Skip to main content

Full text of "USPTO Patents Application 09804625"

See other formats


per 



WORLD INTELLECTUAL PROPERTY ORGANIZATION 
International Bureau 




INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) 



(51) International Patent Classification 4 : 
C07K 13/00, 15/00, A61K 37/00 
C12P 21/00, 21/02, C12N 15/00 
C07H 15/12 



Al 



(11) International Publication Number: WO 88/ 00205 

(43) International Publication Date: 14 January 1988 (14.01.88) 



(21) International Application Number: PCT/US87/01537 

(22) International Filing Date: 30 June 1987 (30.06.87) 
(31) Priority Application Numbers: 



(32) Priority Dates: 



(33) Priority Country: 



880,776 
943,332 
028,285 
031,346 



1 July 1986(01.07.86) 
17 December 1986 (17.12.86) 
20 March 1987 (20.03.87) 
26 March 1987 (26.03.87) 

US 



(71) Applicant: GENETICS INSTITUTE, INC. [US/US]; 

87 CambridgePark Drive, Cambridge, MA 02140 
(US), 

(72) Inventors: WANG, Elizabeth, A. ; 136 Wolf Rock 

Road, Carlisle, MA 01741 (US). WOZNEY, John, M. 
; 59 Old Bolton Road, Hudson, MA 01749 (US). 
ROSEN, Vicki, A. ; 344 Marlborough Street, Apart- 
ment 4, 



Boston, MA 02116 (US). 

(74) Agents: BAK, Mary, E. et al.; Genetics Institute, Inc., 
87 CambridgePark Drive, Cambridge, MA 02140 
(US). 

(81) Designated States: AT (European patent), AU, BE (Eu- 
ropean patent), BG, BJ (OAPI patent), CF (OAPI pa- 
tent), CG (OAPI patent), CH (European patent), CM 
(OAPI patent), DE (European patent), DK, FI, FR 
(European patent), GA (OAPI patent), GB, GB (Eu- 
ropean patent), HU, IT (European patent), JP, KR, 
LU (European patent), ML (OAPI patent), MR (OA- 
PI patent), NL (European patent), NO, SE (European 
patent), SN (OAPI patent), SU, TD (OAPI patent), 
TG (OAPI patent). 

Published 

With international search report. 
With amended claims. 



(54) Title: NOVEL OSTEOINDUCTIVE COMPOSITIONS 



(57) Abstract 



Human and bovine bone inductive factor products and processes. The factors may be produced by recombinant 
techniques and are useful in the research and treatment of bone and periodontal defects. 



FOR THE PURPOSES OF INFORMATION ONLY 



Codes used to identify States party to the PCT on the front pages of pamphlets publishing international appli- 
cations under the PCT. 



AT 


Austria 


FR 


Trance 


ML 


Mali 


AU 


Australia 


GA 


.Gabon 


MR 


Mauritania 


BB 


Barbados 


GB 


United Kingdom 


MW 


Malawi 


BE 


Belgium 


HU 


Hungary 


NL 


Netherlands 


BG 


Bulgaria 


rr 


Italy 


NO 


Norway 


BJ 


Benin 


jp 


Japan 


RO 


Romania 


BR 


Brazil 


KP 


Democratic People's Republic 


SD 


Sudan 


CF 


Central African Republic 




of Korea 


SE 


Sweden 


CG 


Congo 


KR 


Republic of Korea 


SN 


Senegal 


CH 


Switzerland 


LI 


Liechtenstein 


SU 


Soviet Union 


CM 


Cameroon 


LK 


Sri Lanka 


TD 


Chad 


DE 


Germany, Federal Republic of 


LU 


Luxembourg 


TG 


Togo 


DK 


Denmark 


MC 


Monaco 


US 


United States of America 


n 


Finland 


MG 


Madagascar 







WO 88/002195 



PCT/LS87/01S37 



1 

NOVEL OSTEOINDUCTIVE COMPOSITIONS 

The present invention relates to novel proteins and 
processes for obtaining them. These proteins are capable of 
inducing cartilage and bone formation. 
Background 

Bone is a highly specialized tissue characterized by an 
extensive matrix structure formed of fibrous bundles of the 
protein collagen, and proteoglycans, noncollagenous proteins, 
lipids and acidic proteins. The processes of bone formation 
and : renewal/repair of bone tissue, which occur continuously 
throughout life, are performed by specialized cells. Normal 
embryonic long bone development is preceded by formation of a 
cartilage, model. Bone growth is presumably mediated by 
"osteoblasts" (bone-forming cells) , while remodeling of bone 
is apparently accomplished by the joint activities of 
bone-resorbing cells, called "osteoclasts" and osteoblasts. 
A variety of osteogenic, cartilage-inducing and bone inducing 
factors have been described. See, e.g. European patent 
applications 148,155 and 169,016 for discussions thereof. 

Brief Description of the Invention 

The present invention provides novel proteins in purified 
form. Specifically, four of the novel proteins are designated 
BMP-l, BMF-2 Class I (or BMF-2) , BMP-3 , and BMP-2 Class II (or 
BMP-4) wherein BMP is bone morphogenic protein. These proteins 
are- characterized by peptide sequences the same as or 
substantially homologous to amino acid sequences illustrated 
in Tables II through VIII below. They are capable of inducing 
bone*: formation at a predetermined site. These bone inductive 
factors are further characterized by biochemical and biological 
characteristics including activity at a concentration of 1-0 to 
lOOOng/gram of bone in an in vivo rat bone formation assay 
described below. Proteins of this invention may be encoded by 
the DNA sequences depicted in the Tables or by sequences capable 



WO 88/00205 



PCT/US87/01537 



2 

of hybridizing thereto and coding for polypeptides with bone 
growth factor biological properties or other variously modified 
sequences demonstrating such properties. 

One of the proteins of the invention is designated BMP- 

I. A portion of the human BMP-1 or hBMP-1 is characterized 
by the same or substantially the same peptide sequence as 
that of amino acid #1 through amino acid #37 of Table V, 
below which represents a genomic hBMP-1 fragment or amino 
acid #1 through amino acid #730 of Table VI which represents 
the= hBMP-1 cDNA. hBMP-1 or a related bone inductive factor 
may; be further characterized by at least a portion of these 
sequences. These peptide sequences are encoded by the same 
or: substantially the same DNA sequence , as depicted in 
nucleotide #3440 through nucleotide #3550 of Table V and in 
nucleotide #36 through nucleotide #2225 of Table VI, 
respectively. These hBMP-1 polypeptides are further 
characterized by the ability to induce bone formation. hBMP- 
1 demonstrates activity in an in vivo rat bone formation 
assay at a concentration of 10 to lOOOng/gram of bone. 

The homologous bovine growth factor of the invention, 
designated bBMP-1, is characterized by a peptide sequence 
containing the same or substantially the same sequence as that 
of amino acid #1 through amino acid #37 of Table II below which 
represents a genomic bBMP-1 fragment. This peptide sequence 
is encoded by the same or substantially the same* DNA sequence 
as depicted in nucleotide #294 through nucleotide #404 of Table 

II. The bovine peptide sequence identified in Table II below 
is also 3 7 amino acids in length. bBMP-1 is further 
characterized by the ability to induce bone formation. 

Another bone inductive protein composition of the invention 
is designated BMP-2 Class I (or BMP-2). It is characterized by 
at least a portion of a peptide sequence the same or 
substantially the same as that of amino acid #1 through amino 
acid #396 of Table VII which represents the cDNA hBMP-2 Class 
I. This peptide sequence is -encoded by the same or 



WO 88/00205 



PCT/LS87/01537 



3 

substantially the same DNA sequence, as depicted in nucleotide 
#356. through nucleotide #1543 of Table VII. The human peptide 
sequence identified in Table VII is 396 amino acids in length. 
hBMP>2 or related bone inductive proteins may also be 
characterized by at least a portion of this peptide sequence. 
hBMP-2 Class I is further characterized by the ability to 
induce bone formation. 

The homologous bovine bone inductive protein of the 
invention designated bBMP-2 Class I (or bBMP-2) , has a DNA 
sequence identified, in Table III below which represents the 
genomic sequence. This bovine DNA sequence has a prospective 
129 amino acid* coding sequence followed by approximately 205 
nucleotides (a presumptive 3' non-coding sequence). bBMP-2, 
Class I is further characterized by the ability to induce 
bone formation. A further bone inductive protein composition 

of the invention is designated BMP-2 Class II or BMP-4. The 
human protein hBMP-2 Class II (or hBMP-4) is characterized by 
at least a portion of the same or substantially the same peptide 
sequence between amino acid #1 through amino acid #408 of Table 
VIII, which represents the cDNA of hBMP-2 Class II. This 
peptide sequence is encoded by at least a portion of the same 
or substantially the same DNA sequence as depicted in nucleotide 
#403 through nucleotide #1626 of Table VIII. This factor is 
further characterized by the ability to induce bone formation. 

Still another bone inductive factor of the invention, 
BMP-3, is represented by the bovine homolog bBMP-3 . bBMP-3 is 
characterized by the DNA sequence and amino acid sequence of 
Table IV A and B which represents the bovine genomic sequence. 
It is characterized by at least a portion of a peptide sequence 
the same or substantially the same as amino acid #1 through 
amino acid #175 of Table IV A and B. BMP-3 is further 
characterized by the ability to induce bone formation. The 
bovine factor may be employed as a tool for obtaining the 
analogous human BMP-3 protein or other mammalian bone inductive 
proteins. The proper characterization of this bovine bone 



WO88/00205 



PCT/US87/01537 



4 

inductive factor provides the essential "starting point" for 
the. method employing this sequence. The method, employing 
techniques known to those skilled in the art of genetic 
engineering, involves using the bovine DNA sequence as a probe 
to screen a human genomic or cDNA library; and identifying the 
DNA sequences which hybridize to the probes. A clone with a 
hybridizable sequence is plaque purified and the DNA isolated 
therefrom, subcloned and subjected to DNA sequence analysis. 
Thus, as another aspect of this invention is a human protein 
hBMF-3, produced by this method. 

Another aspect of the invention provides pharmaceutical 
compositions containing a therapeutically effective amount of 
one: or more bone growth factor polypeptides according to the 
invention in a pharmaceutical^ acceptable vehicle. These 
compositions may further include other therapeutically useful 
agents. They may also include an appropriate matrix for 
delivering the proteins to the site of the bone defect and for * 
providing a structure for bone growth. These compositions may 
be employed in methods for treating a number of bone defects 
and periodontal disease. These methods, according to the 
invention, entail administering to a patient needing such bone 
formation an effective amount of at least one of the novel 
proteins BMP-1, BMP-2 Class I, BMP-2 Class-II, and BMP- 3 as 
described herein. 

Still a further aspect of the invention are DNA sequences 
coding on expression for a human or bovine polypeptide having 
the ability to induce bone formation. Such sequences include 
the sequence of nucleotides in a 5 1 to 3 1 direction illustrated 
in Tables II through VIII. Alternatively, a DNA sequence which 
hybridizes under stringent conditions with the DNA sequences 
of Tables II - VIII or a DNA sequence which hybridizes under 
non-stringent conditions with the illustrated DNA sequences and 
which codes on expression for a protein having at least one 
bone growth factor biological property are included in the 
present invention. Finally, allelic or other variations of the 



WO 88/00205 



PCT/US87/01S37 



5 

sequences of Tables II through VIII, whether such nucleotide 
changes result in changes in the peptide sequence or not, are 
also included in the present invention. 

Still a further aspect of the invention is a vector 
containing a DNA sequence as described above in operative 
association with an expression control sequence. Such vector 
may be employed in a novel process for producing a bone 
growth factor polypeptide in which a cell line transformed 
with a DNA sequence encoding expression of a bone growth 
factor polypeptide in operative association with an expression 
control sequence therefor, is cultured. This claimed process 
may employ a number of known cells as host cells for expression 
of the polypeptide. Presently preferred cell lines are 
mammalian cell lines and bacterial cells. 

Other aspects and advantages of the present invention will 
be apparent upon consideration of the following detailed 
description and preferred 'embodiments thereof. 
Detailed Description of the Invention 

The proteins of the present invention are characterized 
by amino acid sequences or portions thereof the same as or 
substantially homologous to the sequences shown in Tables II 
- VIII below. These proteins are also characterized by the 
ability to induce bone formation. 

The bone growth factors provided herein also include 
factors encoded by the sequences similar to those of Tables 
II - VIII, but into which modifications are naturally provided 
(e.g. allelic variations in the nucleotide sequence which may 
result in amino acid changes in the polypeptide) or deliberately 
engineered. For example, synthetic polypeptides may wholly or 
partially duplicate continuous sequences of the amino acid 
residues of Tables II - VIII. These sequences, by virtue of 
sharing primary, secondary, or tertiary structural and 
conformational characteristics with bone growth factor 
polypeptides of Tables II - VIII may possess bone growt-h factor 
biological properties in common therewith. Thus, they may be 



WO 88/00205: 



PCT/US87/01S37 



6 

employed as biologically active substitutes for naturally- 
occurxing bone growth factor polypeptides in therapeutic 
processes. 

Other specific mutations of the sequences of the bone 
growth' factors described herein involve modifications of one 
or both of the glycosylation sites. The absence of 
glycosylation or only partial glycosylation results from 
amino, acid substitution or deletion at one or both of the 
aspara^ine-IinJced glycosylation recognition sites present in 
the ^ sequences of the bone -growth f actors shown in Tables II- 
VIIIV The asparagine-linked glycosylation recognition sites 
comprise, tripeptide sequences which are specifically recognized 
by appropria&e cellular glycosylation enzymes. These tripeptide 
sequences: are either asparagine-X-threonine or asparagine-X- 
serine-, where X is usually any amino acid. A variety of 
amino acid substitutions or deletions at one or both of the 
first or third amino acid positions of a glycosylation 
recognition site (and/or amino acid deletion at the second 
position) results in non-glycosylation at the modified 
tripeptide sequence. 

The present invention also encompasses the novel DNA 
sequences, free of association with DNA sequences encoding other 
proteinaceocirs materials , and coding on expression for bone 
growth factors. These DNA sequences include those depicted in 
Tables II - VIII in a 5 1 to 3 1 direction and those sequences 
which:.hybridize under stringent hybridization conditions [see, 
T. Maniatis et al. Molecular Cloning *(A Laboratory Manual) , 
Cold. Spring Harbor Laboratory (1982), pages 387 to 389] to the 
DNA .sequences of Tables II - VIII. 

DNA sequences which hybridize to the sequences of Tables 
II --VIII under relaxed hybridization conditions and which 
code on expression for bone growth factors having bone growth 
factor biological properties also encode bone growth factors 
of the invention. For example, a DNA sequence which shares 
regions of significant homology, e.g., sites of glycosylation 



WO 88/00205 



PCT/LS87/01537 



7 

or disulfide linkages, with the sequences of Tables II - VIII 
and encodes a bone growth factor having one or more bone 
growth factor biological properties clearly encodes a member 
of this novel family of growth factors, even if such a DNA 
sequence would not stringently hybridize to the sequence of 
Tables II - VIII. 

Similarly, DNA sequences which code for bone growth factor 
polypeptides coded for by the sequences of Tables II - VIII, 
but which differ in codon sequence due to the degeneracies of 
the genetic code or allelic variations (naturally-occurring base 
changes in the species population which may or may not result 
in> an amino acid change) also encode the novel growth factors 
described herein. Variations in the DNA sequences of Tables 
II -VIII which are caused by point mutations or by induced 
modifications to enhance the activity, half-life or production 
of the polypeptides encoded thereby are also encompassed in the 
invention. , * 

Another aspect of the present invention provides a novel 
method for producing the novel osteoinductive factors. The 
method of the present invention involves culturing a suitable 
cell or cell line, which has been transformed with a DNA 
sequence coding on expression for a novel bone growth factor 
polypeptide of the invention, under the control of known 
regulatory sequences. Suitable cells or cell lines may be 
mammalian cells, such as Chinese hamster ovary cells (CHO) . 
The selection of suitable mammalian host cells and methods for 
transformation, culture, amplification, screening and product 
production and purification are known in the art. See, e.g., 
Gething and Sambrook, Nature, 293_:620-625 (1981), or 
alternatively, Kaufman et al, Mol. Cell. Biol. . 5(7) : 1750-1759 
(1985) or Howley et al, U.S. Patent 4,419,446. Another suitable 
mammalian cell line, which is described in the accompanying 
examples, is the monkey COS-1 cell line. A similarly useful 
mammalian cell line is the CV-1 cell line. 

Bacterial cells are suitable hosts. For example, the 



WO 88/00205 



PCT/US87/01537 



8 

various strains of E. coli (e.g., HB101, MC1061) are well-known 
as :hbst cells; in the field of biotechnology. Various strains 
of B? subtil is . Pseudomonas . other bacilli and the like may also 
be -employed in. this method. 

Many strains of yeast cells known to those skilled in the 
art", are also available as host cells for expression of the 
polypeptides of the present invention. Additionally, where 
desired f insect cells may be utilized as host cells in the 
method of the. present invention. See, e.g. Miller et al, 
G€ne t i c Elroine erina . 8: 277-298 (Plenum Press 1986) and 
references cited, therein. 

Another, aspect of the present invention provides vectors 
fdrr use in. fch.e method of expression of these novel 
osteoinductive: polypeptides. Preferably the vectors contain 
the full, novel DNA sequences described above which code for 
the novel' factors of the invention. Additionally the vectors 
also contain appropriate expression control sequences permitting 
expression of the bone inductive protein sequences. 
Alternatively, vectors incorporating modified sequences as 
described above- are also embodiments of the present invention 
andvuseful in the production of the bone inductive proteins. 
The vectors may he employed in the method of transforming 
cell llines and 5 contain selected regulatory sequences in 
operative association with the DNA coding sequences of the 
invention which are capable of directing the replication and 
expression thereof in selected host cells. Useful regulatory 
sequences for such vectors are known to one of skill in the 
art and may be selected depending upon the selected host 
cells. Such selection is routine and does not form part of 
the present invention. 

A protein of the present invention, which induces bone 
growth/. in circumstances where bone is not normally formed, has 
application in the healing of bone fractures. An osteogenic 
preparation employing one or more of the proteins of the 
invention may have prophylactic use in closed as well as open 



WO 88/00205 



PCT/LS87/01537 



9 

fracture reduction and also in the improved fixation of 
artificial joints, De novo bone formation induced by an 
osteogenic agent contributes to the repair of congenital, 
trauma induced, or oncologic resection induced craniofacial 
defects, and also is useful in cosmetic plastic surgery. An 
osteogenic factor of the invention may be valuable in the 
treatment of periodontal disease, and in other tooth repair 
processes. Such agents may provide an environment to attract 
bone-forming cells, stimulate growth of bone-forming cells or 
induce differentiation of progenitors of bone-forming cells. 
Of .course, the proteins of the invention may have other 
therapeutic uses, 

A further aspect of the invention is a therapeutic method 
and composition for repairing fractures and other conditions 
related to bone defects or periodontal diseases. Such a 
composition comprises a therapeutically effective amount of at 
least one of the bone inductive factor proteins of the 
invention. The bone inductive factors according to the 
present invention may be present in a therapeutic composition 
in -admixture with a pharmaceutical^ acceptable vehicle or 
matrix. Further therapeutic methods and compositions of the 
invention, comprise a therapeutic amount of a bone inductive 
factor of the invention with a therapeutic amount of at least 
one of the other bone inductive factors of the invention. 
Additionally, the proteins according to the present invention 
or a combination of the proteins of the present invention may 
be co-administered with one or more different osteoinductive 
factors with which it may interact. Further, the bone inductive 
proteins may be combined with other agents beneficial to the 
treatment of the bone defect in question. Such agents include, 
but are not limited to various growth factors. The preparation 
of such physiologically acceptable protein compositions, 
having due regard to pH, isotonicity, stability and the like, 
is within the skill of the art. 

In particular, BMP-1 may be used individually in a 



WO 88/00205 



PCT/US87/01S37 



10 

composition. BMP-1 may also be used in combination with 
one: or more of the other proteins of the invention. BMP-1 
and. BMF-2 Class I may be used in combination. BMP-1 and BMP- 
2 Class II may also be used in combination. BMP-1 and BMP-3 
may be used in combination. Furthermore, BMP-1 may be used 
in combination with two or three of the other proteins of the 
invention. For example, BMP-1, BMP-2 Class I, and BMP-2 
Class II may be combined. BMP-1 may also be combined with 
BMP-2 Class I, and BMP-3. Further, BMP-1 may be combined 
witli BMP-2 Class II, and BMP-3. BMP-1, BMP-2 Class I, BMP-2 
Class II,. and BMP-3 may be combined. 

BMP-2 Class I may be used individually in a pharmaceutical 
composition. BMP-2 Class I may also be used in combination 
with one or more of the other proteins of the invention. 
BMP-2 Class I may be combined with BMP-2 Class II. It may 
also be combined with BMP-3. Further BMP-2 Class I may be 
combined with BMP-2 Class II.- and BMP-3. 

BMP-2 Class II may be used individually in pharmaceutical 
composition. In addition, it may be used in combination with 
other proteins as identified above. Further it may be used in 
combination with BMP-3 . 

BMP-3 may be used individually in a composition. It may 
further be used in the various combinations identified above. 

The therapeutic method includes locally administering the 
composition as an implant or device. When administered, the 
therapeutic composition for use in this invention is, of course, 
in a pyrogen-free, physiologically acceptable form. Further, 
the composition may desirably be encapsulated or injected in 
a viscous form for delivery to the site of bone damage. 
Preferably, the bone growth inductive factor composition 
would include a matrix capable of delivering the bone inductive 
factor to the site of bone damage, providing a structure for 
the developing bone and cartilage and optimally capable of 
being resorbed into the body. Such matrices may be formed of 
other materials presently in use for other implanted medical 



WO 88/00205 



PCT/LS87/01537 



11 

applications. 

The choice of material is based on, for example, 
biocompatibility, biodegraciability, mechanical properties, 
cosmetic appearance and interface properties. Similarly, the 
application of the osteoinductive factors will define the 
appropriate formulation. Potential matrices for the 
osteoinductive factors may be biodegradable and chemically 
defined,, such as, but not limited to calcium sulfate, 
tricalciumphosphate , hydroxyapat ite , poly lactic acid, 
polyanhydrides ; biodegradable and biologically well defined, 
such, as' bone or dermal collagen, other pure proteins or 
extracellular matrix components; nonbiodegradable and chemically 
defined, such as sintered hydroxyapat ite, bioglass, aluminates, 
or other ceramics; or combinations of any of the above mentioned 
types of material, such as polylactic acid and hydroxyapatite 
or collagen and tricalciumphosphate. The bioceramics might 
also be altered in composition, such as in calcium-aluminate- 
phosphate and processing to - alter for example, pore size, 
particle size, particle shape, and biodegradability . 

The dosage regimen will be determined by the attending 
physician considering various factors which modify the action 
of such a growth factor, e.g. amount of bone weight desired to 
be formed, the site of bone damage, the condition of the damaged 
bone, the patient 1 s age, sex, and diet, the severity of any 
infection, time of administration and other clinical factors. 
The dosage may vary with the type of matrix used in the 
reconstitution and the composition of BMP's. The addition of 
other known growth factors, such as XGF 1 (insulin like growth 
factor 1) , to the final composition, may also effect the dosage. 
Generally, the dosage regimen should be in the range of 
approximately 10 to 10 6 nanograms of protein per gram of bone 
weight desired. Progress can be monitored by periodic 
assessment of bone growth and/or repair, e.g. x-rays. Such 
therapeutic compositions are also presently valuable for 
veterinary applications due to the lack of species specificity 



WO 88/00205 



PCT/US87/0IS37 



12 

in bone inductive factors. Particularly domestic animals and 
thoroughbred horses in addition to humans are desired patients 
for such treatment with the bone inductive factors of the 
present invention. 

The following examples illustrate practice of the present 
invention in recovering and characterizing the bovine proteins 
and employing them to recover the human proteins, obtaining the 
human proteins and in expressing the proteins via recombinant 
techniques • 

EXAMPLE I 

Isolation of Bovine Bone Inductive Factor 

Ground bovine bone powder (2 0-120 mesh, Helitrex) is 
prepared according to the procedures of M. R. Urist et al., 
Proc. Natl Acad. Sci USA , 70:3511 (1973) with elimination of 
some extraction steps as identified below. Ten kgs of the 
ground powder is demineralized in successive changes of 0.6N 
HC1 at 4°C over a 48 hour period with vigorous stirring. The 
resulting suspension is extracted for 16 hours at 4°C with 50 
liters of 2M CaCl 2 and lOmM ethylenediamine-tetraacetic acid 
QEDTA] ? and followed by extraction for 4 hours in 50 liters of 
0.5M EDTA. The residue is washed three times with distilled 
water before its resuspension in 20 liters of 4M guanidine 
hydrochloride [GuCl], 20mM Tris (pH7.4), ImM N-ethylmaleimide, 
ImM iodoacetamide, ImM phenylmethylsulf onyl • fluorine as 
described in Clin. Orthop. Rel. Res. . 171: 213 (1962) . 
After 16 to 20 hours the supernatant is removed and replaced 
with another 10 liters of GuCl buffer. The residue is extracted 
for another 24 hours. 

The crude GuCl extracts are combined, concentrated 
approximately 20 times on a Pellicon apparatus with a 10,000 
molecular weight cut-off membrane, and then dialyzed in 50mM 
Tris, 0.1M NaCl, 6M urea (pH7.2), the starting buffer for the 
first column. After extensive dialysis the protein is loaded 
on a 4 liter DEAE cellulose column and the unbound fractions 



WO 88/00205 



PCT/LS87/01537 



13 

are collected. 

The unbound fractions are concentrated and dialyzed against 
50mM NaAc, 50mM NaCl (pH 4.6) in 6M urea. The unbound fractions 
are applied to a carboxymethyl cellulose column. Protein not 
bound to the column is removed by extensive washing with 
starting buffer, and the bone inductive factor containing 
material desorbed from the column by 50mM NaAc, 0.25mM NaCl, 
6M urea (pH 4.6). The protein from this step elution is con- 
centrated 20- to 40- fold, then diluted 5 times with 80mM 
KPO4, 6M urea (pH6.0). The pH of the solution is adjusted to 
6\0 with 500mM K 2 HP0 4 . The sample is applied to an 
hydroxylapatite column (LKB) equilibrated in 80mM KP0 4 , 6M 
urea (pH6.0) and all unbound protein is removed by washing 
the column with the same buffer. Bone inductive factor 
activity is eluted with lOOroM KP0 4 (pH7.4) and 6M urea. 

The protein is concentrated approximately 10 times, and 
solid NaCl added to a final concentration of 0.15M. This 
material is applied to a heparin - Sepharose column equilibrated 
in 50mM KP0 4 , 150mM NaCl, 6M urea (pH7.4). After extensive 
washing of the column with starting buffer, a protein with bone 
inductive factor activity is eluted by 50mM KP0 4 , 700mM NaCl, 
6M urea (pH7.4). This fraction is concentrated to a minimum 
volume, and 0.4ml aliquots are applied to Superose 6 and 
Superose 12 columns connected in series, equilibrated with 4M 
GuCl, 20mM Tris (pH7.2) and the columns developed at a flow 
rate of 0.25ml/min. The protein demonstrating bone inductive 
factor activity has a relative migration corresponding to 
approximately 30,000 dalton protein. 

The above fractions are pooled, dialyzed against 50xoM NaAc, 
6M urea (pH4.6), and applied to a Pharmacia -MonoS HR column. 
The column is developed with a gradient to 1.0M NaCl, 50mM 
NaAc, 6M urea (pH4.6) . Active fractions are pooled and brought 
to pH3.0 with 10% trifluoroacetic acid (TFA) . The material is 
applied to a 0.46 x 25cm Vydac C4 column in 0.1% TFA and the 
column developed with a gradient to 90% acetonitrile, 0.1% TFA 



WO 88/00205 



PCT/US87/01537 



14 

(31.5% acetonitrile, 0.1% TFA to 49.5% acetonitrile, 0.1% TFA 
in 60 minutes at 1ml per minute). Active material is eluted 
at - approximately 40-44% acetonitrile. Aliquots of the appro- 
priate fractions are iodinated by one of the following methods: 
F. J. McConahey et al, Int. Arch. Allergy , 29:185-189 (1966); 
A. E. Bolton et al, Biochem J . . 133:529 (1973); and D. F. 
Boven-Pope. J. Biol. Chem. . 237:5161 (1982). The iodinated 
proteins present in these fractions are analyzed by SDS gel 
electrophoresis and urea Triton X 100 isoelectric focusing. 
At. this stage, the bone inductive factor is estimated to be 
approximately 10-50% pure. 

EXAMPLE II 

Characterization of Bovine Bone Inductive Factor 
A, Molecular Weight 

Approximately 20ug protein from Example I is lyophilized 
and redissolved in "IX SDS sample buffer. After 15 minutes of 
heating at 37 °C, the sample is applied to a 15% SDS 
polyacrylamide gel and then electrophoresed with cooling. The 
molecular weight is determined relative to prestained molecular 
weight standards (Bethesda Research Labs) . Immediately after 
completion, the gel lane containing bone inductive factor is 
sliced into 0.3cm pieces. Each piece is mashed and 1.4ml of 
0.1% SDS is added. The samples are shaken gently overnight at 
room temperature to elute the protein. Each gel slice is 
desalted to prevent interference in the biological assay. The 
supernatant from each sample is acidified to pH 3.0 with 10% 
TFA, filtered through a 0.45 micron membrane and loaded on a 
0.46cm x: 5cm C4 Vydac column developed with a gradient of 0.1% 
TFA to 0.1% TFA, 90% CH 3 CN. The appropriate bone inductive 
factor - containing fractions are pooled and reconstituted with 
20mg rat matrix. In this gel system, the majority of bone 
inductive factor fractions have the mobility of a protein 
having a molecular weight of approximately 28,000 - 3O,0t)0 
daltons . 



WO 88/00205 



PCT/US87/01537 



15 

B. Isoelectric Focusing 

The isoelectric point of bone inductive factor activity 
is determined in a denaturing isoelectric focusing system. The 
Triton X100 urea gel system (Hoeffer Scientific) is modified 
as follows: 1) 40% of the ampholytes used are Servalyte 
3/10; 60% are Servalyte 7-9. 2) The catholyte used is 40mM 
NaOH. Approximately 20ug of protein from Example I is 
lyophilized, dissolved in sample buffer and applied to the 
isoelectrofocusing gel. The gel is run at 20 watts, 10 8 C for 
approximately 3 hours. At completion the lane containing 
bone inductive factor is sliced into 0.5 cm slices. Each 
piece is mashed in 1.0ml 6M urea, 5mM Tris (pH 7.8) and the 
samples agitated at room temperature. The samples are 
acidified, filtered, desalted and assayed as described above. 
The major portion of activity as determined in the assay 
described in Example III migrates in a manner consistent with 
a pi of 8.8 - 9.2. 

C. Subunit Characterization 

The subunit composition of bone inductive factor is also 
determined. Pure bone inductive factor is isolated from a 
preparative 15% SDS gel as described above. A portion of the 
sample is then reduced with 5mM DTT in sample buffer and 
re-electrophoresed on a 15% SDS gel. The approximately 30kd 
protein yields two major bands at approximately 20kd and 18kd, 
as well as a minor band at 30kd. The broadness of the two 
bands indicates heterogeneity caused most probably by 
glycosylat ion , other post translational modification, 
proteolytic degradation or carbamylation. 

EXAMPLE III 

Biological Activity of Bone Inductive Factor 

A rat bone formation assay according to the general 
procedure of Sampath and Reddi, Proc. Natl. Acad. Sci. U.S.A. . 



WO 88/00205 



PCT/US87/01S37 



16 

80:6591-6595. (1983). is used to evaluate the osteogenic activity 
of :the bovine- bone inductive factor of the present invention 
obtained in Example I* This assay can also be used to evaluate 
bonei inductive factors of other species. The ethanol 
precipitation step is replaced by dialyzing the fraction to be 
assayed against water. The solution or suspension is then 
redissolved in. a volatile solvent, e.g. 0.1 - 0.2 % TFA, and 
the resulting: solution added to 20mg of rat matrix. This 
material is- frozen and lyophilized and the resulting powder 
enclosed im #5: gelatin capsules. The capsules are implanted 
subcutaneou&lyr in the abdominal thoracic area of 21 - 49 day 
old male long" Evans rats. The implants are removed after 7 - 
14 days. Half; of each implant is used for alkaline phosphatase 
analysis [See, A. H. Reddi et al., Proc. Natl Acad Sci. , 69:1601 
(1972)] and half is fixed and processed for histological 
analysis. Routinely, lum glycolmethacrylate sections are 
stained with Von Kossa and acid fuschin to detect new bone 
mineral. Alkaline phosphatase, an enzyme produced by 
chondroblasts and osteoblasts in the process of matrix 
formation, is*- also measured . New cartilage and bone formation 
often correlates- with alkaline phosphatase levels. Table I 
below illustrates the dose response of the rat matrix samples 
including a control not treated with bone inductive factor. 

TABLE 1 

Protein* 

Implanted ucr Cartilage Alk. Fhos.u/1 

7.5 2 Not done 

2-5 3 445.7 

0.83 3 77.4 

0.28 0 32.5 

0.00 0 31.0 

*At this stage the bone inductive factor is approximately 
10-15% pure. 

The bone or cartilage formed is physically confined to 
the space occupied by the matrix. Samples are also analyzed 
by SDS gel electrophoresis and isoelectric focusing as described 



WO 88/00205 



PCT/LS87/01537 



17 

'above-., followed by autoradiography. Analysis reveals a 
correlation of activity with protein bands at 28 - 30kd and a 
pi 9.0. An extinction coefficient of 1 OD/mg-cm is used as an 
estimate for protein and approximating the purity of bone 
inductive factor in a particular fraction. In the in vivo rat 
bone formation assays on dilutions as described above, the 
protein is active in vivo at 10 to 20Ong protein/ gram bone to 
probably greater than lug protein/gram bone. 

EXAMPLE IV 

Bovine Bone Inductive Factor Protein Composition 

The protein composition of Example IIA of molecular 
weight 28 - 3 0kd is reduced as described in Example IIC and 
digested with trypsin. Eight tryptic fragments are isolated 
by standard procedures having the following amino acid 
sequences: 

Fragment 1 : AAFLGDIALDEEDLG 

Fragment 2: AFQVQQAADL 

Fragment 3: NYQDMVVEG 

Fragment 4:STPAQDVSR 

Fragment 5: N Q E A L R 

Fragment 6: LSEPDPSHTLEE 

Fragment 7: F D A Y Y 

Fragment 8: LKPSN7ATIQSIVE 

A less highly purified preparation of protein from 
bovine bone is prepared according to a purification scheme 
similar to that described in Example I. The purification 
basically varies from that previously described by omission 
of the DE-52 column, the CM cellulose column and the mono S 
column, as well as a reversal in the order of the 
hydroxy 1 apatite and heparin sepharose columns. Briefly, the 
concentrted crude 4 M extract is brought to 85% final 
concentration of ethanol at 4 degrees. The mixture is then 
centrifuged, and the precipitate redissolved in SO mM Tris, 
0.15 M NaCl, 6.0 M urea. This material is then fractionated 
on Heparin Sepharose as described. The Heparin bound material 



WO 88/00205 



PCT/US87/01S37 



18 

is fractionated on hydroxyapatite as described. The active 
fractions are pooled, concentrated, and fractionated on a 
high: resolution gel filtration (TSK 30000 in 6 M guanidinium 
chloride, 50 mM Tris, pH 7.2). The active fractions are 
pooled, dialyzed against 0.1% TFA, and then fractionated on a 
C4 Vydac reverse phase column as described. The preparation 
is reduced and electrophoresed on an acrylamide gel. The 
protein corresponding to the 18K band is eluted and digested 
with trypsin. Tryptic fragments are isolated having the 
following amino acid sequences: 
Fragment 9: SLKPSNHATIQS?V 
Fragment 10:SFDAYYCS?A 
Fragment 11: VYPNMTVESCA 
Fragment 12: V D F A D I ? W 

Tryptic Fragments 7 and 8 are noted to be substantially 
the same as Fragments 10 and 9, respectively. 
A. bBMP-1 

Probes consisting of pools of oligonucleotides (or unique 
oligonucleotides) are designed according to the method of R. 
Lathe, J. Hoi, Biol ., 183 (1):1-12 (1985) and synthesized on 
an. automated ONA synthesizer. One probe consists of a 
relatively long (32 nucleotides) "guessmer" [See J. J. Toole 
et al, Nature, 312:342-347 (1984)] of the following nucleotide 
sequence: 

TCCTCATCCAGGGCAATGTCGCCCAGGAAGGC 

Because the genetic code is degenerate (more than one 
codon can code for the same amino acid), the number of oligo- 
nucleotides in a probe pool is reduced based on the frequency 
of codon usage in eukaryotes, the relative stability of G:T 
base pairs, and the relative infrequency of the dinucleotide 
CpG in eukaryotic coding sequences [see Toole et al., supra.]. 
The second set of probes consists of shorter oligonucleotides 
(17 nucleotides in length) which contain all possible sequences 
that could encode the amino acids. The second set of probes 
has the following sequences: 



WO 88/00205 



PCT/US87/01S37 



19 

(a) A [A/G] [A/G] TC [T/C] TC [T/C] TC [A/G] TC [T/C] AA 

(b) A [A/G] [A/G] TC [T/C] TC [T/C] TC [A/G] TCNAG 
Bracketed nucleotides are alternatives. "N" means either A, 
T, C or G. 

In both cases the regions of the amino acid sequence used 
for probe design are chosen by avoiding highly degenerate 
codons where possible. The oligonucleotides are synthesized 
on an automated DNA synthesizer; the probes are then radio- 
actively labeled with polynucleotide kinase and 32 P-ATP. 

These two sets of probes are used to screen a bovine 
genomic recombinant library. The library is constructed as 
follows: Bovine liver DNA is partially digested with the 
restriction endonuclease enzyme Sau 3A and sedimented through 
a sucrose gradient. Size fractionated DNA in the range of 
15-3 Okb is then ligated to the bacteriophage Bam HI vector EMBL3 
[Frischauf et al. J. Mol. Biol. , 170:827-842 (1983)]. The 
library is plated at 8000 recombinants per plate. Duplicate 
nitrocellulose replicas of the plagues are made and amplified 
according to a modification of the procedure of Woo et al, 
Proc. Natl. Acad. Sci. USA , 75:3688-91 (1978). 

The 3 2 mer probe is kinased with ^^P-gamma-ATP and 
hybridized to one set of filters in 5X SSC, 0.1% SDS, SX 
Denhardts, lOOug/ml salmon sperm DNA at 45 degrees C and washed 
with 5X SSC, 0.1% SDS at 45 degrees C. The 17 mer probes are 
kinased and hybridized to the other set of filters in 3M 
tetramethylammonium chloride (TMAC) , 0.1M sodium phosphate 
pH6.5, ImM EDTA, 5X Denhardts, 0.6% SDS, lOOug/ml salmon sperm 
DNA at 48 degrees C, and washed in 3M TMAC, 50mM Tris pH8.0 at 
50 degrees C. These conditions minimize the detection of 
mismatches to the 17 mer probe pool [see, Wood et al, Proc. 
Natl. Acad. Sci. U.S.A., 82:1585-1588 (1985)]. 400,000 
recombinants are screened by this procedure and one duplicate 
positive is plaque purified. DNA is isolated from a plate 
lysate of this recombinant bacteriophage designated lambda bP- 
50. bP-50 was deposited December 16, 198€ with the American 



WO 88/00205 



PCT/US87/01537 



20 

Type Culture Collection, 123 01 Parklawn Drive, Rockville, 
Maryland USA, (hereinafter the "ATCC") under accession number 
40295, This deposit as well as the other deposits contained 
herein meets the requirements of the Budapest Treaty on the 
International Recognition of the Deposit of Microorganisms for 
the Purposes of Patent Procedure and Regulations thereunder. 
This bp-50 clone encodes at least a portion of the bovine bone 
growth factor designated bBMP-1. 

The= oligonucleotide hybridizing region of this bBMP-1 clone 
is £ localized to an approximately 8 00bp Eco RI fragment which 
is. - subcloned into M13 and sequenced by standard techniques. 
The .partial DNA sequence and derived amino acid sequence of 
lambda bE-50 are shown below in Table II. The amino acid 
sequences corresponding to the tryptic fragments isolated 
from the bovine bone 28 to 30kd material are underlined in 
Table II. The first underlined portion of the sequence 
corresponds to^ tryptic Fragment 1 above from which the 
oligonucleotide probes are designed. The second underlined 
portion corresponds to tryptic Fragment 2 above. The predicted 
amino acid sequence indicates that tryptic Fragment 2 is 
preceded by a basic residue (R) as expected considering the 
specificity af trypsin. The nucleic acid sequence preceding 
the couplet CF at nucleotide positions #292-293 in Table II 
is.. presumed to be an intron (noncoding sequence) based on the 
presence of a consensus acceptor sequence (i.e., a pyrimidine 
rich tract, TCTCTCTCC, followed by AG) and the lack of a 
basic residue in the appropriate position of the derived 
amino acid sequence. This bBMP-1 genomic sequence appears in 
Table II. The presumptive bBMP-1 peptide sequence from this 
genomic clone is 37 amino acids in length and is encoded by 
the DNA sequence from nucleotide #294 through #404 in Table II. 



WO 88/00205 



PCT/US87/01537 



21 



TABLE II 

280 290 • (1) 308 323 

CCTIGCCTCT TCTCTCTOCA GCT GCC TIC CTT GGG GAC ATC GOC CIG GAC GAG GAG 

Ala Rie Leu Glv Asp lie Ala Leu Asp Glu Glu 

338 353 368 

GAC TIG AGG GCC TIC CAA GIG CAG CAG GCT GCG GAC CTC AGA CAG CGT GCA ACC 
Asp Leu Arg Ala Hie Gin Val Gin Gin Ala Ala Asp Leu Arg Glu Arg Ala Thr 

383. 398 (37) 414 424 

CGC'AGG TCT TCC ATC AAA GCT GCA GGTACACTGG GTACAGGCCA 
Arg Arg Ser Ser lie Lys Ala Ala 



WO 88/00205 



PCT/US87/01537 



22 

K - bBMP-2 

Two probes consisting of pools of oligonucleotides are 
designed on the basis of the amino acid sequence of Fragment 
3.: and synthesized on an automated DNA synthesizer as described 
above. 

Probe #1: ACNACCAT [A/G] T C [T/C] T G £A/G] AT 
Probe #2: C A [A/G] G A [T/C] A T G G T N G T N G A 
Thesis probes are radioactively labeled and employed to screen 
theibovineb genomic librae constructed as described in part A 
except that the vector is lambda Jl Bam HI arms [Mullins et al 
Mature 32£: 856-858 (1984) .] The radioactively labelled 17-mer 
Probe #1. is hybridized to the set of filters according to the 
method for the 17 mer probe described in part A. 

4 00,000 recombinants are screened by the procedure 
described above in Part A. One duplicate positive is plaque 
purified and the DNA is isolated from a plate lysate of the 
recombinant bacteriophage designated lambda bP-21.' 
Bacteriophage bP-21 was deposited with the ATCC under accession 
number ATCC 40310 on March 6, 1987. The bP-21 clone encodes 
the- bovine growth factor designated bBMP-2. 

The oligonucleotide hybridizing region' of this bBMP-2 
clbne^ is: localized to an approximately 1,2 Jcb Sac I restriction 
fragment which is subcloned into M13 and sequenced by standard 
techniques. The partial DNA sequence and derived amino acid 
sequence of this Sac I fragment and the contiguous Hind III- 
Sac I restriction fragment of bP-21 are shown below in Table 
III. The bBMP-2 peptide sequence from this clone is 129 amino 
acids, in length and is encoded by the DNA sequence from 
nucleotide #1 through nucleotide #387. The amino acid sequence 
corresponding to the tryptic fragment isolated from the 
bovine bone 28 to 30kd material is underlined in Table III. 
The underlined portion of the sequence corresponds to tryptic 
Fragment 3 above from which the oligonucleotide probes for 
bBMP-2 are designed. The predicted amino acid sequence 
indicates that tryptic Fragment 3 is preceded by a basic 



WO 88/00205 



PCT/US87/01S37 



23 

residue (K) as expected considering the specificity of trypsin. 
The arginine residue encoded by the CGT triplet is presumed 
to be the carboxy-terminus of the protein bas^d on the presence 
of a stop codon (TAG) adjacent to it. 



WO 88/00205 



PCT/US87/01537 



24 



TABLE III 

(1) 15 30 45 

GGC CAC GAT GGG AAA GGA CAC CCT CTC CAC AGA AGA GAA AAG CGG 
GH DGKGHPLHRREKR 

60 75 90 

CAA GCA AAA CAC AAA CAG CGG AAA CGC CTC AAG TCC AGC TGT AAG 
Q AKHKQRKRLK SSCK 

105 120 135 

AGA CAC CCT TTA TAT GTG GAC TTC AGT GAT GTG GGG TGG AAT GAC 
RHPLYVD FS DVG W ND 

150 165 180 

TGG ATC GTT GCA CCG CCG GGG TAT CAT GCC TTT TAC TGC CAT GGG 
W I V A P P G Y H A F Y C H G 

195 210 225 

GAG TGC CCT TTT CCC CTG GCC GAT CAC CTT AAC TCC ACG AAT CAT 
E CPF PLADHLN STNH 

240 255 270 

GCC ATT CTC CAA ACT CTG GTC AAC TCA GTT AAC TCT AAG ATT CCC 
AIVQTL VN SVNS XI P 

385 300 - 315 

AAG GCA TGC TGT GTC CCA ACA GAG CTC AGC GCC ATC TCC ATG CTG 
KACCVPTELSA ISML 

330 345 360 

TAC CTT GAT GAG AAT GAG AAG GTG GTA TTA AAG AAC TAT CAG GAC 
YLDENEKVVLK N Y O D 

375 (129) 397 407 

ATG GTT GTC GAG GGT TGT GGG TGT CGT TAGCACAGCA AAATAAAATA 
M V V E G C G C R 

417 427 437 447 457 

TAAATATATA TATATATATA TTAGAAAAAC AGCAAAAAAA TCAAGTTGAC 

467 477 487 497 507 

ACTTTAATAT TTCCCAATGA AGACTTTATT TATGGAATGG AATGGAGAAA 

517 527 537 547 557 

AAGAAAAACA CAGCTATTTT GAAAACTATA TTTATATCTA CGGAAAAGAA 



567 577 587 

GTTGGGAAAA CAAATATTTT AATCAGAGAA TTATT 



WO 88/00205 



PCT/LS87/01S37 



25 

C. bBMP-3 

Probes consisting of pools of oligonucleotides are 
designed on the basis of the amino acid sequences of the 
tryptic Fragments 9 (Probe #3), 10 (Probe #2), and 11 (Probe 
#1) , and synthesized on an automated DNA synthesizer. 
Probe #1: ACNGTCAT [A/G] T T N G G [A/G] T A 

Probe. #2: C A [A/G] T A [A/G] T A N G C {A/G] T C [A/G] A A 

Probe: #3:: T: G [A/G/T] ATNGTNGC [A/G] T G [A/G] T T 

A- recombinant bovine genomic library constructed in 
EMBL3 is screened by the TMAC hybridization procedure detailed 
above in part A. 400,000 recombinants are screened in duplicate 
with Probe #1 which has been labeled with 32 P. All 
recombinants which hybridized to this probe are replated for 
secondaries. Triplicate nitrocellulose replicas *are made of 
the secondary plates, and amplified as described. The three 
sets of filters are hybridized to Probes #1, #2 and #3, again 
under TMAC conditions. One clone, lambda bP-819, hybridizes 
to all three probes and is plaque purified and DNA is isolated 
from a plate lysate. Bacteriophage lambda bP-819 was deposited 
with the ATCC on June 16, 1987 under accession number 40344. 
This bP-819 clone encodes the bovine bone growth factor 
designated bBMP~3. 

The region of bP-819 which hybridizes to Probe #2 is 
localized and* sequenced. The partial DNA and derived amino 
acid sequences of this region are shown in Table IVA. The 
amino acid sequences corresponding to tryptic Fragments 10 
and 12 are underlined. The first underlined sequence 
corresponds to Fragment 12 while the second corresponds to 
Fragment 10. This region of bP-819, therefore, which hybridizes 
to Probe #2 encodes at least 111 amino acids. This amino acid 
sequence is encoded by the DNA sequence from nucleotide #414 
through #74 6. 



WO 88/00205 



PCT/US87/01537 



26 

TABLE IV. A. 

383 393 403 413 (1) 428 

GAGGAGGAAG CGGTCTACGG GGGTCdTCT GCCTCTCCAG AAC AAT GAG CTT OCT GGG GCA 

Asn Asn Glu Leu Pro Gly Ala 

443 458 473 488 

GAA TAT CAG TAG AAG GAG GAT GAA GTA TGG GAG GAG AGG AAG OCT TAC AAG ACT 
Glu Tyr Gin Tyr Lys Glu Asp Glu Val Trp Glu Glu Arg Lys Pro Tyr Lys Thr 

503 518 533 

CTT CAG ACT CAG COC OCT GAT AAG ACT AAG AAC AAA AAG AAA CAG AGG AAG GGA 
Leu Glii Thr Gin Pro Pro Asp Lys Ser Lys Asn Lys Lys Lys Gin Arg Lys Gly 

548 563 578 593 

OCT CAG CAG AAG ACT CAG AGG CTC CAG TIT GAT GAA CAG ACC CTG AAG AAG GCA 
Pro Gin Gin Lys Ser Gin Thr Lsu Gin Phe Asp Glu Gin Thr Leu Lys Lys Ala 

608 623 638 

AGA AGA AAG CAA TGG ATT GAA COC CGG AAT TGT GCC AGA OGG TAC CTT AAA CTG 
Arg Arg Lys Gin Trp lie Glu Pro Arg Asn Cys Ala Arg Arg Tyr Leu Lys Val 

653 668 683 698 

GAC TTC GCA GAT ATT GGC TGG AGC GAA TGG ATT ATT TOG COC AAG TCC TTC GAT 

Asp Phe Ala Asp li e Glv Trp Ser Glu Trp lie lie Ser Pro Lys Ser Phe Asp 

713 728 743 (111) 756 

GCC TAT TAC TGC TCC GGA GOG TGC CAG TTC CCC ATG CCA AAG -CTAGCCATIG 
Ala TVr Tvr Cvs Ser Glv Ala Cys Gin Phe Pro NET Pro Lys 

766 776 786 

tttitigtcc TGTocrrocc atttccatag 



WO 88/00205 



PCT/US87/01537 



27 

The region of bP-819 which hybridizes to Probe #1 and 
#3 is localized and sequenced. The partial DNA and derived 
amino acid sequences of this region are shown in Table IVB. 
The amino acid sequences corresponding to tryptic Fragments 9 
and 11 are underlined. The first underlined sequence 
corresponds to Fragment 9 while the second underlined sequence 
corresponds to Fragment 11. The peptide sequence of this 
region of bP-819 which hybridizes to Probe #1 and #3 is 64 amino 
acids in length encoded by nucleotide #3 05 through #493 of 
Table IVB. The arginine residue encoded by the AGA triplet 
is presumed to be the carboxy-terminus of the protein based 
on the presence of a stop codon (TAA) adjacent to it. The 
nucleic acid sequence preceding the couplet TC (positions 
3 05-3 06) is presumed to be an intron (non-coding sequence) 
based on the presence of a consensus acceptor sequence (i.e. 
a pyrimidine-rich stretch, TTCTCCCTTTTCGTTCCT , followed by 
AG) and the presence of a stop rather than a basic residue in 
the appropriate position of the derived amino acid sequence. 

bBMP-3 is therefore characterized by the DNA and 
amino acid sequence of Table IV A and Table IV B. The peptide 
sequence of this clone is 175 amino acids in length and is 
encoded by the DNA sequence from nucleotide #414 through 
nucleotide #74 6 of Table IV A and nucleotide #3 05 through 
nucleotide #493 of Table IV B. 



WO 88/00205 



PCT/US87/01S37 



28 

TABLE IV. B. 



284 294 304 (112) 319 

CTAACCIOIG TTCICCCrrr TCGTTOCTAG TCT TIG AAG OCA TCA AAT CAC GCT AOC 

Ser leu Lys Pro Ser Asn His Ala Thr 

334 349 364 379 

ATC CAG ACT ATA GTS AGA GCT GIG GGG GTC GTC CCT GGA ATC CCC GAG OCT TGC 

lie Gin Ser lie Val Arg Ala Val Gly Val Val Pro Gly lie Pro Glu Pro Cys 

394 409 424 439 

TGTGTS CCA GAA AAG ATG TCC TCA CTC AGC ATC TEA TIC TIT GAT GAA AAC AAG 
Cys Val pro Glu Lys MET Ser Ser Leu Ser lie Leu Ehe Phe Asp Glu Asn Lys 

454 469 484 (175) 

AAT GTS GTA CTT AAA GTA TAT CCA AAC ATG ACA GTA GAG TCT TGT GCT TGC AGA 
Asn Val Val Leu Lys Val Tvr Pro Asn MET Thr Val Glu Ser Cys Ala " Cys Arg 



503 513 523 533 

TAACCTGGTG AAGAACTCAT CTGGATGCTT AACTCAATCG 



WO 88/00205 



PCT/LS87/01S37 



29 

EXAMPLE V 
Human Bone Inductive Factors 
A. hBMP-1 

Because the bovine and human bone growth factor genes 
are presumed to be significantly homologous, the bovine bBMP- 
1 DNA sequence of Table II (or portions thereof) is used as a 
probe to screen a human genomic library. The 800bp EcoRI 
fragment of the bovine genomic clone is labeled with 32 P by 
nick-translation. A human genomic library (Toole et al., 
supra ) is plated on 20 plates at 4 0, 000 recombinants per 
plate. Duplicate nitrocellulose filter replicas are made of 
each plate and hybridized to the nick-translated probe in 5 X 
SSC, 5 X Denhardt«s, lOOug/ml denatured salmon sperm DNA, 
0.1% SDS (the standard hybridization solution) at 50 degrees 
centigrade for approximately 14 hours. The filters are then 
washed in 1 X SSC, 0.1% SDS at 50 degrees centigrade and 
subjected- to autoradiography. Five duplicate positives are 
isolated and plaque purified. DNA is obtained from a plate 
lysate of one of these recombinant bacteriophage, designated 
LP-H1. LP-H1 was deposited with the ATCC on March 6, 1987 under 
accession number 40311. This clone encodes at least a portion 
of the human genomic bone growth factor called hBMP-1. The 
hybridizing region of LP-H1 is localized to a 2.5kb MDal/Hindlll 
restriction fragment. 

The partial DNA sequence and derived amino acid 
sequence of lambda LP-H1 are shown below in Table V. The 
peptide sequence from this clone is 37 amino acids in length 
and is encoded by the DNA sequence from nucleotide #3440 through 
nucleotide #3550. The coding sequence of Table V is flanked 
by approximately 28 nucleotides (a presumptive 5' noncoding 
sequence) as well as approximately 19 nucleotides (a presumptive 
3 1 noncoding sequence. A comparison of the bBMP-1 sequence 
of Table II with the hBMP-1 genomic sequence of Table V 
indicates the significant homology between the two. 

Because the size of coding regions and the positions 



WO 88/00205 



PCT/US87/01S37 



30 

of- noncoding regions is generally conserved in homologous 
genes of different species, the locations of the coding and 
noncoding regions of the bone inductive factor genes may be 
identified. Regions of homology between the two species' 
genes, flanked by RNA processing signals at homologous sites, 
indicate a coding region. 



WO88/00205 



PCT/US87/01537 



31 
TABLE V 



3419 3429 3439 (1) 3454 

CAGCOCTGGC TTCITCTITT CTCnTAGCT GOC TIT CTT GGG GAC AIT GCC CPS GAC 

Ala Hie Leu Gly Asp lie Ala Leu Asp 

3469 3484 3499 3514 

GAA GAG GAC COG AGG GOC TTC GAG GTA CAG GAG GCT GIG GAT CTC AGA GGG GAC 

Glu Glu Asp Leu Axg Ala Hie Gin Val Gin Gin Ala Val Asp Leu Arg Arg His 

3529 3544 (37) 3560 3570 

AGA. GCT OCT AAG TCC TCC ATC AAA GCT GCA GGTAAGOOGG GTCCCAATGG 
Thr~Ala Arg Lys Ser Ser lie Lys Ala Ala 



WO 88/00205 



PCT/US87/01537 



32 

A probe specific for the human coding sequence given 
in; Table V is used to identify a human cell line or tissue 
which synthesizes bone inductive factor. The probe is made 
according to the following method. Two oligonucleotides having 
the following sequences: 

( a ) GGGAATTCTGCCTTTCTTGGGGACATTGCCCTGGACGAAGAGGACCTGAG 
(b) CGGGATCCGTCTGAGATCCACAGCCTGCTGTACCTGGAAGGCCCTCAGG 
area, synthesized on an automated synthesizer , annealed, extended 
using- the Klenow fragment of E. coli DNA polymerase I, digested 
with: the restriction enzymes Eco RI and Bam HI, and inserted 
into, an Ml 3 vector. A single-stranded 32 P-labeled probe is 
then from template preparation of this subclone by standard 
techniques. Polyadenylated RNAs from various cell and tissue 
sources are electrophoresed on formaldehyde-agarose gels and 
transf ered to nitrocellulose by the method of Toole et al . , 
"supra . The probe is then hybridized to the nitrocellulose 
blot in 50% formamide, 5 X SSC, 0.1% SDS, 40 mM sodium phosphate 
PH 6.5, 100 ug/ml denatured salmon sperm DNA, and 5 mM vanadyl 
ribonucleosides at 42° C overnight and washed at 65° C in 0.2 
X SSC, 0.1% SDS. Following autoradiography, the lane containing 
RNA from the human osteosarcoma cell line U-2 OS contains 
hybridizing bands corresponding to RNA species of approximately 
4.3 and 3.0 kb. 

cDNA is synthesized from U-2 OS polyadenylated RNA and 
cloned into lambda gtlO by established techniques (Toole et 
al., supra) . 20 / 000 recombinants from this library are plated 
on each of 50 plates. Duplicate nitrocellulose replicas are 
made- of the plates. The above described oligonucleotides are 
kinased with 32 P-gamma-ATP and hybridized to the two sets of 
replicas at 55° centigrade in standard hybridization solution 
overnight. The filters are then washed in 1 X SSC, 0.1% SDS 
at 55° centigrade and subjected to autoradiography. One 
duplicate positive, designated lambda U20S-1, is plaque 
purified. Lambda U20S-1 was deposited with the ATCC on June 
16, 1987 under accession number 40343. 



WO 88/00205 



PCT/US87/01S37 



33 

The entire nucleotide sequence and derived amino acid 
sequence of the insert of lambda U20S-1 is given in Table VI. 
This cDNA clone encodes a Met followed by a hydrophobic leader 
sequence characteristic of a secreted protein, and contains a 
stop codon at nucleotide positons 2226 - 2228. This clone 
contains an open reading frame of 2190bp, encoding a protein of 
730 amino acids with a molecular weight og 83kd based on this 
amino: acid sequence. The clone contains sequence identical to 
the- coding region given in Table V. This protein is contemplated 
to* represent a primary translation product which is cleaved 
upon secretion to produce the hBMP-1 protein. This clone is 
therefore a cDNA for hBMP-1 corresponding to human gene fragment 
contained in the genomic hBMP-1 sequence lambda LP-H1. It is 
noted that amino acids #550 to #590 of BMP-1 are homologous to 
epidermal growth factor and the "growth factor" domains of 
Protein C, Factor X and Factor IX. 



WO 88/00205 



PCT/US87/01S37 



34 



TABLE VI 

10 20 30 (1) 50 

CTAGAGGCOG CTFOOCTOGC OGO0GO000G CCAGC ATG COC GGC GIG GCC OGC CIG OOS 

MET Pro Gly Val Ala Arg Leu Pro 

65 80 95 110 

CIG CIG CTC GGG CIG CIG CIG CTC COG OCT CCC GGC OGG COG CIG GAC TIG GCC 
Lsu leu Leu Gly Leu Leu Leu Leu Pro Arg Pro Gly Arg Pro Leu Asp Leu Ala 

125 140 155 

GAC "TAG ACC TAT GAC CIG GOG GAG GAG GAC GAC TOG GAG CCC CTC AAC TAC AAA 
Asp Tyr Hhc Tyr Asp Leu Ala Glu Glu Asp Asp Ser Glu Pro Leu Asn Tyr Lys 

170 185 200 215 

GACOOC TGC AAG GOG GCT GCC TTT CTT GGG GAC ATT GCC CIG GAC GAA GAG GAC 
Asp Pro cys lys Ala Ala Ala Hie Leu Gly Asp lie Ala Leu Asp Glu Glu Asp 

230 245 260 275 

CIG AGG GCC TIC CAG GTA CAG CAG GCT GIG GAT CTC AGA OGG CAC ACA -GCT OCT 
Leu Arg Ala Hie Gin Val Gin Gin Ala Val Asp Leu Arg Arg His Thr Ala Arg 

290 305 320 

AAG TOC TCC ATC AAA GCT GCA GOT OCA GGA AAC ACT TCT ACC CCC AGO TGC CAG 
Lys Ser Ser lie lys Ala Ala Val Pro Gly Asn Thr Ser Thr Pro Ser Cys Gin 

335 350 365 380 

AGC ACC AAC GGG CAG OCT CAG AGG GGA GCC TCT GGG AGA TGG AGA GCT AGA TOC 
Ser . Hit Asn Gly Gin Pro Gin Arg Gly Ala Cys Gly Arg Trp Arg Gly Arg Ser 

395 410 425 

OCT AGC OGG OGG GOG GOG AOG TOC OGA CCA GAG OCT GIG TGG CCC GAT GGG GTC 
Arg Ser Arg Arg Ala Ala Thr Ser Arg Pro Glu Arg Val Trp Pro Asp Gly Val 

440 455 470 485 

ATC CCC TTT GTC ATT GGG GGA AAC TTC ACT GCT AGC CAG AGG GCA GTC TIC OGG 

lie Pro Hie Val lie Gly Gly Asn Hie Thr Gly Ser Gin Arg Ala Val Hie Arg 

500 515 530 545 

CAG GCC ATG AGG CAC TGG GAG AAG CAC ACC TCT CTC ACC TTC CIG <SAG OGC ACT 
Gin Ala MET Arg His Trp Glu Lys His Thr Cys Val Thr Hie Leu Glu Arg Thr 

560 575 590 

GAC GAG GAC AGC TAT ATT GIG TTC ACC TAT OGA OCT TGC GGG TGC TGC TCC TAC 
Asp Glu Asp Ser Tyr lie Val Hie Thr Tyr Arg Pro cys "Gly cys Cys Ser Tyr 

605 620 635 650 

GIG GCT OGC OGC GGC GGG GGC CCC GAG GCC ATC TCC ATC GGC AAG AAC TCT GAC 
Val Gly Arg Arg Gly Gly Gly Pro Gin Ala lie Ser lie Gly Lys Asn Cys Asp 



WO 88/00205 



PCT/US87/01S37 



35 



665 680 695 

AAG TTC GGC ATT GIG GTC CAC GAG CIG GGC CAC CTC GTC GGC TTC TGG CAC GAA 
Lys Phe Gly lie Val Val His Glu Leu Gly His Val Val Gly Ehe Trp His Glu 

710 725 740 755 

CAC ACT CGG CCA GAC CGG GAC CGC CAC GTT TOC ATC GTT CGT GAG AAC ATC CAG 

His Thr Arg Pro Asp Arg Asp Arg His Val Ser lie Val Arg Glu Asn lie Gin 

770 785 800 815 

CCA GGG CAG GAG TAT AAC TTC CIG AAG ATG GAG CCT CAG GAG GTG GAG TOC CTG 
Pro Gly Gin Glu Tyr Asn Che Leu Lys MET Glu Pro Gin Glu Val Glu Ser Leu 

830 845 860 

GGG GAG ACC: TAT GAC TTC GAC AGC ATC ATG CAT TAC GCT CGG AAC ACA TTC TCC 
Gly Glu Thr. Tyr Asp Phe Asp Ser lie MET His Tyr Ala Arg Asn Thr Phe Ser 

875 890 905 920 

AGG GGC ATC TTC CTG GAT ACC ATT GTC CCC AAG TAT GAG GTG AAC GGG GTG AAA 
Arg Gly lie Phe Leu Asp Thr lie Val Pro Lys Tyr Glu Val Asn Gly Val Lys 

935-: 950 965 

OCT CCC ATT GGC CAA AGG ACA CGG CTC AGC AAG GGG GAC ATT GGC CAA GOC CGC 
Pro Pro lie Gly Gin Arg Thr Arg Leu Ser Lys Gly Asp lie Ala Gin Ala Arg 

980 995 1010 1025 

AAG CTT TAC AAG TGC CCA GGC TGT GGA GAG ACC CTG CAA GAC AGC ACA GGC AAC 

Lys Leu Tyr Lys Cys Pro Ala Cys Gly Glu Thr Leu Gin Asp Ser Thr Gly Asn 

1040 1055 1070 1085 

TTC TCC TCC OCT GAA TAC CCC AAT GGC TAC TCT GCT CAC ATG CAC TGC GTG TGG 
Rhe Ser Ser Pro Glu. Tyr Pro Asn Gly Tyr Ser Ala His MET His Cys Val Trp 

110© 1115 1130 

CGC ATC TCT GTC ACA CCC GGG GAG AAG ATC ATC CTG AAC TTC ACG TGC CTG GAC 
Arg lie Ser Val Thr Pro Gly Glu Lys lie lie Leu Asn Phe Thr Ser Leu Asp 

1145 1160 . 1175 1190 

CTG TAC CGC AGC CGC CTG TGC TGG TAC GAC TAT GTG GAG GTC CGA GAT GGC TTC 
Leu Tyr Arg Ser Arg: Leu Cys Trp Tyr Asp Tyr Val Glu Val Arg Asp Gly Fhe 

1205 1220 1235 

TGG AGG AAG GCG CCC CTC CGA GGC CGC TTC TGC GGG TCC AAA CTC OCT GAG OCT 
Trp Arg Lys Ala Pro Leu Arg Gly Arg Phe Cys Gly Ser Lys Leu Pro Glu Pro 

1250 1265 1280 1295 

ATC GTC TCC ACT GAC AGC GGC CTC TGG GTT GAA TTC CGC AGC AGC AGC AAT TGG 

lie Val Ser Thr Asp Ser Arg Leu Trp Val Glu Phe Arg Ser Ser Ser Asn Trp 

1310 1325 1340 1355 

GTT GGA AAG GGC TTC TIT GCA GTC TAC GAA GCC ATC TGC GGG GGT GAT GTG AAA 
Val Gly Lys Gly Phe Ehe Ala Val Tyr Glu Ala lie Cys -Gly Gly Asp Val Lys 



WO 88/00205 



PCT/US87/0IS37 



36 



1370 1385 1400 

AAG GAC'TST GGC CAC ATT CAA TOG CQC AAC TAC CCA GAC GAT TAC 03G OOC AGC 
Lys Asp*Tyr Gly His lie Gin Ser Pro Asn Tyr Pro Asp Asp Tyr Arg Pro Ser 

1415" 1430 1445 1460 

AAA GTC TGC ATC TGG OGG ATC CAG GIG TCT GAG GGC TTC CAC GTC GGC CTC ACA 
Lys Val Cys lie Trp Arg lie Gin Val Ser Glu Gly Hie His Val Gly Leu Thr 

1475 1490 1505 

TTC CAG TOC TTT GAG ATT GAG CGC CAC GAC AGC TCT GCC TAC GAC TAT CTG -GAG 
Hie Gin Ser Hie Glu lie Glu Arg His Asp Ser Cys Ala Tyr Asp Tyr Lsu Glu 

1520 1535 1550 1565 

GTC OGC7GAC GGG CAC ACT GAG AGC AGC ACC CTC ATC GGG GGC TAC TGT -GGC TAT 

Val Jtoj Asp Gly His Ser Glu Ser Ser Thr Leu lie Gly Arg Tyr Cys Gly Tyr 

1580: 1595 1610 1625 

GAG AAC (XT' GAT GAC ATC AAG AGC ACG TCC AGC GGC CTC TGG CTC AAG TTC -GTC 
Glu Lys Pro Asp Asp lie Lys Ser Thr Ser Ser Arg leu Trp Leu Lys Hie Val 

1640 1655 1670 

TCT GAC GGG TCC ATT AAC AAA GOG GGC TTT GCC GTC AAC TTT TTC AAA GAG GIG 
Ser Asp Gly Ser lie Asn Lys Ala Gly Hie Ala Val Asn Hie Hie Lys Glu Val 

1685 1700 1715 1730 

GAC GAG TGC TCT OGG CCC AAC GGC GGG GGC TGT GAG CAG GGG TGC CTC AAC ACC 
Asp Glu Cys Ser Arg Pro Asn Arg Gly Gly Cys Glu Gin Arg Cys Leu Asn Sir 

1745 1760 1775 

CTG GGC AGC TAC AAG TGC AGC TGT GAC CCC GGG TAC*GAG CTG GCC CCA GAC AAG 
leu Gly Ser Tyr Lys Cys Ser Cys Asp Pro Gly Tyr Glu Leu Ala Pro Asp Lys 

1790 1805 1820 1835 

OGC CGC TCT GAG GCT GCT TCT GGC GGA TTC CTC AGC AAG CTC AAC GGC TOC ATC 

Arg Arg Cys Glu Ala Ala Cys Gly Gly Hie Leu Thr Lys Leu Asn Gly Ser lie 

1850: 1865 1880 1895 

ACC AGC COG GGC TGG GCC AAG GAG TAC CCC CCC AAC AAG AAC TGC ATC TGG CAG 
Thr Ser Pro Gly Trp Pro Lys Glu Tyr Pro Pro Asn Lys Asn Cys lie Trp Gin 

1910 1925 1940 

CTG GIG GCC OOC AGC CAG TAC GGC ATC TCC CTG CAG TTT GAC TTC TTT GAG ACA 
Leu Val Ala* Pro Thr Gin Tyr Arg lie Ser Leu -Gin Hie Asp Hie Hie Glu Thr 

1955 1970 1985 2000 

GAG GGC AAT GAT GIG TGC AAG TAC GAC TTC GTC GAG CTG OGC ACT -GGA CTC ACA 
Glu Gly Asn Asp Val Cys Lys Tyr Asp Hie Val Glu Val Arg Ser Gly Leu Thr 

2015 2030 2045 

GCT GAC TOC AAG CTG CAT GGC AAG TTC TCT GCT TCT -GAG AAG CCC GAG GTC ATC 
Ala Asp Ser lys Leu His Gly Lys Hie Cys Gly Ser Glu Lys Pro Glu Val He 



WO88/00205 



PCT/US87/01S37 



37 



2060 2075 2090 2105 

ACC TOO CAG TAG AAC AAC AUG OGC GIG GAG TIC AAG TCC GAC AAC ACC GIG TCC 

Thr Ser Gin iyr Asn Asn MET Arg Val Glu Hie Lys Ser Asp Asn Thr Val Ser 

2120 2135 2150 2165 

AAA AAG GGC TTC AAG GOC CAC TIC TIC TCA GAA AAG AGG OCA GCT CIG CAG OCC 
Lys Lys Gly Fhe Lys Ala His Hie Hie Ser Glu Lys Arg Pro Ala Leu Gin Pro 

2180 2195 22.10 

OCT OGG GGA OGC CCC CAC CAG CIC AAA TTC GGA GIG CAG AAA AGA AAC OGG ACC 
Pro= Arg Gly Arg Pro His Gin Leu Lys Hie Arg Val Gin Lys Arg Asn Arg Thr 
(730) 

2225 2235 2245 2255 2265 2275 2285 

OCC CAG TGAGGCCIGC C^GGOCTOOC GGAOOCCTIG TTACTCAGGA ACCTCACCTT GGAOGGAAIG 
Pro Gin 

2295 2305 2315 2325 2335 2345 2355 

GGAIGGGGGC TTOGGIGCCC ACCAAOC00C CACCTCCACT CIGOCATICC GGOOCAOCTC QCKHSGGGG 



2365 2375 2385 2395 2405 2415 2425 

GACAGAACTG GIGCTCICIT CTCCCCACIG TCCOOCTOOG OGGACOGGGG ACCCTTOCCC GTCCCCIACC 



2435 2445 2455 2465 2475 2485 2495 

CCCICCCATT TTGATCGIGT CTGIGACATT TCCIGITGTG AAGIAAAAGA GGGAGCCCIG O3S0CEGCCL 



CTAGA 



WO 88/00205 



PCT/US87/01537 



38 

B. hBMP-2; Class I and II 

The Hindlll-SacI bovine genomic bBMP-2 fragment 
described in Example IV B. is subcloned into an M13 vector. 
A 32 P-labeled. single-stranded DNA probe is made from a template 
preparation of this subclone. This probe is used to screen 
polyadenylated RNAs from various cell and tissue sources as 
described above in part A. A hybridizing band corresponding 
to. an mRNA species of approximately 3.8 kb is detected in the 
lane= containing RNA from the human cell line U-2 OS. The 
HindllX-SacI fragment is labeled with 32 P by nick translation 
and" used: to screen the nitrocellulose filter replicas of the 
above-described U-2 OS cDNA library by hybridization in 
standard., hybridization buffer at 65° overnight followed by 
washing in 1 X SSC, 0.1% SDS at 65°. Twelve duplicate positive 
clones are picked and replated for secondaries. Duplicate 
nitrocellulose replicas are made of the secondary plates and 
both sets hybridized to the bovine genomic probe as the 
primary screening was performed. One set of filters is then 
washed in 1 X SSC, 0.1% SDS; the other in 0.1 X SSC f 0.1% SDS 
at 65°. 

Two classes of hBMP-2 cDNA clones are evident based 
on. strong C4 recombinants) or weak (7 recombinants) 
hybridization signals under the more stringent washing 
conditions (0*1 X SSC, 0.1% SDS). All 11 recombinant 
bacteriophage are plague purified, small scale DNA preparations 
made from plate lysates of each, and the inserts subcloned 
into pSP65 and into M13 for sequence analysis. Sequence 
analysis of the strongly hybridizing clones designated hBMP-2 
Class r (also known as BMP-2) indicates that they have extensive 
sequence homology with the sequence given in Table III. 
These clones are therefore cDNA encoding the human equivalent 
of the protein encoded by the bBMP-2 gene whose partial sequence 
is given in Table III. Sequence analysis of the weakly 
hybridizing recombinants designated hBMP-2 Class II (also 
known as BMP-4) indicates that they are also quite homologous 



WO 88/00205 



PCT/US87/01S37 



39 

with the sequence given in Table III at the 3' end of their 
coding regions, but less so in the more 5' regions. Thus 
they encode a human protein of similar, though not identical, 
structure- to that above. 

Full length hBMP-2 Class I cDNA clones are obtained 
in the following manner. The 1.5 kb insert of one of the 
Class II subclones (II-10-1) is isolated and radioactively 
labeled by nick-translation. One set of the nitrocellulose 
replicas; of the U-2 OS cDNA library screened above (50 filters, 
corresponding to 1,000,000 recombinant bacteriophage) are 
rehybridized with this probe under stringent conditions 
(hybridization at 65° in standard hybridization buffer; 
washing at 6*5° in 0.2 X SSC, 0.1% SDS). All recombinants 
which hybridize to the bovine genomic probe which do not 
hybridize to the Class II probe are picked and plaque purified 
(10 recombinants) . Plate stocks are made and small scale 
bacteriophage DNA preparations made. 'After subcloning into 
M13, sequence analysis indicates that 4 of these represent 
clones which overlap the original Class I clone. One of 
these, lambda U20S-3 9, contains an approximately 1.5 kb 
insert and was deposited with the ATCC on June 16, 1987 
under accession number 40345. The partial DNA sequence 
(compiled from lambda U20S-39 and several other hBMP-2 Class 
I cDNA recombinants) and derived amino acid sequence are 
shown below in Table VII. Lambda U2 0S-39 is expected to 
contain all o:f the nucleotide sequence necessary to encode 
the : entire human counterpart of the protein BMP-2 Class II 
encoded by the bovine gene segment whose partial sequence is 
presented: in Table III. This human cDNA hBMP-2 Class II 
contains an open reading frame of 1188 bp, encoding a protein 
of 396 amino acids. This protein of 396 amino a<:ids has a 
molecular weight of 45kd based on this amino acid sequence. 
It is contemplated that this sequence represents the primary 
translation product. The protein is preceded by a 5 1 
untranslated region of 342 bp with stop codons in all frames. 



WO 88/00205- 



PCT/US87/01S37 



40 

The 13; bp region preceding this 5' untranslated region 
represents a linker used in the cDNA cloning procedure. 



WO 88/00205 



PCT/US87/01537 



41 

TABLE VII 



10 20 30 40 50 60 70 

GTCGACTCIA GftGrTCTCICT CAGCACTTGG CTGGGGACIT CTIGAACTTG CAGGGAGAAT AACTPGCQCA 



80 90 100 110 120 130 140 

axxacnrc cgccggtgcc titgccccag osgagcctgc ttogogatct cjdgagcccca cggccxxtcc 



150 160 170 180 190 200 210 

ACTCCTOGGC CITGCCCGAC ACTGAGACGC TCTTCCCAGC GTGAAAAGAG AGACTGCGCG GCG3GCACCC 



220 230 240 250 260 270 280 

GGGAGAAGGA" GGAGGCAAAG AAAAGGAACG GACATTOGGT CCITCCGCCA GGTCCTTTGA CCAGAGTriT 



290 300 310 320 330 340 350 

TCCATGTGGA CGCTCITTCA ATGGAGGTGT CCCCGCGTGC TTCITAGAOG GACTGCGGTC TCCIAAAGCT 



(1) 370 385 400 

CGACC ATS GTG GCC GGG ACC OGC TST CTT CIA GGG TIG CPS CTT GCC CAG GTC 
MET Val Ala. Gly Thr Arg Cys Leu Leu Ala Leu Leu Leu Pro Gin Val 

415 430 445 

CTC CTG GGC GGC GOS GCT GGC CTC GTT COG GAG CTC GGC GGC AGG AAG TTC GGG 
Leu Leu Gly Gly Ala Ala Gly Leu Val Pro Glu Leu Gly Arg Arg Lys Phe Ala 

460 475 490 • 505 

GOG GOS TOG TOG GGC OGC CCC TCA TOC CAG GCC TCP GAC -GAG GTC CTG AGC GAG 

Ala Ala Ser Ser Gly Arg Pro Ser Ser -Gin Pro Ser Asp Glu Val Leu Ser -Glu 

520 535 550 565 

TTC GAG TIG 0GG CTG CTC AGC ATG TTC GGC CTG AAA CAG AGA CCC ACC CCC AGC 
Phe Glu Leu Arg Leu Leu Ser MET Phe Gly Leu Lys Gin Arg Pro Thr Pro Ser 

580 595 610 

AGG GAC GCC GTG GTG CCC CCC TAC ATS CTA GAC CTG TAT OGC AGG CAC TOG <GGT 
Arg Asp Ala Val Val Pro Pro Tyr MET Leu Asp Leu Tyr Arg Arg His Ser Gly 

625 640 655 670 

CAG CGG GGC TCA CCC GCC CCA GAC CAC CGG TPS GAG AGG GCA GCC AGC OGA GCC 
Gin Pro Gly Ser Pro Ala Pro Asp His Arg Leu -Glu Arg Ala Ala Ser Arg Ala 

685 700 715 

AAC ACT GTS GGC AGC TTC CAC CAT GAA GAA TCT TIG GAA GAA CTA CCA GAA AOS 
Asn Thr Val Arg Ser Phe His His Glu Glu Ser Leu Glu Glu Leu Pro Glu Thr 



WO 88/00205 



PCT/US87/01537 



42 



730 745 760 775 

ACT GGG AAA ACA ACC OGG AGA TIC TIC TTT AAT TEA ACT TCT ATC CQC AQG GftG 

Ser Gly Lys Ihr Thr Arg Arg Hie Hie Hie Asn Leu Ser Ser lie Pro Thr Glu 

790 805 820 835 

GAG TTT ATC ACC TCA GCA GAG CTT CAG GTT TTC CGA GAA CAG ATG CAA GAT GCT 
Glu Hie lie Thr Ser Ala Glu Lsu Gin Val Hie Arg Glu Gin MET Gin Asp Ala 

850 865 880 

TEA GGA AAC AAT AGC ACT TTC CAT CAC OGA AIT AAT ATT TAT GAA ATC ATA AAA 
Leu Gly Asn Asn Ser Ser Hie His His Arg lie Asn lie Tyr Glu lie lie Lys 

895 910 925 940 

OCT GCA ACA GCC AAC TOG AAA TTC CCC GIG ACC ACT CTT TIG GAC ACC AGG TTG 
Pro Ala Thr Ala Asn Ser Lys Hie Pro Val Thr Ser Leu Lsu Asp Thr Arg Leu 

955 970 985 

GIG AAT CAG AAT GCA AGC AGG TOG GAA ACT TTT GAT CTC ACC CCC GCT GIG ATG 
Val Asn Gin Asn Ala Ser Arg Trp Glu Ser Hie Asp Val Thr Pro Ala Val MET 

1000 1015 1030 1045 

OGG TGG ACT GCA CAG GGA CAC GCC AAC CAT GGA TTC GIG GIG GAA GIG GCC CAC 

Arg Trp Thr Ala Gin Gly His Ala Asn His Gly Hie Val Val Glu Val Ala His 

* 

1060 1075 " 1090 1105 

TIG GAG GAG AAA CAA GCT GTC TCC AAG AGA CAT GTT AGG ATA AGC AGG TCT TEG 
Leu Glu Glu Lys Gin Gly Val Ser lys Arg His Val Arg lie Ser Arg Ser Leu 

1120 1135 1150 

CAC CAA GAT GAA CAC AGC TGG TCA CAG ATA AGG CCA TIG CIA GEA ACT ITT GGC 
His Gin Asp Glu His Ser Trp Ser Gin lie Arg Pro Leu Leu Val Thr Hie Gly 

1165 1180 1195 1210 

CAT GAT GGA AAA GGG CAT OCT CTC CAC AAA AGA GAA AAA GCT CAA -GCC AAA CAC 
His Asp Gly Lys Gly His Pro leu His Lys Arg Glu Lys Arg Gin Ala Lys His 

1225 1240 1255 

AAA CAG OGG AAA CGC CTT AAG TCC AGC TCT AAG AGA CAC CCT ITG TAG GIG -GAC 
Lys Gin Arg Lys Arg Leu Lys Ser Ser cys Lys Arg His Pro Leu Tyr Val Asp 

1270 1285 1300 1315 

TTC ACT GAC GIG GGG TGG AAT GAC TGG ATT CTG GCT CCC COG <GGG TAT CAC GCC 

Hie Ser Asp Val Gly Trp Asn Asp lip lie Val Ala Pro Pro Gly iyr His Ala 

1330 1345 1360 1375 

ITT TAC TGC CAC GGA GAA TCC CCT ITT OCT CTG GCT GAT CAT CEG AAC TCC ACT 
Hie Tyr Cys His Gly Glu cys Pro Hie Pro Leu Ala Asp His Lea Asn Ser Thr 

1390 1405 1420 

AAT CAT GCC AIT GIT CAG AOS TIG GTC AAC TCI GIT AAC TCT AAG ATE OCT AAG 
Asn His Ala lie Val Gin Thr Leu Val Asn Ser Val Asn Ser lys lie Pro Lys 



WO 88/00205 



PCT/US87/01537 



43 



1435 1450 1465 1480 

GCA TGC TGT GIC COG ACA GAA CTC ACT GCT ATC TOG AXG CIG TAG CTT GAC GAG 
Ala cys cys Val Pro Thr Glu Leu Ser Ala lie Ser MET Leu iyr Leu Asp Glu 

1495 1510 1525 

AAT GAA AAG GIT GEA TEA AAG AAC TftT GAG GAC ATC GET GIG GAG GGE TGT GGG 
Asn Glu Lys Val Val Leu Lys Asn iyr Gin Asp MET Val Val Glu Gly Cys Gly 

1540(396) 1553 1563 1573 1583 159 3 1603 

TGE CGC TAGEACAGCA AAATEAAATA CAIAAAIAIEA TAIATAIAIA TATATITTAG AAAAAAGAAA 
cysiArg; 



AAAA. 



WO 88/00205 



PCT/US87/01S37 



44 

Full-length hBMP-2Class II human cDNA clones are 
obtained in the following manner. The 2 00 bp EcoRI-SacI r 
fragment from the 5 1 end of the Class II recombinant II-10-1 
is isolated from its plasmid subclone, labeled by nick- 
translation, and hybridized to a set of duplicate nitrocellulose 
replicas of the U-2 OS cDNA library (25 filters/set; 
representing 500, 000 recombinants) . Hybridization and 
washing are performed under stringent conditions as described 
above. 16 duplicate positives are picked and replated for 
secondaries. Nitrocellulose filter replicas of the secondary 
plates are made and hybridized to an oligonucleotide which 
was; synthesized to correspond to the sequence of II-10-1 and 
is of the following sequence: 
CGGGCGCTCAGGATACTCAAGACCAGTGCTG 

Hybridization is in standard hybridization buffer AT 50° C 
with washing at 50° in 1 X SSC, 0.1% SDS. 14 recombinant 
bacteriophage which hybridize to this oligonucleotide are 
plaque purified. Plate stocks are made and small scale 
bacteriophage DNA preparations made. After sucloning 3 of 
these into M13 , sequence analysis indicates that they represent 
clones which overlap the original Class II clone. One of 
these, lambda U20S-3, was deposited with the ATCC under 
accession number 40342 on June 16, 1987. U20S-3 contains an 
insert of approximately 1.8 kb. The partial DNA- sequence and 
derived amino acid sequence of U20S-3 are shown below in 
Table VIII. This clone is expected to contain all of the 
nucleotide sequence necessary to encode the entire human BMP- 
2 Class II protein. This cDNA contains an open reading frame 
of 1224 bp, encoding a protein of 408 amino acids, preceded 
by a. 5' untranslated region of 394 bp with stop codons in all 
frames, and contains a 3* untranslated region of 308 bp 
following the in- frame stop codon. The 8 bp region preceding 
the 5 f untranslated region represents a linker used in the 
cDNA cloning procedure. This protein of 408 amino acids has 
molecular weight of 47kd and is contemplated to represent the 



WO 88/00205 



PCT/LS87/01537 



45 

primary translation product. 



WO 88/00205 



PCT/US87/01S37 



46 



TABLE VIH 

10 20 30 40 50 60 70 

ctciagaggg- CAGAGGAGGA GGGAGGGAGG gaaggagogc ggagoogggc ooggaagcia ggtgagtgig 

80 90 100 110 120 130 140 

GCATCOGAGC TGAGGGAOGC GAGCCIGAGA OGOCGCTGCT GCTCOGGCIG AGTATCTAGC TTGTCTCCCC 

ISO 160 170 180 190 200 210 

GKIGGGSITC CEGTCCAAGC TATCTOGAGC CIGCAGOGCC ACAGICCCOG GaXTCGCCC AGGITCACIG 

220 230 240 250 260 270 280 

CAACOGITCA GAGGTCCCCA GGAGCIGCIG CTGGOGAGOC OGCTACIGCA GGGACCTATG GAGCCAITCC 

290 300 310 320 330 340 350 

GIAGTCCCAT CCCGAGCAAC GCACIGCIGC AGCITCCCIG AGCCTITCCA GCAAGITTCT TCAAGA2TGG 

360 370 380 390 400 (1) 

CICTCAAGAA TCATGGACTG TTATTATAIG CCTTGEITTC TCTCAAGACA CC AUG AIT OCT 

MET He Pro 

417 432 447 462 

GGT -AACT OGA AUG CIG AUG GTC GIT TTA TEA TGC CAA GTC CIG CTA GGA GGC GGG 
Gly AsnArg MET Lsa MET Val Val Leu Leu Cys Gin Val leu Leu Gly Gly Ala 

477 492 507 

AGO CAT GCT ACT TIG ATA CCT GAG AOG GGG AAG AAA AAA GTC <3CC GAG ATT GAG 
Ser His Ala. Ser Leu He Pro Glu Tfar Gly Lys Lys Lys Val Ala Glu lie Gin 

522 537 552 ' 567 

GGC CAC GOG GGA GGA GGC GGC TCA GGG CAG AGO CAT GAG CTC CIG GGG GAC TTC 

Gly His Ala Gly Gly Arg Arg Ser Gly Gin Ser His Glu Leu Leu Arg Asp Hie 

582 597 612 627 

GAG GOG ACA CTT CTG CAG ATG ITT GGG CIG GGC GGC GGC COG CAG GCT AGC AAG 
Glu Ala Thr Leu Leu Gin MET Hie Gly Leu Arg Arg Arg Pro Gin Pro Ser Lys 

642 657 ^72 

ACT . GCC GTC ATT COG GAC TAC AIG GGG GAT CTT TAC OGG CTT CAG TCT *QGG GAG 
Ser: Ala Val He Pro Asp Tyr MET Arg Asp Leu Tyr Arg Leu Gin -Ser <*ly Glu 

687 702 717 732 

GAG GAG GAA GAG CAG ATC CAC AGC ACT GCT CTT GAG TAT OCT GAG GGC OGG GGC 
Glu Glu Glu Glu Gin lie His Ser Thr Gly Leu Glu Tyr Pro *Glu Arg Pro Ala 



WO 88/00205 



PCT/US87/01537 



47 

747 762 777 

AGC OGG GOC AAC ACC GIG AGG AGC TIC CAC CAC GAA GAA CAT CIG GAG AAC ATC 
Ser Arg. Ala Asn Thr Val Arg Ser Hie His His Glu Glu His Leu Glu Asn lie 

792 ' 807 822 837 

CCA GGG ACC ACT GAA AAC TCP GCT TIT OCT TIC CTC TIT AAC CIC AGC AGC ATC 

Pro Gly Thr Ser Glu Asn Ser Ala Hie Arg Hie Lai Hie Asn Leu Ser Ser lie 

852 867 882 897 

OCT GAG AAC GAG GTG ATC TCC TCT GGA GAG CTT OGG CTC TIC OGG GAG GAG GTG 
Pro -Glu Asn Glu Val lie Ser Ser Ala Glu Leu Arg Leu Hie Arg Glu Gin Val 

912 927 942 

GAC CAG GGC OCT GAT TGG GAA AGG GGC TIC CAC OCT ATA AAC ATT TAT GAG GOT 
Asp .Gin Gly Pro Asp Trp Glu Arg Gly Hie His Arg lie Asn lie Tyr Glu Val 

957 972 987 1002 

ATC AAG CCC CCA GCA GAA GTG GIG CCT GGG CAC CTC ATC ACA OGA CEA CTG GAC 
MET .Lys Pro Pro Ala Glu Val Val Pro Gly His Leu lie Thr Arg Leu Leu Asp 

1017 1032 1047 

AOG AGA CTG CTC CAC CAC AAT CTG ACA OGG TGG GAA ACT TIT -GAT GTG AGC OCT 
Thr Arg Leu Val His His Asn Val Thr Arg Trp Glu Thr Hie Asp Val Ser Pro 

1062 1077 1092 1107 

GGG GTC CTT GGC TGG ACC OGG GAG AAG CAG CCA AAC TAT GGG CEA -GOC ATT GAG 

Ala Val Leu Arg Trp Thr Arg Glu Lys Gin Pro Asn Tyr Gly Leu Ala lie -Glu 

1122 1137 1152 1167 

CTG ACT CAC CTC CAT CAG ACT OGG ACC CAC CAG GGC CAG CAT GTC AGG ATT ' AGC 
Val Thr His Leu His Gin Thr Arg Thr His Gin Gly Gin His Val Arg lie Ser 

1182 1197 1212 

OGA TOG TTA OCT CAA GGG ACT GGG AAT TGG GOC CAG CTC OGG CCC CTC CTG CTC 
Arg Ser Leu Pro Gin Gly Ser Gly Asn Trp Ala Gin Leu Arg Pro Leu Leu Val 

1227 1242 1257 1272 

ACC TTT GGC CAT GAT GGC OGG GGC CAT GOC TIG ACC OGA GGC OGG AGG GCC AAG 
Thr Hie Gly His Asp Gly Arg Gly His Ala Leu Thr Arg Arg Arg Arg Ala Lys 

1287 1302 1317 

OCT AGC OCT AAG CAT CAC TCA CAG OGG GGC AGG AAG AAG AAT AAG AAC TGC GGG 
Arg Ser Pro Lys His His Ser Gin Arg Ala Arg Lys Lys Asn Lys Asn Cys Arg 

1332 1347 1362 1377 

OGC CAC TOG CIC TAT GTG GAC TTC AGC GAT GTG GGC TGG AAT GAC TGG ATT CTG 

Arg His Ser Leu Tyr Val Asp Hie Ser Asp Val Gly Trp Asn Asp Trp lie Val 

1392 1407 1422 1437 

GCC CCA OCA GGC TAC CAG GOC TTC TAC TGC CAT GGG GAC TGC GGC TTT OCA CTG 
Ala Pro Pro Gly Tyr Gin Ala Hie Tyr cys His <Jly Asp Cys Pro Hie Pro Lsu 



WO 88/00205 



PCT/US87/01537 



48 

1452 1467 1482 

GCTTGAC CAC CTC AAC TCA ACC AAC CAT GCC ATT GIG CAG ACC CIG GTC AAT TCP 
Ala:. Asp His Lsu Asn Ser Thr Asn His Ala lie Val Gin Thr Leu Val Asn Ser 

1497 1512 1527 1542 

GTC AAT TCC ACT ATC CCC AAA GCC TGT TCT GIG CCC ACT GAA C3?G ACT GCC ATC 
Val Asn Ser Ser lie Pro lys Ala Cys Cys Val Pro Hir Glu Leu Ser bia lie 

1557 1572 1587 

TCC AIG CIG TAC CIG GAT GAG TAT GAT AAG GTC CTA CTC AAA AAT TAT CAG GAG 
Ser. MET Leu Tyr Leu Asp Glu Tyr Asp Lys Val Val Leu Lys Asn Tyr Gin Glu 

1602 1617 (408) 1636 1646 1656 

ATC CTA GIA GAG GGA TCT GGG TCC GGC TCAGATCAGG CACTCCTTGA GGATAGACAG 
MET" Val Val Glu Gly Cys Gly Cys Arg 

1666 1676 1686 1696 1706 1716 1726 

ATATACACAC CACACACACA CACCACATAC ACCACACACA C^CGTTCCCA TCCACTCACC CACACACTAC 



1736 1746 1756 1766 1776 1786 1796 

ACAGACTGCT TOCTTATAGC TCGACITITA TTTAAAAAAA AAAAAAAAAA AATGGAAAAA ATCCCEAAAC 



1806 1516 1826 1836 1846 1856 1866 

ATTCACCITG ACCTEATTIA TCACITTAGG TCCAAATG3T TKACCATAT TCATCATATA TTTTCACAAA 



187 6 1886 1896 1906 1916 1926 1936 

ATATATEEAT AACEACGTAT TAAAAGAAAA AAATAAAATC AGTCATTAIT TTAAAAAAAA AAAAAAAACT 



1946 

CTAGACTOGA CGGAATTC 



WO 88/00205 



PCT/US87/01S37 



49 

The sequences of BMP-2 Class I and II, as well as 
BMP-3- as shown in Tables III, IV, VII and VIII have significant 
homology to the beta (B) and beta (A) subunits of the inhibins. 
The inhibins are a family of hormones which are presently 
being investigated for use in contraception. See, A. J. 
Mason et al, Nature . 318:659-663 (1985). To a lesser extent 
they are also homologous to Mullerian inhibiting substance 
(MIS--) , a testicular glycoprotein that causes regression of 
the : Mullerian duct during development of the male embryo and 
transforming growth factor-beta (TGF-b) which can inhibit or 
stimulate growth of cells or cause them to differentiate. 
Furthermore, the sequence of Table VII encoding hBMP-2 Class 
II has significant homology to the Drosophila decapentaplegic 
(DPP-C) locus transcript. See, J. Massague, Cell, 49:437-438 
(1987); R. W. Padgett et al, Nature . 325:81-84 (1987); R. L. 
Cate et al, Cell 45: 685-698 (1986) . It is considered possible 
therefore that BMP- 2 Class II is the human homolog of the 
protein made from this transcript from this developmental mutant 
locus. 
C. BMP-3 

Because bovine and human bone growth factor genes are 
presumed to be significantly homologous, oligonucleotide 
probes which have been shown to hybridize to the bovine DNA 
sequence of Table IV. A and IV. B are used to screen a human 
genomic library A human genomic library (Toole et al., 
supra ) is screened using these probes, and presumptive positives 
are isolated and DNA sequence obtained as described above. 
Evidence that this recombinant encodes a portion of the human 
bone* inductive factor molecule relies on the bovine/human 
protein and gene structure homologies. 

Once a recombinant bacteriophage containing DNA 
encoding a portion of the human BMP-3 molecule is obtained 
the human coding sequence is used as a probe as described in 
Example V (A) to identify a human cell line or tissue which 
synthesizes BMP-3. mRNA is selected by oligo (dT) cellulose 



WO 88/00205 



PCT/US87/01S37 



50 

chromatography and cDNA is synthesized and cloned in lambda 
gtlO by established techniques (Toole et al., supra ) . 

Alternatively, the entire gene encoding this human 
bone inductive factor can be identified and obtained in 
additional recombinant clones if necessary. Additional 
recombinants containing further 3 f or 5 ' regions of this 
human bone inductive factor gene can be obtained by identifying 
unique DNA sequences at the end (s) of the original clone and 
using these as probes to rescreen the human genomic library. 
The gene can then be reassembled in a single plasmid by 
standard molecular biology techniques and amplified in 
bacteria. The entire human BMP-3 factor gene can then be 
transferred to an appropriate expression vector. The expression 
vector containing the gene is then trans fected into a mammalian 
cell, e.g. monkey COS cells, where the human gene is transcribed 
and the RNA correctly spliced. Media from the transfected 
cells are assayed for bone inductive factor activity as 
described herein as an indication that the gene is complete. 
mRNA is obtained from these cells and cDNA synthesized from 
this mRNA source and cloned. The procedures described above 
may similarly be employed to isolate other species 1 bone 
inductive factor of interest by utilizing the bovine bone 
inductive factor and/or human bone inductive factor as a 
probe source. Such other species 1 bone inductive factor may 
find similar utility in, inter alia, fracture repair. 

EXAMPLE VI 
Express ion of Bone Inductive Factors, 

In order to produce bovine, human or other mammalian 
bone inductive factors, the DNA encoding it is transferred 
into an appropriate expression vector and introduced into 
mammalian cells by conventional genetic engineering techniques. 

One skilled in the art can construct mammalian 
expression vectors by employing the sequence of Tables II- 



WO 88/00205 



PCT/US87/01537 



51 

VIII or other modified sequences and known vectors, such as 
pCD [Okayama et al., Mol. Cell Biol, , 2:161-170 (1982)] and 
pJL3> pJL4 [Gough et al., EMBO J\, 4:645-653 (1985) ]• The 
transformation of these vectors into appropriate host cells 
can result in expression of osteoinductive factors. One 
skilled in the art could manipulate the sequences of Tables 
II-VIII by eliminating or replacing the mammalian regulatory 
sequences flanking the coding sequence with bacterial sequences 
to create* bacterial vectors for intracellular or extracellular 
expression: by bacterial cells. For example, the coding 
sequences could be further manipulated (e.g. ligated to other 
known linkers or modified by deleting non-coding sequences 
there-from-* or altering nucleotides therein by other known 
techniques)*. The modified bone inductive factor coding 
sequence could then be inserted into a known bacterial vector 
using procedures such as described in T. Taniguchi et al., 
Proc. Natl Acad. Sci. USA . 77:5230-5233 (1980). This exemplary 
bacterial vector could then be transformed into bacterial 
host, cells and bone inductive factor expressed thereby. For 
a strategy; for producing extracellular expression of bone 
inductive factor in bacterial cells., see, e.g. European 
patent application EPA 177,343. 

Similar manipulations can be performed for the 
construction of an insect vector [See, e.g. procedures described 
in published European patent application 155,476] for expression 
in insect cells. A yeast vector could also be constructed 
employing yeast regulatory sequences for intracellular or 
extracellular expression of the factors of the present invention 
by yeast cells. [See, e.g., procedures described in published 
PCT application WO86/00639 and European patent application EPA 
123,289] . 

A method for producing high levels of an osteoinductive 
factor of the invention from mammalian cells involves the 
construction of cells containing multiple copies of the 
heterologous bona inductive factor gene. The heterologous gene 



WO 88/00205 



PCT/US87/01S37 



52 

can be linked to an amplifiable marker, e.g. the dihydrofolate 
reductase (DHFR) gene for which cells containing increased gene 
copies can be selected for propagation in increasing 
concentrations of methotrexate (MTX) according to the procedures 
of Kaufman and Sharp, J. Mol. Biol. P 159:601-629 (1982) . This 
approach can be employed with a number of different cell types. 

For example, a plasmid containing a DNA sequence for 
a bone inductive factor of the invention in operative 
association with other plasmid sequences enabling expression 
thereof and the DHFR expression plasmid pAdA26SV(A)3 [Kaufman 
and Sharp, Mol. Cel l, Biol. . 2:1304 (1982)] can be co-introduced 
into DHFR-deficient CHO cells, DUKX-BII, by calcium phosphate 
coprecipitation and transf ection. DHFR expressing transf ormants 
are selected for growth in alpha media with dialyzed fetal 
calf serum, and subsequently selected for amplification by 
growth in increasing concentrations of MTX (sequential steps 
in 0.02, 0.2, 1.0 and 5uM MTX) as described in Kaufman et 
al., Mol Cell Biol., 5:1750 (1983). Transf ormants are cloned, 
and biologically active bone inductive factor expression is 
monitored by rat bone formation assay. Bone inductive factor 
expression should increase with increasing levels of MTX 
resistance. Similar procedures can be followed to produce 
other bone inductive factors. 

Alternatively, the human gene is expressed directly, 
as described above. Active bone inductive factor may be 
produced in bacteria or yeast cells. However the presently 
preferred expression system for biologically active recom- 
binant human bone inductive factor is stably transformed CHO 
cells. 

As one specific example, to produce the human bone 
inductive factor (hBMP-1) of Example V, the insert of U20S-1 
is released from the vector arms by digestion with Sal I and 
subcloned into the mammalian expression vector pMT2CX digested 
with Xho I. Plasmid DNA from this subclone is transf ected 
into COS cells by the DEAE-dextran procedure [Sompayrac and 



WO 88/00205 



PCT/US87/01537 



53 

Danna PNAS 7_8: 7575-7578 (1981); Luthman and Magnusson, 
Nucl. Acids Res , 11: 1295-1308 (1983)]. Serum-free 24 hr. 
conditioned medium is collected from the cells starting 40- 
70 hr, post-transfection. 

The mammalian expression vector pMT2 Cla-Xho (pMT2 
CX) is a derivative of p91023 (b) (Wong et al., Science 
228.: 810-815, 1985) differing from the latter in that it 
contains the arapicillin resistance gene in place of the 
tetracycline resistance gene and further contains a Xhol site 
for insertion of cDNA clones. The functional elements of 
pMT2 ; Cla-Xho have been described (Kaufman, R.J., 1985, Proc. 
Natl.. Acad. Sci. USA 82.: 689-693) and include the adenovirus 
VA- genes, the SV40 origin of replication including the 72 bp 
enhancer, the adenovirus major late promoter including a 5* 
splice site and the majority of the adenovirus tripartite 
leader sequence present on adenovirus late mRNAs, a 3* splice 
acceptor site, a DHFR insert, the SV40 early polyadenylation 
site (SV40) , and pBR322 sequences needed for propagation in 
E '. . coli. 

Plasmid pMT2 Cla-Xho is obtained by EcoRI digestion of 
pMT2-VWF, which has been deposited with the American Type 
Culture Collection (ATCC) , Rockville, MD (USA) under accession 
number ATCC 67122. EcoRI digestion excises the cDNA insert 
present in pMT2-VWF, yielding pMT2 in linear form- which can be 
ligated and used to transform E. coli HB 101 or DH-5 to 
ampicillin -resistance. "Plasmid pMT2 DNA can be prepared by 
conventional methods. pMT2CX is then constructed by digesting 
pMT2 with Eco RV and Xbal, treating the digested DNA with 
Klenow fragment of DNA polymerase I, and ligating Cla linkers 
(NEBiolabs, CATC6AT6) . This removes bases 2266 to 2421 
starting from the Hind III site near the SV40 origin of 
replication and enhancer sequences of pMT2 • Plasmid DNA is 
then digested with EcoRI, blunted as above, and ligated to an 
EcoRI adapter, 

5 1 PO4 -AATTCCTCGAGAGCT 3 1 



WO 88/00205 



PCT/US87/01537 



54 

3 1 6GAGCTCTC6A 5 f 
digested with Xhol, and ligated, yielding pMT2 Cla-Xho, which 
may then be used to transform E. coli to ampicillin resistance, 
Plasmid' pHT2 Cla-Xho DNA may be prepared by conventional 
methods • 

Example VII 

Biological Activity of Expressed Bone Inductive Factor 
A. BMP-1 

To measure the biological activity of the expressed bone 
inductive factor (hBMP-1) obtained in Example VI above. The 
factor is partially purified on a Heparin Sepharose column. 
4 ml of transfection supernatant from one 100 mm dish is 
concentrated approximately 10 fold by ultrafiltration on a YM 
10 membrane and then dialyzed against 20mM Tris, 0.15 M NaCl, 
pH 7.4 (starting buffer). This material is then applied to a 
1.1 ml Heparin Sepharose column in 'starting buffer. Unbound 
proteins are removed by an 8 ml wash of starting buffer, and 
bound. proteins, including BMP-1, are desorbed by a 3-4 ml wash 
of 20 mM Tris, 2.0 M Nad, pH 7.4. 

The proteins bound by the Heparin column are 
concentrated approximately 10-fold on a Centricon 10 and the 
salt reduced by diaf iltration with 0.1% trifluoroacetic acid. 
The appropriate amount of this solution is mixed with 20 mg 
of rat matrix and then assayed for in vivo bone and cartilage 
formation as previously described in Example III. A mock 
transfection supernatant fractionation is used as "a control. 

The implants containing rat matrix to which specific 
amounts- of human BMP-1 have been added are removed from rats 
after seven days and processed for histological evaluation. 
Representative sections from each implant are stained for the 
presence of new bone mineral with von Kossa and acid fuschin, 
and for the presence of cartilage-specific matrix formation 
using toluidine blue* The types of cells present within the 
section, as well as the extent to which these cells display 
phenotype are evaluated. 



WO 88/00205 



PCT/US87/01S37 



55 

Addition of human BMP-1 to the matrix material resulted 
in formation of cartilage-like nodules at 7 days post 
implantation. The chondroblast-type cells were recognizable 
by shape and expression of metachromatic matrix. The amount 
of activity observed for human BMP-1 was dependent upon the 
amount of human BMP-1 protein added to the matrix. Table IX 
illustrates the dose-response relationship of human BMP-1 
protein to the amount of bone induction observed. 

Table IX 

IMPLANT NUMBER AMOUNT USED HISTOLOGICAL SCORE 

(equivalent of ml 
transfection media) 

876-134-1 10 BMP-1 C+2 

876-134-2 3 BMP-1 C+l 

876-134-3 1 BMP-1 C +/" 

876-134-4 10 MOCK C - 

876-134-5 3 MOCK C - 

876-134-6 1 MOCK C - 

Cartilage (c) activity was scored on a scale from 0(-) to 5. 



Similar levels of activity are seen in the Heparin 
Sepharose fractionated COS cell extracts. Partial purification 
is accomplished in a similar manner as described above except 
that 6 M urea is included in all the buffers. Further, in a 
rat bone formation assay as described above, BMP-2 has similarly 
demonstrated chondrogenic activity. 

The procedures described above may be employed to 
isolate other bone inductive factors of interest by utilizing 
the bovine bone inductive factors and/or human bone inductive 
factors as a probe source. Such other bone inductive factors 
may find similar utility in, inter alia, fracture repair. 

The foregoing descriptions detail presently preferred 
embodiments of the present invention. Numerous modifications 



WO 88/00205 



PCT/US87/01S37 



56 

and variations in practice thereof are expected to occur to 
those skilled in the art upon consideration of these descrip- 
tions. Those modifications and variations are believed to be 
encompassed within the claims appended hereto. 



WO 88/00205 



57 



PCT/US87/01S37 



International Application No: PCT/ 



MICROORGANISMS 

Option*! Sneet In connection with tn* microorganism referred to en page , Hno- 



_ of the description » 



A. IDENTIFICATION OF DEPOSIT • 

Further deposits are Identified on an additional a he* I Q » 



Nam* of deooeitary inatltutlon * 



American Type Culture Collection 



Addreee of depositary inatltutlon (including postal coda and country) * 



12301 Parklawn Drive 
Rockville, Maryland. 20852 USA 



Name of 
Deposit 



ATCC No. 



LP-H1 40311 

bP50 40295 

bP-21 40310 

U20S-3 40342 
Lambda U2-0S-1 40343 

Lambda BP819 40344 

U20S-39 40345 



Referred to on 
page/line 

29/20 

20/3 

22/18 

44/22 

32/33 

25/23 

39/21 



Date of 
peposjt 



March 4, 1987 
December 15, 19(86 
March 4, 1987 
June 16, 1987 
June 16, 1987 
June 16, 1987 
June 16, 1987 



C. DESIGNATED STATES FOR WHICH INDICATIONS ARC MADE » (if th« indication* ara not tor all designeteo States) 



D. SEPARATE FURNISHING OF INDICATIONS • (laava clank it noi fipohcaole) 



Tn« indications luted balow *>II be auOmmao to the International Bureau later • (Specify the general nature of the indlcationa e.g., 
'Accession Number of Deposit") 



E. .p^Tm, aneot «»a» received witn tne international application when filed (to Pa cheesed by the receiving Office) 

(Authorized Officer) 
' — 1 The date of receipt (from the applicant) by the International Bureau >° 




nit 



(Authomed Officer) 



Form PCT.RO 134 (January 1981) 



WO 88/00205 



PCT/US87/01537 



58 

WHAT IS CLAIMED IS: 

1..- A pharmaceutical composition comprising a protein 

selected from the group consisting of: 

(a) BMP-1; 

(b) BMP-2 Class. I; 

(c) BMP-2 Class II; 

(d) BMP-3; and 

mixtures: thereof, in a pharmaceutical^ acceptable vehicle. 
21. A composition of Claim 1 wherein said protein is BMP- 

1".. 

3*;, A composition of Claim 1 wherein said protein is BMP— 

2- Class: i.. 

*• A composition of Claim 1 wherein said protein is BMP- 

2 Class II. 

5« A composition of Claim 1 wherein said protein is BMP- 

3. 

6. The pharmaceutical composition of Claim 1 further 

comprising a matrix capable of delivering the composition to 
the site of the bone defect and providing a structure for 
inducing: bone formation. 

7.. The composition of Claim 6 wherein said matrix comprises 

a material selected from the group consisting of hydroxyapatite, 

collagen, polylactic acid and tricalcium phosphate. 

8.. A method for inducing bone formation in a patient in 

need of same comprising administering to said patient an 

effective amount of a composition of Claim 1-7. 

9. A process for producing BMP-1 comprising culturing in 

a suitable culture medium a cell line transformed with a DNA 

sequence, encoding BMP-1, said DNA sequence being in relative 

association with an expression control sequence -therefor, and 

isolating BMP-1 from said culture medium. 

I. 0. A process according to Claim 9 wherein said DNA sequence 
comprises substantially the nucleotide sequence of Table VI. 

II. A process for producing BMP-2 Class I comprising 
culturing in a suitable culture medium a cell line transformed 



WO 88/0020S 



PCT/US87/01537 



59 

with a DNA sequence encoding BMP-2 Class I, said DNA sequence 
being in relative association with an expression control 
sequence therefor, and isolating BMP-2 Class I from said 
culture medium* 

12. A process for according to Claim 11 wherein said DNA 
sequence comprises substantially the nucleotide sequence of 
Table VII. 

13.. A process for producing BMP-2 Class II comprising 
culturing in a suitable culture medium a cell line transformed 
with' a DNA sequence encoding BMP-2 Class II, said DNA sequence 
being in relative association with an expression control 
sequence therefor, and isolating BMP-2 Class II from said 
culture medium. 

14. A process according to Claim 13 wherein said DNA 
sequence comprises substantially the nucleotide sequence of 
Table VIII. 

15. A process for producing BMP-3 comprising culturing in 
a suitable culture medium a cell line transformed with a DNA 
sequence encoding BMP-3, said DNA sequence being in relative 
association with an expression control sequence therefor and 
isolating BMP-3 from said culture medium. 

16. A process according to Claim 15 wherein said DNA 
sequence comprises substantially the nucleotide sequence of 
Table IVA and IVB. 

17. A cDNA sequence encoding BMP-1 comprising substantially 
the nucleotide sequence of Table VI or a sequence which 
hybridize thereto under stringent conditions and which upon 
expression codes for a protein exhibiting substantial properties 
of BMP-1. 

18. A cDNA sequence encoding BMP-2 Class I comprising 
substantially the nucleotide sequence of Table VII or a sequence 
which hybridizes thereto under stringent conditions and which 
upon expression codes for a protein exhibiting substantial 
properties of BMP-2 -Class I. 

19. A cDNA sequence encoding BMP-2 Class II comprising 



WO 88/00205 



PCT/US87/01S37 



60 

substantially the nucleotide sequence of Table VIII or a 
sequence which hybridizes thereto under stringent conditions 
and which upon expression codes for a protein exhibiting 
substantial properties of BMP-2 Class II. 

20. A cDNA sequence encoding BMP-3 comprising substantially 

the nucleotide sequence of Table IVA and IVB or a sequence 
which hybridizes thereto under stringent conditions and which 
upon expression codes for a protein exhibiting substantial 
properties of BMP-3. 



WO 88/00205 6 1 PCT/LS87/01537 

AMENDED CLAIMS 

[received by the International Bureau on 8 December 1987 (08.12.87) 
original claims 6, 8, 10, 12, 14, 16-20 amended; 
new claims 21-23 added; other claims unchanged (13 pages)] 

1. A pharmaceutical composition comprising a protein 
selected from the group consisting of: 

(a) BMP-i; 

(b) BMP-2 Class I; 

(c) BMP-2 Class II; 

(d) BMP-3; and 

mixtures thereof, in a pharmaceutical ly acceptable vehicle. 

2- A composition of Claim 1 wherein said protein is BMP- 
r-. 

a.. A composition of Claim 1 wherein said protein is BMP- 
2 Class I. 

4. A composition of Claim 1 wherein said protein is 8MP- 
2 Class II. 

5. A composition of Claim 1 wherein said protein is BMP- 
3. 

6. The pharmaceutical composition of Claim 1 further 
comprising a matrix capable of delivering the composition to 
the site of the bone or cartilage defect and providing a 
structure for inducing bone or cartilage formation. 

7. The composition of Claim 6 wherein said matrix comprises 
a material selected from the group consisting of 
hydroxyapatite, collagen, polylactic acid and tricalcium 
phosphate. 

8. A method for inducing bone or cartilage formation in a 
patient in need of same comprising administering to said 
patient an effective amount of a composition of Claim 1-7. 



WO 88/00205 1 



62 



PCT/US87/01537 



9. A process for producing BMP-1 comprising the steps of 
culturing in a suitable culture medium a host cell 
transformed with a DNA sequence encoding BMP-1, said DNA 
sequence being in relative association with an expression 
control sequence therefor; and isolating said BMP-1 
therefrom. 

10. A process according to Claim 9 wherein said DNA sequence 

comprises substantially the nucleotide sequence as follows: 

10 20 30 50 

CEAGfiGGCOG CITCCCTCGC CGCCGCCO0G CCAGC AUG CCC GGC GIG GCC OGC CTG COS 

MET Pro Gly Val Ala Arg Leu Pro 

65 80 95 110 

CDS" CSS - CDC GGG CIG CIG CIG CTC CCG OCT CCC GGC GGG COS CPS GAC TIG GCC 
Leu Leu Leu Gly Leu Leu Leu Leu Pro Arg Pro Gly Arg Pro Leu Asp Leu Ala 

125 140 155 

GAC TAG ACC TAT GAC CIG GGG GAG GAG GAC GAC TOG GAG CCC CTC AAC TAC AAA 
Asp Tyr Thr Tyr Asp leu Ala Glu Glu Asp Asp Ser Glu Pro Leu Asn Tyr Lys 

170 185 200 215 

GAC CCC TGC AAG GGG GCI GCC TTT CIT GGG GAC ATT GCC CTG GAC GAA GAG GAC 

Asp Pro Cys Lys Ala Ala Ala Hie Leu Gly Asp He Ala Leu Asp Glu Glu Asp 

230 245 260 275 

CTG AGG GCC TTC CAG GTA CAG CAG GCT GTG GAT CTC AGA GGG CAC ACA GCT GCT 
Leu .Arg Ala Hie Gin Val Gin Gin Ala Val Asp Leu Arg Arg His Thr Ala Arg 

290 305 320 

AAG TCC TCC ATC AAA GCT GCA GIT CCA GGA AAC ACT TCT ACC OGC AGC TGC CAG 
Lys Ser Ser lie Lys Ala Ala Val Pro Gly Asn Thr Ser Thr Pro Ser Cys Gin 

335 350 365 380 

AGC ACC AAC GGG CAG CCT CAG AGG GGA GCC TCT GGG AGA TGG AGA GCT AGA. TCC 
Ser Thr Asn Gly Gin Pro Gin Arg Gly Ala Cys Gly Arg 02p Arg Gly Arg Ser 

395 410 425 

OCT AGC GGG GGG GOG GGG AGG TGC GGA GCA -GAG GCT GTG TGG GCC GAT GGG GTC 
Arg Ser Arg Arg Ala Ala Thr Ser Arg Pro Glu Arg Val Trp Pro Asp Gly ^Val 

440 455 470 485 

ATC CCC TIT GTC ATT GGG GGA AAC TIC ACT GCT AGC GAG AGG GCA GTC TTC GGG 

lie Pro Hie Val lie Gly Gly Asn Hie Thr Gly Ser Gin Arg -Ala Val Hie Arg 

500 515 530 545 

CAG GCC ATG AGG CAC TGG GAG AAG CAC AGC TCT GTC AGC TTC CTG -GAG <3GC ACT 
Gin Ala MET Arg His Trp Glu Lys His Thr Cys Val Thr Hie Leu Glu Arg Thr 



WO 88/00205 



63 



PCT/LS87/01537 



560 575 590 

GAC GAG GAC AGC TAT ATT GIG TTC ACC TAT OGA OCT TGC GGG TGC TGC TGC TAC 
Asp Glu Asp Ser Tyr He Val Hie Thr Tyr Arg Pro Cys Gly Cys Cys Ser Tyr 

605 620 635 650 

GIG GGT OGC OGC GGC GGG GGC CCC GAG GCC ATC TCC ATC GGC AAG AAC TGT GAC 
Val Gly Arg Arg Gly Gly Gly Pro Gin Ala He Ser He Gly Lys Asn cys Asp 

665 680 695 

AAG TTC GGC ATT GIG GTC CAC GAG CIG GGC CAC GTC GTC GGC TTC TGG CAC GAA 
Lys Hie Gly lie Val Val His Glu Leu Gly His Val Val Gly Hie Trp His Glu 

710 725 740 755 

CAC ACT CGG CCA GAC OGG GAC OGC CAC GIT TCC ATC GET GGT GAG AAC ATC CAG 

His Thr Arg Pro Asp Arg Asp Arg His Val Ser lie Val Arg Glu Asn lie Gin 

770 785 800 815 

CCA GGG CAG GAG TAT AAC TTC CIG AAG ATG GAG OCT CAG GAG GIG GAG TCC CIG 
Pro Gly Gin Glu Tyr Asn Hie Leu Lys MET Glu Pro -Gin -Glu Val Glu Ser Leu 

830 845 860 

GGG GAG ACC TAT GAC TTC GAC AGC ATC ATG CAT TAC -GCT OGG AAC ACA TTC TCC 
Gly Glu Thr Tyr Asp Hie Asp Ser lie MET His Tyr Ala Arg Asn Thr Hie Ser 

875 890 905 920 

AGG GGC ATC TTC CIG GAT ACC AIT -GTC CCC AAG TAT GAG GIG AAC GGG GTG AAA 
Arg Gly lie Hie Leu Asp Thr He Val Pro Lys Tyr Glu Val Asn Gly Val Lys 

935 950 965 

OCT CCC AIT GGC CAA AGG ACA OGG CTC AGC AAG GGG GAC ATT GGC CAA GCC GGC 
Pro Pro He Gly Gin Arg Thr Arg Leu Ser Lys Gly Asp lie Ala Gin Ala Arg 

980 995 . 1010 1025 

AAG CTT TAC AAG TGC OCA GCC TGT GGA GAG ACC CIG CAA 'GAC AGC ACA GGC AAC 

Lys Leu Tyr Lys Cys Pro Ala Cys Gly Glu Thr Leu Gin Asp Ser Thr Gly Asn 

1040 1055 1070 1085 

TTC TCC TCC OCT GAA TAC CCC AAT GGC TAC TCT GCT CAC ATG CAG TGC GIG TGG 
Hie Ser Ser Pro Glu Tyr Pro Asn Gly Tyr Ser Ala His MET His Cys Val Trp 

1100 1115 1130 

OGC ATC TCT GTC ACA CCC GGG GAG AAG ATC ATC CIG AAC TTC AGG TCC CIG GAC 
Arg lie Ser Val Thr Pro Gly Glu Lys lie He Leu Asn Hie Thr Ser Leu Asp 

1145 1160 1175 1190 

CIG TAC OGC AGC GGC CIG TGC TGG TAC GAC TAT GIG «GAG GTC GGA -GAT -GGC TTC 
Leu Tyr Arg Ser Arg Leu Cys Trp Tyr Asp Tyr Val Glu Val Arg Asp -Gly Hie 

1205 1220 1235 

TGG AGG AAG GOG CCC CTC GGA GGC GGC TTC TGC -GGG TCC AAA CTC OCT GAG OCT 
Trp Arg Lys Ala Pro Leu Arg Gly Arg Hie Cys Gly Ser Lys Leu Pro Glu Pro 



WO 88/00205 



PCT/US87/01537 



64 

1250 1265 1280 1295 

ATC GTC TCC ACT GAC AGC OGC CTC TGG GIT GAA TIC OGC AGC AGC AGC AAT TGG 

lie Val Ser Thr Asp Ser Arg Leu Trp Val Glu Hie Arg Ser Ser Ser Asn Trp 

1310. 1325 1340 1355 

GIT GGA AAG-GGC CTC TIT GCA GTC TAC GAA GCC ATC TGC GGG GGT GAT GIG AAA 
Val Gly LysrGly His Hie Ala Val Tyr Glu Ala lie O/s Gly Gly Asp Val Lys 

1370 1385 1400 

AAG GAC TAT GGC CAC ACT CAA TOG CCC AAC TAC CCA GAC GAT TAC OGG CCC AGC 
lys Asp Tyr Gly His lie Gin Ser Pro Asn Tyr Pro Asp Asp Tyr Arg Pro Ser 

1415 1430 1445 1460 

AAA GTC TGC ATC TGG OGG ATC CAG GTG TCI GAG GGC CTC CAC G2G GGC CTC ACA 
Lys. Val Cys:Ile Trp Arg lie Gin Val Ser Glu Gly Hie His Val Gly Leu Thr 

1475 1490 1505 

CTC* CAG TOCCTT GAG ACT GAG CGC CAC GAC AGC TGT GOC TAC GAC TAT CTG GAG 
HteGln.Ser Hte Glu lie Glu Arg His Asp Ser Cys Ala Tyr Asp Tyr Leu Glu 

1520 1535 1550 1565 

GIG CGC-GAC GGG CAC AGT GAG AGC AGC ACC CTC ATC GGG CGC TAC TGT GGC TAT 

Val-Arg Asp Gly His Ser Glu Ser Ser Thr Leu lie Gly Arg Tyr Cys Gly Tyr 

1580 1595 1610 1625 

GAG AAG CCT GAT GAC ATC AAG AGC AOG TCC AGC GGC CTC TGG CTC AAG CTC GTC 
Glu Lys Pro Asp Asp lie Lys Ser Thr Ser Ser Arg leu Trp Leu Lys Hie Val 

1640 1655 1670 

TCT GAC GGG TCC ATT AAC AAA GOG GGC TIT GCC GTC AAC TIT CTC AAA GAG GTG 
Ser Asp. Gly Ser lie Asn Lys Ala Gly Hie Ala Val Asn Hie Hie Lys Glu Val 

1685 1700 1715 1730 

GAC GAG TGC TCT OGG- CCC AAC GGC GGG GGC TCT GAG CAG OGG TGC CTC AAC ACC 
Asp Glu cys Ser Arg Pro Asn Arg Gly Gly Cys Glu -Gin Arg cys Leu Asn Thr 

1745 1760 1775 

CTG GGC AGC TAC AAG TGC AGC TGT GAC CCC GGG TAC GAG CTG GOC OCA -GAC AAG 
Leu Gly Ser Tyr Lys Cys Ser Cys Asp Pro Gly Tyr Glu Leu Ala Pro Asp Lys 

1790 1805 1820 1835 

OGC CGC TGT GAG GCT GCT TGT GGC GGA CTC CTC ACC AAG CTC AAC GGC TCC ATC 

Arg Arg; Cys Glu Ala Ala Cys Gly Gly Hie Leu Thr Lys Leu Asn Gly Ser lie 

1850 1865 1880 1895 

ACC AGC" COG GGC TGG CCC AAG GAG TAC GOC CCC AAC AAG AAC TGC ATC TGG CAG 
Thr Ser . Pro Gly Trp Pro Lys Glu Tyr Pro Pro Asn Lys Asn Cys lie Trp Gin 

1910 1925 1940 

CTG CTG GOC CCC ACC CAG TAC OGC ATC TOG CTG CAG TIT GAC CTC TIT-GAG ACA 
Leu Val Ala Pro Thr Gin Tyr Arg lie Ser Leu Gin Hie Asp Hie Hie Glu Thr 



WO 88/00205 



PCT/LS87/01S37 



65 



1955 1970 1985 2000 

GAG GGC AAT GAT GIG TCC AAG TAC GAC TIC GIG GAG GTC OGC AGT GGA CTC AGA 
Glu Gly Asn Asp Val Cys Lys Tyr Asp Hie Val Glu Val Arg Ser Gly Leu Thr 

2015 2030 2045 

GCT GAC TCC AAG CTG CAT GGC AAG TIC TCT GGT TCP GAG AAG OCC GAG CTC ATC 
Ala Asp Ser Lys Leu His Gly Lys Hie Cys Gly Ser Glu Lys Pro Glu Val lie 

2060 2075 2090 2105 

ACC TCC GAG TAC AAC AAC ATG OGC GIG GAG TTC AAG TCC GAC AAC ACC GIG TCC 

Thr Ser Gin Tyr Asn Asn MET Arg Val Glu Hie Lys Ser Asp Asn Thr Val Ser 

2120 2135 2150 2165 

AAA AAG GGC TIC AAG GCC CAC TTC TTC TGA GAA AAG AGG CCA GCT CIG CAG OCC 
Lys Lys Gly Hie Lys Ala His Hie Hie Ser Glu Lys Arg Pro Ala Leu Gin Pro 

2180 2195 2210 

CCT OGG GGA OGC COC CAC CAG CTC AAA TIC OGA GIG CAG AAA AGA AAC OGG ACC 
Pro Arg Gly Arg Pro His Gin Leu Lys Hie Arg Val Gin Lys Arg Asn Arg Thr 

2225 2235 2245 2255 2265 2275 2285 

CCC CAG TGAGGCdGC CAGGCCTCCC GGACCCCTIG TTACTCAGGA ACCTCACCTT GGAGGGAATG 
Pro Gin 

2295 2305 2315 2325 2335 2345 2355 

GGATGGGGGC TTOGGTGOOC ACCAACOCCC CAOCTCCACT CIGOCATTCC GGCCCAOCTC OCTCTGGCOG 



2365 2375 2385 2395 2405 2415 2425 

GACAGAACTC GTCCTCTCIT CTCCCCACIG TGOOOGTCOG OGGACOGGGG ACOCITCOOC GTGCCCTACC 



2435 2445 2455 2465 2475 2485 2495 

CCCTCCCAST TTGATGGIGT CTGTGAGAIT TCCIGITCTG AAGTAAAAGA GGGACQOCIG GCTCCTGCCT 



CTAGA 



11. A process for producing BMP-2 Class I comprising culturing 
in a suitable culture medium a cell line transformed with a DNA 
sequence encoding BMP-2 Class I, said DNA sequence being in 
relative association with an expression control sequence 
therefor, and isolating BMP-2 Class I from said culture medium. 

12. A process for according to Claim 11 wherein said DNA 
sequence comprises substantially the nucleotide sequence as 



WO 88/00205 



66 



PCT/US87/01537 



follows: 

10 20 30 40 50 60 70 

GTCGACTCTA GAGTGTGTGT CAGCACITGG CIGGGGACIT CCTGAACITG CAGGGAGAAT AACITGGGCA 

80 90 100 110 120 130 140 

CCCCACTTIG OGCCGGTGOC TTIGCCCCAG CGGAGCCTGC TIOXCKJXT 00GAGO0CCA OCmXXTGC 

150 160 170 180 190 200 210 

ACTOCTOGGC CITGCCOGAC ACTGAGACGC TCITCCCAGC GTGAAAAGAG AGACEGGGGG GCOGGCAOOC 



220 230 240 250 260 270 280 

GGGAGAAGGA. GGAGGCAAAG AAAAGGAAOG GACAITOGGT (XTIGCGCCA GGTCCITIGA CCAGAGITIT 

29CT 300 310 320 330 340 350 

TCC^ICTGGAvOGCICI^^ ATGGAOCTCT COCCGGGTGC TTCTEAGAOG GACTGOGGTC TGCEAAAGCT 

370 385 400 

CaCCZATGGIG GCC GGG ACC OGC TCT CTT CIA GOG TIG CTG CIT CCC CAG GTC 
MET Val Ala Gly Thr Arg Cys Leu Leu Ala Leu Leu Leu Pro Gin Val 

415- 430 445 

crc ;cdg;ggc ggc gog gct ggc ctc git GOG GAG CTG ggc gsc AGG aag TTC GOG 
Leu Leu Gly Gly Ala Ala Gly Leu Val Pro Glu Leu Gly Arg Arg Lys Hie Ala 

460 475 490 505 

GOG GOG TOG TOG GGC OGC CCC TCA TOC CAG CCC TCP GAC GAG CTC CTG AGO GAG 

Ala Ala Ser Ser Gly Arg Pro Ser Ser Gin Pro Ser Asp Glu Val Leu Ser Glu 

520 535 550 565 

TTC -GAG TIG OGG CTG CTC AGO AUG TTC GGC CTG AAA CAG AGA CCC ACC CCC AGC 
Hie Ghi Leu Arg leu Leu Ser MET Hie Gly Leu Lys Gin Arg Pro Thr Pro Ser 

580 595 610 

AGG "GAG GCC GIG GIG CCC CCC TAC AUG CEA GAC CTG TAT OGC AGG CAC TOG GCT 
Arg Asp Ala Val Val Pro Pro Tyr MET Leu Asp leu Tyr Arg Arg His Ser Gly 

625 640 655 670 

CAG COG GGC TCA CCC GCC CCA GAC CAC CGG TTG GAG AGG CCA GCC AGC OGA GCC 
Gin Pro Gly Ser Pro Ala Pro Asp His Arg Leu Glu Arg Ala Ala Ser Arg Ala 

685 700 715 

AAC ACT GIG OGC AGC TTC CAC CAT GAA GAA TCT TIG GAA GAA CEA CCA GAA AGG 
Asn Thr Val Arg Ser Hie His His Glu Glu Ser Leu Glu Glu Leu Pro Glu Thr 

730 745 760 775 

ACT GGG. AAA ACA ACC GGG AGA TTC TTC TIT AAT TEA AGE TCT ATC CCC AGG GAG 

Ser GlyLys Thr Thr Arg Arg Hie Hie Hie Asn Leu Ser Ser lie Pro Thr Glu 

790 805 820 835 

GAG TTT ATC ACC TCA GCA GAG CTT CAG CTT TTC GGA GAA CAG ATG CAA <SAT GCT 
Glu Hie lie Thr Ser Ala Glu Leu Gin Val Hie Arg Glu Gin MET Gin Asp Ala 



WO 88/0020S 



67 



PCT/US87/01537 



850 865 880 

TTA GGA AAC AAT AGC ACT TIC CAT CAC OGA ATT AAT ATT TAT GAA ATC ATA AAA 
Leu Gly Asn Asn Ser Ser Hie His His Arg He Asn He Tyr Glu He He Lys 

895 910 925 940 

CCT GCA ACA GCC AAC TOG AAA TTC CCC GIG ACC ACT CIT TIG GAC AOC AGG TTG 
Pro Ala Thr Ala Asn Ser Lys Hie Pro Val Thr Ser Leu Leu Asp Thr Arg Leu 

955 970 985 

GIG AAT CAG AAT GCA AGC AGG TGG GAA ACT TIT GAT GIC ACC CCC GCT GIG ATG 
Val Asn Gin Asn Ala Ser Arg Trp Glu Ser Hie Asp Val Thr Pro Ala Val MET 

1000 1015 1030 1045 

OGG TGG ACT GCA CAG GGA CAC GCC AAC CAT GGA TIC GTG GIG GAA GTG GCC CAC 

Arg Trp Thr Ala Gin Gly His Ala Asn His Gly Hie Val Val Glu Val Ala His 

1060 1075 1090 1105 

TTG GAG GAG AAA CAA GCT GTC TCC AAG AGA CAT GIT AGG ATA AGC AGG TCT TTG 
Leu Glu Glu Lys Gin Gly Val Ser Lys Arg His Val Arg He Ser Arg Ser Leu 

1120 1135 1150 

CAC CAA GAT GAA CAC AGC TGG TCA CAG ATA AGG GCA TTG CIA GTA ACT ITT GGC 
His Gin Asp Glu His Ser Trp Ser Gin He Arg Pro Leu Leu Val Thr Hie Gly 

1165 1180 U95 1210 

CAT GAT GGA AAA GGG CAT CCT CTC CAC AAA AGA GAA AAA CCT CAA GCC AAA CAC 
His Asp Gly Lys Gly His Pro Leu His Lys Arg Glu Lys Arg Gin Ala Lys His 

1225 1240 1255 

AAA CAG OGG AAA OGC CIT AAG TCC AGC TCT AAG AGA CAC OCT TTG TAC GTG GAC 
Lys Gin Arg Lys Arg Leu Lys Ser Ser Cys Lys Arg His Pro Leu Tyr Val Asp 

1270 1285 1300 1315 

TTC ACT GAC GIG GGG TGG AAT GAC TGG ATT GTG GCT GGC COG GGG TAT CAC GCC 

Hie Ser Asp Val Gly Trp Asn Asp Trp lie Val Ala Pro Pro -Gly Tyr His Ala 

1330 1345 1360 1375 

TIT TAC TGC CAC GGA GAA TGC CCT TIT CCT CIG GCT GAT CAT CIG AAC TCC ACT 
Hie Tyr Cys His Gly Glu Cys Pro Hie Pro Leu Ala Asp His Leu Asn Ser Thr 

1390 1405 1420 

AAT CAT GCC AIT GTT CAG AOG TTG GTC AAC TCT GFT AAC TCT AAG ATT GCT AAG 
Asn His Ala lie Val Glu Thr Leu Val Asn Ser Val Asn Ser Lys lie Pro Lys 

1435 1450 1465 1480 

GCA TGC TCT GTC COG ACA GAA CTC ACT GCT ATC TGG ATG CIG TAC CIT GAC GAG 
Ala cys Cys Val Pro Thr Glu Leu Ser Ala lie Ser MET Leu Tyr Leu Asp -Glu 



WO 88/00205 



68 



PCT/US87/01537 



1495 1510 1525 

AAT GAA AAG GTT GEA HA AAG AAC TAT CAG GAC ATG GIT GIG GAG GGT TGT GGG 
Asn Glu Lys Val Val Leu Lys Asn Tyr Gin Asp MET Val Val Glu Gly Cys Gly 

1540 1553 1563 1573 1583 1593 1603 

TGT OGC TAGEACAGCA AAATTAAATA CATAAATATA TATATATATA TATAl'lTilAG AAAAAAGAAA 

Cys Arg 
AAAA 



13. A process for producing BMP-2 Class II comprising culturing 
in a suitable culture medium a cell line transformed with a DNA 
sequence encoding BMP-2 Class II > said DNA sequence being in 
relative association with an expression control sequence 
therefor, and isolating BMP-2 Class II from said culture medium. 



14. A process according to Claim 13 wherein said DNA sequence 
comprises substantially the nucleotide sequence as follows: 



10 


20 


30 


40 


50 


60 70 


CTCTAGAGGG 


CAGAGGAGGA 


GGGAGGGAGG 


GAAGGAGCGC 


GGAGCCGGGC 


CGGGAAGCEA GGIGAGPGTC 


80 


90 


100 


110 


120 


130 140 


GCATCCGAGC 


TCAGGGACGC 


GAGCCIGAGA 


GGOOGCPGCT 


GCTCC3GGCIG 


AGIATCESGC TTGTCTCCCC 


150 


160 


170 


180 


190 


200 210 


GATGGGATTC 


CCCTCCAAGC 


TATCTOGAGC 


CTCCAGCGCC 


ACAGEGCCGG 


GCCCTGGCCC AGGITCACPG 


220 


230 


240 


250 


260 


270 280 


CAACCGITCA 


GAGGTCOGCA 


GGAGCIGCIG 


CTGGCGAGCC 


GGCTACTCCA 


GGGACCEATG GAGCCMTCC 


290 


300 


310 


320 


330 


340 350 


GEAGIGCCAT 


CCCGAGCAAC 


GCACIGCIGC 


AGCITCCCIG 


AGOCTTTCCA 


«aauri'iur tcaagaitgg 


360 


370 


380 


390 


400 




CIGTCAAGAA 


TCATGGACTG 


ITATEATATG 




TCTCAAGACA 


CC ATC AIT GCT 












MET lie -Pro 


417 




432 




447 


4€2 



GGT AAC GGA AUG CTG AUG GTC GIT TTA TEA TGC CAA GTC CIG CIA GGA GGC GGG 
Gly Asn Arg MET Leu MET Val Val Leu Leu Cys Gin Val Leu Leu Gly Gly Ala 

477 492 507 

AGC CAT GCT AGT TTG ATA CCT GAG AOG GGG AAG AAA AAA GTC GCC -GAG AIT GAG 
Ser His Ala Ser Leu lie Pro Glu Thr Gly Lys Lys Lys Val Ala Glu lie Gin 



WO 88/00205 



69 



PCT/LS87/01537 



522 537 552 567 

GGC CAC GOG GGA GGA OGC OGC TCA GGG CAG AGC CAT GAG CTC CTG OGG GAC TTC 

Gly His Ala Gly Gly Arg Arg Ser Gly Gin Ser His Glu Leu Leu Arg Asp Hie 

582 597 612 627 

GAG GOG AGA CIT CTG CAG AIG TIT GGG CTG OGC OGC OGC COG CAG CCT AGC AAG 
Glu Ala Thr Leu Leu Gin MET Hie Gly Leu Arg Arg Arg Pro Gin Pro Ser Lys 

642 657 672 

AGT GCC GTC ATT COG GAC TAC ATG OGG GAT CTT TAC OGG CIT CAG TCP GGG GAG 
Ser Ala Val He Pro Asp Tyr MET Arg Asp Leu Tyr Arg Leu Gin Ser Gly Glu 

687 702 717 732 

GAG GAG GAA GAG CAG ATC CAC AGC ACT GGT CIT GAG TAT OCT GAG OGC COG GCC 
Glu Glu Glu Glu Gin lie His Ser Thr Gly Leu Glu Tyr Pro Glu Arg Pro Ala 

747 762 777 

AGC OGG GCC AAC ACC GTG AGG AGC TTC CAC CAC GAA GAA CAT CTG GAG AAC ATC 
Ser Arg Ala Asn Thr Val Arg Ser Hie His His Glu Glu His Leu Glu Asn lie 

792 807 822 837 

CCA GGG ACC AGT GAA AAC TCT GCT TIT CCT TTC CTC TIT AAC CTC AGC AGC ATC 

Pro Gly Thr Ser Glu Asn Ser Ala Hie Arg Hie Leu Hie Asn Leu Ser Ser He 

852 867 882 897 

CCT GAG AAC GAG GOG ATC TCC TCT GCA GAG CTT OGG CTC TTC OGG -GAG CAG GTG 

Pro Glu Asn Glu Ala lie Ser Ser Ala Glu Leu Arg Leu Hie Arg Glu Gin Val 

912 927 942 

GAC CAG GGC OCT GAT TGG GAA AGG GGC TTC CAC OCT ATA AAC ATT TAT GAG CTT 
Asp Gin Gly Pro Asp Trp Glu Arg Gly Hie His Arg He Asn He Tyr -Glu Val 

957 972 987 1002 

ATG AAG COC CCA GCA GAA GTG CTG CCT GGG CAC CTC ATC ACA GGA CIA CTG GAC 
MET Lys Pro Pro Ala Glu Val Val Pro Gly His Leu lie Thr Arg Leu Leu Asp 

1017 1032 1047 

AOG AGA CTG GTC CAC CAC AAT GIG ACA OGG TGG GAA ACT ITT GAT GTG AGC OCT 
Thr Arg Leu Val His His Asn Val Thr Arg Trp Glu Thr Hie Asp Val Ser Pro 

1062 1077 1092 1107 

GOG GTC CTT OGC TGG ACC OGG GAG AAG CAG CCA AAC TAT GGG CTA GCC ATT GAG 

Ala Val Leu Arg Trp Thr Arg Glu Lys Gin Pro Asn Tyr Gly Leu Ala He Glu 

1122 1137 1152 1167 

GTG ACT CAC CTC CAT CAG ACT GGG ACC CAC CAG GGC CAG CAT GTC AGG ATT AGC 
Val Thr His Leu His Gin Thr Arg Thr His Gin Gly Gin His Val Arg He Ser 

1182 1197 1212 

OGA TOG TTA CCT GAA GGG ACT GGG AAT TGG GGC CAG CTC OGG COC CTC CTG-GIC 
Arg Ser Leu Pro Gin Gly Ser Gly Asn Trp Ala Gin Leu Arg Pro Leu Leu Val 



WO 88/00203 



PCT/US87/01S37 



70 



1227 1242 1257 1272 

ACC TIT GGC CAT GAT GGC OGG GGC CAT GCC TIG ACC CGA GGC OGG AGG GCC AAG 
Thr Hie Gly His Asp Gly Arg Gly His Ala Leu Thr Arg Arg Arg Arg Ala Lys 

1287 1302 1317 

OCT AGC OCT AAG CAT CAC TCA CAG OGG GCC AGG AAG AAG AAT AAG AAC TGC OGG 
Arg Ser Pro Lys His His Ser Gin Arg Ala Arg Lys Lys Asn Lys Asn cys Arg 

1332 1347 1362 1377 

OGC CAC TOG CTC TAT GTG GAC ITC AGC GAT GIG GGC TGG AAT GAC TGG ATT GIG 

Arg His Ser Leu Tyr Val Asp Fhe Ser Asp Val Gly Trp Asn Asp Trp lie Val 

1392 1407 1422 1437 

GCC CCA CCA GGC TAC CAG GCC TTC TAC TGC CAT GGG GAC TGC CCC TTT CCA CIG 
Ala Pro Pro Gly Tyr Gin Ala Rie Tyr cys His Gly Asp Cys Pro Hie Pro Leu 

1452 1467 1482 

GOT GAC CAC CTC AAC TCA ACC AAC CAT GCC ATT GIG CAG ACC CIG GTC AAT TCT 
Ala Asp His Leu Asn Ser Thr Asn His Ala lie Val Gin Thr Leu Val Asn Ser 

1497 1512 1527 1542 

GTC AAT TOC ACT ATC CCC AAA GCC TCT TCT GTG CCC ACT GAA CIG ACT GCC ATC 
Val Asn Ser Ser lie Pro Lys Ala Cys Cys Val Pro Hir Glu Leu Ser Ala lie 

1557 1572 1587 

TCC ATG CIG TAC CIG GAT GAG TAT GAT AAG GTG GEA CIG AAA AAT TAT CAG GAG 
Ser MET Leu Tyr Leu Asp Glu Tyr Asp Lys Val Val- Leu Lys Asn Tyr Gin Glu 

1602 1617 1636 1646 1656 1666 

ATG CTA CTA GAG GGA TCT GGG TGC OGC TGAGATCAGG O&TCCTIGA GGATAGACAG ATATACACAC 
MET Val Val Glu Gly Cys Gly Cys Arg 

1676 1686 1696 1706 1716 1726 1736 

CACACACACA CACCACATAC ACCACACACA CAOGTTGCGA TCCACTCACC CACACACIAC ACAGACTGCT 

1746 1756 1766 1776 1786 1796 1806 

TCTTTATAGC TGGACITTTA STEAAAAAAA AAAAAAAAAA AATGGAAAAA ATCCCIAAAC ACTOKCTIG 

1816 1826 1836 1846 1856 1866 1876 

ACCTTATITA TGACETTAOG TGCAAATGTT TIGACCATAT TGATCATATA TTTPGACAAA ATATA3TTAT 

1886 1896 1906 1916 1926 1936 1946 

AACTACGTAT TAAAAGAAAA AAATAAAATG AGTCATIATT TEAAAAAAAA AAAAAAAACT CTAGAGTGGA 

CGGAATTC 



15,. A process for producing BMP-3 comprising culturing in a 
suitable culture medium a cell line transformed with a DNA 
sequence encoding BMP-3 7 said DNA sequence being in relative 



WO 88/00205 



PCT/LS87/01537 



71 

association with an expression control sequence therefor and 
isolating BMP-3 from said culture medium. 



16, A process according to Claim 15 wherein said DNA sequence 

comprises substantially the nucleotide sequence as follows: 

383 393 403 413 428 

GAGGAGGAAG OGGTCIACGG GGCTCCITCT GCCTCTGCAG AAC AAT GAG CIT CCT GGG GCA 

Asn Asn Glu Leu Pro Gly Ala 

443 458 473 488 

GAA TAT CAG TAC AAG GAG GAT GAA CTA TGG GAG GAG AGG AAG CCT TAC AAG ACT 
Glu Tyr Gin Tyr Lys Glu Asp Glu Val Trp Glu Glu Arg Lys Pro Tyr Lys Thr 

503 518 533 

CCT CAG ACT CAG CCC CCT GAT AAG ACT AAG AAC AAA AAG AAA CAG AGG AAG GGA 
Leu Gin Thr Gin Pro Pro Asp Lys Ser Lys Asn Lys Lys lys Gin Arg Lys Gly 

548 563 578 593 

CCT CAG CAG AAG ACT CAG AOG CTC CAG TTT GAT GAA CAG ACC CIG AAG AAG GCA 
Pro Gin Gin Lys Ser Gin Thr leu Gin Fhe Asp Glu Gin Thr Leu Lys Lys Ala 

608 623 638 

AGA AGA AAG CAA TGG ATT GAA CCC GGG AAT TGT GCC AGA GGG TAC CIT AAA GIG 
Arg Arg Lys Gin Trp lie Glu Pro Arg Asn Cys Ala Arg Arg Tyr Leu Lys Val 

653 668 683 698 

GAC TTC GCA GAT ATT GGC TGG AGC GAA TGG ATT ATT TOC CCC AAG TCC TTC GAT 

Asp Hie Ala Asp lie Gly Trp Ser Glu Trp lie lie Ser Pro Lys Ser Fhe Asp 

713 728 743 756 766 

GCC TAT TAC TGC TCC GGA GGG TGC CAG TIC CCC ATG OCA AAG GIAGCCATIG TTTTTTCTCC 
Ala Tyr Tyr Cys Ser Gly Ala Cys Gin Fhe Pro MET Pro Lys 

776 786 
TGTOdTOCC ATITCCATAG ; and 



284 294 304 319 

CTAACCTCTG TTCTCCCITr TCGTTCCTAG TCT TIG AAG OCA TCA AAT CAC GOT ACC 

Ser Leu Lys Pro Ser Asn His Ala Thr 

334 349 364 379 

ATC CAG ACT ATA GIG AGA GCT GIG GGG CTC GTC -OCT GGA ATC CCC GAG CCT TGC 

He Gin Ser He Val Arg Ala Val Gly Val Val Pro Gly He Pro Glu Pro Cys 

394 409 , 424 439 

TCT CTG CCA GAA AAG ATG TCC TCA CTC AGC ATC TTA TTC TIT -GAT GAA AAC AAG 
Cys Val Pro Glu Lys MET Ser Ser Leu Ser He Leu Fhe Fhe Asp Glu Asn Lys 



WO 88/00205 



PCT/US87/01537 



72 

454 469 484 

AAT "GTC GTA CTT AAA GTA TAT CCA AAC ATS ACA GTA GAG TCT TGT GCT TCC AGA 
Asn V&l Val Leu Lys Val Tyr Pro Asn MET Thr Val Glu Ser Cys Ala Cys Arg 

503 513 523 533 

TAAOCTGGTG AAGAACTCAT CTGGATGCIT AACTCAATCG. 

17. A cDNA sequence encoding BMP-1 comprising substantially the 
nucleotide sequence recited in Claim 10 or a sequence which 
hybridizes thereto under stringent conditions and which upon 
expression codes for a protein exhibiting substantial properties 
of ;BMP-1. 

18 7 .. A cDNA sequence encoding BMP-2 Class I comprising 
substantially the nucleotide sequence recited in Claim 12 or a 
sequence which hybridizes thereto under stringent conditions and 
which upon expression codes for a protein exhibiting substantial 
properties of BMP-2 Class I. 

19. A cDNA sequence encoding BMP-2 Class II comprising 
substantially the nucleotide sequence recited in Claim 14 or a 
sequence which hybridizes thereto under stringent conditions and 
which upon expression codes for a protein exhibiting substantial 
properties of BMP-2 Class II. 

20. A cDNA sequence encoding BMP-3 comprising substantially the 
nucleotide sequence recited in Claim 16 or a sequence which 
hybridizes thereto under stringent conditions and which upon 
expression codes for a protein exhibiting substantial properties 
of BMP-3. 

21. A vector containing a DNA sequence encoding an 
osteoinductive protein and heterologous DNA, the DNA sequence 
encoding; the protein being selected from the group consisting of: 

a. a DNA sequence encoding BMP-1 comprising substantially 
the nucleotide sequence recited in Claim 10 or a sequence which 



WO 88/0020S 



73 



PCT/US87/01S37 



hybridize thereto under stringent conditions and which upon 
expression codes for a protein exhibiting substantial properties 
of . BMP-l; 

b. a DNA sequence encoding BMP-2 Class I comprising 
substantially the nucleotide sequence recited in Claim 12 or a 
sequence which hybridizes thereto under stringent conditions and 
which upon expression codes for a protein exhibiting substantial 
properties of BMP-2 Class I; 

c. a DNA sequence encoding BMP-2 Class II comprising 
substantially the nucleotide sequence recited in Claim 14 or a 
sequence which hybridizes thereto under stringent conditions and 
which upon expression codes for a protein exhibiting substantial 
properties of BMP-2 Class II; and 

d. a DNA sequence encoding BMP-3 comprising substantially 
the nucleotide sequence recited in Claim 16 or a sequence which 
hybridizes thereto under stringent conditions and which upon 
expression codes for a protein exhibiting substantial properties 
of BMP-3. 

22. A cell transformed with a vector according to claim 21 which 
is capable of expressing a DNA sequence encoding the 
osteoinductive protein and progeny of said cell. 

23 ~ The transformed cell according to claim 24 selected from the 
group consisting of a mammalian cell, a bacterial cell, an insect 
cell, and a yeast cell. 



INTERNATIONAL SEARCH REPORT 

International Application No PCT/ US 8 7/01537 



CLASSIFICATION OF SUBJECT MATTER (it several classification symbols apply, indicate all) » 



According to International Patent Classification (IPC) or to both National Classification and IPC 

IPC(4): C07K 13/00,15/00; A61K 37/00; See Attachment 
US CL: 530/350,395,397; 514/12; 536/27 See Attachment 



II. FIELDS SEARCHED 



Minimum Documentation Searched * 



Classification System 



Classification Symbols 



us 



530/350,395,397; 514/12; 536/27 
435/68, 70, 172.3; 935/13 



Documentation Searched other than Minimum Documentation 
to the Extent that such Documents are Included in the Fields Searched 5 



COMPUTER SEARCH CAS, APS : BONE MORPHOGEN, BONE 
INDUCTIVE PROTEIN, BMP, OSTEOINDUCTIVE FACTOR 



111. DOCUMENTS CONSIDERED T O BE RELEVANT 

Category • [ Citation of Document, with indication, where appropriate, of the relevant passages 17 | Relevant to Claim No. ■ " 



X,P 
Y,P 

X 

y 
x 

Y 



US, A, 4,619,989 (URIST) 28 Oct 1986. 



US, A, 4,563,350 (NATHAN ET AL) 
7 January 1986. 

US, A, 4,455,256 (URIST) 19 June 1984. 



Proc. Natl. Acad. Sci USA , Vol. 81, 
issued January 1984, (Washington , 
D.C. ), 

(URIST), "Purification of bovine 
morphogenetic protein by hydroxyapatite 
chromatography", pages 371-375. 



1-8 
9-20 

1-8 
9-20 



2-20 



* Special categories of cited documents: 13 
*'A" document defining the general state of the art which is not 
considered to be of particular relevance 

"E" earlier document but published on or after the international 
filing date 

"L" document which may throw doubts on priority claim(s) or 
which is ctted to establish the publication date of another 
citation or other special reason (as specified) 

"O" document referring to an oral disclosure, use. exhibition or 
other means 

"P" document published prior to the international filing date but 
later than the priority date claimed 



*'T" tater document published after the international filing date 
or priority date and not in conflict with the application but 
cited to understand the principle or theory underlying the 
invention 

"X" document of particular relevance; the claimed invention 
cannot be considered novel or cannot be considered to 
involve an inventive step 

"Y" document of particular relevance; the claimed invention 
cannot be considered to involve an inventive step when the 
document is combined with one or more other such docu- 
ments, such combination being obvious to a person skilled 
in the art. 

"A" document member of the same patent family 



IV. CERTIFICATION 



Pate of the Actual Completion of the International Search • 

08 October 1987 



Date of Mailing of this International Search Report * 



2 0 OCT 1987 



International Searching Authority * 



ISA/US 




Form PCT/ISA/210 (second sheet! (May 1986) 



PCT/US87/ 01537 

Attachment To Form PCT/ISA/210, Part I. 

IPC.(4) : C12P 21/00, 21/02; C12N 15/00; C07H 15/12 
US CL : 435/68, 70, 172.3; 935/13 . 



International Application No. 

PCT/US87/01537 



111. DOCUMENTS CONSIDERED TO BE RELEVANT (CONTINUED FROM THE SECOND SHEET) 



Category • Citation of Document. " ; with indication, where appropriate, of the relevant passages Relevant to Claim No '» 



Science , Vol. 220 issued 13 May 1983 1-20 
(Washington, D.C.) (URIST) "Bone cell 
Differentiation and Growth Factors" 
pages 680-686 . 

Proc. Natl, Acad Sci , USA, Vol. 80 1-20 
issued November 1983 (Washington, D.C.) 
(SAMPATH ET AL), "Homology of bone- 
inductive proteins from human monkey, 

bovine and rat extracellular matrix" 

pages 6591-6595. 

Proc. Natl. Acad. Sci , USA, Vol. 78 1-20 
issued November 1981, (Washington, 
D.C.) (SUGGS ET AL) , "Use of synthetic 
oligonucleotides as hybridization probes: 
Isolation of cloned cDNA sequence for 
human p2" micro 9 1 ot>ulin" pages 6613-6617. 



Form PCT/ISA/21 0 (extra sheet) (May 1 986) 



This Page is Inserted by IFW Indexing and Scanning 
Operations and is not part of the Official Record 

BEST AVAILABLE IMAGES 

Defective images within this document are accurate representations of the original 
documents submitted by the applicant. 

Defects in the images include but are not limited to the items checked: 

□ BLACK BORDERS 

□ IMAGE CUT OFF AT TOP, BOTTOM OR SIDES 
□TfADED TEXT OR DRAWING 

12^ BLURRED OR ILLEGIBLE TEXT OR DRAWING 

□ SKEWED/SLANTED IMAGES 

□ COLOR OR BLACK AND WHITE PHOTOGRAPHS 

□ GRAY SCALE DOCUMENTS 

□ LINES OR MARKS ON ORIGINAL DOCUMENT 

□ REFERENCE(S) OR EXHIBIT(S) SUBMITTED ARE POOR QUALITY 

□ OTHER: 

IMAGES ARE BEST AVAILABLE COPY. 
As rescanning these documents will not correct the image 
problems checked, please do not report these problems to 
the IFW Image Problem Mailbox.