Skip to main content

Full text of "USPTO Patents Application 09804625"

See other formats


WORLD INTELLECTUAL PROPERTY ORGANIZATION 
International Bureau 




per 

INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCD 



(51) InternatiODal Patent Gassincation ^ : 

C12P 21/00, C07K 13/00 
C07H 15/12 



Al 



(11) International Publication Number: WO 89/10409 

(43) International Publication Date: 2 November 1989 (02.1 1.89) 



(21) International Application Number: PCT/US89/01464 

(22) International Filing Date : 7 April 1989 (07.04.89) 



(30) Priority data: 
179,197 



8 April 1988 (08.04.88) 



US 



(71) Applicant: GENETFCS INSTITUTE. INC. [US/US]; 87 

CambridgePark Drive, Cambridge. MA 02140 (US). 

(72) Inventors: WANG, Elizabeth, A. ; 136 Wolf Rock Road. 

Carlisle, MA 01741 (US). WOZNEY, John, M. ; 59 Old 
Bolton Road, Hudson, MA 01749 (US). ROSEN, Vicki ; 
344 Mariborough Street, Apt. 4, Boston, MA 021 16 (US). 

(74) Agent: KAPINOS, Ellen, J.; Genetics Institute, Inc., 87 
CambridgePark Drive. Cambridge, MA 02140 (US). 



(81) Designated States: AT (European patent), AU, BE (Euro- 
pean patent). BF (OAPI patent), BG, BJ (OAPI patent), 
CF (OAPI patent), CG (OAPI patent). CH (European 
patent), CM (OAPI patent), DE (European patent), DK, 
FI, FR (European patent), GA (OAPI patent), GB, GB 
(European patent), HU, IT (European patent). JP, KR, 
LU (European patent), ML (OAPI patent), MR (OAPI 
patent), NL (European patent), NO. SE (European pa- 
tent), SN (OAPI patent). SU. TD (OAPI patent), TG 
(OAPI patent). 



Published 

With international search report. 



(54) Title: BONE AND CARTILAGE INDUCTIVE COMPOSITIONS 



(57) Abstract 



Purified BMP-3 proteins and processes for producing them are disclosed. Compositions thereof may be used in the treat- 
mem of bone and/or cartilage defects and in wound healing and related tissue repair. 



FOR THE PURPOSES OF INFORMATION ONLY 



Codes used to identify States party to the PCX on the front pages of pamphlets publishing international appli- 
cations under the PCX. 



AT 


Austria 


FR 


France 


ML 


MaU 


AV 


Australia 


GA 


Gabon 


MR 


Mauritania 


BB 


Barbados 


GB 


United Kingdom 


MW 


Malawi 


BE 


Belgiam 


HU 


Hungary 


NL 


Netherlands 


BG 


Bulgaria 


rr 


Italy 


NO 


Norway 


BJ 


Benin 


JP 


Japan 


RO 


Romania 


BR 


Brazil 


KP 


Democratic People*s Republic 


SD 


Sudan 


CF 


Central African Republic 




of Korea* 


SE 


Sweden 


CG 


Congo 


KB 


Republic of Korea 


SN 


Senegal 


CH 


Swiueriand 


U 


Liechtenstein 


6U 


Soviet Union 


CM 


Cameroon 


l£ 


"Sri Lanka 


TD 


Ctiad 


DE 


Germany, Federal Republic of 


LU 


Luxembourg 


TG 


Togo 


DK 


Denmaii 


MC 


Monaco 


US 


United States of America 


n 


Fmland 


MG 


Madagascar 







wo 89/10409 



PCT/US89/01464 



BONE AND CARTILAGE INDUCTIVE COMPOSITIONS 

5 

The present invention relates to a novel family of purified 
proteins designated BMP-3 proteins and processes for obtaining 
them. Compositions thereof may be used to induce bone and/or 
cartilage formation and in wound healing and tissue repair. 

10 The invention provides proteins, capable of stimulating, 

promoting or otherwise inducing cartilage and/or bone 
formation, substantially free from other mammalian proteins. 
Human BMP-3 proteins of the invention are characterized by 
containing the amino acid sequence set forth in Table II 

15 from at least amino acid #377 through amino acid #472. These 
proteins are capable of inducing cartilage and or bone 
formation • 

Human BMP-3 proteins are produced by culturing a cell 
transformed with a DNA sequence substantially as shown in 

20 Table II and recovering from the culture medium a protein 
containing substantially the 96 amino acid sequence as shown 
in Table II from amino acid # 377 through amino acid # 472. 

Members of the BMP-3 protein family may be further 
characterized by the ability to demonstrate -cartilage and/or 

25 bone formation activity in the rat bone formation assay 
described below. In preferred embodiments the proteins of 
the invention demonstrate activity in this rat bone formation 
assay at a concentration of .5/ig - 100//g/gram of bone. In 
more preferred embodiments these proteins demonstrate activity 

3 0 in this assay at a concentration of Iptg - SO/^g/gram of bone. 
More particularly, these proteins may be characterized by the 
ability of 1/xg of the protein to score at least +2 in the rat 
bone formation assay. 

Another aspect of the invention provides pharmaceutical 

3 5 compositions containing a therapeutically effective amount of 
a BMP-3 protein in admixture with a pharmaceutically acceptable 
vehicle or carrier. The compositions may be used for bone 



wo 89/10409 



PCr/US89/01464 



2 

and/or cartilage formation and may also be used for wound 
healing and tissue repair. Compositions of the invention may 
further include other therapeutically useful agents such as 
the BMP proteins BMP-1, BMP-2A, and BMP-2B disclosed in PCT 
5 pxiblication WO88/00205. Other therapeutically useful agents 
include growth factors such as epidermal growth factor (EGF) , 
fibroblast growth factor (FGF) , and transforming growth 
factors (TGF-a and TGF-^) . The compositions may also include 
an appropriate matrix, for instance, for supporting the 
10 compositions and providing a surface for bone and/or cartilage 
growth. 

The compositions may be employed in methods for treating 
a number of bone defects and periodontal disease and various 
types Of wounds. These methods, according to the invention, 

15 entail administering to a patient needing such bone and/or 
cartilage formation, wound healing, or tissue repair an 
effective amount of a novel BMP-3 protein of the present 
invention. These methods may also entail the administration 
of a BMP-3 protein of the invention in conjunction with at 

20 least one of the novel BMP proteins disclosed in PCT pxiblication 
W088/00205. In addition, these methods may also include 
administration of a BMP-3 with other growth factors. 

Still a further aspect of the invention are DNA sequences 
coding for expression of a BMP-3 protein. Such sequences 

25 include the sequence of nucleotides in a 5 ' to 3 ' direction 
illustrated in Tables I A and I B and II or DNA sequences 
which hybridize under stringent conditions with the DNA 
sequences of Tables I A and I B and II and encode a protein 
having the ability to induce cartilage and/or bone formation. 

30 It is preferred that such proteins be further characterized 
by the ability to demonstrate cartilage and/or bone formation 
activity in the rat bone formation assay described below. In 
preferred embodiments the proteins of the invention demonstrate 
activity in this rat bone formation assay at a concentration 

35 of .5/ig - lOOpg/gram of bone. In more preferred embodiments 



wo 89/10409 



PCT/US89/01464 



these proteins demonstrate activity in this assay at a 
concentration of l/zg - sOpg/gram of bone. More particularly, 
these proteins may be characterized by the ability of l/xg of 
the protein to score at least +2 in the rat bone formation 
5 assay. Finally, allelic or other variations of the sequences 
of Tables I A and I B and II, whether such nucleotide changes 
result in changes in the peptide sequence or not, are also 
included in the present invention. 

Still a further aspect of the invention is a vector 

10 containing a DNA sequence as described above in operative 
association with an expression control sequence therefor. 
Such vector may be employed in a novel process for producing 
a protein of the invention in which a cell line 

transformed with a DNA sequence encoding expression of a 

15 BMP-3 protein in operative association with an expression 
control sequence therefor, is cultured in a suitable culture 
medium and a BMP-3 protein is isolated and purified therefrom. 
This claimed process may employ a number of known cells both 
prokaryotic and eukaryotic as host cells for expression of 

20 the polypeptide. 

Other aspects and advantages of the present invention will 
be apparent upon consideration of the following detailed 
description and preferred embodiments thereof. 

25 Detailed Description of the Invention 

The purified BMP-3 proteins of the present invention are 
produced by culturing a host cell transformed with a DNA 
sequence comprising sxibstantially as shown in Table II from 
nucleotide #321 to nucleotide #1736 or a portion thereof and 

30 recovered from the culture medium. The recovered BMP-3 
proteins are characterized by the 96 amino acid sequence of a 
substantially homologous sequence as amino acid # 377 to 
amino acid # 472 as shown in Table II. These proteins 

may be further characterized by the ability to demonstrate 

35 cartilage and/or bone formation activity in the rat bone 



wo 89/10409 



PCT/US89/01464 



4 

formation assay described below. In preferred embodiments 
they demonstrate activity in this rat bone formation assay at 
a concentration of .5 fig - 100/xg/gram of bone. In more 
preferred embodiments these proteins demonstrate activity in 
5 this assay at a concentration of l/xg - 50//g/gram of bone. 
More particularly, these proteins may be characterized by the 
ability of l/^g of the protein to score at least +2 in the rat 
bone formation assay. Encompassed within the BMP-3 family of 
proteins of the invention are multiple variant forms including 

10 dimers and monomers both precursor and mature forms. 

The BMP-3 proteins provided herein also include proteins 
encoded by the sequences similar to those of Tables I A and 
I B and II r but into which modifications are naturally provided 
(e.g. allelic variations in the nucleotide sequence which may 

15 result in amino acid changes in the polypeptide) or 
deliberately engineered. For example, synthetic polypeptides 
may wholly or partially duplicate continuous sequences of the 
amino acid residues of Tables I A and I B and II. These 
sequences, by virtue of sharing primary, secondary, or tertiary 

20 structural and conformational characteristics with BMP-3 
proteins of Tables I A and I B and II may possess biological 
properties in common therewith. Thus, they may be employed 
as biologically active stibstitutes for naturally-occurring 
BMP-3 polypeptides in therapeutic processes. 

25 Other specific mutations of the sequences of BMP-3 

described herein involve modifications of the glycosylation 
sites. The absence of glycosylation or only partial 
glycosylation results from amino acid substitution or deletion 
at one or both of the asparagine-linkad glycosylation 

30 recognition sites present in the sequences of the BMP-3 shown 
in Tables I A and I B and II. The asparagine-linked 
glycosylation recognition sites comprise tripeptide sequences 
which are specifically recognized by appropriate cellular 
glycosylation enzymes. These tripeptide sequences are either 

35 asparagine-X-threonine or asparagine-X-serine, where X is 



wo 89/10409 



PCT/US89/0I464 



5 

usually any amino acid. A variety of amino acid substitutions 
or deletions at one or both of the first or third amino acid 
positions of a glycosylation recognition site (and/or amino 
acid deletion at the second position) results in non- 
glycosylation at the modified tripeptide sequence. 

The present, invention also encompasses the novel DNA 
sequences, free of association with DNA sequences encoding other 
proteinaceous materials, and coding on expression for a BMP- 
3 protein. These DNA sequences include those depicted in 
Tables I A and I B and II in a 5* to 3' direction and those 
sequences which hybridize under stringent hybridization 
conditions [see, T. Maniatis et al, Molecular Cloning (A 
Laborat ory Manual^ . Cold Spring Harbor Laboratory (1982), 
pages 387 to 389] to the DNA sequences of Tables I A and I B 
and II and demonstrate cartilage and/or bone formation activity. 
An example of one such stringent hybridization condition is 
hybridization at 4X SSC at 65*C, followed by a washing in 0.1 
X SSC at 65°C for an hour. Alternatively, an exemplary 
stringent hybridization condition is in 50% formamide, 4 X 
sec at 42**C. 

Similarly, DNA sequences which code for a BMP-3 
polypeptides coded for by the sequences of Tables I A and I B 
and II, but which differ in codon sequence due to the degen- 
eracies of the genetic code or allelic variations (naturally- 
occurring base changes in the species population which may or 
may not result in an amino acid change) also encode the novel 
growth factors described herein. Variations in the DNA 
sequences of Tables I A and I B and II which are caused by 
point mutations or by induced modifications (including 
insertion, deletion, and substitution) to enhance the activity, 
half -life or production of the polypeptides encoded thereby 
are also encompassed in the invention. 

Another aspect of the present invention provides a novel 
method for producing BMP-3 proteins. The method of the 
present invention involves culturing a suitable cell or cell 



wo 89/10409 



PCT/US89/01464 



line, which has been transformed with a DNA sequence coding 
on expression for a BMP-3 polypeptide of the invention, under 
the control of known regulatory sequences recovering and 
purifying the proteins from the culture medium. Suitable 
5 cells or cell lines may be mammalian cells, such as Chinese 
hamster ovary cells (CHO) . The selection of suitable mammalian 
host cells and methods for transformation, culture, 
amplification, screening and product production and 
purification are known in the art. See, e.g., Gething and 

10 Sambrook, Nature, 293.: 620-625 (1981), or alternatively, 
Kaufman et al, Mol. Cell. Biol. . 5(7) : 1750-1759 (1985) or 
Howley et al, U.S. Patent 4,419,446. Another suitable mammalian 
cell line, which is described in the accompanying examples, 
is the monkey COS-1 cell line. The mammalian cell line CV-1 

15 may also be useful. 

Bacterial cells may also be suitable hosts. For example, 
the various strains of E. coli (e.g., HBlOl, MC1061) are 
well-known as host cells in the field of biotechnology. 
Various strains of B. subtilis . Pseudomonas, other bacilli 

20 and the like may also be employed in this method. 

Many strains of yeast cells known to those skill-ed in the 
art may also be available as host cells for expression of the 
polypeptides of the present invention. Additionally, where 
desired, insect cells may be utilized as host cells in the 

25 method of the present invention. See, e.g. Miller et al, 
Genetic Enaineerincr. 8:277-298 (Plenum Press 1986) and 
references cited therein. 

Another aspect of the present invention provides vectors 
for use in the method of expression of these novel BMP-3 

3 0 polypeptides. Preferably the vectors contain the full novel 
DNA sequences described above which code for the novel BMP-3 
factors of the invention. Additionally the vectors also contain 
appropriate expression control sequences permitting expression 
of the BMP-3 protein sequences. Alternatively, vectors 

35 incorporating modified sequences as described above are also 



wo 89/10409 



PCT/US89/01464 



embodiments of the present invention and useful in the 
production of the BMP-3 proteins. The vectors may be employed 
in the method of transforming cell lines and contain selected 
regulatory sequences in operative association with the DNA 
5 coding sequences of the invention which are capable of directing 
the replication and expression thereof in selected host 
cells. Useful regulatory sequences for such vectors are 
known to one of skill in the art and may be selected depending 
upon the selected host cells. Such selection is routine and 

10 does not form part of the present invention. Host cells 
transformed with such vectors and progeny thereof for use in 
producing BMP-3 proteins of the invention are also provided 
by the invention. Furthermore, proteins of the invention may 
be coexpressed with other "BMP" proteins such as those disclosed 

15 in WO88/00205. 

A protein of the present, invention, which induces 
cartilage and/or bone growth in circumstances where bone is not 
normally formed, has application in the healing of bone 
fractures and cartilage defects in humans and other animals. 

20 Such a preparation employing a BMP-3 protein may have 
prophylactic use in closed as well as open fracture reduction 
and also in the improved fixation of artificial joints. BMP- 
3 preparations of the invention may also be useful in the 
treatment of osteoporosis. De novo bone formation induced by 

25 an osteogenic agent contributes to the repair of congenital, 
trauma induced, or oncologic resection induced craniofacial 
defects, and also is useful in cosmetic plastic surgery. A 
BMP-3 protein of the invention may be valuable in the treatment 
of periodontal disease, and in other tooth repair processes - 

30 Such agents may provide an environment to attract bone- forming 
cells, stimulate growth of bone-forming cells or induce 
differentiation of progenitors of bone-forming cells. A 
variety of osteogenic, cartilage-inducing and bond inducing 
factors have been described. See, e.g. European patent 

3 5 applications 148,155 and 169,016 for discussions thereof. 



wo 89/10409 PCr/US89/01464 



8 

The proteins of the invention may also be used in vound 
healing and tissue repair in humans and other animals. The 
types of wounds include, but are not limited to burns, 
incisions, and ulcers. (See, e.g., PCT Publication WO84/01106 
5 for discussion of wound healing and related tissue repair) . 
Of course, the proteins of the invention may have other 
therapeutic uses. 

A further aspect of the invention is a therapeutic method 
and composition for repairing fractures and other conditions 

10 related to cartilage and/or bone defects or periodontal dis- 
eases. In addition, the invention comprises therapeutic 
methods and compositions for woxind healing and tissue repair. 
Such compositions comprise a therapeutically effective amount 
of a BMP-3 protein in admixture with a pharmaceutically 

15 acceptable vehicle, carrier or matrix. It is expected that 
BMP-3 proteins may act in concert with or perhaps 
synergistically with other related proteins and growth factors . 
The invention encompasses therapeutic, methods and compositions 
comprising a BMP-3 protein in combination with other related 

20 proteins or growth factors. Therapeutic methods and 
compositions of the invention may therefore comprise a 
therapeutic amount of a BMP-3 protein with a therapeutic 
amoxant of at least one of the other "BMP" proteins disclosed 
in PCT publication WO88/00205. Such combinations may comprise 

25 separate molecules of the "BMP" proteins or heteromolecules 
comprised of different "BMP" protein moieties. For example, 
a method and composition of the invention may comprise a 
disul fide-linked dimer comprising a BMP-3 protein and another 
"BMP" protein described above. Further, a BMP-3 protein of 

30 the invention may be combined with other agents beneficial to 
the treatment of the cartilage and/or bone defect, xround or 
tissue in question. These agents include various growth 
factors such as epidermal growth factor (EGF) , platelet 
derived growth factor (PDGF) , transforming growth factors 

35 (TGF-a and TGF-^) , insulin-like growth factor (I^F). and 



wo 89/10409 



PCT/US89/01464 



fibroblast growth factor (FGF) . The preparation and formulation 
of such physiologically acceptable protein compositions, 
having due regard to pH, isotonicity, stability and the like, 
is within the skill of the art. The therapeutic compositions 
5 of the invention are also presently valuable for veterinary 
applications due to the lack of species specificity in BMP 
proteins. Particularly domestic animals and thoroughbred 
horses in addition to humans are desired patients for such 
treatment with BMP-3 proteins. 

10 The therapeutic method includes administering the 

composition topically, systematically, or locally as an 
implant or device. When administered, the therapeutic 
composition for use in this invention is, of course, in a 
pyrogen-free, physiologically acceptable form. Further, the 

15 composition may desirably be encapsulated or injected in a 
viscous form for delivery to the site of bone, cartilage or 
tissue damage. Topical administration may be suitable for 
wound healing and related tissue repair. Preferably, for bone 
and/or cartilage formation, the bone growth inductive factor 

20 composition would include a matrix capable of delivering the 
bone inductive factor to the site of bone and/or cartialge 
damage, providing a surface and support structure for the 
developing bone and/or cartilage and optimally capable of being 
resorbed into the body. Such matrices may be formed of 

25 materials presently in use for other implanted medical 
applications. 

The choice of matrix material is based on, for example, 
biocompatibility , biodegradability, mechanical properties, 
cosmetic appearance and interface properties. The particular 

30 application of the BMP-3 compositions will determine the 
appropriate formulation. Potential matrices for the 
compositions may be biodegradable and chemically defined such 
as calcium sulfate, tricalciumphosphate, hydroxyapatite, 
polylactic acid, and polyanhydrides . Other potential materials 

35 are biodegradable and biologically well defined, such as bone 



wo 89/10409 



PCr/US89/01464 



10 

or dermal collagen. Further matrices are comprised of pure 
proteins or extracellular matrix components, other potential 
matrices are nonbiodegradable and chemically defined, such as 
sintered hydroxyapatite , bioglass, aluminates, or other 
5 ceramics. Matrices may be comprised of combinations of any 
of the above mentioned types of material, such as poly lactic 
acid and hydroxyapatite or collagen and tricalciTimphosphate . 
The bioceramics may also be altered in composition, such as 
in calcium-aluminate-phosphate and processing to alter for 

10 example, pore size, particle size, particle shape, and 
biodegradability . 

The dosage regimen will be determined by the attending 
physician considering various factors which modify the action 
of the BMP-3 protein, e*g. amount of bone weight desired to 

15 be formed, the site of bone damage, the condition of the 
damaged bone, the size of a wound, type of damaged tissue, 
the patient's age, sex, and diet, the severity of any infection, 
time of administration and other clinical factors. The 
dosage may vary with the type of matrix used in the 

20 reconstitution and the types of BMP proteins in the composition. 
The addition of other known growth factors, such as IGF-I 
(insulin like growth factor I) , to the final composition, may 
also effect the dosage. 

Generally, the dosage regimen for cartilage and/or bone 

25 fojnaatibn should be in the range of approximately 10 to 10^ 
nanograms of protein per gram of bone weight desired. Progress 
can be monitored by periodic assessment of bone growth and/or 
repair, for example, using x-rays, histomorphometric 
determinations and tetracycline labeling. 

30 The following examples illustrate practi<:e of the present 

invention in recovering and characterizing a bovine BMP-3 
protein and employing it to recover corresponding hxaman BMP-3 
proteins, and in expressing BMP-3 proteins via recombinant 
techniques . 



35 



wo 89/10409 



PCT/US89/01464 



EXAMPLE I 

Isolation of Bovine Bone Inductive Factor 

Ground bovine bone powder (2 0-120 mesh, Helitrex) is 
prepared according to the procedures of M. R. Urist et al., 
5 Proc, Natl Acad, Sci USA . 70:3511 (1973) with elimination of 
some extraction steps as identified below. Ten kgs of the 
ground powder is demineralized in successive changes of 0.6N 
HCl at 4'C over a 48 hour period with vigorous stirring. The 
resulting suspension is extracted for 16 hours at 4*C with 50 

10 liters of 2M CaCl2 and lOmM ethyl enediamine-tetraacetic acid 
[EDTA] , and followed by extraction for 4 hours in 50 liters of 
0.5M EDTA. The residue is washed three times with distilled 
water before its resuspension in 20 liters of 4M guanidine 
hydrochloride [GuCl], 20mM Tris (pH7.4), ImM N-ethylmaleimide, 

15 ImM iodoacetamide, ImM phenylmethylsulf onyl fluorine as 
described in Clin. Orthop. Rel. Res. , 171: 213 (198.2) . 
After 16 to 20 hours the supernatant is removed and replaced 
with another 10 liters of GuCl buffer. The residue is extracted 
for another 24 hours. 

20 The crude GuCl extracts are combined, concentrated 

approximately 20 times on a P^llicon apparatus with a 10,000 
molecular weight cut-off membrane, and then dialyzed in 50mM 
Tris, O.IM NaCl, 6M urea (pH7.2), the starting buffer for the 
first column. After extensive dialysis the protein is loaded 

25 on a 4 liter DEAE cellulose column and the unbound fractions 
are collected. 

The unbound fractions are concentrated and dialyzed against 
50mM NaAc, 50mM NaCl (pH 4.6) in 6M urea. The unbotmd fractions 
are applied to a carboxymethyl cellulose column. Protein not 

30 bound to the column is removed by extensive washing with 
starting buffer, and the material containing protein having 
bone and/or cartilage formation activity as measured by the 
Rosen-modified Sampath-Reddi rat bone formation assay (described 
in Example III below) is desorbed from the column by 50mM 

35 NaAc, 0.25mM NaCl, 6M urea (pH 4.6). The protein from this 



wo 89/10409 



PCr/US89/01464 



12 

step elution is concentrated 20- to 40- fold, then diluted 5 
times with SOmM KPO4, 6M urea (pH6.0). The pH of the solution 
is adjusted to 6.0 with SOOmM K2HPO4. The sample is applied 
to an hydroxylapatite column (LKB) equilibrated in 80mM KPO4, 
5 6M urea (pH6.0) and all unbound protein is removed by washing 
the colxuan with the same buffer. Protein having bone and/ or 
cartilage formation activity as measured by the rat bone 
formation assay is eluted with lOOmM KPO4 (pH7.4) and 6M urea. 
The protein is concentrated approximately 10 times, and 

10 solid NaCl added to a final concentration of 0.15M. This 
material is applied to a heparin - Sepharose column equilibrated 
in 50mM KPO4, isOmM NaCl, 6M urea (pH7.4). After extensive 
washing of the column with starting buffer, a protein with 
bone and/or cartilage formation activity is eluted by 50mM 

15 KPO4, 700mM NaCl, 6M urea (pH7.4). This fraction is con- 
centrated to a minimum volume, and 0.4ml aliquots are applied 
to Superose 6 and Superose 12 coliimns connected in series, 
equilibrated with 4M GuCl, 20mM Tris (pH7.2) and the columns 
developed at a flow rate of 0.2Sml/min. The protein demon- 

20 strating bone and/or cartilage inductive activity has a 
relative migration on SDS-PAGE corresponding to an approximately 
28,000 to 30,000 dalton protein. 

The above fractions from the superose colvunns ar« pooled, 
dialyzed against SOmM NaAc, 6M urea (pH4.6), and applied to a 

25 Pharmacia MonoS HR column. The colxmn is developed with a 
gradient to l.OM NaCl, 50mM NaAc, 6M urea (pH4.6). Active 
fractions are pooled and brought to pH3 . 0 with 10% 
trifluoroacetic acid (TFA) . The material is applied to a 
0.46 X 25cm Vydac C4 column in 0.1% TFA and the column developed 

30 with a gradient to 90% acetonitrile, 0.1% TFA (31.5% 
acetonitrile, 0.1% TFA to 49.5% acetonitrile, 0.1% TFA in 60 
minutes at 1ml per minute) . Active bone and/or cartilage 
forming material is eluted at approximately 40-44% ace- 
tonitrile. Aliquots of the appropriate active fractions are 

35 iodinated by one of the following methods: P. J. McConahey et 



wo 89/10409 



PCr/US89/01464 



13 

al. Int. Arch. Allergy , 29:185-189 (1966); A. E. Bolton et 
al, Biochem J . . 133 : 529 (1973); and D. F- Bowen-Pope, 
J. Biol > Chem. , 237:5161 (1982). The iodinated proteins 
present in these fractions are analyzed by SDS gel 
5 electrophoresis and urea Triton X 100 isoelectric focusing. 
At this stage, the bone inductive factor is estimated to be 
approximately 10-50% pure. 

EXAMPLE II 

10 Characterization of Bovine Bone Inductive Factor 

A. Molecular Weight 

Approximately 20ug protein from Example I is lyophilized 
and redissolved in IX SDS sample buffer. After 15 minutes of 
heating at 37*C, the sample is applied to a 15% SDS 

15 polyacrylamide gel and then electrophoresed with cooling. The 
molecular weight is determined relative to prestained molecular 
weight standards (Bethesda Research Labs) . Immediately after 
completion, the gel lane containing the bone and/ or cartilage 
fonaing material is sliced into 0.3cm pieces. Each piece is 

20 mashed and 1.4ml of 0.1% SDS is added. The samples are 
shaken gently overnight at room temperature to elute the 
protein. Each gel slice is desalted to prevent interference 
in the biological assay. The supernatant from each sample is 
acidified to pH 3.0 with 10% TFA, filtered through a 0.45 

25 micron membrane and loaded on a 0.46cm x 5cm C4 Vydac column 
developed with a gradient of 0.1% TFA to 0.1% TFA, 90% CH3CN. 
The appropriate bone and/or cartilage inductive protein - 
containing fractions are pooled and reconstituted with 20mg 
rat matrix and assayed. In this gel system, the majority of 

3 0 bone and/or cartilage formation fractions have the mobility 
of a protein having a molecular weight of approximately 
28,000 - 30,000 daltons. 

B. Isoelectric Focusing 

35 The isoelectric point of the protein having bone and/ or 



wo 89/10409 



PCr/US89/01464 



cartilage formation activity is determined in a denaturing 
isoelectric focusing system. The Triton XlOO urea gel system 
(Hoeffer Scientific) is modified as follows: 1) 40% of the 
ampholytes used are Servalyte 3/10; €0% are Servalyte 7-9; and 
5 2) the catholyte used is 40mM NaOH. Approximately 20ug of 
protein from Example I is lyophilized, dissolved in sample 
buffer and applied to the isoelectrofocusing gel. The gel is 
rxxn at 20 watts, 10 "C for approximately 3 hours • At completion 
the lane containing bone and/or cartilage inductive factor is 

10 sliced into 0.5 cm slices. Each piece is mashed in 1.0ml 6M 
urea, 5mM Tris (pH 7.8) and the samples agitated at room 
temperature. The samples are acidified, filtered, desalted 
and assayed as described above. The major portion of activity 
as determined by the Rosen-modified Sampath-Reddi assay migrates 

15 in a manner consistent with a pi of about 8.8 - 9.2. 

C. Subunit Characterization 

The subunit composition of the isolated bovine bone 
protein is also determined. Pure bone inductive factor is 

20 isolated from a preparative 15% SDS gel as described above. 
A portion of the sample is then reduced with 5mM DTT in sample 
buffer and re-electrophoresed on a 15% SDS gel. The 
approximately 2 8-3 0kd protein yields two major bands at 
approximately 18 - 20kd and approximately 16 - 18kd, as well 

25 as a minor band at approximately 28 - 30kd. The broadness of 
the two bands indicates heterogeneity caused most probably by 
glycosylation, other post translational modification, 
proteolytic degradation or carbamylation. 

30 EXAMPLE III 

Rosen Modified Samr>ath-Reddi Assay 

A modified version of the rat bone formation assay 

described in Sampath and Reddi, Proc. Natl. Acad. Sci. U.S.A. . 

80:6591-6595 (1983) is used to evaluate bone and/or cartilage 
35 activity of the bovine protein obtained in Example I and the 



wo 89/10409 



PCT/US89/01464 



BMP-1 proteins of the invention. This modified assay is 
herein called the Rosen-modified Sampath-Reddi assay. The 
ethanol precipitation step of the Sampath-Reddi procedure is 
replaced by dialyzing (if the composition is a solution) or 
5 diafiltering (if the composition is a suspension) the fraction 
to be assayed against water. The solution or suspension is then 
redissolved in 0.1 % TFA, and the resulting solution added to 
20mg of rat matrix. A mock rat matrix sample not treated with 
the protein serves as a control. This material is frozen and 

10 lyophilized and the resulting powder enclosed in #5 gelatin 
capsules. The capsules are implanted subcutaneously in the 
abdominal thoracic area of 21 - 49 day old male Long Evans 
rats. The implants are removed after 7-14 days. Half of 
each implant is used for alkaline phosphatase analysis [See, 

15 A. H. Reddi et al., Proc. Natl Acad Sci. . 69:1601 (1972)]. 

The other half of each implant is fixed and processed for 
histological analysis. lum glycolmethacrylate sections are 
stained with Von Kossa and acid fuschin to score the amount 
of induced bone and cartilage formation present in each 

20 implant. The terms +1 through +5 represent the area of each 
histological section of an implant occupied by new bone and/or 
cartilage cells and matrix. A score of +5 indicates that 
greater than 50% of the implant is new bone and/ or cartilage 
produced as a direct result of protein in the implant. A score 

25 of +4, +3, +2 and +1 would indicate that greater than 40%, 
3 0%, 2 0% and 10% respectively of the implant contains new 
cartilage and/or bone. 

The rat matrix samples containing 200 ng of protein 
obtained in Example I result in bone and/or cartilage formation 

30 that filled more than 20% of the implant areas that was 
sectioned for histology. This protein therefore scores at 
least +2 in the Rosen-modified Sampath-Reddi assay. The 
dose .response of the matrix samples indicates that the amount 
of bone and/or cartilage formed increases with the amount of 

35 protein in the sample. The control sample did not result in 



wo 89/10409 



PCr/US89/01464 



16 

any bone and/or cartilage formation. The purity of the 
protein assayed is approximately 10-15% pure. 

The bone and/or cartilage formed is physically confined 
to the space occupied by the matrix. Samples are also analyzed 
5 by SDS gel electrophoresis and isoelectric focusing as described 
above, followed by autoradiography. Analysis reveals a 
correlation of activity with protein bands at 28 - 303cd and a 
pi of approximately 8.8-9.2. To estimate the purity of the 
protein in a particular fraction an extinction coefficient" of 
10 1 OD/mg-cm is used as an estimate for protein and the protein 
is run on SDS PAGE followed by silver staining or 
radioiodination and autoradiography. 

EXAMPLE IV 
15 Bovine BMP-3 

The protein composition of Example IIA of molecular 

weight 28 - 30kd is reduced in situ and digested with trypsin. 

Eight tryptic fragments are isolated by standard procedures 

having the following amino acid sequences: 
20 Fragment 1: AAFLGDIALDEEDLG 

Fragment 2: AFQVQQAADL 

Fragment 3:NYQDMVVEG 

Fragment 4: STPAQDVSR 

Fragment 5: N Q E A L R 
25 Fragment 6: L S E P D P S H T L E E 

Fragment 7: F D A Y Y 

Fragment 8:LKPSN?ATIQSIVE 

-A less highly purified preparation of protein from 
bovine bone is prepared according to a purification scheme 

30 similar to that described in Example I. The purification 
basically varies from that previously described by omission 
of the DE-52 column, the CM cellulose column and the mono S 
column/ as well as a reversal;, in the order of the 
hydroxylapatite and heparin sepharose columns. Briefly, the 

35 concentrted crude 4 M extract is brought to 85% final 



wo 89/10409 



PCr/US89/01464 



concentration of ethanol at 4 degrees. The mixture is then 
centrifuged, and the precipitate redissolved in 50 mM Tris, 
0.15 M NaCl, 6.0 M urea. This material is then fractionated 
on Heparin Sepharose as described. The Heparin bound material 
5 is fractionated on hydroxyapatite as described. The active 
fractions are pooled, concentrated, and fractionated on a 
high resolution gel filtration (TSK 30000 in 6 M guanidinium 
chloride, 50 mM Tris, pH 7.2). The active fractions are 
pooled, dialyzed against 0.1% TFA, and then fractionated on a 

10 C4 Vydac reverse phase column as described. A small amount 
of 125j labeled counterpart is mixed with the sample at this 
stage and the whole preparation is reduced and electrophoresed 
on an SDS ployacrylanide acrylamide gel [Laemmli, U.K., 
Nature, 222:680-685 (1970)]. The protein corresponding to 

15 the 16-18kd band is located using wet gel autoradiography and 
fixed with methanol-acetic acid-water using standard procedures, 
briefly rinsed with water, then neutralized with O.IM ammonium 
bicarbonate. Following dicing the gel slice with a razor 
blade, the protein is digested from the gel matrix by adding 

20 0.2 /ig of TPCK-treated trypsin (Worthington) and incubating 
the gel for 16 hours at 27^C. The resultant digest is then 
subjected to RPHPLC using a C4 Vydac RPHPLC column and 0.1% 
TFA-water 0.1% TFA water-acetonitrile gradient. The resultant 
peptide peaks were monitored by UV absorbance at 214 and 280 

25 nm and subjected to direct amino terminal amino acid sequence 
analysis using an Applied Biosystems gas phase sequenator 
(Model 470A) . Tryptic fragments are isolated having the 
following amino acid sequences: 
Fragment 9: SLKPSNHATIQS7V 

30 Fragment 10: SFDAyYCS?A 
Fragment ll:VyPNMTVESCA 
Fragment 12:VDFADI?W 

Tryptic Fragments 7 and 8 are noted to be substantially 
the same as Fragments 10 and 9, respectively. 

35 



wo 89/10409 



PCT/US89/01464 



18 

Probes consisting of pools of oligonucleotides (or 
unique oligonucleotides) are designed on the basis of the 
amino acid sequences of the tryptic Fragments 9 (Probe #3), 
10 (Probe #2), and 11 (Probe #1), according to the method of 
5 R. Lathe, J . Mol . ^iol. , 183(1): 1-12 (1985), and synthesized 
on an automated DNA synthesizer; the probes are then 
radioactively labeled with polynucleotide Kinase and ^^^-hTP. 
Probe #l:ACNGTCAT [A/G] T T N G G [A/G] T A 

10 Probe #2! C A [A/G] T A [A/G] T A N G C [A/G] T C [A/G] A A 

Probe #3: T G [A/G/T] ATNGTNGC [A/G] T G [A/G] T T 

The standard nucleotide symbols in the above-identified 

15 probes are as follows: A, adenosine; c, cytosine; G, guanine; 
T, thymine; and N, adenosine or cytosine or guanine or thymine. 

Because the genetic code is degenerate (more than one codon 
can code for the same amino acid) , the number of oligo- 
nucleotides in a probe pool is reduced based on the frequency 

20 of codon usage in eukaryotes, the relative stability of G:T 
base pairs, and the relative infrequency of the dinucleotide 
CpG in eukaryotic coding sequences [See Toole et al.. Nature . 
312:342-347 (1984)]. 

A recombinant bovine genomic library is constructed as 

25 follows: Bovine liver DNA is partially digested with the 
restriction endonuclease enzyme Sau 3A and sedimented through 
a sucrose gradient. Size fractionated DNA in the range of 
15-3 0kb is then ligated to the bacteriophage Bam HI vector 
EMBL3 [Frischauf et al, J. Mol. Biol . . 170:827-842 (1983)]. 

30 The library is plated at 8000 recombinants per plate. Duplicate 
nitrocellulose replicas of the plaques are made and amplified 
according to a modification of the procedure of Woo et al. 
Prop. Natl. Acad. Sei. TTRa , 75:3688-91 (1978). 400,000 
recombinants are screened in duplicate with Probe #i which 

35 has been labeled with 32p, ^he probes are hybridized in 



wo 89/10409 



PCT/US89/01464 



3M tetraniethylananonium chloride (TMAC) , O.IM sodium phosphate 
pH6.5, ImM EDTA, 5X Denhardts, 0.6% SDS, lOOug/ml salmon sperm 
DNA at 48 degrees C; and washed in 3M TMAC, 50mM Tris pHS.O at 
50 degrees C. These conditions minimize the detection of 
5 mismatches to the 17 mer probe pool [see, Wood et al, Proc. 
Natl. Acad. Sci, U.S.A., 82:1585-1588 (1985)]. All 
recombinants which hybridized to this probe are replated for 
secondaries. Triplicate nitrocellulose replicas are made of 
the secondary plates, and amplified as described. The three 

10 sets of filters are hybridized to Probes #1, #2 and #3, again 
under TMAC conditions. One clone, lambda bP-819, hybridizes 
to all three probes and is plaque purified and DNA is isolated 
from a plate lysate. Bacteriophage lambda bP-819 was deposited 
with the American Type Culture Collection, 12301 Parklawn 

15 Drive, Rockland, Maryland USA (hereinafter the ATCC) on June 
16, 19 87 under accession nximber 40344. This deposit meets 
the requirements of the Budapest Treaty on the International 
Recognition of the Deposit of Microorganisms for the Purposes 
of Patent Procedure and Regulations thereunder. This bP-819 

20 clone encodes at least a portion of the bovine protein which 
we have designated BMP-3 or bBMP-3. 

The region of bP-819 which hybridizes to Probe #2 is 
localized and sequenced. The partial DNA and derived amino 
acid sequences of this region are shown in Table IIA. The 

25 amino acid sequences corresponding to tryptic Fragments 10 
and 12 are underlined. The first underlined sequence 
corresponds to Fragment 12 while the second corresponds to 
Fragment 10. This region of bP-819, therefore, which hybridizes 
to Probe #2 encodes at least 111 amino acids. This amino acid 

30 sequence is encoded by the DNA sequence from nucleotide #414 
through #746. 



wo 89/10409 



PCT/US89/01464 



10 



20 

TABIE I. A. 

383 393 403 413 (1) 428 

GAGGAGGAAG OGGTCTROSG GGGIXXTTCr GOCTC^^ AAC AAT GAG CTT OCT GOG GCA 

Asn Asn Glu Leu £>ro Gly Ala 

443 458 473 488 

GAA TAT CftG TAG AAG GAG GAT GAA QEA TGG GAG GAG AGG AAG OCT TAC AAG ACT 
Glu Tyr Gin Tyr Lys Glu Asp Glu Val Trp Glu Glu Arg lys Pro lyr lys mr 

503 518 533 

CTTCAGACrCAGOCCCCrGATAAGAGfrAAGAAC AAA AAG AAA CaO AGG AAG GGA 
iBa Gin ISar Gin rto Pro Asp lys Ser lys Asn Lys lys Lys Gin Arg lys Gly 

548 563 578 593 

5 CCT GAG GAG AAG AGfT GAG AOG CTC GAG TIT GAT GAA GAG ACC CTG AAG AAG GGA 
Eco Gin Gin lys Ser Gin Hyr Leu Gin Hie Asp GLn Gin Hxr Leu lys lys Ala 

608 623 638 

AGA AGA AAG GAA TGG ATT GAA COG OSG AAT TCT GCC AGA CX3G TAC GIT AAA GIG 
10 Arg Arg Lys Gin Trp lie Glu Pro Arg Asn Cys Ala Arg Arg T^ Leu lys V&l 

653 668 683 698 

GAG TTC GGA GAT ATT QGC TGG AGG GAA TGG ATT ATT TGG COG AAG TOG TIC GAT 
^ Asp Fhe Ala Asp lie Gly Trp Ser Glu Trp lie lie Ser Pro Lys Ser Rie Asp 

"713 728 743 (ill) 756 

GCCTATTACTGCTOCGGAGaGTGCCAGTrCOOCATGOGAAAG -GEAGOCATIG 
Ala Tvr Tvr Gvs Ser Glv Ala cys Gin Hae Pro MET Pro Lys 

20 766 776 786 

TiTmtJioc TGTccrrcac atitgcaiag 



wo 89/10409 



PCr/US89/01464 



21 

The region of bP-819 which hybridizes to Probe #1 and 
#3 is localized and sequenced. The partial DNA and derived 
amino acid sequences of this region are shown in Table JIB. 
The amino acid sequences corresponding to tryptic Fragments 9 
5 and 11 are underlined. The first underlined sequence 
corresponds to Fragment 9 while the second underlined sequence 
corresponds to Fragment 11. The peptide sequence of this 
region of bP-819 which hybridizes to Probe #1 and #3 is 64 amino 
acids in length encoded by nucleotide #305 through #493 of 

10 Table JIB. The arginine residue encoded by the AGA triplet 
is presumed to be the carboxy-terminus of the protein based 
on the presence of a stop codon (TAA) adjacent to it. The 
nucleic acid sequence preceding the couplet TC (positions 
3 05-3 06) is presumed to be an intron (non-coding sequence) 

15 based on the presence of a consensus acceptor sequence (i.e. 
a pyrimidine-rich stretch, TTCTCCCTTTTCGTTCCT, followed by 
AG) and the presence of a stop rather than a basic residue in 
the appropriate position of the derived amino acid sequence. 
bBMP-3 is therefore characterized by the DNA and amino 

20 acid sequence of Table I A and Table I B. The peptide sequence 
of this clone is 175 amino acids in length and is encoded by 
the DNA sequence from nucleotide #414 through nucleotide #746 
of Table I A and nucleotide #305 through nucleotide #493 of 
Table I B. 



wo 89/10409 



PCT/US89/01464 



22 



TABLE I. B. 



284 294 304 (112) 319 

5 CEACCIECTG TKrrOOCTIT TOGTrCCTAG TCT TIG AAG CCk TCk AAT €3^: GCT ACC 

Ser IBM Lvs Pro Ser Asn His Ala Ihr 

334 349 364 379 

ATC CAG ACT ATA GTC AGA GCT GUG GGG CTC GTC OCT GGA AIC OC!C GAG OCT TGC 
10 He Gin S er lie Val Arg Ala Val cay Val Val Pro Gly He Pro Glu Pro cys 

394 409 424 439 

TCT GIG CCk GAA AAG ATG TOO TCA CTC AGC ATC TTA TTC TPT GAT GAA AAC AAG 
^ Cys. Val Pro Glu Lys MET Ser Ser Lea Ser He Leu Hie Hie Asp Glu Asn Lys 

454 469 484 (175) 

AAT GIG GEA CIT AAA CTA TAT OCA AAC ATG ACA GTA GAG TCT TCT <3CT TGC AGA 
Asn Val Val Leu Lys Val Tvr Pro Asn MET 'Pir Val Glu Ser Cvs Ala q/s Arg 

20 503 513 523 533 

TAACdGGIG AAGAACrCAT CTGGATGCIT AACTCAAITOG 



wo 89/10409 



PCr/US89/01464 



23 

EXAMPLE V 

The bovine and human BMP-3 genes are presumed to be 
significantly homologous, therefore a hiiman genomic library 
5 is screened with two oligonucleotide probes synthesized with 
the bovine BMP-3 sequence above. The oligonucleotides are as 
follows 

#1 : d ( AATTCCGGGGTTCAATCCATTGCTTTCTTCTTGCCTTCTTCAGGGTCTCTGT) 
# 2 : d ( TTCGCTCCAGCCAATATCTGCGAAGTCCACTTTAAGGTACCGTCTGGCAC ) 

10 The oligonucleotides are synthesized on an automated 
synthesizer and radioactively labeled with polynucleotide 
kinase and ^^p.^^rpp^ ^ hiiman genomic library (Toole et al., 
supra ) is plated. Duplicate nitrocellulose filter replicas 
of the library corresponding to 1,000,000 recombinants are 

15 made of and hybridized to the nick-translated probes in 5 X 
SSC, 5 X Denhardt's, lOOug/ml denatured salmon sperm DNA, 
0.1% SDS (the standard hybridization solution) at 50 degrees 
centigrade for approximately 14 hours. The filters are then 
washed in 1 X SSC, 0.1% SDS at 50*C and subjected to 

20 autoradiography. Ten duplicate positives are isolated and 
plaque purified. Sequence analysis indicates that the positives 
contain the human BMP-3 gene. 

A region comprised of the bovine DNA sequence residues 4 08- 
72 7 in Table I. A. is subcloned into the plasmid pSP65 [see 

25 D.A. Melton et al, Nucl. Acid Res. . 12 : 7035-7056 (1984) ] , and 
amplified by standard techniques. The insert region of this 
plasmid is then excised and labeled with •'^p by nick- 
translation. A primer-extended cDNA library is made from the 
human lung small cell carcinoma cell line H128 (ATCC# HTB 120) 

30 using as a primer an oligonucleotide of the sequence 
d(AATGAtTGAATTAAGCAATTC) . This oligonucleotide was synthesized 
on the basis of the DNA sequence of the 3 ■ untranslated 
region of the human BMP-3 gene. 375,000 recombinants from 
this library are screened with the nick-translated probe by 

35 standard methods. Recombinants from the library are hybridized 



wo 89/10409 



PCr/US89/01464 



to the probe in standard hybridization solution at 65 and washed 
in 0.2 X SSc, 0.1% SDS at 65«C. 17 positives are obtained. 
One of these, AH128-4 was deposited with the ATCC on March 
31, 1988 under accession number 40437. This deposit meets 
5 the requirements of the Budapest Treaty on the International 
Recognition of the Deposit of Microorganisms for the Purposes 
of Patent Procedure and Regulations thereunder. The entire 
nucleotide sequence and derived amino acid sequence of the 
insert of H128-4 are given in Table II. This clone is expected 

10 to contain all of the nucleotide sequence necessary to encode 
the entire BMP-3 protein. The amino acid sequence of Table 
II is contemplated to represent a primary translation product 
which may be cleaved to produce the mature protein/s. 
Nucleotide, #1 to #320 represents the 5» untranslated region 

15 and nucleotide #173 6 to #1794 represents the 3" untranslated 
region. Precursor proteins may be cleaved at the proteolytic 
processing site between amino acid #360 and #361. The BMP-3 
proteins encoded by Table II are contemplated to contain the 
96 amino acid sequence from amino acid #377 to amino acid #472 

20 or a sequence s;ibstantially homologous thereto. The sequences 
corresponding to tryptic Fragments 9-12 are iinderlined in 
Table II. The DNA sequence indicates that the human BMP-3 
precursor protein is 472 amino acids. It is contemplated 
that BMP-3 corresponds to the approximately 16 to 18 kd 

25 subunit of Example IIC. 

The sequences of BMP-3 as shown in Tables I A and I B 
and II, have significant homology to the beta (B) and beta 
(A) subunits of the inhibins. The inhibins are a family of 
hormones which are presently being investigated for use in 

30 contraception. See, A. J. Mason et al. Nature, 318:659-663 
(1985) . To a lesser extent they are also homologous to 
Mullerian inhibiting siabstance (MIS) , a testicular glycoprotein 
that causes regression of the Mullerian duct during development 
of the male embryo and transforming growth factor-beta (T-GF- 

35 b) which can inhibit or stimulate growth of cells or cause 



wo 89/10409 



PCr/US89/01464 



25 

them to differentiate. BMP-3 also demonstrates sequence 
similarity with Vgl. Vgl mRNA has been localized to the 
vegetal hemisphere of xenopus oocytes • During early development 
it is distributed throughout the endoderm, but the mRNA is 
5 not detectable after blastula formation has occurred. The 
Vgl protein may be the signal used by the endoderm cells to 
commit ectodermal cells to become the embryonic mesoderm. 
BMP-3 also shares some sequence similarity with the bone 
inductive protein BMP-2A disclosed in PCT publication 
10 WO88/00205. 



wo 89/10409 



PCr/US89/01464 



26 



TABEE H 

10 20 30 40 50 60 70 

5 MATCnGAA AACAOOOGGG OCACACaOSC OGOGAOdftC AGC LCmm ' CSUSOGaTIGGA GIGG3^G2«33G 

80 90 100 no 120 130 140 

CJGCCOSCaGC GCCJCIGOGaS GCnGAGGTCC GOSCaGCTGC TGGGGAflGAG CXXaCCIGTC AGGCIGCGCT 

10 

150 160 170 180 190 200 210 

GGSrcaCOGC AGCRAGIGGG GCTGGCOGCr AlCSOGCIGC ACX3CGGCCX3C GKXXXSGGCT OOSIGCGCOC 

15 

220 230 240 250 260 270 280 

TOGCCOCRGC TCaTTIGGRG TTCAACOCrC GGCIOOGOaS COGGCIOCIT GQGCCITOGG AGIGICOCEC 

20 290 300 310 320 (1) 335 

AGOC3AOGCC23 GGAGOOGAOG C3SGat30GCGG GIROCEAGCX; AIGGCrGGGGCXSMCAGGCTGCIC 

MET Ala Gly Ala Ser Arg Leu 

350 365 380 395 

25 TIT CEG IGG CTC GGC TS: TTC TCC GIG AO: CIG GOG ^ 

Hie Ifiu Trp Ifiu Gly Cys ae cys Val Ser l£u Ala Gin Gly Glu Arg Pro lys Pro 

410 425 440 455 

OCTTrccaSGftGCTCax:AaAGCT<aG0CAGGrGACQGCAC3G QCAGGT QGT GGC CXE 
Pro Hie Pro Glu Lsu Arg Lys Ala Val Pro Gly Asp Arg Hir Ala Gly GLy Gly Pro 

470 485 500 515 

GkC ICC GRG CrS CftG COS CRA GAG AAG GTCTCTGAACACAIGCIGOGGCTCTAT -GAC 
Asp Ser Glu leu Gin Pro dn Asp lys Val Ser Glu His MET Leu Arg Lsu Tyr Asp 

530 545 560 

AGG TAG AGC AOS QIC CAG GOS GOC CGG ACA COG GGC TQC CCG GAG <a3A GGC TOG CftG 
Arg 0^ Ser Thr Val Gin Ala Ala Arg Thr Pro Gly Ser Leu Glu Gly Gly Ser Gin 

40 575 590 605 620 

OCC TGG OSC CCT OSG dC CTS OSC <3AA GGC AAC ACX3 GTT OSC AGC TTT GGG GOS GCA 
Pro Trp Arg Pro Arg Leu Leu Arg Glu Gly Asn Eir Val Arg Ser Hie Arg Ala Ala 

635 650 665 680 

45GCAGCAGAAACrCITGaAAGAAAAGGACIGTATATCTICAftrCK5ACATOGC!IAACC 
Ala Ala Glu mir Leu Glu Arg Lys Gly Leu lyr lie Rie Asn Lai !Ilir «er Leu *Ilir 

695 710 725 740 

AftG TCr GAA AAC ATT TIG TCT GOC AGA dG TRT TTC TGT AIT G6A GAG CIA GQA AAC 
50 Lys Ser Glu Asn lie Leu Ser Ala T3ir Leu lyr Rie cys lie Gly Glu Leu Gly Asn 



30 



35 



wo 89/10409 



PCr/US89/0l464 



27 



755 770 785 800 

ATCAGCCTGAGTTCTCCAGTCTCrGGA 

lie Ser Lseu Ser cys Pro Val Ser Gly Gly cys Ser His His Ala Gin Arg Lys His 

5 

815 830 845 

ATT GAG ATT GAT CCT TCP GCA TOG AOC CTC AAA TTC AGO AGA AAC CAA ACT CAA CTC 
lie Gin lie Asp Leu Ser Ala Trp Hir Leu Lys Rie Ser Arg Asn Gin Ser Gin Leu 

10 860 875 890 905 

err GGC CAT CTC TCA GTC GAT ATG GCC AAA TCT CAT OGA GAT ATT ATC TOG TGG CTG 
Leu Gly His Leu Ser Val Asp MET Ala Lys Ser His Arg Asp He MET Ser Tcp Leu 

920 935 950 965 

15 TCr AAA GAT ATC ACT CAA TTC TTG AGG AAG GOC AAA GAA AAT GAA GAG TTC CTC ATA 
Ser Lys Asp He Hxsc Gin Phe Leu Arg Lys Ala Lys Glu Asn Glti Glu Hie Leu He 

980 995 1010 1025 

GGA Trr AAC ATT ACG TOC AAG GGA OGC CAG CTG OCA AAG AGG AGG TEA OCr TTT OCA 
20 Gly Phe Asn lie Thr Ser Lys Gly Arg Gin Leu Pro Lys Arg Arg Leu Pro Fhe Pro 

1040 1055 1070 1085 

GAG OCr TAT ATC TTG GEA TAT GCC AAT GAT GCC GOC ATr TCT GAG OCA GAA ACT CTG 
Glu Pro Tyr He Leu Val lyr Ala Asn Asp Ala Ala He Ser Glu Pro Glu Ser Val 

25 

UOO H15 H30 

GEA TCA AGO TEA CAG GGA CAC OGG AAT TIT GOC ACT GGA ACT" GTT OOC AAA TGG GAT 
Val Ser Ser Leu Gin Gly His Arg Asn Hie Pro Thr Gly Hir Val Pro Lys Trp Asp 

301145 1160 1175 U90 

AGO CAC ATC AGA GCT GCC CTE TOC ATT GAG OGG AGG AAG AAG 030 TCT ACT GGG GTC 
Ser His He Arg Ala Ala Leu Ser He Glu Arg Arg Lys Lys Arg Ser Ihr Gly Val 

1205 1220 1235 1250 

35 TTG CTG OCT CTG CAG AAC AAC GAG CTT OCT GGG GCA GAA TAC CAG TAT. AAA AAG GAT 
Leu Leu Pro Leu Gin Asn Asn Glu Leu 'Pro Gly Ala Glu Tfr Gin lyr Lys Lys Asp 

1265 1280 1295 1310 

GAG GTG TGG GAG GAG AGA AAG OCT TAC AAG AOC CTr CAG GCT CAG GOC OCT GAA AAG 
40 Glu Val Trp Glu Glu Arg Lys Pro lyr Lys Tlir Leu Gin Ala Gin Ala Pro Glu Lys 

1325 1340 1355 1370 

ACT AAG AAT AAA AAG AAA CAG AGA AAG GGG OCT CAT OGG AAG AGO CAG AGG CTC CAA 
Ser Lys Asn Lys Lys Lys Gin Arg Lys Gly Pro His Arg Lys Ser Gin Thr Leu Gin 

45 

1385 1400 1415 

TTT GAT GAG CAG AOC CIG AAA AAG GCA AGG AGA AAG CAG TGG ACT GAA CCT GGG AAT 
Fhe Asp Glu Gin Ihr Leu Lys Lys Ala Arg Arg Lys <Sln Trp He Glu Pro Arg Asn 

501430 1445 (377) 1460 1475 

TGC GCC AGG AGA TAC CTC AAG GTA GAC TTT GGA GAT ATT GGC TGG ACT GAA TGG ATT 
cys Ala Arg Arg Tyr Ifiu Lys Val Asp Fhe Ala Asp He Glv Tro Ser Glu T^ He 



wo 89/10409 



PCr/US89/01464 



28 



1490 1505 1520 1535 

MC TCX: OOC AAGTOCTITGftTGOCTftTTATTGC TCT GGA GC3^ TGC CAG TIC CXT AIG 
lie Ser Pro Lys Ser Rie Asp Ala Tv r Tvr Cvs Ser Glv Ala cys Gin Hie Pro MET 

5 

1550 1565 1580 1595 

-0GAAAGTCTTlX3AAG<XATCAj^CM<CTA0Ci^C^ 
^ lys Ser l£U Lvs Pro Ser A sh His Ala ihr lie Gin Ser lie Val Arg Ala Val 

10 1610 1625 1640 1655 

GGGGTCGirOCTGQGAOTCCTGAGOCTTGCTCTGIAOCAGAAAAG 
Gly Val Val Pro Gly lie Pro Glu Pro Cys cys Val Pro Glu Lys MET Ser Ser Leu 

1670 1685 1700 

15AtSTA37rTlATrcOTrGMGAAAM'A2U3AATGlACnGCITAAA<^ 

Ser ne l£u Rie Hie Asp Glu Asn lys Asn Val Val Lbu lys Val Tvr Pro Asn MET 

^13^ «™ ^ ^'^''2) 1746 1756 1766 1776 

ACAGSEAGAGTCTTGCGCTTGCAGA TftACCTGGCA AAGaAdCKr TIGAMGCTr AmCAftlCT 
20 Ihr Val Glu Ser Cys Ala cys Arg 



1786 

CEAGAGTCXSA OGGAATTC 



wo 89/10409 PCT/US89/01464 



29 

EXAMPLE VI 
Expression of BMP^-S 

In order to produce bovine, hximan or other mammalian 
bone inductive factors, the DNA encoding it is transferred 
5 into an appropriate expression vector and introduced into 
mammalian cells or other preferred eukaryotic or prokaryotic 
hosts by conventional genetic engineering techniques. However 
the presently preferred expression system for biologically 
active recombinant human bone inductive factor is stably 

10 transformed mammalian cells. 

One skilled in the art can construct mammalian expression 
vectors by employing the sequence of Tables I A and I B and 
II or other modified sequences and known vectors, such as pCD 
[Okayama et al. . Mol, Cell Biol. , 2:161-170 (1982)] and 

15 pJL3, pJL4 [Gough et al., EMBO J. . 4:645-653 (1985)]. The 
transformation of these vectors into appropriate host cells 
can result in expression of a BMP-3 protein. One skilled in 
the art could manipulate the sequences of Tables I A and I B 
and II by eliminating or replacing the mammalian regulatory 

2 0 sequences flanking the coding sequence with bacterial sequences 
to create bacterial vectors for intracellular or extracellular 
expression by bacterial cells. For example, the coding 
sequences could be further manipulated (e.g. ligated to other 
known linkers or modified by deleting non-coding sequences 

25 therefrom or altering nucleotides therein by other known 
techniques) . The modified BMP-3 coding sequence could then 
be inserted into a known bacterial vector using procedures 
such as described in T. Taniguchi et al., Proc . Natl Acad . 
Sci. USA . 77:5230-5233 (1980). This exemplary bacterial 

30 vector could then be transformed into bacterial host cells and 
BMP-3 expressed thereby. For a strategy for producing 
extracellular expression of BMP-3 in bacterial cells., see, 
e.g. European patent application EPA 177,343. 

Similar manipulations can be performed for the construction 

35 of an insect vector [See, e.g. procedures described in pi:*lished 



wo 89/10409 PCr/US89/01464 



30 

European patent application 155,476] for expression in insect 
cells. A yeast vector could also be constructed employing 
yeast regulatory sequences for intracellular or extracellular 
expression of the factors of the present invention by yeast 
5 cells. [See, e.g., procedures described in pxiblished PCT 
application WO86/0G639 and European patent application EPA 
123,289] . 

A method for producing high levels of a BMP-3 protein 
factor of the invention from mammalian cells involves the 

10 construction of cells containing multiple copies of the 
heterologous BMP-3 gene. The heterologous gene can be linked 
to an amplifiable marker, e.g. the dihydrofolate reductase 
(DHFR) gene for which cells containing increased gene copies 
can be selected for propagation in increasing concentrations 

15 of methotrexate (MTX) according to the procedures of Kaufman 
and Sharp, J. Mol. Biol, , 159:601-629 (1982). This approach 
can be employed with a nxmber of different cell types. For 
example, a plasmid containing a DNA sequence for a BMP-3 
protein of the invention in operative association with other 

20 plasmid sequences enabling expression thereof and the DHFR 
expression plasmid pAdA26SV(A)3 [Kaufman and Sharp, Mol. 
Cell. Biol., 2:1304 (1982)] can be co-introduced into DHFR- 
deficient CHO cells, DUKX-BII, by calcium phosphate 
coprecipitation and transf ection, electroperation or protoplast 

25 fusion. DHFR expressing transf ormants are selected for 
growth in alpha media with dialyzed fetal calf serum, and 
subsequently selected for amplification by growth in increasing 
concentrations of MTX (sequential steps in 0.02, 0.2, 1.0 and 
5uM MTX) as described in Kaufman et al., Mol Cell Biol. , 

30 5:1750 (1983). Transf ormants are cloned, and biologically 
active BMP-3 expression is monitored by rat bone formation 
assay described above in Example III. BMP-3 expression 
should increase with increasing levels of MTX resistance. 
Similar procedures can be followed to produce other BMP-3 family 

35 proteins. 



wo 89/10409 



PCT/US89/01464 



31 



A. COS Cell Expression 

As one specific example of producing a BMP-3 protein 
of Example V, the insert of H12 8-4 is released from the 
5 vector arms by digestion with Kpnl, blvmting with T4 polymerase, 
ligating on an EcoRl adapter, followed by digestion with Sal 
I. The insert is sxibcloned into the EcoRl and Xho I cloning 
sites of the mammalian expression vector, pMT2CXM. Plasmid 
DNA from this subclone is transfected into COS cells by the 

10 DEAE-dextran procedure [Sompayrac and Danna PNAS 78:7575-7578 
(1981); Luthman and Magnusson, Nucl> Acids Res , 11: 1295-1308 
(1983)] and the cells are cultured. Serum-free 24 hr. 
conditioned medium is collected from the cells starting 40- 
70 hr. post-trans feet ion. 

15 The mammalian expression vector pMT2 CXM is a derivative 

of P91023 (b) (Wongetal., Science 228:810-815, 1985) differing 
from the latter in that it contains the ampicillin resistance 
gene in place of the tetracycline resistance g«ne and further 
contains a Xhol site for insertion of cDNA clones. The 

20 functional elements of pMT2 CXM have been described (Kaufman, 
R.J., 1985, Proc. Natl. Acad. Sci. USA 82 : 689-693) and include 
the adenovirus VA genes, the SV40 origin of replication 
including the 72 bp enhancer, the adenovirus major late 
promoter including a 5* splice site and the majority of the 

25 adenovirus tripartite leader sequence present on adenovirus 
late mRNAs, a 3* splice acceptor site, a DHFR insert, the SV40 
early polyadenylation site (SV40) , and pBR322 sequences 
needed for propagation in E^ coli . 

Plasmid pMT2 CXM is obtained by EcoRI digestion of pMT2- 

30 VWF, which has been deposited with the American Type Culture 
Collection (ATCC) , Rockville, MD (USA) under accession number 
ATCC 67122. EcoRI digestion excises the cDNA insert present 
in PMT2-VWF, yielding pMT2 in linear form which can be ligated 
and used to transform E. coli HB 101 or DH-5 to ampicillin 

35 resistance. Plasmid pMT2 DNA can be prepared by -conventional 



wo 89/10409 



PCT/US89/01464 



32 

methods. pMT2CXM is then constructed using loopout/in 
mutagenesis (Morinaga,et al-. Biotechnology 84: 636 (1984). 
This removes bases 1075 to 1145 relative to the starting from 
thr Hind III site near the SV40 origin of replication and 
5 enhancer sequences of pMT2. In addition it inserts the 
following sequence: 

5 ' P0_CATGGGCAGCTCGAG-3 ' 
at nucleotide 1145. This sequence contains the recognition 
site for the restriction endonuclease Xho I, which is compatable 
10 with the Sal I site on the BMP-3 insert. Plasmid pMT2 CXM DNA 
may be prepared by conventional methods. 

B. CHO Cell Expression 

A BMP-3 protein of Example V may be expressed in CHO 

15 cells by releasing the insert of H128-4 from the vector arms 
by digestion with Kpnl, blunting with T4 polymerase, ligating 
on an EcoRl adapter, followed by digestion with Sal I. The 
insert is subcloned into the EcoRl and Xho I cloning sites of 
the mammalian expression vector, pMT2CXM. Plasmid DNA from 

20 this subclone is transfected into CHO cells by electroporation 
[Neuman et al, EMBO J., 1:841-845 (1982)]. Two days later, 
cells are switched to selective medium containing 10% dialyzed 
fetal bovine serum and laclcing nucleosides. Colonies expressing 
DHFR are counted 10-14 days later. Individual colonies or 

25 pools of colonies are expanded and analyzed for expression 
of BMP-3 RNA and protein using standard procedures and are 
subsequently selected for amplification by growth in increasing 
concentrations of MTX. 

cDNA genes inserted into the EcoRI and/or Xho I sites 

30 will be expressed as a bicistronic mRNA with DHFR in the 
second position. In this configuration, translation of the 
upstream (BMP-3) open reading frame is more efficient than the 
downstream (DHFR) cDNA gene {Kaufman et al, EMBO J . 6:187-193 
(1987) . The amount of DHFR protein expressed is nevertheless 

35 sufficient for selection of stable CHO cell lines. 



wo 89/10409 



PCr/US89/01464 



Characterization of the BMP-3 polypeptides through pulse 
labeling with [35S] methionine and polyacrylamide gel 
electrophoresis indicates that multiple molecular size forms 
of BMP-3 proteins are being expressed and secreted from the 
5 stable CHO lines. 

Example VII 

Biological Activity of Expressed BMP-3 

To measure the biological activity of the expressed BMP- 

10 3 obtained in Example VI above, the BMP-3 is partially purified 
on a Heparin Sepharose column. 4 ml of the collected post 
transfection conditioned medium supernatant from one 100 mm 
dish is concentrated approximately 10 fold by ultrafiltration 
on a YM 10 membrane and then dialyzed against 20mM Tris, 0.15 

15 M NaCl, pH 7.4 (starting buffer). This material is then 
applied to a 1.1 ml Heparin Sepharose column in starting 
buffer. Unbound proteins are removed by an 8 ml wash of 
starting buffer, and bound proteins, including BMP-3, are 
desorbed by a 3-4 ml wash of 20 mM Tris, 2.0 M NaCl, pH 7.4. 

20 The proteins bound by the Heparin column are concentrated 

approximately 10-fold on a Centricon 10 and the salt reduced 
by diaf iltration with 0.1% trif luoroacetic acid. The 
appropriate amount of this solution is mixed with 20 mg of 
rat matrix and then assayed for in vivo bone and/or cartilage 

25 formation activity by the Rosen-modified Sampath - Reddi 
assay. A mock transfection supernatant fractionation is used 
as a control for COS expressed proteins and for CHO expressed 
proteins CHO cell without BMP-3 conditioned medium 
fractionation is utilized. The implants containing rat 

30 matrix to which specific amounts of hximan BMP-3 have been 
added are removed from rats after seven days and processed 
for histological evaluation. Representative sections from 
each implant are stained for the presence of new bone mineral 
with von Kossa and acid fuschin, and for the presence of 

35 cartilage-specific matrix formation using toluidine blue. 



wo 89/10409 



PCT/US89/01464 



34 

The types of cells present within the section, as well as the 
extent to which these cells display phenotype are evaluated and 
scored as described in Example III. 

Addition of hvunan BMP-3 to the matrix material resulted 
5 in formation of cartilage-like nodules at 5 days post 
implantation. The chondroblast-type cells were recognizable 
by shape and expression of metachromatic matrix. The assay 
results indicate that BMP-3 proteins may be characterized by 
the ability of l^g of the protein to score at least +2 in the 

10 rat bone formation assay. The amount of activity observed for 
human BMP-3 indicates that it may be dependent upon the 
amount of BMP-3 protein added to the matrix sample. 

The procedures described above may be employed to isolate 
other related BMP-3 factors of interest by utilizing the 

15 bovine BMP-3 or human BMP-3 factors as a probe source. Such 
other BMP-3 proteins may find similar utility in, inter alia, 
fracture repair, wound healing and tissue repair. 

The foregoing descriptions detail presently preferred 
embodiments of the present invention. Numerous modifications 

20 and variations in practice thereof are expected to occtir to 
those skilled in the art upon consideration of these descrip- 
tions. Those modifications and variations are believed to be 
encompassed within the claims appended hereto. 



wo 89/10409 



PCr/US89/01464 



35 

What is claimed is: 

1. A purified BMP-3 protein produced by the steps of 

(a) culturing a cell transformed with a cDNA substantially 
5 as shown in Table II; and 

(b) recovering from said culture medium a protein 
containing substantially the 96 amino acid sequence as 
shown in Table II from amino acid # 377 to amino acid # 
472. 

10 

2. A protein of claim 1 further characterized by the ability 
to induce cartilage and/or bone formation, 

3. A protein of claim 1 further characterized by the ability 
15 of 1/ig of said protein to score at least C +2 in the Rosen- 
modified Sampath-Reddi assay. 

4. A cDNA sequence encoding a protein of claim 2. 
20 5. A host cell transformed with a cDNA of claim 4. 

6. A method for producing a purified BMP-3 protein said 
method comprising the st^ps of 

(a) culturing in a suitable culture medium said transformed 
25 host cells of claim 5; and 

(b) isolating and purifying said BMP-3 from said culture 
medium. 

7. A pharmaceutical composition comprising an effective 
30 amount of a protein of claim 1 in admixture with a 

pharmaceutical ly acceptable vehicle. 

8. A pharmaceutical formulation for bone and/or cartilage 
formation comprising an effective amount of a protein of 

35 claim 2 in a pharmaceutical ly acceptable vehicle. 



1 



wo 89/10409 



PCr/US89/01464 



36 

9. A composition of claim 8 further comprising a matrix for 
supporting said composition and providing a surface for bone 
and/or cartilage growth. 

5 

10. The composition of claim 9 wherein said matrix comprises 
a material selected from the group consisting of hydroxyapatite, 
collagen, polylactic acid and tricalcium phosphate. 

10 11. A method for inducing bone and/or cartilage formation in 
a patient in need of same comprising administering to said 
patient an efective amoxint of the composition of claim 8. 

12. A pharmaceutical composition for wovmd healing and tissue 
15 repair said composition comprising an effective amount of the 

protein of claim 1 in a pharmaceutically acceptable vehicle. 

13 . A method for treating wounds and/or tissue repair in a 
patient in need of same comprising administering to said 

20 patient an effective amount of the composition of claim 12. 

14. An isolated DNA sequence encoding a BMP-3 protein said 
DNA sequence comprising substantially the nucleotide sequence 
or a portion thereof selected from the group consisting of: 

(a) nucleotide #321 through nucleotide #1736 

(b) sequences which 

(1) hybridize to said sequence under stringent 
hybridization conditions; and 

(2) encode a protein characterized by the ability 
to induce cartilage and/pr bone formation. 

15. A DNA sequence of claim 14 further characterized by the 
ability of If^g of said protein having the ability to score at 
least +2 in the Rosen-modified Sampath-Reddi assay. 



25 



30 



35 



wo 89/10409 



PCr/US89/01464 



37 

16. A vector comprising a DNA sequence of claim 14 in operative 
association with an expression control sequence therefor. 

17. A host cell transformed with a DNA sequence of claim 14. 

18. A method for producing a BMP-3 protein, said method 
comprising the steps of 

(a) culturing in a suitable culture medium said 
transformed host cell of claim 17; and 

(b) isolating and purifying said BMP-3 from said culture 
medium. 



INTERNATIONAL SEARCH REPORT 

,n,.r«.ti,«,i APP....UO- MP.PCT/US 89/01464 



I. CLASSinCATION or SUBJECT WATTCH til %Mfa\ claiilficailon aymcolt apply, indicate alQ * 



Aecordinn to JnlftrniiliPtat PiUiit Classification (IPC) Of Id both National Ciistincation and IPC 

1PC(4): C12P 21/00; C07K 13/00; C07H 15/12 
nS: 435/68; 530/350; 536/27 



II. riELDS SEARCHED 



Mittimum Oocumtntatlon S«itrchfri ' 



Claisiftcition S yttgm 
DS 



CI«i>nicnllon Symboli 



435/68,91,172.1,172.3,320 
536/27j530/350;935/l8,22,33,56 



Documentation S«»rch«d othtf Itian Minimum DocumenUUon 
|9 ih« Eittnl that «ueh Oocumanta are Inctutfed in tha Fitlds Searched • 



Chemical Abstracts Data Base (CAS) 1967-1989 

Key Words; bone morphogenic protein, pharmaceutical composition 



III. DOCUMENTS CONSIDERED TO BE WEtEV^WT • 



Catagery * 



Y,P 



Citalioii ol Dotumcni. " with initlcttion. whew approptiat*. ol lh« piim»»9«« a 



US, A, 4.619,989 (0RIST)28 October 1936, 
see abstract. 

US,JV, 4,793,804 (ORI5T)03 January 1989 # 
see abstract. 

Proceedings of the National Academy of 
ScUnces, U.S.A.. Volume 85. issued 
December 1988 (WANO et al) "Purifica- 
tion and characterisation of other 
distinct bone-inducing factors , see 
pages 9484-9488, see especially, the 
absract. 

WO, A W086/00525 (SZABO)30 January 1986 see 
abstract. 

US,A, 4.394,370 (JEFFRIES) 19 July 1983 
see abstract. 



R«l««anl lA Claim No. ■* 



1-18 
1-18 
1-18 



12^13 
7-13 



« SpaclAl cMtgoriM of «il*d doeumtnta: ^ 

•A" doeumtnt dvTmlng th» ganaral «aio of th» *rt which ia nrt 

con»id*T«d to he of pariicuiir r«i«v*nee 

Mrtiar document but Dubhahod on or after the inttmatienal 

filing dele 

-L" document which may throw ^ouOlt on Pftemy cUimJaJ or 
wMch I* cited 10 aetabiiah the publication date et another 
citation or other special leason (aa apeciAedl 

-O** document referring to en otel diecloaure, use. eihibitlon or 
other meena 

^P" document pubMahed'prior to the internetionat RHng data but 
later than the priority dale cieimed 



• T" later document publiahad eOer the '***";^'^"}5 
pr priority dale and not In conflict with the eppllcation but 
cil& to understand the principle or theory undertymg the 
invention 

-X" docum«nl ol particular rele»ence: the e»;*'r5!.i'J!i"J* ^2 
cannot be conaidered no»el or cannot be conaiderad to 
invotve an inventive step 

"V- document of particular relevance; the S!*'*"?.** STJlI'lSIl 
cannot be considered to nvoive »n mventhre »t«P *nen the 
SScum.nl "combined with one i\^^l'J^^VJ^S^SSS^ 
menta, auch combination being obvloua to • person sKiHed 
In the art 

"A** documerit member of the same patant family 



IV/CCRTIPieATlOM 



Date ol the Aciual Completion of lh« International Search 

09 June 1989 



Date of Mailing of IhH International Search Report 



17 JUL 1989 



Intemattonal Searching Authority 

ISA/US 
fonnfiCT/ISAaiO (aacand ahsi^ <Hev.1l^ 



! Signature of Authorlied^fTicer 

Joan Ellis 




MurAattOMl Application No. 



PCT/US 89/014&4 



111. DOCUMENTS CONSIDERED TO BE RELEVANT ICONTINUCO FROM THC SECOND SHEET) 



CaUgtiry * 



Citation ot Document, with tudicntion. where appropriate, of the relevant patu^et | Relwsnt to Claim No 



US, A, 4,563,350 (NATRAM et al)07 January 
1986, see abstract. 

US, A, 4,789,732 (URIST)06 December 1988, 
see abstract. 



7-13 
7-13 



foniiPCIISMW(«dr«ihMq(Rw.11-a) 



This Page is Inserted by IFW Indexing and Scanning 
Operations and is not part of the Official Record 

BEST AVAILABLE IMAGES 

Defective images within tliis document are accurate representations of the original 
documents submitted by the applicant. 

Defects in the images include but are not limited to the items checked: 

□ BLACK BORDERS 

□ IMAGE CUT OFF AT TOP, BOTTOM OR SIDES 
FADED TEXT OR DRAWING 

[^BLURRED OR ILLEGIBLE TEXT OR DRAWING 

□ SKEWED/SLANTED IMAGES 

□ COLOR OR BLACK AND WHITE PHOTOGRAPHS 

□ GRAY SCALE DOCUMENTS 

□ LINES OR MARKS ON ORIGINAL DOCUMENT 

□ REFERENCE(S) OR EXHIBIT(S) SUBMITTED ARE POOR QUALITY 

□ OTHER: 

IMAGES ARE BEST AVAILABLE COPY. 
As rescanning these documents will not correct the image 
problems checked, please do not report these problems to 
the IFW Image Problem Mailbox.