form part of the 
present invention. Host cells transformed with 
such vectors and progeny thereof for use in 
producing BMP-5, BMP-6 and BMP-7 proteins are also 
provided by the invention. 

One skilled in the art can construct mammalian 
expression vectors by employing the DNA sequences 
of the invention and known vectors, such as pCD 
[Okayama et al., Mol. Cell Biol. . 2:161-170 (1982)] 
and pJL3, pJL4 [Gough et al., EMBO J^, 4:645-653 
(1985)]. Similarly, one skilled in the art could 
manipulate the sequences of the invention by 
eliminating or replacing the mammalian regulatory 
sequences flanking the coding sequence with 
bacterial sequences to create bacterial vectors for 
intracellular or extracellular expression by 
bacterial cells. For example, the coding 
sequences could be further manipulated (e.g. 
ligated to other known linkers or modified by 
deleting non-coding sequences there-from or 
altering nucleotides therein by other known 



19 



techniques). The modified coding sequence could 
then be inserted into a known bacterial vector 
using procedures such as described in T. Taniguchi 
et al " Proc. Natl Acad. SH- no , 77:5230-5233 
(1980) . This exemplary bacterial vector could then 
be transformed into bacterial host cells and a 
protein of the invention expressed thereby. For a 
strategy for producing extracellular expression of 
a cartilage and/or bone protein of the invention in 
bacterial cells., see, e.g. European patent 
application EPA 177,343. 

Similar manipulations can be performed for the 
construction of an insect vector [See, e g 
procedures described in published European patent 
application 155,476] for expression in insect 
cells. a yeast vector could also be constructed 
employing yeast regulatory sequences for 
intracellular or extracellular expression of the 
factors of the present invention by yeast cells. 
[See, e.g., procedures described in published PCT 
application WO86/00639 and European patent 
application EPA 123,289]. 

A method for producing high levels of a 
protein of the invention from mammalian cells 
involves the construction of cells containing 
multiple copies of the heterologous gene encoding 
proteins of the invention. The heterologous gene 
may be linked to an amplifiable marker, e.g. the 
dihydrofolate reductase (DHFR) gene for- which cells 
containing increased gene copies can be selected 
for propagation in increasing concentrations of 
methotrexate (MTX) according to the procedures of 
Kaufman and Sharp, J. Moi . th„i , 159: 601-629 
(1982). This approach can be employed with a 
number of different cell types. 



20 

For instance, a plasmid containing a DNA 
sequence for a protein of the invention in 
operative association with other plasmid sequences 
enabling expression thereof and the DHFR 
expression plasmid pAdA26SV(A)3 [Kaufman and Sharp, 
Msii — £§11^ Biol. . 2:1304 (1982)] may be co- 
introduced into DHFR-deficient CHO cells, DUKX-BII, 
by calcium phosphate coprecipitation and 
transfection, electroperation or protoplast fusion. 

DHFR expressing transformants are selected for 
growth in alpha media with dialyzed fetal calf 
serum, and subsequently selected for amplification 
by growth in increasing concentrations of MTX 
(sequential steps in 0.02, 0.2, 1.0 and 5uM MTX) as 
described in Kaufman et al., Mol Cell Biol . f 5:1750 
(1983) . Protein expression should increase with 
increasing levels of MTX resistance. 

Transformants are cloned, and the proteins of 
the invention are recovered, isolated, and purified 
from the culture medium. Characterization of 
expressed proteins may be carried out using 
stnadard techniques. For instance, 

characterization may include pulse labeling with 
[35 s ] methionine or cysteine, or poly aery 1 amide gel 
electrphoresis. Biologically active protein 
expression is monitored by the Rosen-modified 
Sampath - Reddi rat bone formation assay described 
above in Example III. Similar procedures can be 
followed to produce other related proteins. 

A protein of the present invention, which 
induces cartilage and/or bone formation in 
circumstances where bone and/or cartilage is not 
normally formed, has application in the healing of 
bone fractures and cartilage defects in humans and 
other animals. a preparation employing a protein 



WO 90/1 1366 PCI7 US90/01630 

21 

of the invention may have prophylactic use in 
closed as well as open fracture reduction and also 
in the improved fixation of artificial joints, De 
novo bone formation induced by an osteogenic agent 
5 contributes to the repair of congenital , trauma 
induced, or oncologic resection induced 
craniofacial defects, and also is useful in 
cosmetic plastic surgery. A protein of the 
invention may be used in the treatment of 

10 periodontal disease, and in other tooth repair 
processes. Such agents may provide an environment 
to attract bone- forming cells, stimulate growth of 
bone-forming cells or induce differentiation of 
progenitors of bone-forming cells. A variety of 

15 osteogenic, cartilage-inducing and bone inducing 
factors have been described. See, e.g. European 
Patent Applications 148,155 and 169,016 for 
discussions thereof. 

The proteins of the invention may also be used 

20 in wound healing and related tissue repair. The 
types of wounds include, but are not limited to 
bums, incisions and ulcers. See, e.g. PCT 
Publication W084/01106 for discussion of wound 
healing and related tissue repair. 

25 A further aspect of the invention includes 

therapeutic methods and composition for repairing 
fractures and other conditions related to bone 
and/or cartilage defects or periodontal diseases. 
In addition, the invention comprises therapeutic 

30 methods and compositions for wound healing and 
tissue repair. Such compositions comprise a 
therapeutically effective amount of at least one of 
the BMP proteins BMP-5, 

BMP-6 and BMP-7 of the invention in admixture with 
35 a pharmaceutically acceptable vehicle, carrier or 



22 

matrix. 



It is expected that the proteins of the 
invention may act in concert with or perhaps 
synergistically with one another or with other 
related proteins and growth factors. Therapeutic 
methods and compositions of the invention 
therefore comprise one or more of the proteins of 
the present invention. Further therapeutic methods 
and compositions of the invention therefore 
comprise a therapeutic amount of at least one 
protein of the invention with a therapeutic amount 
of at least one of the other "BMP'* proteins BMP-l, 
BMP-2, BMP-3 and BMP-4 disclosed in co-owned 
Published International Applications WO88/00205 and 
W089/10409 as mentioned above. Such methods and 
compositions of the invention may comprise 
proteins of the invention or portions thereof in 
combination with the above-mentioned "BMP" proteins 
or portions thereof. 

Such combination may comprise individual 
separate molecules of the proteins or 
heteromolecules such as heterodimers formed by 
portions of the respective proteins. For example, 
a method and composition of the invention may 
comprise a BMP protein of the present invention or 
a portion thereof linked with a portion of another 
"BMP" protein to form a heteromolecule. 

Further therapeutic methods and compositions 
of the invention comprise the proteins of the 
invention or portions thereof in combination with 
other agents beneficial to the treatment of the 
bone and/or cartilage defect, wound, or tissue in 
question. These agents include various growth 
factors such as epidermal growth factor (EGF) , 
fibroblast growth factor (FGF) , platelet derived 



23 



growth factor (PDGF) , transforming growth factors 
(TGF-a and TGF-/}), K-fibroblast growth factor 
(kFGF) , parathyroid hormone (PTH) , leukemia 
inhibitory factor (LIF/HILDA, DIA) and insulin-like 
growth factor (igf-i and IGF-ll) . Portions of 
these agents may also be used in compositions of 
the invention. 

The preparation and formulation of such 
physiologically acceptable protein compositions, 
having due regard to p H , isotonicity, stability and 
the like, is within the skill of the art. The 
therapeutic compositions are also presently 
valuable for veterinary applications due to the 
apparent lack of species specificity in cartilage 
and bone growth factor proteins. Domestic animals 
and thoroughbred horses in addition to humans are 
desired patients for such treatment with the 
proteins of the present invention. 

The therapeutic method includes administering 
the composition topically, systemically, or locally 
as an implant or device. When administered, the 
therapeutic composition for use in this invention 
is, of course, in a pyrogen-free, physiologically 
acceptable form. Further, the composition may 
desirably be encapsulated or injected in a viscous 
form for delivery to the site of cartilage and/or 
bone or tissue damage. Topical administration may 
be suitable for wound healing and tissue repair. 

Preferably for bone and/or cartilage 
formation, the composition would include a matrix 
capable of delivering the BMP proteins of the 
invention to the site of bone and/or cartilage 
damage, providing a structure for the developing 
bone and cartilage and optimally capable of being 
resorbed into the body. The matrix may provide 



24 

slow release of the BMP proteins or other factors 
comprising the composition. Such matrices may be 
formed of materials presently in use for other 
implanted medical applications. 

The choice of matrix material is based on 
biocompatibility, biodegradability, mechanical 
properties, cosmetic appearance and interface 
properties. The particular application of the 
compositions of the invention will define the 
appropriate formulation. Potential matrices for 
the compositions may be biodegradable and 
chemically defined calcium sulfate, 
tricalciumphosphate, hydroxyapatite, polylactic 
acid and polyanhydrides. Other potential 
materials are biodegradable and biologically well 
defined, such as bone or dermal collagen. Further 
matrices are comprised of pure proteins or 
extracellular matrix components. other potential 
matrices are nonbiodegradable and chemically 
defined, such as sintered hydroxyapatite, 
bioglass, aluminates, or other ceramics. Matrices 
may be comprised of combinations of any of the 
above mentioned types of material, such as 
polylactic acid and hydroxyapatite or collagen and 
tricalciumphosphate. The bioceramics may be 
altered in composition, such as in calcium- 
aluminate-phosphate and processing to alter pore 
size, particle size, particle shape, and 
biodegradability. 

The dosage regimen will be determined by the 
attending physician considering various factors 
which modify the action of the proteins of the 
invention. Factors which may modify the action of 
the proteins of the invention include the amount of 
bone weight desired to be formed, the site of bone 



25 



damage, the condition of the damaged bone, the size 
of a wound, type of damaged tissue, the patient's 
age, sex, and diet, the severity of any infection, 
time of administration and other clinical factors. 
The dosage may vary with the type of matrix used in 
the reconstitution and the type or types of bone 
and/or cartilage proteins present in the 
composition. The addition of other known growth 
factors, such as EGF, PDGF, TGF-a , TGF-/3, and IGF-I 
and IGF-II to the final composition, may also 
effect the dosage. 

Progress can be monitored by periodic 
assessment of cartilage and/or bone growth and/or 
repair. The progress can be monitored, for 
example, using x-rays, histomorphometric 
determinations and tetracycline labeling. 

The following examples illustrate practice of 
the present invention in recovering and 
characterizing bovine cartilage and/or bone 
proteins of the invention and employing these 
proteins to recover the corresponding human protein 
or proteins and in expressing the proteins via 
recombinant techniques. 

EXAMPLE I 

. Isolation of Bovine CarH 1 g qe/Bong Xnductjv* 
Protein 

Ground bovine bone powder (20-120 mesh, 
Helitrex) is prepared according to the procedures 
of M. R. Urist et al., Proc. Natl Acad, ttq i , 

70:3511 (1973) with elimination of some extraction 
steps as identified below. Ten kgs of the ground 
powder is demineralized in successive changes of 
0.6N 

HCl at 4 Jc over a 48 hour period with vigorous 



26 

stirring. The resulting suspension is extracted 
for 16 hours at 4¥C with 50 liters of 2M CaCl 2 and 
lOmM ethylenediamine-tetraacetic acid [EDTA] , and 
followed by extraction for 4 hours in 50 liters of 
0.5M EDTA. The residue is washed three times with 
distilled water before its resuspension in 20 
liters of 4M guanidine hydrochloride [GuCl] , 20mM 
Tris (pH 7.4), ImM N-ethylmaleimide, ImM 
iodoacetamide, ImM phenylmethylsulfonyl fluorine as 
described in Clin. Orthop. Rel. T?os. r 171 . 2 13 
(1982). After 16 to 20 hours the supernatant is 
removed and replaced with another 10 liters of GuCl 
buffer. The residue is extracted for another 24 
hours . 

The crude GuCl extracts are combined, 
concentrated approximately 20 times on a Pell icon 
apparatus with a 10,000 molecular weight cut-off 
membrane, and then dialyzed in 50mM Tris, 0.1M 
NaCl, 6M urea (pH7.2), the starting buffer for the 
first column. After extensive aialysis the protein 
is loaded on a 4 liter DEAE cellulose column and 
the unbound fractions are collected. 

The unbound fractions are concentrated and 
dialyzed against 50mM NaAc, 50mM NaCl (pH 4.6) in 
6M urea. The unbound fractions are applied to a 
carboxymethyl cellulose column. Protein not bound 
to the column is removed by extensive washing with 
starting buffer, and the material containing 
protein having bone and/or cartilage formation 
activity as measured by the Rosen-modified Sampath- 
Reddi assay (described in Example III below) 
desorbed from the column by 50mM NaAc, 0.25mM NaCl, 
6M urea (pH 4.6). The protein from this step 
elution is concentrated 20- to 40- fold, then 
diluted 5 times with 80mM KP0 4 , 6M urea (pH6.0). 



27 



The pH of the solution is adjusted to 6.0 with 
500mM K 2 HP0 4 . The sample is applied to an 
hydroxylapatite column (LKB) equilibrated in 80mM 
KP0 4 , 6M urea (pH6.0) and all unbound protein is 
removed by washing the column with the same 
buffer. Protein having bone and/or cartilage 
formation activity is eluted with loomM KP0 4 
(PH7.4) and 6M urea. 

The protein is concentrated approximately 10 
times, and solid NaCl added to a final concen- 
tration of 0.15M. This material is applied to a 
heparin - Sepharose column equilibrated in 50mM 
KP0 4 , IsomMNaCI, 6Murea (pH7.4). After extensive 
washing of the column with starting buffer, a 
protein with bone and/or cartilage inductive 
activity is eluted by 50mM KP0 4 , 700mM NaCl, 6M 
urea (pH7.4). This fraction is concentrated to a 
minimum volume, and 0.4ml aliquots are applied to 
Superose 6 and Superose 12 columns connected in 
series, equilibrated with 4M GuCl, 20mM 
Tris (pH7.2) and the columns developed at a flow 
rate of 0.25ml/min. The protein demonstrating bone 
and/or cartilage inductive activity corresponds to 
an approximate 30,000 dalton protein. 

The above fractions from the superose columns 
are pooled, dialyzed against SOmM NaAc, 6M urea 
(PH4.6), and applied to a Pharmacia MonoS HR 
column. The column is developed with a gradient to 
1.0M NaCl, 50mM NaAc, 6M urea (pH4.6). Active bone 
and/or cartilage formation fractions are pooled. 
The material is applied to a 0.46 x 25cm Vydac C4 
column in 0.1% TFA and the column developed with a 
gradient to 90% acetonitrile, o.l% tfa (31.5% 
acetonitrile, o.l% TFA to 49.5% acetonitrile, o.'l% 
TFA in 60 minutes at 1ml per minute). Active 



28 



material is eluted at approximately 40-44% ace- 
tonitrile. Fractions were assayed for cartilage 
and/ or bone formation activity. The active material 
is further fractionated on a MonoQ column. The 
protein is dialyzed against 6M urea, 2 5mM 
diethanolamine, pH 8.6 and then applied to a 0.5 by 
5 cm MonoQ column (Pharmacia) which is developed 
with a gradient of 6M urea, 25mM diethanolamine, pH 
8.6 and 0.5 M NaCl, 6M urea, 25mM diethanolamine, 
pH 8.6. Fractions are brought to pH3.0 with 10% 
trifluoroacetic acid (TFA) . Aliquots of the 
appropriate fractions are iodinated by one of the 
following methods: p. j. McConahey et al, 
Int. Arcfr. Allergy , 29:185-189 (1966); A. E. Bolton 
et al, Bjochem J. , 133:529 (1973); and D. F. 
Bowen-Pope, J. Biol. rw T r 237:5161 (1982). The 
iodinated proteins present in these fractions are 
analyzed by SDS gel electrophoresis. 

EXAMPLE II 

Characterization of Bovine r* r tilage/Bnne Induct v» 
Factor 

A. Molecular Weight 

Approximately 5/*g protein from Example I in 6M 
urea, 25mM diethanolamine, pH 8.6, approximately 
0.3 M NaCl is made 0.1% with respect to SDS and 
dialyzed against 50 mM tris/HCl 0.1% SDS pH 7.5 for 
16 hrs. The dialyzed material is then 
electrophorectically concentrated against a 
dialysis membrane [Hunkapillar et al Meth. En^y ™"? 
21: 227-236 (1983) 3 with a small amount of I 125 
labelled counterpart. This material (volume 
approximately 100„1) is loaded onto a 12% 
polyacrylamide gel and subjected to SDS-PAGE 
[Laemmli, U.K. Nature, 227:680-685 (1970)] without 



29 

reducing the sample with dithiothreitol . The 
molecular weight is determined relative to 
prestained molecular weight standards (Bethesda 
Research Labs) . Following autoradiography of the 
unfixed gel the approximate 28,000-30,000 dalton 
band is excised and the protein electrophoretically 
eluted from the gel (Hunkapillar et al suora l . 
Based on similar purified bone fractions as 
described in the co-pending "BMP" applications 
described above wherein bone and/or cartilage 
activity is found in the 28,000-30,000 region, it 
is inferred that this band comprises bone and/or 
cartilage inductive fractions. 

B. Subunit Characterization 

The subunit composition of the isolated bovine 
bone protein is also determined. The eluted 
protein described above is fully reduced and 
alkylated in 2% SDS using iodoacetate and standard 
procedures and reconcentrated by electrophoretic 
packing. The fully reduced and alkylated sample is 
then further submitted to SDS-PAGE on a 12% gel and 
the resulting approximate 14, 000-20,000 dalton 
region having a doublet appearance located by 
autoradiography of the unfixed gel. A faint band 
remains at the 28,000-30,000 region. Thus the 
28,000-30,000 dalton protein yields a broad region 
of 14,000-20,000 which may otherwise also be 
interpreted and described as comprising two broad 
bands of approximately 14,000-16,000 and 16, 000- 
20,000 daltons. 



EXAMPLE III 

Rosen Modified Sam path-Rftr^ &e ea y 

A modified version of the rat bone 



formation assay described in Sampath and Reddi, 
Proc. Natl. Acad . Sci. U.S.A. . 80:6591-6595 (1983) 
is used to evaluate bone and/or cartilage activity 
of the proteins of the invention. This modified 
assay is herein called the Rosen-modified Sampath- 
Reddi assay. The ethanol precipitation step of the 
Sampath-Reddi procedure is replaced by dialyzing 
(if the composition is a solution) or diafiltering 
(if the composition is a suspension) the fraction 
to be assayed against water. The solution or 
suspension is then redissolved in 0.1 % TFA, and 
the resulting solution added to 20mg of rat matrix. 
A mock rat matrix sample not treated with the 
protein serves as a control. This material is 
frozen and lyophilized and the resulting powder 
enclosed in #5 gelatin capsules. The capsules are 
implanted subcutaneously in the abdominal thoracic 
area of 21 - 49 day old male Long Evans rats. The 
implants are removed after 7-14 days. Half of 
each implant is used for alkaline phosphatase 
analysis [See, A. H. Reddi et al., Proc. Natl 
Sci. . 69:1601 (1972)]. 

The other half of each implant is fixed and 
processed for histological analysis. 
Glycolmethacrylate sections . (l,im) are stained with 
Von Kossa and acid fuschin or toluidine blue to 
score the amount of induced bone and cartilage 
formation present in each implant. The terms +1 
through +5 represent the area of each histological 
section of an implant occupied by new bone and/or 
cartilage cells and newly formed bone and matrix. 
Two scoring methods are herein described. In the 
first scoring method a score of +5 indicates that 
greater than 50% of the implant is new bone and/or 
cartilage produced as a direct result of protein in 



31 

the implant. a score of +4, " + 3f +2 and +1 
would indicate that greater than 40%, 30%, 20% and 
10% respectively of the implant contains new 
cartilage and/or bone. The second scoring method 
(which hereinafter may be referred to as the 
modified scoring method) is as follows: three non- 
adjacent sections are evaluated from each implant 
and averaged. .-+/-•■ indicates tentative 
identification of cartilage or bone; 
indicates >io% of each section being new cartilage 
or bone; «+2«, >25%; »+3", >50%; «.+4« f -75%; »+5«, 
>80%. The scores of the individual implants are 
tabulated to indicate assay variability. 

It is contemplated that the dose response 
nature of the cartilage and/or bone inductive 
protein containing samples of the matrix samples 
will demonstrate that the amount of bone and/or 
cartilage formed increases with the amount of 
cartilage/bone inductive protein in the sample, it 
is contemplated that the control samples will not 
result in any bone and/or cartilage formation. 

As with other cartilage and/or bone inductive 
proteins such as the above-mentioned "BMP- 
proteins, the bone and/or cartilage formed is 
expected to be physically confined to the space 
occupied by the matrix. Samples are also analyzed 
by SDS gel electrophoresis and isoelectric focusing 
followed by autoradiography. The activity is 
correlated with the protein bands and pi. To 
estimate the purity of the protein in a particular 
fraction an extinction coefficient of i OD/mg-cm 
is used as an estimate for protein and the protein 
is run on SDS-PAGE followed by silver staining or 
radioiodination and autoradiography. 



32 



EXAMPLE IV 

A. Bovine P rotein Composition 

The gel slice of the approximate 14,000-* 
20,000 dalton region described in Example IIB is 
fixed with methanol-acetic acid-water using 
standard procedures, briefly rinsed with water, 
then neutralized with 0.1M ammonium bicarbonate. 
Following dicing the gel slice with a razor blade, 
the protein is digested from the gel matrix by 
adding 0.2 pg of TPCK-treated trypsin (Worthington) 
and incubating the gel for 16 hr. at 37 degrees 
centigrade. The resultant digest is then subjected 
to RPHPLC using a C4 Vydac RPHPLC column and 0.1% 
TFA-water 0.1% TFA water-acetonitrile gradient. 
The resultant peptide peaks were monitored by UV 
absorbance at 214 and 280 nm and subjected to 
direct amino terminal amino acid sequence analysis 
using an Applied Biosystems gas phase seguenator 
(Model 470A). One tryptic fragment is isolated by 
standard procedures having the following amino acid 
sequence as represented by the amino acid standard 
three-letter symbols and where "Xaa" indicates an 
unknown amino acid the amino acid in parentheses 
indicates uncertainty in the sequence: 

Xaa-His-Glu-Leu-Tyr-Val-Ser-Phe-(Ser) 

The following four oligonucleotide probes are 
designed on the basis of the amino acid sequence 
of the above-identified tryptic fragment and 
synthesized on an automated DNA synthesizer. 

PROBE fit 6TRCTYGANATRCANTC 
PROBE #2: GTRCTYGANATRCANAG 



33 

PROBE #3: GTRCTYAAYATRCANTC 
PROBE #4: GTRCTYAAYATRCANAG 



The standard nucleotide symbols in the above 
identified probes are as follows: Adenosine; 
C,cytosine; G,guanine; T, thymine; N, adenosine or 
cytosine or guanine or thymine; R, adenosine or 
guanine; and Y, cytosine or thymine. 

Each of the probes consists of pools of 
oligonucleotides. Because the genetic code is 
degenerate (more than one codon can code for the 
same amino acid) , a mixture of oligonucleotides is 
synthesized that contains all possible nucleotide 
sequences encoding the amino acid sequence of the 
tryptic. These probes are radioactively labeled 
and employed to screen a bovine cDNA library as 
described below. 

B. Bovine TWp-n 

Poly (A) containing RNA is isolated by 
oligo(dT) cellulose chromatography from total RNA 
isolated from fetal bovine bone cells by the method 

of Gehron-Robey et al in Current 1n 

SkeletoqenPsis , Elsevier Science Publishers (1985) . 
The total RNA was obtained from Dr. Marion Young,' 
National Institute of Dental Research, National 
institutes of Health. a cDNA library is made in 
lambda gtio (Toole et al supra, and plated on 50 
plates at a 000 recombinants per plate. These 
recombinants (400,000) are screened on duplicate 
nitrocellulose filters with a combination of Probes 
1/ 2, 3, and 4 using the Tetramethylammonium 
chloride (TMAC) hybridization procedure [see Wozney 
et al Science , 242: 1528-1534 (1988)]. Twenty- 



34 



eight positives are obtained and are replated for 
secondaries. Duplicate nitrocellulose replicas 
again are made. One set of filters are screened 
with Probes #1 and #2; the other with Probes #3 and 
#4. Six positives are obtained on the former, 21 
positives with the latter. One of the six, called 
HEL5, is plague purified, a phage plate stock made, 
and bacteriophage DNA isolated. This DNA is 
digested with EcoRl and subcloned into M13 and 
PSP65 (Promega Biotec, Madison, Wisconsin) [Melton, 
et al - Pugl- Acids Pes, xz: 7035-7056 (1984)]. The 
DNA sequence and derived amino acid sequence of 
this fragment is shown in Table I. 

DNA sequence analysis of this fragment in 
M13 indicates that it encodes the desired tryptic 
peptide sequence set forth above, and this derived 
amino acid sequence is preceded by a basic residue 
(Lys) as predicted by the specificity of trypsin. 
The underlined portion of the sequence in Table I 
from amino acid #42 to #48 corresponds to the 
tryptic fragment identified above from which the 
oligonucleotide probes are designed. The derived 
amino acid -sequence Ser-Gly-Ser-His-Gln-Asp-Ser- 
Ser-Arg as set forth in Table I from amino acid #15 
to #23 is noted to be similar to a tryptic fragment 
sequence Ser-Thr-Pro-Ala-Gln-Asp-Val-Ser-Arg found 
in the 28,000 - 30,000 dalton purified bone 
preparation as described in the "BMP" Publications 
W088/00205 and WO89/10409 mentioned above. This 
fragment set forth in Table 1 is a portion of the 
DNA sequence which encodes a bovine BMP-5 protein. 
The DNA sequence shown in Table I indicates an open 
reading frame from the 5' end of the clone of 420 
base pairs, encoding a partial peptide of 140 amino 
acid residues (the first 7 nucleotides are of the 



WO 90/11366 PCT/US90/01630 



35 



adaptors used in the cloning procedure). An in- 
frame stop codon (TAA) indicates that this clone 
encodes the carboxy-terminal part of bovine BMP-5. 



WO 90/11366 



36 

TABLE I 



PCT/US90/01630 



1 TCTAGAGGTGAGAGCAGCCAACAAGAGAAAAAATCAAAACCGCAATAAATCCGGCTCTCAT 
LeuGluValArgAlaAlaAsnLysArgLysAsnGlnAsnArgAsnLys SerGlvSerHis 
(1) (15) 

CAGGACTCCTCTAGAATGTCCAGTGTTGGAGATTATAACACCAGTGAACAAAAACAAGCC 
GlnAspSerSerArgMetSerSerValGlyAspTyrAsnThrSerGluGlnLysGlnAla 

TGTAAAAAGCATGAACTCTATGTGAGTTTCCGGGATCTGGGATGGCAGGACTGGATTATA 
CysLvsLvsHisGluLeuTvry a lSA y p>,o&>-r f ^« 5r T a ,^ 1 y T ^ n1nft -- T IlcIlc 

(42) (48) 

182 GCACCAGAAGGATATGCTGCATTTTATTGTGATGGAGAATGTTCTTTTCCACTCAATGCC 
AlaProGluGlyTyrAlaAlaPheTyrCysAspGlyGluCysSerPheProLeuAsnAla 

242 CATATGAATGCCACCAATCATGCCATAGTTCAGACTCTGGTTCACCTGATGTTTCCTGAC 
HisMetAsnAlaThrAsnHisAlalleValGlnThrLeuValHisLeuMetPheProAsp 



62 



122 



302 



CACGTACCAAAGCCTTGCTGCGCGACAAACAAACTAAATGCCATCTCTGTGTTGTACTTT 
HisValProLysProCysCysAlaThrAsnLysLevAsnAlalleSerValLeuTyrPhe 



362 GATGACAGCTCCAATGTCATTTTGAAAAAGTACAGAAATATGGTCGTGCGTTCGTGTGGT 
AspAspSerSerAsnVallleLeuLysLysTyrArgAsnMetValValArgSerCysGly 

422 TGCCACTAATAGTGCATAATAATGGTAATAAGAAAAAAGATCTGTATGGAGGTTTATGA 
cysHisEnd 

(140) 

481 CTACAATAAAAAATATCTTTCGGATAAAAGGGGAATTTAATAAAATTAGTCTGGCTCATT 
541 TCATCTCTGTAACCTATGTACAAGAGCATGTATATAGT 578 



WO 90/11366 

C. Bovine BMP-fi 



37 



PCT/US90/01630 



The remaining positive clones (the second set 
containing 21 positives) isolated with Probes #1, 
#2, #3, and #4 described above are screened with 
5 HEL5 and a further clone is identified that 

hybridizes under reduced hybridization conditions 
[5x SSC, 0.1% SDS, 5X Denhardfs, 100 „g/ml salmon 
sperm DNA standard hybridization buffer (SHB) at 
65-c, wash in 2XSSC 0.1% SDS at 65"C] . This clone 

10 is plaque purified, a phage plate stock made and 

bacteriophage DNA isolated. The DNA sequence and 
derived amino acid sequence of a portion of this 
clone is shown in Table II. This sequence 
represents a portion of the DNA sequence encoding a 

15 bovine BMP-6 cartilage/bone protein of the 

invention. 

The first underlined portion of the sequence 
in Table II from amino acid #97 - amino acid #105 
corresponds to the tryptic fragment found in the 

20 28,000-30,000 dalton purified bovine bone 

preparation (and its reduced form at approximately 
18,000-20,000 dalton reduced form) as described in 
the "BMP" Publications W088/00205 and WO89/10409 
mentioned above. The second underlined sequence in 

25 Table II from amino acid #124 - amino acid #130 

corresponds to the tryptic fragment identified 
above from which the oligonucleotide probes are 
designed. 

The DNA sequence of Table II indicates an open 
reading frame of 666 base pairs starting from the 
5' end of the sequence of Table II, encoding a 
partial peptide of 222 amino acid residues. An in- 
frame stop codon (TGA) indicates that this clone 
encodes the carboxy-terminal part of a bovine BMP-6 



30 



WO 90/11366 PCT/US90/01630 

38 

protein. Based on knowledge of other BMP proteins 
and other proteins in the TGF-jfl family, it is 
predicted that the precursor polypeptide would be 
cleaved at the three basic residues (ArgArgArg) to 
5 yield a mature peptide beginning with residue 90 or 

91 of the sequence of Table II. 



WO 90/11366 



39 



PCT/US90/01630 



TABLE U 



CDS CIG 
Leu Leu 
(1) 



ATC AOS 
He Thr 



CAG CIG 
Gin Leu 



CIG GIG 
Leu Val 



AAG GOC 
Lys Ala 



9 

GGC AOS 031 
Gly Thr Arg 

63 

GOC ACC AGO 
Ala Thr Ser 

117 

AGC GIG GTC 
Ser Val Val 

171 

GGC AGG GAC 
Gly Arg Asp 

225 

AGT GAG GTC 
Ser Glu Val 



18 

GCT GIG TGG 
Ala Val Tip 

72 

AAC CIG TGG 
Asn Leu Trp 

126 

AOS OST GAT 
Thr Arg Asp 

180 

GGC CCC TAG 
Gly Pro Tyr 



279 



234 

CAC GTS GGC 
His Val Arg 

288 



27 

GCC TCA GAG 
Ala Ser Glu 

81 

GTC CIG ACT 
Val Leu Thr 

135 

GGG CTC AGC 
Gly Leu Ser 

189 

GAC AAG GAG 
Asp Lys Gin 

243 



36 



45 



54 



GOS GGC TGG CIG GAG TIT GAC 
Ala Gly Trp Leu Glu Hie Asp 



90 



99 



108 



COS GAG CAC AAC ATG GGG CTG 
Ero Gin His Asn MET Gly Leu 



144 



153 



162 



ATC AGC OCT GGG GCC GOG GGC 
He Ser Pro Gly Ala Ala Gly 



198 



207 



216 



CCC TIC ATG CTG GCC TIC TIC 
Pro She MET Val Ala Hie Phe 



252 



261 



270 



CAG GAG 
Gin Gin 



GCC TCA 
Ala Ser 



TAG GTG 
Tvr Val 



GCC CGG AAC 
Ala Arg Asn 

333 

GAC TAC AAC 
Asp Tyr Asn 

387 

AGC TIC CAG 
_Ser Phe Gin 



OSC TCC ACC 
Arg Ser ihr 



342 



(97) 



AST GCC CGG 
Ser Ala Arg 

297 

COS GCC CAG 
Pro Ala CIt^ 



TOS GCC CCC GGG OGG OSC CGG 
Ser Ala Pro Gly Arg Arg Arg 



306 



315 



324 



GAC GTG TOS CGG GCC TCC AGC 
Asp Val Sp»t» &ttj Al a ser Ser 



441 



(130) 



TAC GCT 
Tyr Ala 



AAC GCT 
Asn Ala 



GOC AAC TAC 
Ala Asn Tyr 

495 

ACC AAC CAT 
Thr Asn His 



AGC AGC GAG 
Ser Ser Glu 

396 

GAC CTG GGG 
Asp Leu dy 

450 

TGT-GAC GGA 
Cys Asp Gly 

504 

GCC ATC GTG 
Ala lie Val 



351 

CTG AAG AGS 
Leu Lys Thr 

405 

TGG CAG GAC 
Trp Gin Asp 

459 

GAA TGT TOG 
Glu Cys Ser 

513 

CAG ACC CTG 
Gin Thr Leu 



360 



(105) 
369 



378 



GCC TGC CGG AAG CAT GAG CTC 
Ala Cys Arg Lys His Glu Ton 

(121) <124)" 

4 14 423 432 

TGG ATC ATT GCC CCC AAG GGC 
Trp lie lie Ala Pro Lys Gly 



468 



477 



486 



TIC OCT CTC AAC GCA CAC ATG 
Phe Pro Leu Asn Ala His MET 



522 



531 



540 



GTT CAC CTC ATG AAC CCC GAG 
Val His Leu MET Asn Pro Glu 



WO 90/1 1366 PCT/US90/01630 

40 

TABLE II 
(page 2 of 2) 



549 558 567 576 585 



594 



TAC GTC CCC AAA COS TGC TGC GOG COC AOS AAA CTG AAC GOC ATC TCG GTG CTC 
TyrValProLysEcoCysC^i^itoihrl^lfiuAEnAlalleSerValLeu 



603 612 621 630 639 



648 



TAC TTC GAC GAC AAC TCC ART GTC ATC CTG AAG AAG TAC OGG AAC ATC GTC GTA 
Tyr Hie Asp Asp Asn Ser Asn Val lie Leu Lys Lys Tyr Arg Asn MET Val Val 

657 666 676 686 696 706 716 

Arg ALa Cys Gly Cys His TGACT0GQGG TSftCT3G< -^ GGGAOGCTGT GCACACACIG CCTCGACICC 

(222) 

726 736 746 756 766 776 786 

TGGATCACGT OCGCCTTAAG OCCACAGAGG CCCCOGGGAC ACAGGAGGAG ACCCGGAGGC CACCIT0GGC 

_ 796 806 816 826 836 846 856 

TCG03TTGGC CTITCCGCCC AACGCAGAOC CGAAGGGACC CIGTCCGCCC CITGCICACA COGTGAGCCT 

866 876 886 

TGTGAGTAGC CATOGGGCTC TAGGAAGCAG CACTCGAG 



WO 90/11366 



41 



PCT/US90/01630 



EXAMPLE V 

A - Human P rotein Composition 

Human cell lines which synthesize BMP-5 and/or 
5 BMP-6 mRNAs are identified in the following manner. 

RNA is isolated from a variety of human cell lines, 
selected for poly (A) -containing RNA by 
chromatography on oligo(dT) cellulose, 
electrophoresed on a formaldehyde-agarose gel, and 
10 transferred to nitrocellulose. A nitrocellulose 

replica of the gel is hybridized to a single 
stranded M13 3 2p-iabeled probe corresponding to the 
above mentioned BMP-5 EcoRI-Bglll fragment 
containing nucleotides 1-465 of the sequence of 
15 Table I. a strongly hybridizing band is detected 

in the lane corresponding to the human osteosarcoma 
cell line U-20S RNA. Another nitrocellulose 
replica is hybridized to a single stranded M13 32 p _ 
labeled probe containing the Pstl-Smal fragment of 
20 bovine BMP-6 (corresponding to nucleotides 106- 

261 of Table II). it is found that several RNA 
species in the lane corresponding to U-20S RNA 
hybridize to this probe. 

A cDNA Library is made in the vector lambda 
ZAP (Stratagene) from U-20S poly (A) -containing RNA 
using established techniques (Toole et al.). 
750,000 recombinants of this library are plated and 
duplicate nitrocellulose replicas made. The Smal 
fragment of bovine BMP-6 corresponding to 
nucleotides 259-751 of Table II is labeled by nick- 
translation and hybridized to both sets of filters 
in SHB at 65-Y. One set of filters is washed 
under stringent conditions (0.2X SSC, 0.1% SDS at 
65-r), the other under reduced stringency 
35 conditions (ix SSC, 0.1% SDS at 65T) . Many 



25 



30 



42 

duplicate hybridizing recombinants (approximately 
162) are noted. 24 are picked and replated for 
secondaries. Three nitrocellulose replicas are 
made of each plate. One is hybridized to the BMP-6 
Smal probe, one to a nick-translated BMP-6 Pstl- 
SacI fragment (nucleotides 106-378 of Table II) , 
and the third to the nick-translated BMP-5 Xbal 
fragments (nucleotides 1-76 of Table I) . 
Hybridization and washes are carried out under 
stringent conditions. 
B. Human BMP-5 Proteins 

17 clones that hybridize to the third probe 
more strongly than to the second probe are plaque 
purified. DNA sequence analysis of one of these, 
U2-16, indicates that it encodes human BMP-5. U2- 
16 was deposited with the American Type Culture 
Collection (ATCC) , Rockville, Maryland on June 22, 
1989 under accession number ATCC 68109. This 
deposit as well as the other deposits described 
herein are made under the provisions of the 
Budapest Treaty on the International Recognition of 
the Deposit of Microorganisms for the Purposes of 
Patent Procedure and the Regulations thereunder 
(Budapest Treaty). U2-16 contains an insert of 
approximately 2.1 Kb. The DNA sequence and derived 
amino acid sequence of U2-16 is shown below in 
Table III. This clone is expected to contain all 
of the nucleotide sequence necessary to encode 
human BMP-5 proteins. The cDNA sequence of Table 
III contains an open reading frame of 1362 bp, 
encoding a protein of 454 amino acids, preceded by 
a 5 » untranslated region of 700 bp with stop codons 
in all frames, and contains a 3 1 untranslated 
region of 90 bp following the in frame stop codon 
(TAA) . 



This protein of 454 amino acids has a 
Molecular weight of approximately 52,000 daltons as 
predicted by its amino acid sequence, and is 
contemplated to represent the primary translation 
product. Based on knowledge of other BMP proteins 
and other proteins within the TGF-fi family, it is 
predicted that the precursor polypeptide would be 
cleaved at the tribasic peptide Lys Arg Lys 
yielding a 132 amino acid mature peptide beginning 
with amino acid #323 "Asn". The processing of BMP- 
5 into the mature form is expected to involve 
dimerization and removal of the N-terminal region 
in a manner analogous to the processing of the 
related protein TGF-0 [L.E. Gentry, et al., Molec. 
* Cell. pfhl. U4162 (1988); R. Dernyck, et al., 
Ha^iEe 31f:701 (1985)]. 

It is contemplated therefore that the mature 
active species of BMP-5 comprises a homodimer of 2 
polypeptide subunits each subunit comprising amino 
acid #323 - #454 with a predicted molecular weight 
of approximately 15,000 daltons. Further active 
BMP-5 species are contemplated, for example, 
proprotein dimers or proprotein subunits linked to 
mature subunits. Additional active species may 
comprise amino acid #329 - #454 such species 
including homologous the tryptic sequences found in 
the purified bovine material. Also contemplated 
are BMP-5 proteins comprising amino acids #353- 
#454 thereby including the first conserved 
cysteine residue. 

The underlined sequence of Table in from 
amino acid #329 to #337 Ser-Ser-Ser-His-Gln-Asp- 
Ser-Ser-Arg shares homology with the bovine 
sequence of Table I from amino acid #15 to #23 as 
discussed above in Example IV. Each of these 



WO 90/11366 



44 



PCT/US90/01630 



sequences shares homology with a tryptic fragment 
sequence Ser-Thr-Pro-Ala-Gln-Asp-Val-Ser-Arg found 
in the 28,000 - 30,000 dalton purified bone 
preparation (and its reduced form at approximately 
18,000 - 20,000 daltons) as described in the "BMP" 
published applications W088/00205 and W089/10409 
mentioned above. 

The underlined sequence of Table III from 
amino acid #356 to #362 His-Glu-Leu-Tyr-Val-Ser-Phe 
corresponds to the tryptic fragment identified in 
the bovine bone preparation described above from 
which the oligonucleotide probes are designed. 



WO 90/11366 



45 



PCT/US90/01630 



TABLE III 



10 20 30 40 50 

CTGGTATATT TGTGCCTGCT GGAGGTGGAA TTAACAGTAA GAAGGAGAAA 
60 70 80 90 100 

GGGATTGAAT GGACTTACAG GAAGGATTTC AAGTAAATTC AGGGAAACAC 
110 "0 130 140 iso 

ATTTACTTGA ATAGTACAAC CTAGAGTATT ATTTTACACT AAGACGACAC 
160 170 180 190 2 oo 

AAAAGATGTT AAAGTTATCA CCAAGCTGCC GGACAGATAT ATATTCCAAC 
210 220 230 240 250 

ACCAAGGTGC AGATCAGCAT AGATCTGTGA TTCAGAAATC AGGATTTGTT 
260 270 280 290 300 

TTGGAAAGAG CTCAAGGGTT GAGAAGAACT CAAAAGCAAG TGAAGATTAC 
310 320 330 340 350 

TTTGGGAACT ACAGTTTATC AGAAGATCAA CTTTTGCTAA TTCAAATACC 
360 "0 380 390 400 

AAAGGCCTGA TTATCATAAA TTCATATAGG AATGCATAGG TCATCTGATC 
410 «0 430 440 450 

AAATAATATT AGCCGTCTTC TGCTACATCA ATGCAGCAAA AACTCTTAAC 
460 470 «0 490 500 

AACTGTGGAT AATTGGAAAT CTGAGTTTCA GCTTTCTTAG AAATAACTAC 
510 520 530 540 550 

TCTTGACATA TTCCAAAATA TTTAAAATAG GACAGGAAAA TCGGTGAGGA 
560 57 0 580 590 600 

TGTTGTGCTC AGAAATGTCA CTGTCATGAA AAATAGGTAA ATTTGTTTTT 
610 620 630 640 650 

TCAGCTACTG GGAAACTGTA CCTCCTAGAA CCTTAGGTTT TTTTTTTTTT 

660 670 680 690 700 

AAGAGGACAA GAAGGACTAA AAATATCAAC TTTTGCTTTT GGACAAAA 



WO 90/11366 



46 



PCT/US90/01630 



TABLE III 
(page 2 Of 4) 

701 710 719 728 737 

ATG CAT CTG ACT GTA TTT TTA CTT AAG GGT ATT GTG GGT TTC CTC 

MET His Leu Thr Val Phe Leu Leu Lys Gly lie Val Gly Phe Leu 

746 755 764 773 782 

TGG AGC TGC TGG GTT CTA GTG GGT TAT GCA AAA GGA GGT TTG GGA 

Trp Ser Cys Trp Val Leu Val Gly Tyr Ala Lys Gly Gly Leu Gly 

791 800 809 818 827 

GAC AAT CAT GTT CAC TCC AGT TTT ATT TAT AGA AGA CTA CGG AAC 

Asp Asn His Val His Ser Ser Phe He Tyr Arg Arg Leu Arg Asn 

836 845 854 863 872 

CAC GAA AGA CGG GAA ATA CAA AGG GAA ATT CTC TCT ATC TTG GGT 

His Glu Arg Arg Glu He Gin Arg Glu He Leu Ser He Leu Gly 

881 890 899 908 917 

TTG CCT CAC AGA CCC AGA CCA TTT TCA CCT GGA AAA ATG ACC AAT 

Leu Pro His Arg Pro Arg Pro Phe Ser Pro Gly Lys Gin Ala Ser 

926 9 35 944 953 962 

CAA GCG TCC TCT GCA CCT CTC TTT ATG CTG GAT CTC TAC AAT GCC 

Ser Ala Pro Leu Phe MET Leu Asp Leu Tyr Asn Ala MET Thr Asn 

971 980 989 998 1007 

GAA GAA AAT CCT GAA GAG TCG GAG TAC TCA GTA AGG GCA TCC TTG 

Glu Glu Asn Pro Glu Glu Ser Glu Tyr Ser Val Arg Ala Ser Leu 

1016 1025 1034 1043 1052 

GCA GAA GAG ACC AGA GGG GCA AGA AAG GGA TAC CCA GCC TCT CCC 
Ala Glu Glu Thr Arg Gly Ala Arg Lys Gly Tyr Pro Ala Ser Pro 

1061 1070 1079 1088 1097 

AAT GGG TAT CCT CGT CGC ATA CAG TTA TCT CGG ACG ACT CCT CTG 
Asn Gly Tyr Pro Arg Arg He Gin Leu Ser Arg Thr Thr Pro Leu 

1106 1115 H24 1133 H42 

ACC ACC CAG AGT CCT CCT CTA GCC AGC CTC CAT GAT ACC AAC TTT 
Thr Thr Gin Ser Pro Pro Leu Ala Ser Leu His Asp Thr Asn Se 

1151 1160 1169 1178 H87 

CTG AAT GAT GCT GAC ATG GTC ATG AGC TTT GTC AAC TTA GTT GAA 
Leu Asn Asp Ala Asp MET Val MET Ser Phe Val Asn Leu Val Glu 

1196 1205 1214 1223 1232 

AGA GAC AAG GAT TTT TCT CAC CAG CGA AGG CAT TAC AAA GAA TTT 
Arg Asp Lys Asp Phe Ser His Gin Arg Arg His Tyr Lys -Glu Phe 



WO 90/11366 



47 



PCI7US90/01630 



TABLE III 
(page 3 of 4) 

1241 1250 1259 1268 1277 

CGA TTT GAT CTT ACC CAA ATT CCT CAT GGA GAG GCA GTG ACA GCA 
Arg Phe Asp Leu Thr Gin lie Pro His Gly Glu Ala Val Thr* Alt 

1286 1295 1304 1313 1395 

GOT GAA TTC CGG ATA TAC AAG GAC CGG AGC AAC AAC CGA TTT GAA 
Ala Glu Phe Arg lie Tyr Lys Asp Arg Ser Asn Asn Sg ™ Glu 

1331 1340 1349 135a . 

OS* S£ if* ?T T ^ ATT AGC ATA TAT CAA ATC ATC AAG GAA TAC 
Asn Glu Thr lie Lys lie Ser lie Tyr Gin lie lie Lys Glu ™r 

1376 1385 1394 1403 hi, 

ACA AAT AGG GAT GCA GAT CTG TTC TTG TTA GAC ACA lei i*r /.^ 
Thr Asn Arg Asp Ala Asp Leu Phe Leu 25 Asp i£ £g £s A?a 

1421 1430 1439 1 448 

CAA GCT TTA GAT GTG GGT TGG CTT GTC TTT GAT ATC ACT GTG Arr 
Gin Ala Leu Asp Val Gly Trp Leu Val Phe Asp lit .Jg S2 Thr 

1466 1475 1484 

S S 25 3 S S S £ S2 J2 SS Si 5 0 ^ 

1601 1610 1619 162B imt 

S S S S i- S'S M 5 S E 1 S « 

1646 1655 1664 1673 i«p-> 

JSi ?f C ^ *** CGA AAA AAT CAA AAC CGC AAT AAA TCC AGC 

Arg Ala Ala Asn Lys Arg Lys Asn Gin Asn Arg ktS £?s ser Ser 

(323) (329) 

1691 1700 1709 1718 179-7 

US. SK ^ G ? A<= TCC T€C AGA ATG TCC AGT GTT GGA GAT TAT AAC 
Ser His Gin Asp Se r Ser ftrg MET Ser Ser Val Gly Asp Tyr Asn 

(337) 



WO 90/1 1366 



PCT/US90/01630 



48 



TABLE III 
(page 4 of 4) 

1736 1745 1754 1763 1772 

ACA AGT GAG CAA AAA CAA GCC TGT AAG AAG CAC GAA CTC TAT GTG 
Thr Ser Glu Gin Lys Gin Ala Cys Lys Lys His Glu t&u tvt vai 

(356) 

17 81 1790 1799 1808 1817 

AGC TTC CGG GAT CTG GGA TGG CAG GAC TGG ATT ATA GCA CCA GAA 
Ser Phe Arg Asp Leu Gly Trp Gin Asp Trp lie lie Ala Pro Glu 

(3 62 ) 

1826 1835 1844 1853 1862 

GGA TAC GCT GCA TTT TAT TGT GAT GGA GAA TGT TCT TTT CCA CTT 
Gly Tyr Ala Ala Phe Tyr Cys Asp Gly Glu Cys Ser Phe Pro Leu 

1871 1880 1889 1898 1907 

AAC GCC CAT ATG AAT GCC ACC AAC CAC GCT ATA GTT CAG ACT CTG 
Asn Ala His MET Asn Ala Thr Asn His Ala lie Val Gin Thr Leu 

1916 1925 1934 1943 1952 

GTT CAT CTG ATG TTT CCT GAC CAC GTA CCA AAG CCT TGT TGT GCT 
Val His Leu MET Phe Pro Asp His Val Pro Lys Pro Cys Cys Ala 

1961 1970 1979 1988 1997 

CCA ACC AAA TTA AAT GCC ATC TCT GTT CTG TAC TTT GAT GAC AGC 
Pro Thr Lys Leu Asn Ala lie Ser Val Leu Tyr Phe Asp Asp Ser 

2006 2015 2024 2033 2042 

TCC AAT GTC ATT TTG AAA AAA TAT AGA AAT ATG GTA GTA CGC TCA 
Ser Asn Val lie Leu Lys Lys Tyr Arg Asn MET Val Val Arg Ser 

(450) 

2051 2060 2070 2080 2090 2100 

TGT GGC TGC CAC TAATATTAAA TAATATTGAT AATAACAAAA AGATCTGTAT 
Cys Gly Cys His 
(454) 

2110 2120 2130 2140 2150 

TAAGGTTTAT GGCTGCAATA AAAAGCATAC TTTCAGACAA ACAGAAAAAA AAA 



WO 90/11366 PCT/US90/01630 



49 



The tryptic sequence His-Glu-Leu-Tyr-Val-Ser- 
Phe-(Ser) described above is noted to be similar to 
the sequence His-Pro-Leu-Tyr-Val-Asp-Phe-Ser found 
in the bovine and human cartilage/bone protein BMP- 
5 2A sequence, for instance as described in 

Publication WO 88/00205. Human BMP-5 shares 
homology with other BMP molecules as well as other 
members of the TGF-/3 superfamily of molecules. The 
cysteine-rich carboxy-terminal 102 amino acid 
10 residues of human BMP-5 shares the following 

homologies with BMP proteins disclosed herein and 
in Publications WO 88/00205 and WO 89/10409 
described above: 61% identity with BMP-2; 43% 
identity with BMP-3, 59% identity with BMP-4; 91% 
15 identity with BMP-6; and 88% identity with BMP-7. 

Human BMP-5 further shares the following 
homologies: 38% identity with TGF-/J3; 37% identity 
with TGF-/J2; 36% identity with TGF-/>1; 25% identity 
with Mullerian Inhibiting Substance (MIS), a 
20 testicular glycoprotein that causes regression of 

the Mullerian duct during development of the male 
embryo; 25% identity with inhibin a; 38% identity 
with inhibin fiBt 45% identity with inhibin /j a ; 56% 
identity with Vgl, a Xenopus factor which may be 
25 involved in mesoderm induction in early 

embryogenesis (Weeks and Melton, Cell 51:861-867 
(1987)]; and 57% identity with Dpp the product of 
the Drosophila decapentaplegic locus which is 
required for dorsal-ventral specification in early 
30 embryogenesis and is involved in various other 

developmental processes at later stages of 
development [Padgett, et al., Nature 325:81-84 
(1987)] . 



35 



C Human BMP-6 Protons 



50 

Six clones which hybridize to the second probe 
described in Example V.A. more strongly than to the 
third are picked and transformed into plasmids. 
Restriction mapping, Southern blot analysis, and 
DNA sequence analysis of these plasmids indicate 
that there are two classes of clones. Clones U2-7 
and U2-10 contain human BMP-6 coding sequence based 
on their stronger hybridization to the second probe 
and closer DNA homology to the bovine BMP-6 
sequence of Table II than the other 4 clones. DNA 
sequence data derived from these clones indicates 
that they encode a partial polypeptide of 132 amino 
acids comprising the carboxy-terminus of the human 
BMP-6 protein. U2-7 was deposited with the 
American Type Culture Collection (ATCC) , Rockville, 
Maryland on June 23, 1989 under accession number 
68021 under the provisions of the Budapest Treaty. 

A primer extended cDNA library is made from U- 
2 OS mRNA using the oligonucleotide 
GGAATCCAA6GCAGAATGTG , the sequence being based on 
the 3' untranslated sequence of the human BMP-6 
derived from the clone U2-10. This library is 
screened with an oligonucleotide of the sequence 
CAGAGTCGTAATCGC, derived from the BMP-6 coding 
sequence of U2-7 and U2-10. Hybridization is in 
standard hybridization buffer (SHB) at 42 degrees 
centigrade, with wash conditions of 42 degrees 
centigrade, 5X SSC, 0.1% SDS. Positively 
hybridizing clones are isolated. The DNA insert of 
one of these clones, PEH6-2, indicates that it 
extends further in a 5 1 direction than either U2-7 
or U2-10. A primer extended cDNA library 
constructed from U-20S mRNA as above is screened 
with an oligonucleotide of the sequence 
GCCTCTCCCCCTCCGACGCCCCGTCCTCGT , derived from the 



51 

sequence near the 5« end of PEH6-2. Hybridization 
is at 65 degrees centigrade in SHB, with washing at 
65 degrees centigrade in 2X SSC, 0.1% SDS. 
Positively hybridizing recombinants are isolated 
and analyzed by restriction mapping and DNA 
sequence analysis. 

The 5' sequence of the insert of one of the 
positively hybridizing recombinants, PE5834#7, is 
used to design an oligonucleotide of the sequence 
CTGCTGCTCCTCCTGCTGCCGGAGCGC. A random primed cDNA 
library [synthesized as for an oligo (dT) primed 
library except that (dN) 6 is used as the primer] 
is screened with this oligonucleotide by 
hybridization at 65 degrees centigrade in SHB with 
washing at 65 degrees centigrade in IX SSC, o.l% 
SDS. a positively hybridizing clone, RPio, is 
identified, isolated, and the DNA sequence 
sequence from the 5- end of its insert is 
determined. This sequence is used to design an 
oligonucletide of the sequence 

TCGGGCTTCCTGTACCGGCGGCTCAAGACGCAGGAGAAGCGGGAGATGCA. 
A human placenta cDNA library (Stratagene catalog 
#936203) is screened with this oligonucleotide by 
hybridization in SHB at 65 degrees centigrade, and 
washing at 65 degrees centigrade with 0.2 X SSC, 
0.1% SDS. a positively hybridizing recombinant 
designated BMP6C35 is isolated. DNA sequence 
analysis of the insert of this recombinant 
indicates that it encodes the complete human BMP-6 
protein. BMP6C35 was deposited with the American 
Type culture Collection, 12301 Parklawn Drive, 
Rockville, Maryland USA on March 1, 1990 under 
Accession Number 68245 under the provisions of the 
Budapest Treaty. 

The DNA and derived amino acid sequence of the 



52 



majority of the insert of BMP6C35 is given in Table 
IV. This DNA sequence contains an open reading 
frame of 1539 base pairs which encodes the 513 
amino acid human BMP-6 protein precursor. The 
presumed initiator methionine codon is preceded by 
a 5» untranslated sequence of 159 base pairs with 
stop codons in all three reading frames. The stop 
codon at nucleotides 1699-1701 is followed by at 
least 1222 base pairs of 3 'untranslated sequence. 
It is noted that U2-7 has a C residue at the 
position corresponding to the T residue at 
position 1221 of BMP6C35; U2-7 also has a C residue 
at the position corresponding to the G residue at 
position 1253 of BMP6C35. These do not cause amino 
acid differences in the encoded proteins, and 
presumably represent allelic variations. 

The oligonucleotide 
TCGGGCTTCCTGTACCGGCGGCTCAAGACGCAGGAGAAGCGGGAGATGCA 
is used to screen a human genomic library (Toole et 
al supra ) , by hybridizing nitrocellulose replicas 
of 1 x 10 6 recombinants with the oligonucleotide in 
SHB at 65 degrees centigrade, and washing at 65 
degrees centigrade with 0.2 X SSC, 0.1% SDS. 
Positively hybridizing clones are purified. The 
oligonucleotide hybridizing region is localized to 
an approximately 1.5 kb Pst I fragment. DNA 
sequence analysis of this fragment confirms the 5' 
sequence indicated in Table IV. 

The first underlined portion of the sequence 
in Table IV from amino acid #388 to #396, Ser-Thr- 
Gln-Ser-Gln-Asp-Val-Ala-Arg, corresponds to the 
similar sequence Ser-Thr-Pro-Alg-Gln-Asp-Val-Ser- 
Arg of the bovine sequence described above and set 
forth in Table II. The second underlined sequence 



53 

in Table IV from amino acid #415 through #421 His- 
Glu-Leu-Tyr-Val-Ser-Phe, corresponds to the tryptic 
fragment identified above from which the 
oligonucleotide probes are designed. The tryptic 
sequence His-Glu-Leu-Tyr-Val-Ser-Phe- (Ser) is 
noted to be similar to a sequence found in other 
BMP proteins for example the sequence His-Pro-Leu- 
Tyr-Val-Asp-Phe-Ser found in the bovine and human 
cartilage/bone protein BMP-2 sequence as described 
in Publication wo 88/00205. BMP-6 therefore 
represents a new member of the BMP subfamily of 
TGF-/J like molecules which includes the molecules 
BMP-2, BMP-3, BMP-4 described in Publications WO 
88/00205 and WO 89/10409, as well as BMP-5 and BMP- 
7 described herein. 

Based on knowledge of other BMP proteins, as 
well as other proteins in the TGF-/9 family, BMP-6 
is predicted to be synthesized as a precursor 
molecule and the precursor polypeptide would be 
cleaved between amino acid #381 and amino acid #382 
yielding a 132 amino acid mature polypeptide with a 
calculated molecular weight of approximately l5Kd. 
The mature form of BMP-6 contains three potential 
N-linked glycosylation sites per polypeptide chain 
as does BMP-5. 

The processing of BMP-6 into the mature form 
is expected to involve dimerization and removal of 
the N-terminal region in a manner analogous to the 
processing of the related protein TGF-0 [L .E. 
Gentry, et al., (1988); R. Dernyck, et al., (i 98 5) 
SHEra]. it is contemplated that the active BMP-6 
protein molecule is a dimer. it is further 
contemplated that the mature active species of BMP- 
5 comprises protein molecule is a homodimer 
comprised of two polypeptide subunits each subunit 



WO 90/1 1366 PCT/US90/01630 

54 

comprising amino acid #382 - #513 as set forth in 
Table IV. Further active species of BMP-5 are 
contemplated such as phoprotein dimers or a 
proprotein • subunit and a mature subunit. 

5 Additional active BMP-5 proteins may comprise amino 

acid #388 - #513 thereby including the tryptic 
fragments found in the purified bovine material. 
Another BMP-5 protein of the invention comprises 
amino acid #412 - #513 thereby including the first 

0 conserved cystine residue. 



WO 90/11366 



PCT/US90/01630 



55 

TABLE IV 

10 20 30 40 c fl 

CGACCATGA6 AGATAAGGAC TGAGGGCCAG GAAGGGGAAG CGAGCCCGCC 



60 



70 



80 



90 



GAGAGGTGGC GGGGACTGCT CACGCCAAGG GCCACAGCGG CCGCGCTCTO 



110 



120 



130 



140 



GCCTCGCTCC GCCGCTCCAC GCCTCGCG^G ATCCGCGGGG GCAGCCCtoJ 



CGGGCGGGG ATG CCG GGG CTG GGG III AGG GCG JaG TGG CTG TGC 
MET Pro Gly Leu Gly Arg Arg Ala Gin Trp 2u <gs 

204 213 222 

2 2 2222 22 2 5 s « « « 2 

2 2 S a s s s s § sg g 2 2 i 

294 303 312 

2 2 5 2 2 2 2 2 2222 2 2 2 
S22222222222222 

384 393 402 An 

tS G^n 2S m ? G ATG GAG ATC TTG TCG GTG £££ 

Thr Gin Glu Lys Arg clu MET Gin Lys Glu lie Leu Ser Val Leu 



456 

CTC CAA CAG 
Leu Gin Gin 



465 
CCG 
Pro 



WO 90/11366 



56 



PCT/US90/01630 



Table IV 
(page 2 of 6) 

474 4 83 492 501 510 

CAG CCC CC6 6CG CTC CGG CAG CAG GAG GAG CAG CAG CAG CAG CAG 
Gin Pro Pro Ala Leu Arg Gin Gin Glu Glu Gin Gin Gin Gin Gin 

519 528 537 546 555 

CAG CTG CCT CGC GGA GAG CCC CCT CCC GGG CGA CTG AAG TCC GCG 
Gin Leu Pro Arg Gly Glu Pro Pro Pro Gly Arg Leu Lys Ser Ala 

564 573 582 591 6on 

CCC CTC TTC ATG CTG GAT CTG TAC AAC GCC CTG TCC GCC GAC AAC 
Pro Leu Phe MET Leu Asp Leu Tyr Asm Ala Leu Ser Ala Asp Asn 

609 618 627 636 

GAC GAG GAC GGG GCG TCG GAG GGG GAG AGG CAG CAG TCC TGG CCC 
Asp Glu Asp Gly Ala ser Glu Gly Glu Arg Gin Gin Ser Trp 

654 663 672 681 fiQft 

2£ Glu Sf? SfS t GC l° G TCC ^ CGT CGG Ct =G CCC CCG GGC 

His Glu Ala Ala Ser Ser Ser Gin Arg Arg Gin Pro Pro Gly Ser 

699 708 717 726 7« 

GCC GCG CAC CCG CTC AAC CGC AAG AGC CTT CTG GCC CCC GGA TCT 
Pro Pro Gly Ala Ala His Pro Leu Asn Arg Lys Ser LeS Leu Ala 

744 753 762 771 , an 

to S 2 25 G?v l C ° ACC AGC GCG «° GAC ^ GCC 

Gly ser Gly Gly Ala Ser Pro Leu Thr Ser Ala Gin Asp Ser Ala 

789 798 807 816 B5«t 

TTC CTC AAC GAC GCG GAC ATG GTC ATG AGC TTT GTG AAC CTG <2TG 
Phe Leu Asn Asp Ala Asp MET Val MET Ser Phe Val XsS Val 

834 843 852 861 fl7 n 

? AG ^ AC GAC AAG GAG TTC TCC CCT CGT CAG CGA CAC CAC AAA GAG 
Glu Tyr Asp Lys Glu Phe Ser Pro Arg Gin Arg His His Lys* g?u 

879 88 8 897 906 one; 

TTC AAG TTC AAC TTA TCC CAG ATT CCT GAG GGT GAG GTG GTG ACG 
Phe Lys Phe Asn Leu Ser Gin He Pro Glu Gly Glu Val Val Thr 



WO 90/11366 



57 



PCT/US90/01630 



Table IV 
(page 3 of 6) 

924 9 33 942 qk-i 

pS ?f l TC T CGC ATC TAC GAC GTT lil GGG ACT m 

Phe Arg He Tyr Lys Asp cys Val MET Ala Ala Glu Gly Ser Se 

969 978 907 qq c 

s 5 5 s s s s 5 s 5 a S a a- 

1014 1023 1032 in>n 

a: s as 5 5 is 2s s s a a 55 £ 55 

1059 1068 1077 -100* 

5 5S 5 5 5 5 5 SS 5 55 S 55 

1104 1113 1123 Tion 

S 5 5 5 55 ts £ « ~ -1 s 

SI 25 5 tS S 5 S fi ~ -ig ffi ccc^ 

S S§ s| 5 55 s 55 5 2S 
5 55 5 25 5 55 5 55 5 55 

1284 1293 1302 -i-sn 

5 5 5 5 5 5 5555 55 5 55 

(382) 

S, jS5 5 55 5 55 5 55 5 55 



WO 90/11366 



PCT/US90/01630 



58 

Table IV 
(page 4 of 6) 

1374 1383 1392 1401 1410 

TAC AAC AGC AGT GAA TTG AAA ACA GCC TGC AGG AAG CAT GAG CTG 
Tyr Asn Ser Ser Glu Leu Lys Thr Ala Cys Arg Lys His Glu Leu 

(412) 

1419 1428 1437 1446 . 1455 

TAT GTG AGT TTC CAA GAC CTG GGA TGG CAG GAC TGG ATC ATT GCA 
Tyr Val Ser Phe Gin Asp Leu Gly Trp Gin Asp Trp lie lie Ala 

1464 1473 1482 1491 1500 

CCC AAG GGC TAT GCT GCC AAT TAC TGT GAT GGA GAA TGC TCC TTC 
Pro Lys Gly Tyr Ala Ala Asn Tyr Cys Asp Gly Glu Cys Ser Phe 



1509 1518 1527 1536 1545 

CCA CTC AAC GCA CAC ATG AAT GCA ACC AAC CAC GCG ATT GTG CAG 
Pro Leu Asn Ala His MET Asn Ala Thr Asn His Ala lie Val Gin 



1554 1563 1572 1581 1590 

Thr Su S? SiS t TT ^ C CCC GAG TAT GTC CCC *>* «* T<SC 

Thr Leu Val His Leu MET Asn Pro Glu Tyr Val Pro Lys Pro Cys 

1599 1608 1617 1626 163? 

TGT GCG CCA ACT AAG CTA AAT GCC ATC TCG GTT CTT TAC TTT GAT 
Cys Ala Pro Thr Lys Leu Asn Ala He Ser Val Leu Tyr Phe Asp 

1644 1653 1662 1671 1680 

GAC AAC TCC AAT GTC ATT CTG AAA AAA TAC AGG AAT ATG <5TT GTA 
Asp Asn Ser Asn Val He Leu Lys Lys Tyr Arg Asn MET Val Val 

1689 1698 1708 1718 1728 

Arg 111 T 4l Sg gS Ss TAACTCGAAA CCAGATGC ^ GGGACACACA 

(513) 

1738 1748 1758 1768 1778 

TTCTGCCTTG GATTCCTAGA TTACATCTGC CTTAAAAAAA CACGGAAGCA 

1788 1798 1808 1818 1828 

CAGTTGGAGG TGGGACGATG AGACTTTGAA ACTATCTCAT GCCAGTGCCT 



1848 1858 1868 1878 



WO 90/1,366 PCT/US90/01630 

59 

Table IV 
(page 5 of 6) 

TATTACCCAG GAAGATTTTA AAGGACCTCA TTAATAATTT GCTCACTTGG 

1888 1898 1908 TQTft ir>-*« 

TAAATGACGT GAGTAGTTGT TGGTCTGTAG CAAGCTGAGl" TTGGATG?CT 

1938 1948 1958 lg , B 

GTAGCATAAG GTCTGGTAAC TGCAGAAACA TAACCGTGAA GCTCTT^CTA 

CCCTCCmS CCAAAAACCC ACCAAAAt"?! GTTTTAGCTG TAGATCAaI? 

2038 2048 2058 on*o 

tatttggggt gttogttagt aaatagggaa aataatct" aaggagSSIa 

2088 2098 2108 ono 

atgtattctt ggctaaagga tcagctggtt cagtactgtc tatcaaagg? 

2138 2148 2158 , Uo 

AGATTTTACA GAGAACAGAA ATCGGGGAAG TGGGGgIaI? GCCTCTCTTC 

2188 2198 2208 *»-iio 

AGTTCATTCC CAGAAGTCCA CAGGACGCAC AGCCCAgIcc ACAGCCaIIS 

2238 2248 2258 

CTCCACGGGG CGCCCTTGTC TCAGTCATtI CTGTTGTA^G TTCGTGC^g" 

2288 2298 2308 „ 1fl 

AGTTTTGTTG GTGTGAAAAT ACACTTATTT CMCCMttS ATACCAT^? 

,£338 2348 2358 2368 



TACACCTCAA TCCTCCATTT GCTGTACTCT TTGCTAGTaS CAAAAGtIga 

2388 2398 2408 •tAia 

CTGATTACAC TGAGGTGAGG CTACAAGGGG TGTGTa1«G TGTAACaJct 



2438 2448 2458 r^co 

gaaggcagtg ctcacctctt ctttaccaga aoggttIt?? gaccagcaca 



WO 90/11366 PCT/US90/01630 

60 

Table IV 
(page 6 of 6) 

2488 2498 2508 2518 2528 

TTAACTTCT6 GACTGCCGGC TCTAGTACCT TTTCAGTAAA GTGGTTCTCT 

2538 2548 2558 2568 2578 

GCCTTTTTAC TATACAGCAT ACCACGCCAC AGGGTTAGAA CCAACGAAGA 

2588 2598 26 ° a 2618 2628 

AAATAAAATG AGGGTGCCCA GCTTATAAGA ATGGTGTTAG GGGGATGAGC 

2638 2648 2658 2668 2678 

ATGCTGTTTA TGAACGGAAA TCATGATTTC CCTGTAGAAA GTGAGGCTCA 

2688 2698 2708 2718 57on 

GATTAAATTT TAGAATATTT TCTAAATGTC TTTTTCACAA TCATGTGACT 

2738 2748 2758 2768 r>7-7o 

GGGAAGGCAA TTTCATACTA AACTGATTAA ATAATACATT TATAATCTAC 

2788 2798 2808 2818 , fl9fl 

AACTGTTTGC ACTTACAGCT TTTTTTGTAA ATATAAACTA TAATTTATTG 

2838 2848 2858 2868 r>a-7a 

TCTATTTTAT ATCTGTTTTG CTGTGGCGTT GGGGGGGGGG CCGGGCTTTT 

2888 2898 2908 2918 

GGGGGGGGGG GTTTGTTTGG GGGGTGTGGT GGTGTGGGCG GGCGG 



WO 90/11366 



61 



PCT/US90/01630 



Comparison of the sequence of murine vgr-1 [Lyons, 
et al., pnas 86:4554 (1989)] to human BMP-6 reveals 
a degree of amino acid sequence identity greater 
5 than 92% The murine Vgr-1 is likely the murine 

homologue of BMP-6. Human BMP-6 shares homology 
with other BMP molecules as well as other members 
of the TGF-/J superfamily of molecules. The 
cysteine-rich carboxy-terminal 102 amino acid 
10 residues of human BMP-6 shares the following 

homologies with BMP proteins disclosed herein and 
in Publications WO 88/00205 and WO 89/10409: 61% 
identity with BMP-2; 44% identity with BMP-3, 60% 
identity with BMP-4; 91% identity with BMP-5; and 
15 87% identity with BMP-7. Human BMP-6 further 

shares the following homologies: 41% identity with 
TGP-/93; 39% identity with TGF-/J2; 37% identity with 
TGF-/a; 26% identity with Mullerian Inhibiting 
substance pus,, a testicular glycoprotein that 
causes regression of the Mullerian duct during 
development of the male embryo; 25% identity with 
inhibin a; 43% identity with inhibin ft B , 4 9% 
identity with inhibin $K , 58% identity with Vgl, a 
Xenopus factor which may be involved in mesoderm 
induction in early embryogenesis (Weeks and Melton 
(1987) SuEra]; and 59% identity with Dpp the 
product of the Drosophila decapentaplegic locus 
which is required for dorsal-ventral specification 
in early embryogenesis and is involved in various 
other developmental processes at later stages of 
development [Padgett, et al., (i 98 7) supra]. 

D. Human BMP- 7 Proteins 

The other four clones of Example V.C. above 
which appear to represent a second class of clones 



25 



30 



35 



62 

encode a novel polypeptide which we designate as 
BMP-7. one of these clones, U2-5, was deposited 
with the ATCC on June 22, 1989 under accession 
number ATCC 68020 under the provisions of the 
Budapest Treaty. This clone was determined not to 
contain the entire coding sequence for BMP-7. An 
oligo of the sguence GCGAGCAATGGAGGATCCAG (designed 
on the basis of the 3' noncoding sequence of U2-5) 
was used to make a primer-extended cDNA library 
from U-2 OS mRNA (Toole, et al.). 500,000 
recombinants of this library were screened with the 
loigpnucleotide GATCTCGCGCTGCAT (designed on the 
basis of the BMP-7 coding sequence) by 
hybridization in SHB at 42° and washing in 5X SSC, 
0.1% SDS at 42°. several hybridizing clones were 
obtained. DNA sequence analysis and derived amino 
acid sequence of one of these clones, PEH7-9, is 
given in Table V. PEH7-9 was deposited with the 
American Type Culture Collection (ATCC), Rockville, 
Maryland on November 17, 1989 under accession 
number ATCC 68182 under the provisions of the 
Budapest Treaty. PEH7-9 contains an insert of 1448 
base pairs. This clone, PEH7-9, is expected to 
contain all of the nucleotide sequence necessary to 
encode BMP-7 proteins. The cDNA sequence of Table 
V contains an open reading frame of 1292 base 
pairs, encoding a protein of 431 amino acids, 
preceded by a 5' untranslated region of 96 base 
pairs with stop codons in all frames, and contains 
a 3« untranslated region of 60 base pairs following 
the in frame stop codon TAG. 

This protein of 431 amino acids has a 
molecular weight of 49,000 daltons as predicted by 
its amino acid sequence and is contemplated to 
represent the primary translation product. Based 



63 



on knowledge of other BMP proteins as well as other 
proteins within the TGT-ft family, it is predicted 
that the precursor polypeptide would be cleaved 
between amino acid #299 and #300, yielding a 132 
amino acid mature peptide. 

It is contemplated that processing of BMP-7 to 
the mature form involves dimerization of th 
proprotein and removal of the N-terminal region in 
a manner analogous to the processing of the related 
protein TGP-B [L.E. Gentry, et al., (1988) Suora 
and; R. Dernyck, et al., (1985) SHEEa] . It is 
comtemplated therefore that the mature active 
species of BMP-7 comprises a homodimer of 2 
polypeptide subunits each subunit cmprising amino 
acid #300 - #431 as shown in Table v with a 
calculated weight of 15,000 daltons. other active 
BMP-7 species are contemplated, for example, 
protein dimers or proprotein subunits linked to 
mature subunits. Additional active species may 
comprise amino acids #309 - #431 of Table V such 
species including the tryptic sequences found in 
the purified bovine material. Also contemplated 
are BMP-7 proteins comprising amino acids #330- 
#431 thereby including the first conserved cysteine 
residue. 

The underlined sequence of Table V from amino 
acid #309 - #314 Asn-Gln-Glu-Ala-Leu-Arg is the 
same sequence as that of tryptic fragment #5 found 
in the 28,000 - 30,000 dalton purified bone 
preparation as described in the -BMP" Publications 
WO 88/00205 and wo 89/10409 mentioned above. The 
underlined sequence of Table V from amino acid 
#333-#339 His-Glu-Leu-Tyr-Val-Ser-Phe corresponds 
to the tryptic fragment identified in the bovine 
bone preparation described above from which the 



WO 90/11366 PCI7US90/01630 

64 

oligonucleotide probes are designed. 



WO 90/11366 



65 



PCT/US90/01630 



TABLE V 



10 20 30 40 50 



GTGAOOGAGC GGCGCGGACG GCO30CIGCC CCCICIGCCA CCTGGGGCGG 

TSCGGGCCCG (SAGOEGGAG CXXXSGGI^ GOTOU^ (3GC3GOS ^ 

MET 

108 117 126 135 (1) -> AA 

His val Arg Ser Leu Arg Ala Ala Ala Pro Si £r ™ w S 

153 162 171 lao 100 

I£U Trp Ma 1^ ^ ^ ^ Ser Ma ^ Ma ^ ^ 

198 20V 
AGC CTG GAC AAC GAG GIG CAC TOG AGC TIC ATC CAC OGG OGC CTC 
Ser Ibu Asp Asn Glu Val His Ser Ser Hie He ^ S 

OGC AGC CAG GAG OQG CSS GAG ATG CW3 OSC GAG ATC CTC TOC ATT 
Arg Ser Gin Glu Arg Arg Glu MET Gin Arg Glu lie Leu Ser lie 

288 297 306 

378 387 3Q6 

Val Glu Glu Gly Gly Gly Pro Gly Gly Gin Gly pS ier Ty? S 

Tyr Lys Ala Val Phe Ser Tnr Gin Gly Pro pS 2£ 2£ £ l2 
468 477 486 

^f^^S^^^^^^GACATGGTCATOAGCTr^ 
Gin Asp Ser His Rie Leu Thr Asp Ala Asp MET Val MET Ser Phe 

513 522 531 c^q 

GTC AAC CTC GTG GAA CAT GAC AAG GAA TIC TIC CAC CCA CGC TAG 
Val Asn Leu val Glu His Asp Lys Glu Phe Phe^^o^^ 



WO 90/11366 



PCT/US90/01630 



66 



Table V 
(page 2 of 3) 



558 567 576 585 594 

CAC CAT CGA GAG TIC CGG TIT GAT COT TCC AAG ATC CCA GAA GGG 
His His Arg Glu Rie Arg Fhe Asp Leu Ser Lys lie Pro Glu Gly 

603 612 621 630 639 

GAA GCT GTC ACG GCA GCC GAA TIC CGG ATC TAC AAG GAC TAC ATC 
Glu Ala Val Thr Ala Ala Glu Hie Arg lie Tyr Lys Asp Tyr lie 

648 657 666 675 684 

CGG GAA OGC TTC GAC AAT GAG ACG TIC GGG ATC AGC GTT TAT CAG 
Arg Glu Arg Hie Asp Asn Glu Thr Rhe Arg lie Ser Val Tyr Gin 

693 702 711 720 729 

GTS CTC CAG GAG CAC TIG GGC AGG GAA TCG GAT CTC TTC CTG CIC 
Val leu Gin Glu His Leu Gly Arg Glu Ser Asp Leu Fhe Leu Leu 

738 747 756 765 774 

GAC AGC CCT ACC CTC TGG GCC TOG GAG GAG GGC TGG CTG GIG TIT 
Asp Ser Arg Thr Leu Trp Ala Ser Glu Glu Gly Trp Leu Val Roe 

783 792 801 810 819 

GAC ATC ACA GCC ACC AGC AAC CAC TGG GIG GTC AAT COG CGG CAC 
Asp lie Thr Ala Thr Ser Asn His Trp Val Val Asn Pro Arg His 

828 837 846 855 864 

AAC CTG GGC CTG CAG CTC TCG GTG GAG ACG CTG GAT GGG CAG AGC 
Asn Leu Gly Leu Gin Leu Ser Val Glu Thr Leu Asp Gly Gin Ser 

873 882 891 900 909 

ATC AAC GCC AAG TEG GOG GGC CTG ATT GGG CGG CAC GGG CCC CAG 
lie Asn Pro Lys Leu Ala Gly Leu lie Gly Arg His Gly Pro Gin 

918 927 936 945 954 

AAC AAG CAG CCC TTC ATG GTG GCT TTC TTC AAG GCC ACG GAG GTC 
Asn Lys Gin Pro Fhe MET Val Ala Fhe Fhe Lys Ala Thr Glu Val 

963 972 981 990 999 

CAC TTC OGC AGC ATC CGG TCC ACG GGG AGC AAA CAG OGC AGC CAG 
His Fhe Arg Ser lie Arg Ser Thr Gly Ser Lys Gin Arg Ser Gin 

(300) 

1008 1017 1026 1035 1044 

AAC OGC TCC AAG ACG CCC AAG AAC CAG GAA GCC CDS CGG ATG GCC 
Asn Arg ser Lys Thr Pro Lys Asn Gin Glu Ala leu Am MET Ala 

(309) 

1053 1062 1071 1080 1089 

AAC GTG GCA GAG AAC AGC AGC AGC GAC CAG AGG CAG GCC TGT AAG 
Asn Val Ala Glu Asn Ser Ser Ser Asp Gin Arg Gin Ala Cys Lys 

(330) 



WO 90/11366 PCT/US90/01630 



67 



Table V 
(page 3 of 3) 



1098 1107 1116 1125 ii W 

^^C^CTOTRTCTCAKTlCaaG^CTCGGCTCG CAGGAC 
lys pis Glu im Tyr VrI ^ r Phn Aig Asp Leu Gly gp Gto 

1143 1152 1161 U70 ii-jo 

?K ^ f? 5 S ^ 050 ™ 600 « «C TAC 1ST GAGlS 
Trp lie lie Ala Pro Glu Gly Tyr Ala Ala Tyr Tyr Cys Glu Gly 

1188 1197 1206 1215 

GAG TOT GCC TIC OCT CTG AAC TOC TAG AUG AAC GCC AOC AACCAC 
Glu Cys Ala Hie Pro Leu Asn Ser Tyr MET Asn Ala Thr Asn His 

1233 1242 1251 1260 i->«o 

GCC ATC GTG CAG AOG CIG GTC CAC TIC ATC AAC COG GAA AGS GIG 
Ala lie Val Gin Thr Leu Val His tte lie S S£ £S vS 

1278 1287 1296 1305 irn 

CCC AAG CCC TGC TGT GCG CCC ACS CAG CTC AAT GCC ATC TOC rrr 
P» lys Pro cys Cys Ala Pro Tnr Gin S aS S 2 vS 

1323 13 32 1341 13SO t»rq 

CTCTACTTCGAT^AGCTCCAACGICATC CIG AAG AAA TAC^S 
IauTyrRieAspAspSerSerAsnValllelfiuiys^^^ 

1368 1377 1386 1390 

AAC ATG GTG GTC CGG GCC TGT GGC TGC CAC TAGCKCTCC 
Asn MET Val Val Arg Ala Cys Gly Cys His ™ SCJ!CCICC 

(431) 

1409 1419 142 9 i 43g 

GAGAATTCAG ACCCnTGGG GCCAAGTTrr TCIGGATOCT CCATTGCTC 



68 



Like BMP- 5 and BMP- 6, human BMP-7 shares 
homology with other BMP molecules as well as other 
members of the TGF-p superfamily of molecules. The 
cysteine-rich carboxy-terminal 102 amino acids 
residues of human BMP-7 shares the following 
homologies with BMP proteins herein and in 
Publications WO 88/00205 and WO 89/10409 described 
above: 60% identity with BMP-2; 43% identity with 
BMP-3, 58% identity with BMP-4, 87% identity with 
BMP-6; and 88% identity with BMP-5. Human BMP-7 
further shares the following homologies: 40% 
identity with TGF-03; 40% identity with TGF-/82; 36% 
identity with TGF-/J1; 29% identity with Mullerian 
Inhibiting Substance (MIS), a testicular 
glycoprotein that causes regression of the 
Mullerian duct during development of the male 
embryo; 25% identity with inhibin-a; 44% identity 
with inhibin-/> B ; 45% identity with inhibin-/» A ; 57% 
identity with Vgl, a Xenopus factor which may be 
involved in mesoderm induction in early 
embryogenesis [Weeks adn Melton, (1987) Supra. ] : 
and 58% identity with Dpp the product of the 
Drosophila decapentaplegic locus which is required 
for dorsal-ventral specification in early 
embryogenesis and is involved in various other 
developmental processes at later stages of 
development [Padgett, et al., (1987) Supra. ] . 

The invention encompasses the genomic 
sequences of BMP-5, BMP-6 and BMP-7. To obtain 
these sequences the cDNA sequences described herein 
are utilized as probes to screen genomic libraries 
using techniques known to those skilled in the art. 

The procedures described above and additional 



WO 90/1 1366 PCT/US90/01630 



10 



20 



25 



30 



69 



methods known to those skilled in the art may be 
employed to isolate other related proteins of 
interest by utilizing the bovine or human proteins 
as a probe source. Such other proteins may find 
similar utility in, inter alia, fracture repair, 
wound healing and tissue repair. 

EXAMPLE VI 

Express ion of BMP Prot-^ne 

In order to produce bovine, human or other 
mammalian BMP-5, BMP-6 or BMP-7 proteins of the 
invention, the DNA encoding it is transfected into 
an appropriate expression vector and introduced 
into mammalian cells or other preferred eukaryotic 
or prokaryotic hosts by conventional genetic 
engineering techniques. it is contemplated that 
the preferred expression system for biologically 
active recombinant human proteins of the invention 
will be stably transformed mammalian cells. For 
transient expression, the cell line of choice is 
SV40 transformed African green monkey kidney cos-l 
or cos-7 which typically produce moderate amounts 
of the protein encoded within the plasmid for a 
period of 1-4 days. For stable high level 
expression of BMP-5, BMP-6 or BMP-7 the preferred 
cell line is Cinese hamster ovary (CHO) . it is 
therefore contemplated that the preferred mammalian 
cells will be CHO cells. 

The transformed host cells are cultured and 
the BMP proteins of the invention expressed thereby 
are recovered, isolated and purified. 
Characterization of expressed proteins is carried 
out using standard techiques. For example, 
characterization may include pulse labeling with 
35 [ 5 ] methionine or cysteine and analysis by 



70 



polyacrylamide electrphoresis. The recombinantly 
expressed BMP proteins are free of proteinaceous 
materials with which they are co-produced and with 
which they ordinarily are associated in nature, as 
well as from other contaminants, such as materials 
found in the culture media. 

A. Vector Construction 

As described above, numerous expression 
vectors known in the art may be utilized in the 
expression of BMP proteins of the invention. The 
vector utilized in the following examples is pMT21, 
a derivitive of pMT 2 , though other vectors may be 
suitable in practice of the invention. 

pMT 2 is derived from pMT2-VWF, which has been 
deposited with the American Type Culture Collection 
(ATCC), Rockville, MD (USA) under accession number 
ATCC 67122 under the provisions of the Budapest 
Treaty. EcoRI digestion excises the cDNA insert 
present in pMT-VWF, yielding pMT2 in linear form 
which can be ligated and used to transform coli 
HB 101 or DH-5 to ampicillin resistance. Plasmid 
pMT2 DNA can be prepared by conventional methods. 

pMT21 is then constructed using loopout/in 
mutagenesis [Morinaga, et al., Biotechnology 84*63* 
(1984)]. This removes bases 1075 to 1170 
(inclusive) . In addition it inserts the following 
sequence: 5 1 TCGA 3». This sequence completes a 
new restriction site, Xhol. This plasmid now 
contains 3 unique cloning sites PstI, EcoRI, and 
Xhol. 

In addition, pMT21 is digested with EcoRV and 
Xhol, treating the digested DNA with Klenow 
fragment of DNA polymerase I and ligating Clal 
linkers (NEBio Labs, CATCGATG) . This removes bases 



71 



2171 to 2420 starting from the Hindlll site near 
the SV4 0 origin of replication and enhancer 
sequences of pMT2 and introduces a unique Cla I 
site, but leaves the adenovirus VAI gene intact. 

B ' BMP-5 Ve ctor Construction 

A derivative of the BMP-5 cDNA sequence set 
forth in Table in comprising the the nucleotide 
sequence from nucleotide #699 to #2 07 0 is 
specifically amplified. The oligonucleotides 
CGACCTGCAGCCACCAT G C ATCTGACTGTA and 
TGCCTGCAGTTTAATATTAGTGGCAGC are utilized as primers 
to allow the amplification of nucleotide sequence 
#699 to #2070 of Table in from the insert of clone 
D2-16 described above in Example V. This procedure 
introduces the nucleotide sequence CGACCTGCAGCCACC 
immediately preceeding nucleotide #699 and the 
nucleotide sequence CTGCAGGCA immediately following 
nucleotide #2070. The addition of these sequences 
results in the creation of PstI restriction 
endonuclease recognition sites at both ends of the 
amplified DNA fragment. The resulting amplified 
DNA product of this procedure is digested with the 
restriction endonuclease PstI and subcloned into 
the PstI site of the pMT2 derivative pM T21 
described above. The resulting clone is designated 
H5/5/pMT. 

The insert of H5/5/pMT is excised by PstI 
digestion and subcloned into the plasmid vector 
PSP65 at the PstI site resulting in BMP5/SP6. 
BMP5/SP6 and U2-16 are digested with the 
restriction endonucleases Nsil and Ndel to excise 
the portion of their inserts corresponding to 
nucleotides #704 to #1876 of Table III. The 
resulting 1173 nucleotide Nsil-Ndei fragment of 



72 

clone U2-16 is ligated into the Nsil-Ndel site of 
BMP5/SP6 from which the corresponding 1173 
nucleotide Nsil-Ndel fragment had been removed. 
The resulting clone is designated BMP5mix/SP64 . . 

Direct DNA sequence analysis of BMP5mix/SP64 
is performed to confirm identity of the nucleotide 
sequences produced by the amplification to those 
set forth in Table III. The clone BMP5mix/SP64 is 
digested with the restriction endonuclease PstI 
resulting in the excision of an insert comprising 
the nucleotides #699 to #2070 of Table III and the 
additional sequences containing the PstI 
recognition sites as described above. The 
resulting 13 82 nucleotide PstI fragment is 
subcloned into the PstI site of the pMT2 derivative 
PMT21. This clone is designated BMP5mix/pMT21#2. 

C BMP-6 Vector Construction 

A derivative of the BMP-6 cDNA sequence set 
forth in Table IV comprising the nucleotide 
sequence from nucleotide #160 to #1706 is produced 
by a series of techniques known to those skilled in 
the art. The clone BMP6C35 described above in 
Example V is digested with the restriction 
endonucleases Apal and Taql, resulting in the 
excision of a 1476 nucleotide portion of the insert 
comprising nucleotide #231 to #1703 of the sequence 
set forth in Table IV. Synthetic olignucloetides 
with Sail restriction endonuclease site converters 
are designed to replace those nucleotides 
corresponding to #160 to #230 and #1704 to #1706 
which are not contained in the 1476 Apal-TaqI 
fragment of the BMP-6 cDNA sequence. 
Oligonucleotide/Sall converters conceived to 
replace the missing 5» 



73 

(TCGACCCACCAT6CCGGGGCTGGGGCGGAGGGCGCAGTGGCTGTG 
CTGGTGGT GGGGGCTGTGCTGCAGCTGCTGCGGGCC and 
CGCAGCAGCTGCACAGCAGCCCCCACCACCAGCACAGCCACTGCGCC 
CTCCGCCCCAG CCCCGGCATGGTGGG) and 3- (TCGACTGGTTT 
and CGAAACCAG) sequences are annealed to each other 
independently. The annealed 5 • and 3' converters 
are then ligated to the 1476 nucleotide Apal-TaqI 
described above, creating a 1563 nucleotide 
fragment comprising the nucleotide sequence from 
#160 to #1706 of Table IV and the additional 
sequences contrived to create Sail restriction 
endonuclease sites at both ends. The resulting 
1563 nucleotide fragment is subcloned into the Sail 
site of psP64. This clone is designated 
BMP6/SP64#15. 

DNA sequence analysis of BMP6/SP64#15 is 
performed to confirm identity of the 5' and 3» 
sequences replaced by the converters to the 
sequence set forth in Table XV. The insert of 
BMP6/SP64#15 is excised by digestion with the 
restriction endonuclease Sail. The resulting 1563 
nucleotide Sail fragment is subcloned into the Xhol 
restriction endonuclease site of the pMT2 
derivative P MT21 and designated herein as 
BMP6/pMT21. 

D « BMP-7 Vector Consfrrnrt^^ 

A derivative of the BMP-7 sequence set forth 
in Table V comprising the nucleotide sequence from 
nucleotide #97 to #1402 is specifically amplified. 
The oligonucleotides CAGGTCGACCCACCATGCACGTGCGCTCA 
and TCTGTCGACCTCGGAGGAGCTAGTGGC are Utilized as 
primers to allow the amplification of nucleotide 
sequence #97 to #1402 of Table V from the insert of 
clone PEH7-9 described above. This procedure 



74 

generates the insertion of the nucleotide sequence 
CAGGTCGACCCACC immediately preceeding nucleotide 
#97 and the insertion of the nucleotide sequence 
GTCGACAGA immediately following nucleotide #1402. 
The addition of these sequences results in the 
creation of a Sail restriction endonuclease 
recognition site at each end of the amplified DNA 
fragment. The resulting amplified DNA product of 
this procedure is digested with the restriction 
endonuclease Sail and subcloned into the Sail site 
of the plasmid vector pSP64 resulting in 
BMP7/SP6#2. 

The clones BMP7/SP6#2 and PEH7-9 are digested 
with the restriction endonucleases Ncol And Stul to 
excise the portion of their inserts corresponding 
to nucleotides #363 to #1081 of Table V. The 
resulting 719 nucleotide NcoI-StuI fragment of 
clone PEH7-9 is ligated into the NcoI-Stul site of 
BMP7/SP6#2 from which the corresponding 719 
nucleotide fragment is removed. The resulting 
clone is designated BMP7mix/SP6. 

Direct DNA sequence analysis of BMP7mix/SP6 
confirmed identity of the 3' region to the 
nucleotide sequence from #1082 to #1402 of Table V, 
however the 5' region contained one nucleotide 
misincorporation. 

Amplification of the nucleotide sequence (#97 
to #1402 of Table V) utilizing PEH7-9 as a template 
is repeated as described above. The resulting 
amplified DNA product of this procedure is digested 
with the restriction endonucleases Sail and Pstl. 
This digestion results in the excision of a 747 
nucleotide fragment comprising nucleotide #97 to 
#833 of Table v plus the additional sequences of 
the 5« priming oligonucleotide used to create the 



75 

Sail restriction endonuclease recognition site 
described earlier. This 747 Sall-PstI fragment is 
subcloned into a Sall-PstI digested pSP65 vector 
resulting in 5-BMP7/SP65. DNA sequence analysis 
demonstrates that the insert of the 5 »BMP7/SP65#l 
comprises a sequence identical to nucleotide #97 to 
#362 of Table V. 

The clones BMP7mix/SP6 and 5-BMP7/SP65 are 
digested with the restriction endonucleases Sail 
and Ncol. The resulting 3« Ncol-Sall fragment of 
BMP7mix/SP6 comprising nucleotides #363 to #1402 of 
Table V and 5- Sall-Ncol fragment of 5'BMP7/SP65 
comprising nucleotides #97 to #362 of Table V are 
ligated together at the Ncol restriction sites to 
produce a 1317 nucleotide fragment comprising 
nucleotides #97 to #1402 of Table v plus the 
additional sequences derived from the 5' and 3' 
oligonucleotide primers which allows the creation 
of Sail restriction sites at both ends of this 
fragment. This 1317 nucleotide Sail fragment is 
ligated into the Sail site of the pMT2 derivative 
P MT2Cla-2. This clone is designated BMP7/pMT2. 

The insert of BMP7/pMT2 is excised by 
digestion with the restriction endonuclease Sail. 
The resulting 1317 nucleotide Sail fragment is 
subcloned into the Sail restriction site of the 
vector pSP64. This clone is designated 
BMP7/SP64#2d. The insert of BMP7/SP64#2d is 
excised by digestion with Sail and the resulting 
Sail fragment comprising nucleotides #97 to #1402 
of Table V is subcloned into the Xhol restriction 
endonuclease site of the pMT2 derivative pMT21 
described above. 



Example VII 



76 

Transient COS Cell Expression 

To obtain transient expression of BMP-5, BMP- 
6, and BMP-7 proteins one of the vectors containing 
the CDNA for BMP-5, BMP-6 or BMP-7, 
BMP5mix/pMT21#2, BMP6/pMT21#2 , or BMP7/pMT21 
respectively, are transfected into COS-1 cells 
using the electroporation method. Other suitable 
transfection methods include DEAE-dextran, and 
lipofection. Approximately 48 hours later, cells 
are analysed for expression of both intracellular 
and secreted BMP-5, BMP-6 or BMP-7 protein by 
metabolic labelling with [ 35 S] methionine and 
polyacrylamide gel electrophoresis. Intracellular 
BMP is analyzed in cells which are treated with 
tunicamycin, an inhibitor of N-linked 
glycosylation. In tunicamycin-treated cells, the 
nonglycosylated primary translation product 
migrates as a homogeneous band of predictable size 
and is often easier to discern in polyacrylamide 
gels than the glycosylated form of the protein, in 
each case, intracelluar protein in tunicamycin- 
treated cells is compared to a duplicate plate of 
transfected, but untreated COS-1 cells. 

A. BMP-5 CO S Express injx 

The results demonstrate that intracellular 
forms of BMP-5 of approximately 52 Kd and 57 Kd are 
made by COS cells. The 52 Kd protein is the size 
predicted by the primary sequence of the the BMP-5 
cDNA clone. Following treatment of the cells with 
tunicamycin, only the 52 Kd form of BMP-5 is made, 
suggesting that the 57 Kd protein is a glycosylated 
derivative of the 52 Kd primary translation 
product. The 57 Kd protein is secreted into the 
conditioned medium and is apparently not 



77 



efficiently processed by COS-l cells into the pro 
and mature peptides. 

B. BMP- 6 CO S ExnrPfiR<A B 

Intracellular BMP-6 exists as a doublet of 
approximately 61 Kd and 65 Kd in untreated COS-l 
cells, in the presence of tunicamycin, only the 61 
Kd protein is observed, indicating that the 65 Kd 
protein is the glycosylated derivative of the 61 Kd 
primary translation product. This is similar to 
the molecular weight predicted by the cDNA clone 
for BMP-6. m the absence of tunicamycin, the 
predominant protein secreted from COS-l cells is 
the 65 Kd glycosylated, unprocessed clipped form of 
BMP-6. There are also peptides of 46 Kd and 20 Kd 
present at lower abundance than the 65 Kd that 
likely represent the processed pro and mature 
peptides, respectively. 
C « BMP-7 CO S Expragp^ p 

Intracellular BMP-7 protein in tunicamycin- 
treated COS-l cells is detected as a doublet of 44 
Kd and 46 Kd. m the absence of tunicamycin, 
proteins of 46 Kd and perhaps 48 Kd are 
synthesized. These likely represent glycosylated 
derivatives of the BMP-7 primary translation 
products. The 48 Kd protein is the major BMP 
species secreted from COS-l cells, again suggesting 
inefficient cleavage of BMP-7 at the propeptide 
dibasic cleavage site. 

Example VIII 

CHO Cell Expression 

DHFR deficient CHO cells (DUKX Bll) are 
transfected by electroporation with one of the BMP- 
5, BMP-6 or BMP-7 expression vectors described 



78 

above, and selected for expression of DHFR by 
growth in nucleoside-free media. Other methods of 
transfection, including but not limited to CaP0 4 
precipitation, protoplast fusion, microinjection, 
and lipofection, may also be employed. In order to 
obtain higher levels of expression more 
expediently, cells may be selected in nucleoside- 
free media supplemented with 5 nM, 20 nM or 100 nM 
MTX. Since the DHFR selectable marker is 
physically linked to the BMP cDNA as the second 
gene of a bicistronic coding region, cells which 
express DHFR should also express the BMP encoded 
within the upstream cistron. Either single 
clones, or pools of combined clones, are expanded 
and analyzed for expression of BMP protein. Cells 
are selected in stepwise increasing concentrations 
of MTX (5 nM, 20 nM, 100 nM, 500 nM, 2 uM, 10 uM, 
and 100 uM) in order to obtain cell lines which 
contain multiple copies of the expression vector 
DNA by virtue of gene amplification, and hence 
secrete large amounts of BMP protein. 

Using standard techniques cell lines are 
screened for expression of BMP RNA, protein or 
activity, and high expressing cell lines are cloned 
or recloned at the appropriate level of selection 
to obtain a more homogeneous population of cells. 
The resultant cell line is then further 
characterized for BMP DNA sequences, and expression 
of BMP RNA and protein. Suitable cell lines can 
then be used for producing recombinant BMP protein. 

A. CHO Expression of BMP-5 

The BMP-5 vector BMP5mix/pMT21#2 described 
above is transfected into CHO cells by 
electroporation, and cells are selected for 



WO 90/11366 

PCT/US90/01630 

79 

egression of DHFR. clonal cell lines are 
Hsf" COl ° nleS Sel60ted 

r • lD SOTe "ess cell lines may be 

ssrc pooib ana cionea at iat - — - 

AS described in Example v.B. the cOHA (or BHP- 
5 encodes for a protein of approximately S2 K d 
10 w 9 Pr ° Cessln * withl » *e cell that includes 

but may not be limited to, propeptide cleavage 
glycosylate, and aimer or multimer formats' 
multiple BMP-s peptides are produced. ZTe a ", 
•t least 4 candidate peptide, for processed for^s 
cf the BMP-5 protein discemable following SDS l^ 

pCide reduci r eonaitioM! " " M • « « 

' ritr tight dOUbl " -.-^—^ M- 
peptide, may ale. b. present. By comparison to the 

~i 11 " 9 0th " " late<1 "» noleo »l« «d tfcl 
related protein TC F-b.ta, the 65 Kd protein liKriy 
represents unprocessed BMP-5, th . ? 8 ra spec^ 
represents the propeptide, and th. „ Kd doubi" 
repreents th. matur. peptide. 

25 a , I? 6 ' 18 ' * B " f " 5 °* U lin » is »aly„d in 

a 2-dimen.iona! oel ^ y £ 

dimension, proteins are electrophoresed »d« 
nonr.duci» g conditions. a. Mterial ^ 
reduced, and electrophoresed in a 

poiyacrylamide gel. Proteins that form disulfide- 

TCL al * ere or * altin ° t ° Mlu ™ b -"" a 

diagonal across th. second reduced gel. Results 
sl™i,r * ° f EMP - 5 Pr ° tein indi «t.s that a 

^ , ', M ' OUnt ° £ ' MtUre BKP - 5 Paptides can 
form homodimers of approximately 30-35 Kd that 
reduce to the 22 Kd doublet observed in ^ 



80 

dimensional reduced gels. A fraction of the mature 
peptides are apparently in a disulfide-bonded 
complex with the pro peptide. The amount of this 
complex is minor relative to the mature homodimer. 
In addition, some of the unprocessed protein can 
apparantly form homodimers or homomultimers . 

B « CHO Expr ession nf BMP- 6 

The BMP-6 expression vector BMP6/pMT21 
described above is transfered into CHO cells and 
selected for stable trans formants . via DHFR 
expression in a manner as described above in part A 
with relation to BMP-5. The mature active species 
of BMP-6 is contemplated to comprise amino acid 
#382 - #513 of Table IV. it is contemplated that 
secreted BMP-6 protein will be processed in a 
manner similar to that described above for BMP-5, 
other related BMP molecules and analogous to the 
processing of the related protein TGF-/J [Gentry, et 
al.; Dernyck, et al., Supra. 

C CHO Expre ssion of BMP»7 

The BMP-7 expression vector BMP7/pMT21 
described above is transfected into CHO cells and 
selected for stable transformants via DHFR 
expression in a manner as described above in 
relation to BMP-5. The mature active species of 
BMP-7 is contemplated to comprise amino acid #300- 
#431 of Table V. It is contemplated that secreted 
BMP-7 protein will processed in a manner similar to 
that described above for BMP-5, other related BMP 
molecules and analogous to the processing of the 
related protein TGF-/J [Gentry, et al.; Dernyck, et 
al . , Supra. ] . 



81 

EXAMPLE IX 

Biological Activity of Em r, sea . m Prnt ^ na 

To measure the biological activity of the 
expressed BMP- 5/ BMP-6 and BMP-7 proteins obtained 
in Example vii and VIII above, the BMP proteins are 
recovered from the culture media and purified by 
isolating the BMP proteins from other 
proteinaceous materials with which they are co- 
produced, as well as from other contaminants. The 
proteins may be partially purified on a Heparin 
Sepharose column and further purified using 
standard purification techniques known to those 
skilled in the art. 

For instance, post transfection conditioned 
medium supernatant collected from the cultures is 
concentrated approximately 10 fold by 

dalv 2 f rati ° n ° n a ^ 10 aettbrane and then 
dialyzed against 20mM Tris, 0.15 M NaCI, pH 7 4 

(starting buffer) . This material is then applied 
to a Heparin Sepharose column in starting buffer 
Unbound proteins are removed by a wash of starting 
buffer, and bound proteins, including proteins of 
the invention, are desorbed by a wash of 20 mM 
jris, 2.0 M N aci, p H 7.4. The proteins bound by 
the Heparin column are concentrated approximately 
10-fold on, for example, a Centricon 10 and the 
salt reduced by diafiltration with, for example, 
0.1% trifluoroacetic acid. The appropriate amount 
of the resultant solution is mixed with 20 mg of 
rat matrix and then assayed for in. vivo bone and/or 
cartilage formation activity by the Rosen- 
modified Sampath - Reddi assay. A ffiock 

transfection supernatant fractionation is used as a 
control. 

Further purification may be achieved by 



82 



preparative NaDodS0 4 /PAGE [laeromli, Nature 227 ; 680- 
685 (1970)]. for instance, approximately 300 /*g of 
protein is applied to a 1 . 5-mm-thick 12.5% gel: 
recovery is be estimated by adding L- 
[ 35 S]methionine-labeled BMP protein purified over 
heparin-Sepharose as described above. Protein may 
be visualized by copper staining of an adjacent 
lane [Lee, et al., Anal. Bio«h»m. ^£6:308-312 
(1987)]. Appropriate . bands are excised and 
extracted in 0.1% NaDodSO 4 /20 mM Tris, pH 8.0. The 
supernatant may be acidified with 10% CF 3 C00H to pH 
3 and the proteins are desalted on 5.0 x 0.46 cm 
Vydac C 4 column (The Separations Group, Hesperia, 
CA) developed with a gradient of 0.1% CF 3 COOH to 
90% acetonitrile/0 . 1% CF3COOH. 

The implants containing rat matrix to which 
specific amounts of human BMP-5, BMP-6 or BMP-7 
proteins of the invention have been added are 
removed from rats after approximately seven days 
and processed for histological evaluation. 
Representative sections from each implant are 
stained for the presence of new bone mineral with 
von Kossa and acid fuschin, and for the presence of 
cartilage-specific matrix formation using toluidine 
blue. The types of cells present within the 
section, as well as the extent to which these cells 
display phenotype are evaluated and scored as 
described in Example III. 

Levels of activity may also be tested for host 
cell extracts. Purification is accomplished in a 
similar manner as described above except that 6 M 
urea is included in all the buffers. 

The foregoing descriptions detail presently 
preferred 

embodiments of the present invention. Numerous 



WO 90/1 1366 

PCIYUS90/01630 

83 

modifications and variations in practice thereof 
are expected to occur to those skiUed in the art 
upon consideration of these descriptions. Those 
modifications and variations are believed to be 
encompassed within the claims appended hereto. 



WO 90/11366 

What is claimed is: 



84 



PCT/US90/01630 



A purified human BMP protein selected from the 
group consisting of: 

(a) BMP-5 characterized by the amino acid 
sequence comprising amino acid #323 to 
#454 of Table III; 

(b) BMP-6 characterized by the amino acid 
sequence comprising amino acid #382 to 
#513 of Table IV; and 

(c) BMP-7 characterized by the amino acid 
sequence comprising amino acid #300 to 
#431 of Table V. 

A purified human BMP protein selected from the 
group consisting of 

(a) BMP-5 protein produced by the steps of 

(i) culturing a cell transformed with a 
DNA sequence comprising nucleotide 
#1665 to #2060 of Table III or a 
sequence substantially homologous 
thereto; and 

(ii) recovering, isolating and purifiying 
from said culture medium a protein 
comprising amino acid #323 to #454 
as shown in Table III or a sequence 
substantially homologous thereto; 

(b) BMP-6 produced by the steps of 

(i) culturing a cell transformed 
with a DNA sequence comprising 
nucleotide #1303 to #1698 of 
Table IV or a sequence 
substantially homologous 
thereto; and 

(ii) recovering, isolating and purifying 



WO 90/11366 



85 



PCT/US90/01630 



from said culture medium a protein 
comprising amino acid #382 to #513 
as shown in Table IV or a sequence 
substantially homologous thereto; 
and 

(c) BMP-7 protein produced by the steps of 

(i) culturing a cell transformed with a 
DNA sequence comprising nucleotide 
#994 to #1389 of Table V or a 
sequence substantially homologous 
thereto; and 

(ii) recovering, isolating and purifying 
from said culture medium a protein 
comprising the amino acid #300 to 
amino acid #431 as shown in Table V 
or a sequence substantially 
homologous thereto. 

3. A purified human BMP protein selected from the 
group consisting of 

(a) BMP-5 produced by the steps of 

(i) culturing a cell transformed with a 
DNA sequence comprising nucleotide 
#699 to #2060 of Table in or a 
sequence substantially homologous 
thereto; and 

(ii) recovering, isolating and purifying 
from said culture medium said BMP-5 
protein; 

(b) BMP-6 produced by the steps of 

(i) culturing a cell transformed with a 
DNA sequence comprising nucleotide 
#160 to #1698 of Table IV or a 
sequence substantially homologous 
thereto; and 



WO 90/11366 



86 



PCT/US90/01630 



(ii) recovering, isolating and purifying 
from said culture medium said BMP-6 
protein; and 
(c) BMP-7 produced by the steps of 

(i) culturing a cell transformed with a 
DNA sequence comprising nucleotide 
#97 to #1389 of Table V or a 
sequence substantially homologous 
thereto; and 

(ii) recovering, isolating and purifying 
from said culture medium said BMP-7 
protein. 

A purified BMP protein produced by the steps 
of: 

(a) culturing a cell transformed with a DNA 
sequence comprising a sequence which 
hybridizes to the DNA sequence selected 
from the DNA sequences of Table III 
comprising nucleotide #1665 - #2060, 
Table IV comprising nucleotide #1303- 
#1698 or Table V comprising nucleotide 
#994 - #1389 under stringent 
hybridization conditions; and 

(b) recovering, isolating and purifying from 
said culture medium a protein 
characterized by the ability to induce 
cartilage and/ or bone formation. 

A protein of claim 1 further characterized by 
the ability to demonstrate the induction of 
cartilage and/or bone formation. 

A protein of claim 2 further characterized by 
the ability to demonstrate the induction of 



WO 90/11366 



PCT/US90/01630 

87 



7. 



cartilage and/or bone formation. 

A protein of claim 3 further characterized by 
the ability to demonstrate the induction of 
cartilage and/or bone formation. 

8. A DNA sequence encoding a protein of claim l. 

9. A DNA sequence encoding a BMP protein said DNA 
sequence selected from the group consisting of 

(a) a DNA sequence encoding BMP-5 comprising 
the nucleotide #1665 to #2060 of Table 
III and sequences which hybridize thereto 
under stringent hybridization conditions 
and encode a protein characterized by the 
ability to induce the formation of 
cartilage and/or bone; 

a DNA sequence encoding BMP-6 comrising 
nucleotide #1303 - #1698 of Table iv and 
sequences which hybridize thereto under 
stringent hybridization conditions and 
encode a protein characterized by the 
ability to induce the formation of 
cartilage and/or bone; 
(c) a DNA sequence encoding BMP-7 comprising 
nucleotide #994 - #1389 of Table V and 
sequences which hybridize thereto under 
stringent hybridization conditions and 
encode a protein characterized by the 
ability to induce the formation of 
cartilage and/or bone; 



(b) 



. A DNA sequence encoding a BMP protein selected 
from the group consisting of 



88 



(a) a DNA sequence encoding BMP-5 comprising 
the nucleotide #669 to #2060 of Table III 
and sequences which hybridize thereto 
under stringent hybridization conditions 
and encode a protein characterized by the 
ability to induce the formation of 
cartilage and/or bone; 

(b) a DNA sequence encoding BMP-6 comrising 
nucleotide #160 - #1698 of Table IV and 
sequences which hybridize thereto under 
stringent hybridization conditions and 
encode a protein characterized by the 
ability to induce the formation of 
cartilage and/ or bone; 

(c) a DNA sequence encoding BMP-7 comprising 
nucleotide #97 - #1389 of Table V and 
sequences which hybridize thereto under 
stringent hybridization conditions and 
encode a protein characterized by the 
ability to induce the formation of 
cartilage and/or bone; 

A vector comprising a DNA sequence of claim 8 
in operative association with an expression 
control sequence therefor. 

A vector comprising a DNA sequence of claim 9 
in operative association with an expression 
contol sequence therefor. 

A vector comprising a DNA sequence of claim 10 
in operative association with an expression 
control sequence therefor. 

A host cell transformed with a vector of claim 



WO 90/11366 



11. 



89 



PCT/US90/01630 



15. A host cell transformed with a vector of claim 
12. 

16. A host cell transformed with a vector of claim 
13. 

17. A method for producing a purified BMP protein 
said method comprising the steps of 

(a) culturing in a suitable culture medium a 
transformed host cell of claim 14; and 

(b) recovering, isolating and purifying said 
protein from said culture medium. 

18. A method for producing a purified BMP protein 
said method comprising the steps of 

(a) culturing in a suitable culture medium a 
transformed host cell of claim 15; and 

(b) recovering, isolating and purifying said 
protein from said culture medium. 

19. A method for producing a purified BMP protein 
said method comprising the steps of 

(a) culturing in a suitable culture medium a 
transformed host cell of claim 16; and 

(b) recovering, isolating and purifying said 
protein from said culture medium. 

20. a pharmaceutical composition comprising an 
effective amount of a BMP-5, BMP-6 or BMP-7 
protein in admixture with a pharmaceutical^ 
acceptable vehicle. 



• A pharmaceutical composition comprising 



WO 90/11366 PCT/US90/01630 

90 

effective amount of a protein of claim 1 in 
admixture with a pharmaceutically acceptable 
vehicle. 

22. A pharmaceutical composition comprising an 
effective amount of a protein of claim 2 in 
admixture with a pharmaceutically acceptable 
vehicle. 



23. A pharmaceutical composition comprising an 
effective amount of a protein of claim 3 in 
admixture with a pharmaceutically acceptable 
vehicle. 

24. A composition of claim 20 further comprising a 
pharmaceutically acceptable matrix. 

25. A composition of claim 21 further comprising a 
pharmaceutically acceptable matrix. 

26. A composition of claim 22 further comprising a 
pharmaceutically acceptable matrix. 

27. A composition of claim 23 further comprising a 
pharmaceutically acceptable matrix. 

28. The composition of claim 20 wherein said 
matrix comprises a material selected from the 
group consisting of hydroxyapatite, collagen, 
polylactic acid and tricalcium phosphate. 

29. The composition of claim 21 wherein said 
matrix comprises a material selected from the 
group consisting of hydroxyapatite, collagen, 
polylactic acid and tricalcium phosphate. 



WO 90/11366 



91 



PCT/US90/01630 



30. The composition of claim 22 wherein said 
matrix comprises a material selected from the 
group consisting of hydroxyapatite, collagen, 
polylactic acid and tricalcium phosphate. 

31. The composition of claim 23 wherein said 
matrix comprises a material selected from the 
group consisting of hydroxyapatite, collagen, 
polylactic acid and tricalcium phosphate. 

32. Use of the composition of claim 20 for the 
treatment of a patient in need of cartilage 
and/or bone formation. 



33. 



34. 



Use of the composition of claim 21 for the 
treatment of a patient in need of cartilage 
and/or bone formation. 

Use of the composition of claim 22 for the 
treatment of a patient in need of cartilage 
and/or bone formation. 

35. use of the composition of claim 23 for the 
treatment of a patient in need of cartilage 
and/or bone formation. 

36. A pharmaceutical composition for wound healing 
and tissue repair said composition comprising 
an effective amount of a BMP-5, or BMP-7 
protein in a pharmaceutical^ acceptable 
vehicle. 

37. A pharmaceutical composition for wound healing 
and tissue repair said composition comprising 



WO 90/11366 



92 



PCT/US90/01630 



an effective amount of the protein of claim 1 
in a pharmaceutical^ acceptable vehicle. 

38. A pharmaceutical composition for wound healing 
and tissue repair said composition comprising 
an effective amount of the protein of claim 2 
in a pharmaceutical^ acceptable vehicle. 

39. A pharmaceutical composition for wound healing 
and tissue repair said composition comprising 
an effective amount of the protein of claim 3 
in a pharmaceutical^ acceptable vehicle. 





INTERNATIONAL SEARCH REPORT 




International Application No PCT/US 90/01630 


1. CLASSIFICATION OF SUBJECT MATTER (if several classification symbols apply, indicate all) 6 


According to International Patent Classification (IPC) or to both National Classification and IPC — ~~ ■ 

IPCS: C 12 P 21/00, A 61 K 37/36, C 07 K 13/00 




Minimum Documentation Searched 7 


Classification System 


^ _ Classification Symbols 


IPCS 


C 12 P; A 61 K; C 07 K 



Documentation Searched other than Minimum Documentation 
to the Extent that such Documents are Included in Fields Searched 8 



III. DOCUMENTS CONSIDERED TO BE RELEVANT 9 



Category ■ 


Citation of Document," with indication, where appropriate, of the relevant passages « 


Relevant to Claim No. 1 ' 


A 


Proc. Natl. Acad. Sci., Vol. 85, No. 24, 1988, Wang, 
Elisabeth A et al: "Purification and 
characterization of other distinct 
bone- inducing factors see page 9484 - 
page 9488 


1-39 


A 


WO, Al, 8910409 (GENETICS INSTITUTE, INC.) 
2 November 1989, 
see the whole document 


1-39 


A 

It ChuuJ. 


US, A, 4789732 (MARSHALL R. URIST) 
6 December 1988, 
see the whole document 


1-39 



* A * MS!5SI^L d ^ 1 ^ i !!L n S ^ tnc -? en ? ^a, $ . ,ate of ,he » rt i* not 

considered to be of particular relevance 
*** ming'daff Ument but publi,ned on or after ,he international 

* L * £h£FF. nt jy]U c . h mB y lb™? doubts on priority claim(s) or 
HXi? h 18 c,le ? to establish the publication dale of another 
citation or other special reason (as specified) 

*°* o?her n means ,errin5 t0 8n 0r *' disclosure ' U8e » exhibition or 

*** &-jy& x P" Wished prior to the international filing date but 
later than the priority date claimed ~ 

CERTIFICATION — ' — __ 



nr «riS2K l 5Sl2 SJS'JSS* 1 8,te f the international filing date 
?ft£i ?« JX.SfiS.fSS ,r ».conf ict with the application but 
fnventfon Principle or theory underlying the 

* X " SS£HHl e J2! ?lP a 3 icu !? r relevance, the claimed invention 
K or Mnwt <* considered to° 

KEfc 1 *?- w,l £ ^ e or other such doc" 
in the art comb,na,,on being obvious to a person skilled 

document member of the same patent family 



Date of the Actual Completion of the International Search 

20th June 1990 


Date of Mailing of this International Search Report 

17.07.90 


International Searching Authority 

EUROPEAN PATENT OFFICE 

Form PCT/IS A/210 <second sheet) (January 19B5) 


Signature of Authorized Officer , 



international Application No. PCT/US 90/01630 



lit. DOCUMENTS CONSIDERED TO BE RELEVANT (CONTINUED FROM THE SECOND SHEET! 


Category " 


Citation of Document, with indication, where appropriate, ol the relevant passages 


Relevant to Claim No 


A 


WO, Al, 8800205 (GENETICS INSTITUTE, INC.) 
14 January 1988, 
see the whole document 


1-39 


A 


EP, A2, 0212474 (UNIVERSITY OF CALIFORNIA) 
4 March 1987, 
see the whole document 


1-39 



ANNEX TO THE INTERNATIONAL SEARCH REPORT 

ON INTERNATIONAL PATENT APPLICATION NO.PCT/US 90/01630 

SA 35737 

The European Pa.en, office is in no way .iatfe .heaeparlic.ar, wnicK are merely oiven for .he P^e^ormaUor, 



Patent document 
cited in search report 



Publication 
date 



Patent family 
member(s) 



Publication 
date 



W0-A1- 


8910409 


02/11/89 


AU-D- 


3448789 


24/11/89 


US-A- 


4789732 


06/12/88 


US-A- 
US-A- 
US-A- 
US-A- 
US-A- 


4294753 
4761471 
4455256 
4619989 
4795804 


13/10/81 
02/08/88 
19/06/84 
28/10/86 


W0-A1- 


8800205 


14/01/88 


AU-D- 
EP-A- 
US-A- 


7783587 
0313578 
4877864 


29/01/88 
03/05/89 


EP-A2- 


0212474 


04/03/87 


JP-A- 
US-A- 


62111933 
4795804 


22/05/87 
03/01/89 



For more details about this annex : see Official Journal of the European patent Office, No. 12/82 
EPO FORM P0479 



This Page is Inserted by IFW Indexing and Scanning 
Operations and is not part of the Official Record 

BEST AVAILABLE IMAGES 

Defective images within this document are accurate representations of the original 
documents submitted by the applicant. 

Defects in the images include but are not limited to the items checked: 

□ black borders 

□ image cut off at top, bottom or sides 
qTfaded text or drawing 
(^blurred or illegible text or drawing 

□ skewed/slanted images 

□ color or black and white photographs 

□ gray scale documents 

□ lines or marks on original document 

□ reference(s) or exhibit(s) submitted are poor quality 

□ OTHER: 

IMAGES ARE BEST AVAILABLE COPY. 
As rescanning these documents will not correct the image 
problems checked, please do not report these problems to 
the IFW Image Problem Mailbox.