Skip to main content

Full text of "USPTO Patents Application 09804625"

See other formats


(19) 



J 



(12) 



EuropSfsches Patentamt 
European Patent Office 
Off Ice europ^en des brevets (11) EP 0 741 187 A2 

EUROPEAN PATENT APPLICATION 



(43) Date of publication: 

06.11.1996 Bulletin 1996/45 

(21) Application number: 96106408.6 

(22) Date of filing: 24.04.1 996 



(51) Int. CI. 6 : C12N 15/12, C12N 15/62, 
C12N 1/21, C07K 14/47, 
A61K 38/17, A61K 47/48 
//(C12N1/21,C12R1:19) 



(84) Designated Contracting States: 


(72) Inventors: 


ATBECHDEDKESR FRGBGRIEITLILUMC 


• Campf ield, Arthur 


NL PT SE 


Verona, N.J. 07044 (US) 




• Devos, Ren6 


(30) Priority: 05.05.1995 US 435777 


B-8400Oostende (BE) 


07.06.1995 US 484629 


• Guisez, Yves 


(71) Applicant: F. HOFFMANN-LA ROCHE AG 


B-8200 St. Andrles Brugge (BE) 


4070 Basel (CH) 





09 

m 

j— 
m 

o 
o 

< 



(54) Recombinant obese (Ob) proteins 

(57) Proteins which modulate body weight of ani- 
mals and humans for the treatment, prevention and con- 
trol of obesity and associated diseases or conditions, 
and the recombinant expression of these biologically 
active proteins in purified and homogeneous forms. 



CM 
< 

oo 



o 
o. 

LU 



Primed by Rank Xeroa (UK) Business Services 
2.13 6734 



EP0 741 187 A2 



Description 

Obesity is reported to be the commonest nutritional disorder in Western societies [Zhang, Y et al., Nature 372, 425- 
432 (1994)]. More than three in 10 adult Americans weigh at least 20% in excess of their ideal weight [Zhang, Y. et at., 
5 supra]. Increased body weight is a public health problem because it is associated with important medical morbidities 
such as type II diabetes mellitus (i.e., non-insulin-dependent diabetes mellitus), hypertension and hyperlipidaemia 
[Grundy, S.M. and Barnett, Disease-a-Mouth 36, 645-696 (1990)]. There is evidence that body weight is physiologically 
regulated and the obesity (and its related conditions or diseases) are due in part to derangements in this regulation 
[Zhang, Y et al. t supra]. 

10 In rodents, there are described seven single gene mutations that result in an obese phenotype; five of which are 
present in mice. Of these seven rodent models, one of the most intensively studied is the obese (ob) gene mutation in 
mice, identified in 1950 [Ingalls, A.M. et al., J. Hered. 41 , 317-318 (1950)]. Mice homozygous for this ob gene mutation 
are profoundly obese, develop type II diabetes mellitus, and are hyperphagic and hypometabolic, as part of a syndrome 
resembling morbid obesity in man [Friedman J.M. et al., Genomics 1 1 . 1054-1062 (1991)]. This ob gene is mapped to 

is the mouse proximal chromosome 6 and encodes a protein (i.e., ob protein) expressed in adipose tissue [Zhang, Y et 
al., supra]. Mice homozygous for the ob gene mutation have little to no production of this ob protein, and accordingly 
have defective regulation of body weight leading to obesity. 

The murine or, human ob proteins may be administered to patients suffering from defects or mutations in their cor- 
responding obese (ob) gene, which defects or mutations prevent or interfere with the production and/or function of the 

20 ob proteins in modulating body weight. These proteins may therefore be used as a hormone-like substance to control, 
prevent or treat obesity and its related diseases and conditions in man and animals. 

To use the murine or human ob proteins in this manner, these proteins can be administered through injection by a 
variety of routes, such as intraperitoneal, intravenously, intramuscularly or subcutaneous! y, in frequent dosages. Since 
it is administered frequently through injection, it is important that the murine or human ob proteins be purified, preferably 

25 to homogeneity, be free of contaminating protein materials, and be recombinantly expressed in a soluble and biologi- 
cally active form. It is generally known to practitioners in the field that contaminants present in injectable medication can 
often lead to toxic side-effects or adverse immunological responses. 

While the murine ob gene sequence is disclosed in Zhang, Y et al, supra, no methods of expressing the murine ob 
protein or its human counterpart have been reported, much less producing these proteins in a biologically active and 

30 soluble state from which the proteins can be purified to homogeneity. Therefore it is important, and is an object of this 
invention, to express and produce the murine or human ob proteins in a homogeneous, soluble, and biologically-active 
state. 

It has been discovered that recombinant human and murine ob proteins can be expressed in a biologically active 
and soluble state, and thereafter purified to homogeneity suitable for injection to patients for treating, preventing or con- 
35 trolling obesity and its related conditions and diseases, such as type II diabetes mellitus, hypertension, hyperlipidaemia 
and the tike. 

In accordance with this invention, the human and murine ob proteins can be produced recombinantly in a biologi- 
cally active form and purified to homogeneity by first constructing novel expression vectors for Escherichia coli (E. coti). 
These expression vectors contain a promoter and a DNA sequence, which ON A sequence encodes a fusion protein 

40 comprising two parts: the signal peptide of the outer membrane protein A of E. coli (i.e., sOmpA) and the human or 
murine ob protein. In accordance with this invention, the next step for producing the biologically active recombinant form 
of the murine and human ob proteins is to insert this expression vector in an E. coli host whereby there is obtained effi- 
cient expression and translocation of the fusion protein into the periplasmic space (i.e., between the inner and outer cell 
membranes of the E. coli microorganism), at which point the signal peptide is excised from the ob protein leaving the 

45 ob protein in a soluble and biologically active form. Next, the ob proteins are efficiently secreted in soluble and biologi- 
cally active form into cell free medium following treatment of the host E. coli cells to cold osmotic shock, at which point 
the ob proteins are purified to homogeneity by the sequential use of anion exchange chromatography, hydrophobic 
interaction column chromatography and gel filtration, carried out in that order. 

The present invention is also directed to 1) an expression vector containing the DNA encoding a fusion protein 

so comprising a sOmpA signal peptide and a human or murine ob protein; 2) to a host organism transfected or transformed 
by such expression vector; 3) to the DNA sequence encoding the human ob protein; and 4) polyethylene or polypropyl- 
ene glycol conjugates of the ob protein. 

The present invention is further directed to methods for expressing recombinant human and murine ob proteins in 
a biologically active and soluble state, and for producing these proteins in a purified homogeneous form suitable for 

55 administration to animals and humans. 

The method for expressing and producing the murine ob protein in accordance with this invention is achieved uti- 
lizing the murine ob gene as reported by Zhang, Y. et al., supra, the sequence for which gene is a 702 base pair (bp) 
nucleotide sequence identified herein as SEQ ID NO. 1. This murine ob gene sequence comprises a 501 bp coding 
sequence or open reading frame (ORF) starting with a start codon at nucleotide 36 and terminating with a stop codon 



2 



EP0741 187 A2 



at nucleotide 537, and having untranslated sequences at both the 3' and 5' ends. The ORF contains a 63 bp signal 
sequence from nucleotide 36 to 98. 

This murine ob gene sequence (SEQ ID NO: 1) encodes the murine ob protein (plus its signal sequence) whose 
amino acid sequence is 167 amino acids in length and is identified as SEQ ID NO: 2. In this protein of SEQ ID NO: 2, 
5 the first 21 amino adds represent the signal sequence of the murine ob protein. The mature murine ob protein (without 
its signal sequence) extends from amino acid 22 (Val) to amino acid 167 (Cys) and is represented by SEQ ID NO: 3. 

The method for expressing and producing the human ob protein in accordance with this invention is achieved uti- 
lizing the human ob gene, the sequence for which gene is a 690 bp nucleotide sequence identified herein as SEQ ID 
NO: 4. 

10 Zhang Y et al., supra, report the human ob gene as highly homologous to the murine ob gene, and disclose a con- 
ventional method using oligonucleotide probes directed to the murine ob gene which can be utilized to 1) screen a 
cDNA library of clones derived from human adipose tissue, 2) identify those clones having the human ob gene, and 3) 
isolate and sequence the human ob gene sequence. When sequenced by conventional means, this human ob gene 
sequence is determined to have the nucleotide sequence SEQ ID NO: 4. 

75 As with the murine ob gene, the human ob gene comprises a 501 bp coding sequence or open reading frame 
(ORF) starting with a start codon at nucleotide 37 and terminating with a stop codon at nucleotide 538, and having an 
untranslated sequences at both the 3' and 5* ends. The ORF contains a 63 bp signal sequence from nucleotide 37 to 99. 

This human ob gene sequence (SEQ ID NO: 4) encodes a human ob protein plus its signal sequence whose amino 
acid sequence of 1 67 amino acids in length is identified as SEQ ID NO: 5. The first 21 amino acids of this protein of 1 67 

20 amino acids in length represent the signal sequence. The mature human ob protein (without its signal sequence) 
extends from amino acid 22 (Val) to amino acid 167 (Cys) and is represented by SEQ ID NO: 6. 

Zhang, Y et al., supra, report 84% identity between the murine and human ob proteins. Zhang Y et al., supra, also 
report that variants of the murine and human proteins exist, one such variant being characterized in both species by a 
deletion of glutamine 49. Approximately 30% of cDNA clones in the libraries derived from mouse adipose tissue and 

25 human adipose tissue have the codon 49 missing [Zhang, Y et al., supra]. 
The following terms shall have the definitions set out below: 
Murine ob protein (mob) refers to the protein of SEQ ID NO: 3 whose biological properties relate to the treating, con- 
trolling or preventing obesity or its associated conditions and diseases. Specifically, a murine ob protein is defined to 
include any protein or polypeptide having an amino acid sequence which is substantially homologous to the amino acid 

30 sequence SEQ ID NO: 3, and further having the following biological activities: 

1) When the protein or polypeptide is administered by intracerebroventricular (ICV) injection to 16-18 hour fasted 
mature obese ob/ob mice having a body weight of at least 30 grams at a dose of 20 fig or less using the methods 
of Haley and McCormick, Brit. J. Pharmacol. 12, 12-15 (1957), the protein or polypeptide: 

35 

(a) reduces food intake during a 5 hour feeding test by 50% compared to vehicle injected control mice (ED50 
for reducing food intake); and 

(b) reduces body weight gain during the 24 hours following the ICV injection by at least 50% compared to vehi- 
40 cle injected control mice (ED50 for reducing body weight gain); 

or 

2) When the protein or polypeptide is administered intraperitoneal (IP) to non-fasted mature ob/ob mice having a 
45 body weight of at least 30 grams twice a day at the beginning of daylight and again at the 3 hour point of the dark 

phase, for one week, in a total daily dose of 20 ng or less, the protein or polypeptide: 

(a) reduces 5 and 24 hour food intake by at least 20% compared to vehicle injected control mice (ED20 for 
reducing food intake); and 

50 

(b) reduces body weight gain during the 24 hours following the first IP injection by at least 20% compared to 
vehicle injected control mice (ED20 for reducing body weight gain). 

As used herein the term murine ob protein includes such proteins modified deliberately, as for example, by site 
55 directed mutagenesis or accidentally through mutations. 

Human ob protein (hob) refers to the protein of SEQ ID NO: 6 whose biological properties relate to the treating, control- 
ling or preventing obesity or its associated conditions and diseases. Specifically, a human ob protein is defined to 
include any protein or polypeptide having an amino acid sequence which is substantially homologous to the amino acid 
sequence SEQ ID NO: 6, and further having the following biological activities: 



3 



EP0741 187 A2 



1) When the protein or polypeptide is administered ICV to 16-18 hour fasted mature obese ob/ob mice having a 
body weight of at least 30 grams at a dose of 20 ng or less using the methods of Haley and McCormick, supra, the 
protein or polypeptide: 

5 (a) reduces food intake during a 5 hour feeding test by 50% compared to vehicle injected control mice (ED50 

for reducing food intake); and 

(b) reduces body weight gain during the 24 hours following the ICV injection by at least 50% compared to vehi- 
cle injected control mice (ED50 for reducing body weight gain); 

10 

or 

2) When the protein or polypeptide is administered IP to non-fasted mature ob/ob mice having a body weight of at 
least 30 grams twice a day at the beginning of daylight and again at the 3 hour point of the dark phase, for one 

is week, in a total daily dose of 20 m9 or less, the protein or polypeptide: 

(a) reduces 5 and 24 hour food intake by at least 20% compared to vehicle injected control mice (ED20 for 
reducing food intake); and 

20 (b) reduces body weight gain during the 24 hours following the first IP injection by at least 20% compared to 

vehicle injected control mice (ED20 for reducing body weight gain). 

As used herein the term human ob protein includes such proteins modified deliberately, as for example, by site 
directed mutagenesis or accidentally through mutations. 

25 Substantially homologous which can refer both to nucleic acid and amino acid sequences, means that a particular sub- 
ject sequence, for example, a mutant sequence, varies from a reference sequence by one or more substitutions, dele- 
tions, or additions, the net effect of which do not result in an adverse functional dissimilarity between the reference and 
subject sequences. For purposes of the present invention, sequences having greater than 95 percent homology, equiv- 
alent biological properties, and equivalent expression characteristics are considered substantially homologous. For pur- 

30 poses of determining homology, truncation of the mature sequence should be disregarded. Sequences having lesser 
degrees of homology, comparable bioactivity, and equivalent expression characteristics are considered substantial 
equivalents. Generally, homologous DNA sequences can be identified by cross-hybridization under standard hybridiza- 
tion conditions of moderate stringency. 

Fragment of the murine or human ob protein means any protein or polypeptide having the amino acid sequence of a 
35 portion or fragment of a murine or human ob protein, and which has the biological activity of the murine or human ob 
protein, respectively. Fragments include proteins or polypeptides produced by proteolytic degradation of the murine or 
human ob proteins or produced by chemical synthesis by methods routine in the art. 

An ob protein or fragment thereof is biologically active when administration of the protein or fragment to a mammal, 
including man, reduces food intake and reduces the rate of weight gain in the mammal. Determining such biological 
40 activity of the human or murine ob protein can be caried out by conventional, well known tests utilized for such purposes 
on one or more species of mammals, particularly the obese ob/ob mouse. Several of these tests which can be utilized 
to demonstrate such biological activity are described herein. In determining biological activity in accordance with the 
ICV test in ob/ob mice as described herein, the human or murine ob protein preferably has an ED50 for reducing food 
intake of 20 ug or less and an ED50 for reducing body weight gain of 20 ug or less. Alternatively, in determining biolog- 
45 ical activity of the human or murine ob protein in accordance with the IP test in ob/ob mice as described herein, the 
human or murine ob protein preferably has an ED20 for reducing food intake of 20 ug or less and an ED20 for reducing 
body weight gain of 20 ug or less. Generally, fragments which exhibit the above mentioned biological activity are pre- 
ferred. 

Replicon is any genetic element (e.g., plasmid, chromosome, virus) that functions as an autonomous unit of DNA rep- 

so lication in vivo, i.e., capable of replication under its own control. 

Expression vector is a replicon, such as a plasmid. phage or cosmid. to which another ONA segment may be attached 
so as to bring about the replication of the attached segment. It comprises a transcriptional unit comprising an assembly 
of (1) a genetic element or elements having a regulatory role in gene expression, for example, promoters or enhancers, 
(2) a structural or coding sequence which is transcribed into mRNA and translated into protein, and t3) appropriate tran- 

55 scription initiation and termination sequences. 

Clone is a group of DNA molecules derived from one original length of DNA sequences and produced by a bacterium 
or virus using genetic engineering techniques, often involving plasmids. 

Signal sequence is the nucleic acid sequence located at the beginning (5* end) of the coding sequence of a protein to 
be expressed. This signal sequence encodes a signal peptide, N-terminal to the newly synthesized protein, that directs 



4 



EP0741 187 A2 



the host cell to translocate the protein toward or through the host cell membrane, and which signal peptide is usually 
excised during such translocation. 

Start codon is a codon usually ATG located in the coding sequence of a protein, and usually at the 5' end, and signals 
the first amino acid in a protein sequence. 
s Stop codon is a nonsense codon located in and usually at the 3' end of a coding sequence of a protein, and signals the 
end of a growing polypeptide chain. 

Open Reading Frame (ORF) is a linear array of codon triplets in double-stranded DNA encoding an amino acid 
sequence in a cell in vitro or in vivo when placed under the control of appropriate regulatory sequences. The boundaries 
of the ORF are determined by a start codon at the 5' terminus and a stop codon at the 3' terminus. It may also be 

to referred to as a "coding sequence". 

Promoter sequence is DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription 
of a downstream (3' direction) open reading frame of one or more structural genes. The promoter sequence is usually 
located at the 5' end of the signal sequence or open reading frame and extends upstream in the 5* direction to include 
the minimum number of bases or elements necessary to initiate transcription of the polypeptide at a level detectable 

75 above background. 

A coding sequence or ORF is under the control of a promoter sequence when RNA polymerase transcribes the coding 
sequence into mRNA. 

A composition comprising A (where A is a single polypeptide) is homogeneous for A when there is no detectable 
quantity of contaminating proteins or other endogenous materials, as detected by conventional means, for example, 
20 staining of polyacrylamide gels. For purposes of this invention, the term homogeneous shall refer to a composition com- 
prising a single protein or polypeptide when at least 95% by weight of the composition is that single protein or polypep- 
tide. 

The following steps outline the methods for recombinantly expressing the human and murine ob proteins in a bio- 
logically active and soluble cell-free state, free of other mammalian proteins, from which the ob proteins can then be 
25 purified to homogeneity. These steps are exemplified in detail in the examples. 

1) Obtaining the mouse and human ob oenes . 

The cDNA (SEQ ID NO. 1) encoding the murine ob protein plus its natural signal sequence is published in Zhang. 
30 Y. et al., supra. This murine cDNA has been isolated and amplified by PCR technique using oligodeoxynucleotide DNA 
primers by conventional techniques. These DNA primers and the methods for obtaining them are described in Zhang, 
Y et al., supra. 

The cDNA (SEQ ID NO. 4) encoding the human ob protein plus its natural signal sequence is obtained using the 
same oligodeoxynucleotide DNA primers as used in Zhang, Y et al., supra to obtain the murine ob gene. By using con- 

35 ventional technique, this human cDNA has been isolated from a lambda phage cDNA library made from RNA derived 
from human adipocyte tissue. 

The human or mouse ob cDNA may be obtained not only from cDNA libraries, but by other conventional means, 
e.g., by chemical synthesis, or by cloning genomic DNA, or fragments thereof, purified from the desired cell. These pro- 
cedures are described by Sambrook et al., in "DNA Cloning: A Practical Approach", Vol. I and II, D.N. Glover, ed., 1985, 

40 MRL Press. Ltd., Oxford, U.K.; Benton and Davis. Science 196, 180-182 (1977); and Grunstein and Hogness, Proc. 
Nat. Acad. Sci. 72, 3961-3965 (1 975). To obtain the human or mouse ob cDNA from cDNA libraries, the cDNA libraries 
are screened by conventional DNA hybridization techniques by the methods of Benton and Davis, supra, or Grunstein 
and Hogness, supra, using primers prepared by reverse transcription of polyadenylated RNA isolated from murine adi- 
pose cells containing the murine ob gene. Clones which hybridize to the primers are analyzed by restriction endonucle- 

45 ase cleavage, agarose gel electrophoresis, and additional hybridization experiments ("Southern blots") involving the 
electrophoresed primers. After isolating several clones which hybridized to the murine cDNA probes, the hybridizing 
segment of one clone is subcloned and sequenced by conventional techniques. 

Clones derived from genomic DNA may contain regulatory and intron DNA regions in addition to coding regions: 
clones derived from cDNA will not contain intron sequences. In the molecular cloning of the gene from genomic DNA, 

so DNA fragments are generated, some of which will encode the desired gene. The DNA may be cleaved at specific sites 
using various restriction enzymes. Alternatively, one may use DNAse in the presence of manganese to fragment the 
DNA, or the DNA can be physically sheared, as for example, by sonication. The linear DNA fragments can then be sep- 
arated according to size by standard techniques, including but not limited to, agarose and polyacrylamide gel electro- 
phoresis and column chromatography. 

55 Whatever the source, the human or murine ob gene may be molecular y cloned into a suitable vector for propaga- 
tion of the gene by methods known in the art. Any commercially available vector may be used. For example, the mouse 
cDNA may be inserted into a pCDNA3 vector and the human cDNA may be inserted into a pBluescriptSK' vector. 
Appropriate vectors for use with bacterial hosts are described by Pouwels et al., in "Cloning Vectors: A Laboratory Man- 
ual", 1985, Elsevier, N.Y As a representative but nonlimrting example, useful cloning vectors for bacterial use can com- 



5 



EP0 741 187 A2 



prise a selectable marker and bacterial origin of replication derived from commercially available plasmids which are in 
turn derived from the well known cloning vector pBR322 (ATCC 37017). Such commercial vectors include, for example. 
pKK223-3 (Pharmacia Fine Chemicals, Uppsala. Sweden) and pGEM1 (Promega Biotec, Madison, Wise. USA). 

The nucleotide sequences of the human or murine ob gene inserted in these commercially available vectors can 
s be verified by methods known in the art, by standard nucleotide sequencing techniques. 

Other nucleic acids that code for ob proteins of species other than human or murine may be used herein. Accord- 
ingly, while specific DNA has been cloned and sequenced in relation to the human and mouse ob gene, any animal adi- 
pocyte potentially can be used as the nucleic acid source of the ob protein. 

10 2) Construction of an Expression Vector for the human and murine ob protein. 

The human or murine ob gene cloned in accordance with the methods described above are used to construct the 
expression vectors for the human and murine ob proteins, respectively. 

For expression of the biologically active human and murine ob protein by a transfected or transformed E. coli host 

15 cell and for secretion of the ob protein into the periplasm, a novel expression vector can be utilized. This expression vec- 
tor includes a promoter and a DNA sequence encoding a fusion protein. The fusion protein consists of two parts: the 
first part being a signal peptide for the outer membrane protein A of E. coli (sOmpA) and the second part of the fusion 
protein being the human or murine ob protein (minus their own natural signal sequences). The DNA sequence encoding 
this fusion protein also consists of two parts: a first part that encodes the sOmpA peptide and a second part that 

20 encodes the murine or human ob protein (minus their natural signal sequences). The first part of the DNA sequence 
that encodes the sOmpA peptide is the signal sequence described by De Sutter, K. et al., Gene 141, 163-170 (1994) 
and has the nucleotide sequence of SEQ ID NO: 7. The second part of the two-part DNA sequence encodes the murine 
or human ob proteins and has the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 4. respectively minus that por- 
tion of the nucleotide sequence that encodes the respective natural signal sequences. 

25 The signal peptide encoded by the sOmpA signal sequence of SEQ ID NO: 7 has the amino acid sequence SEQ 
ID NO: 8 as reported by De Sutter, K. et ai., supra. 

The novel expression vector of this invention is achieved by inserting the promoter and DNA sequence encoding 
the fusion protein into a conventional expression vector suitable for expression of recombinant proteins in E. coli host 
cells. 

30 In constructing this novel expression vector in accordance with this invention, any promoter may be used as long 
as it is capable of controlling transcription of the fusion protein comprising the sOmpA peptide and the ob protein in the 
E. coli host cell. When the sOmpA is used as the signal peptide, it is preferable to use both the lac-operator promoter 
( p °/ac) and tn © lipoprotein promoter (P^ p ). Other useful promoters for such expression in E. coli include the T7 RNA 
polymerase promoter described by Studier et al., J. Mol. Biol. 189, 113-130 (1986), the lacz promoter described by 

35 Lauer, J. Mol. Appl. Genet. 1 , 139-147 (1 981) and available from the American Type Culture Collection (ATCC) as ATCC 
37121, the tac promoter described by Maniatis, in "Molecular Cloning: A Laboratory Manual", Cold Spring Harbor 1982, 
and available as ATCC 37138, the alkaline phosphatase (phoA) promoter, and the trp promoter described by Goeddel 
et al., Nucleic Acids Research 8, 4057-4075 (1980). Other promoters have been discovered and utilized in E. coli and 
details concerning their nucleotide sequences, enabling a skilled worker to ligate them functionally within the expres- 

40 sion vector of this invention, have been published (Siebenlist et al., Cell 20, 269-281 (1980). 
Specifically, an expression vector comprises: 

a) a promoter sequence, and 

b) a DNA sequence encoding a fusion protein, which fusion protein comprises the murine ob protein of SEQ ID NO: 
45 3 or the human ob protein of SEQ ID NO: 6, and the signal peptide for the outer membrane protein A of E. coli. 

Next, the method for constructing this novel expression vector is described. This method is further detailed in the 
Examples and depicted in Figures 2 and 3. First, the coding sequence of the human or mouse ob gene (minus its nat- 
ural signal sequence) is incorporated into a plasmid containing the sOmpA signal sequence, such as the plasmid 

so pTIOsOmpArPDI. This pTIOsOmpArPDI plasmid and its construction and preparation is described by De Sutter, K. et 
al., supra. Once incorporated into this plasmid, the human or mouse ob gene is fused to this sOmpA gene to create a 
"hybrid gene sequence" in this plasmid. The sOmpA gene must be upstream of the 5* region of the ob gene coding 
sequence. Thereafter, promoters as enumerated above, and preferably the lipoprotein promoter (P tpp ) and the lac pro- 
moter-operator (POjac), are incorporated into this plasmid containing the hybrid gene sequence to create the expres- 

55 sion vectors of this invention. Two embodiments of these expression vectors are identified as pLPPsOmpA mob and 
pLPPsOmpA hob1 and are depicted in Figures 2 and 3, respectively. 

Any method or procedure known in the art to construct such a plasmid may be used. Moreover, the order by which 
one fuses the sOmpA and ob gene sequences, incorporates the gene sequences into a suitable plasmid, and incorpo- 
rates the promoter to arrive at the expression vector of this invention is not critical. For example, the sOmpA gene 



6 



EP0 741 187 A2 



sequence can be initially fused to the murine or human ob gene sequence directly to create a hybrid gene sequence, 
and then this hybrid sequence inserted into a plasmid having already incorporated therein the appropriate promoters. 
It is necessary however that the sOmpA gene sequence be upstream at the 5' end of the murine or ob gene sequence. 
It has been discovered that by using such novel expression vector, and in particular, by using the signal sequence 
s encoding the sOmpA, the murine or human ob proteins can be translocated to the periplasmic space, where the signal 
peptide is appropriately cleaved leaving intact the human or murine ob proteins therein in a soluble and biologically 
active form. Once in this periplasmic space, the ob proteins are efficiently secreted to the cell free environment free of 
other mammalian proteins upon subjecting the host cells to cold osmotic shock, at which time the ob proteins can be 
purified to homogeneity in a biologically active form. 

10 

3, Expressing the Human or Murine ob Proteins in Transformed E. coli cells. 

Next, the expression vectors constructed in accordance with the above described procedures are inserted into a 
host E. coli cell to transform the E. coli cell. Any strain of E. colt may be used, such as E. coli K-12 strain 294 as 

is described in British Patent Publication No. 2055382 A (ATCC No. 31446). Other strains useful in accordance with this 
invention include E. coli MC1061 [Casadaban and Cohen, J. Mol. Biol. 138, 179-207 (1980)], E. coli B, E. coli X 1776 
(ATTC No. 31537), and E. coli W 31 10 (ATCC No. 27325) or other strains many of which are deposited and available 
from recognized microorganism depository institutions. 

The transformed E. coli cells are grown to an appropriate cell density and cultured by standard methods. In so 

20 growing and culturing the transformed E. coli hosts, the expression vectors of this invention efficiently and effectively 
allow expression of the murine or human ob proteins and translocation of these same proteins into the periplasm of the 
host E. coli cells in a soluble and biologically active form. The sOmpA signal peptide (i.e., part 1 of the fusion protein) 
is cleaved during translocation of the fusion protein into the periplasm yielding the biologically active ob protein free of 
other mammalian proteins or polypeptides. Specifically, the method of producing biologically active recombinant human 

25 or murine obese protein free of other mammalian proteins comprises the steps of: 

a) constructing an expression vector having a promoter sequence, and a DNA sequence encoding a fusion protein, 
which fusion protein comprises SEQ ID NO: 3 or SEQ ID NO: 6, and the signal peptide for the outer membrane 
protein A of E. coli; 

30 b) inserting the expression vector into an E. coli host cell to transform the E. coli host cell; 

c) expressing the fusion protein in the E. coli host cell; and 

d) treating the E. coli host cell with cold osmotic shock buffer to liberate the murine or human ob protein free of other 
mammalian proteins and free of the signal peptide. 

35 The recombinant^ produced human or murine ob proteins in a soluble biologically active state in the periplasm of 
transformed E. coli cells are thereafter purified to homogeneity. 

The recombinant human and murine ob proteins translocated to the cell periplasm in accordance with the proce- 
dures described herein can be effectively secreted outside the cell by subjecting the host cells to cold osmotic shock by 
methods known in the art and described by Koshland, D. and Botstein, D., Cell 20, 749-760 (1980). The use of cold 

40 osmotic shock liberates from the E. coli the ob proteins in their biologically active state free of other mammalian proteins 
or polypeptides. 

The human or murine ob proteins located in the osmotic fluid following cold osmotic shock of transformed E. coli 
cells, in accordance with the above described procedure, are biologically active and can be purified to homogeneity 
using a combination of anion exchange column chromatography, hydrophobic interaction column chromatography and 

45 gel filtration. Anion exchange and hydrophobic interaction chromatography can be carried out in any order, however, the 
use of either must precede gel filtration. 

The anion exchange stage can be carried out by conventional means. The preferred column for anion exchange 
chromatography is a Q Sepharose Fast Flow column. Suitable anion exchange chromatography media include various 
insoluble matrices comprising diethylaminoethyl (DEAE) or diethyl-(2-hydroxypropyl)aminoethyl (QAE) groups. The 

so matrices can be acrylamide, agarose, dextran, cellulose or other types commonly employed in protein purification. A 
particularly useful material for anion exchange chromatography is DEAE-Sephacel (Pharmacia, Uppsala, Sweden). 
When media containing DEAE groups are employed, extracts containing murine or human ob proteins are applied at a 
weakly basic pH, e.g., pH 8.1. The bound murine or human ob proteins can be eluted in more highly purified form by 
application of a salt gradient in a suitable buffer such as Tris-HCI. Generally, the characteristics of the gradient can be 

55 determined by preliminary elution experiments involving a small quantity of recombinant protein. 

The material containing the human or murine ob protein obtained through the use of anion exchange chromatog- 
raphy, when anion exchange chromatography is used as the first stage of purification, is next subjected to hydrophobic 
interaction chromatography. Hydrophobic interaction chromatography is a separation technique in which substances 
are separated on the basis of differing strengths of hydrophobic interaction with an uncharged bed material containing 



7 



EP0741 187 A2 



hydrophobic groups. Typically, the hydrophobic interaction column is first equilibrated under conditions favorable to 
hydrophobic binding, e.g., high ionic strength. A descending salt gradient may be used to elute the sample. 

Any hydrophobic interaction column can be used. The preferred hydrophobic column is phenyl Sepharose, how- 
ever, butyl Sepharose can also be utilized. In accordance with the invention, the material containing the recombinant 

s murine or human ob protein which has been eluted from the anionic column is loaded onto a column containing a rela- 
tively strong hydrophobic gel such a phenyl sepharose. To promote hydrophobic interaction with the hydrophobic gel, a 
solvent is used which contains, for example, greater than or equal to 0.4 M ammonium sulfate, with 0.4 M being pre- 
ferred. Thus the column and the sample are adjusted to 0.4 M ammonium sulfate in 50 mM Tris buffer and the sample 
applied to the column. The column is washed with 0.4 M ammonium sulfate buffer. The ob protein is then eluted with 

10 solvents which attenuate hydrophobic interactions such as, for example, decreasing salt gradients, ethylene or propyl- 
ene glycol, or urea. A preferred embodiment involves washing the column sequentially with the Tris buffer and the Tris 
buffer containing 20% ethylene glycol. The ob protein is subsequently eluted from the column with a gradient of 
decreasing ammonium sulfate concentration and increasing ethylene glycol concentration in the Tris buffer. The collec- 
tive and sequential use of anion exchange chromatography and hydrophobic interaction column chromatography, in any 

75 order, yields human or murine ob protein routinely at an estimated purity of 90%. 

The gel filtration chromatography step follows the anion exchange chromatography and hydrophobic interaction 
column chromatography steps outlined above, and can be performed by any conventional gel filtration procedure. The 
ob protein eluted from the hydrophobic interaction column, or the anion exchange column, whichever column is used 
last, can be concentrated and dialyzed to a small volume by using a membrane with a cut-off molecular weight of 

20 10,000 (AMICON-YM10 membrane). The concentrated material can then be loaded onto a column containing gel filtra- 
tion media such as GlOO-Sephadex (Pharmacia, Uppsala, Sweden). The ob protein can then be separated from other 
contaminants on the basis of its molecular weight by standard techniques using SDS-PAGE. 

The collective and sequential use of anion exchange chromatography, hydrophobic interaction column chromatog- 
raphy and gel filtration routinely yields human or murine ob protein at 95% purity. 

25 N-terminal amino acid sequencing of the purified murine or human ob protein can be performed by methods known 
in the art, e.g., by electrotransfer according to the methods of Laemli, U.K., Nature 227, 680-685 (1970) or by the pro- 
cedures described by Matsudaira, P., J. Biol. Chem. 262, 10035-10038 (1987). Internal sequencing can also be done 
by methods known in the art. For example, peptide fragments may be generated by digesting the M band (on nitrocel- 
lulose) with endoproteinase Lysine C and then separated by an HPLC system. 

30 The biological activity of the purified human and murine ob proteins of this invention are such that frequent admin- 
istration of the ob protein by injection to human patients or mice results in decreased food intake and decreased rate of 
weight gain compared to non-injected or control groups of subjects. 

The biological activity of the human and murine ob proteins, or fragments thereof, obtained and purified in accord- 
ance with this invention can be tested by routine methods, e.g. , by repeated or single intracerebroventricular (ICV) injec- 

35 tion in ob/ob mice according to the procedures of Haley, T.J. et al., supra, as described in detail in Examples 13 and 16. 
Based on this ICV test, the ED 50 for reducing food intake and the ED50 for reducing body weight gain can be deter- 
mined. In addition, the biological activity of the purified human and murine ob proteins or fragments thereof can be 
determined by repeated IP injection in ob/ob mice as detailed in Example 15. Based on the IP test, the ED20 for reduc- 
ing food intake and the ED20 for reducing body weight gain can be determined. 

40 The biological activity of the human and murine ob proteins, or fragments thereof, obtained and purified in accord- 
ance with this invention can also be determined in humans by methods known in the art, e.g., measuring the reduction 
of test meal intake following IV administration of the ob protein to the obese human test subjects compared to IV admin- 
istration of saline control, in accordance with the methods of Muurahainen, N.E. et al., Am. J. Physiol 260, 672-680 
(1991), and as described in detail in Examples 14 and 17. Alternatively, the ability of the purified murine and human ob 

45 proteins of this invention to reduce the rate of weight gain (e.g., induce weight loss) can be determined by repeated IV 
administration to obese human test subjects according to the methods of Drent, M.L et al., Int. J. Obesity 19, 221 -226 
(1995), as described in detail in Example 18. 

The murine and human ob proteins of this invention when purified in accordance with this invention have biological 
activity in that: 

50 

1) When they are administered by intracerebroventricular (ICV) injection to 16-18 hour fasted mature obese ob/ob 
mice having a body weight of at least 30 grams at a dose of 20 \iq or less using the methods of Haley and McCor- 
micK supra, the protein or polypeptide: 

55 (a) reduces food intake during a 5 hour feeding test by 50% compared to vehicle injected control mice (ED50 

for reducing food intake); and 

(b) reduces body weight gain during the 24 hours following the ICV injection by at least 50% compared to vehi- 
cle injected control mice (ED50 for reducing body weight gain); 



8 



EP0 741 187 A2 



and 

2) When they are administered intraperitoneal (IP) to non-fasted mature ob/ob mice having a body weight of at 
least 30 grams twice a day at the beginning of daylight and again at the 3 hour point of the dark phase, for one 
5 week, in a total daily dose of 20 ng or less, the protein or polypeptide: 

(a) reduces 5 and 24 hour food intake by at least 20% compared to vehicle injected control mice (ED20 for 
reducing food intake); and 

io (b) reduces body weight gain during the 24 hours following the first IP injection by at least 20% compared to 

vehicle injected control mice (ED20 for reducing body weight gain). 

In addition this reduction in body weight and food intake even take place at doses below 20 \ig or less, even at a 
dosage level administered ICV-of 1 \iq or less especially when these proteins are purified to homogenrty. 

is The biological assays described above and detailed in the examples for determining the biological activity of human 
and/or murine ob proteins can be used to determine the biological activity of fragments of these proteins, whether these 
fragments are produced by proteolytic degradation of the ob proteins, by chemical synthesis by recombinant protein 
expression of a portion DNA sequence for the ob proteins or by any other means known to the skilled artisan. 

In accordance with a further embodiment of this invention, the murine and human ob protein of this invention can 

20 be conjugated with polyethylene or polypropylene glycol homopolymers which can be unsubstituted or substituted by 
ethertf ication of the one of the hydroxy groups at one of its ends with a lower alkyl group. These conjugates provide the 
ob protein in stable form and improve the half life of these proteins. In addition, the use of these conjugates formed from 
polyethyleneglycol or polypropylene glycol homopolymers provide means tor increasing the half life of the activity of the 
ob protein in the body. Furthermore, these conjugates have been found to provide additional advantages such as 

25 increasing the stability and circulation time of the therapeutic ob protein in the body while also decreasing the immuno- 
genicrty of the ob protein. These pegylated ob proteins can also be readily adsorbed in the human body and provide 
increased uptake in the blood system. 

The preferred polyethylene or polypropylene glycol homopolymers which are conjugated to the ob protein have 
molecular weights of approximately 15 to 60 kDa, to produce a protein which can be mono- or poly-pegylated with pol- 

30 yethylene or polypropylene glycol molecules. In the preferred case, the ob protein is either mono- or di- pegylated to 
form a conjugate with polyethylene or polypropylene glycol units, which units in the conjugate have a total molecular 
weight of from 15 to 60 kDa, most preferably from 35 to 45 kDa. In general, the conjugates are produced as mixture 
(composition) of polyethylene and polypropylene glycol conjugates since polyethylene and polypropylene glycol starting 
materials are sold as a mixture of different homopolymers having different molecular weights. The molecular weight set 

35 forth above is average molecular weight of the mixture of ob conjugates thus produced. These mixtures can be sepa- 
rated into the individual conjugates, if desired, by conventional means such as by column chromatography which 
includes HPLC. However, for treatment, generally this conjugate is utilized as a mixture 

The polyethyleneglycol or polypropylene glycol polymers [PEG] can be attached to the ob protein via the free Ni- 
ter mi nal amino acid of the protein to form the conjugate by any conventional means. Methods for attachment of the pol- 

40 yethylene or polypropylene glycol to form the conjugates with the ob protein can be by any of the many known methods 
available. The polyethylene or polypropylene glycol may be covalently bonded through the N-terminal amino acid of the 
protein, as well as also through the various lysine residues on the ob protein. 

Additionally, the polyethylene or polypropylene glycol homopolymers may be conjugated to the ob protein by bi- or 
poly functional linking groups. In producing mono-polyethylene or polyproplylene gylcol homopolymer conjugates, di- 

45 functional linkers are used and the homopolymer is conjugated to one functional group of this linker whereas the N-ter- 
minal amino acid as well as the lysine group of the ob protein can be conjugated to the other functional group of this 
linker. Tri- or poly- [polyethylene or polypropylene glycol] polymers, conjugates with the ob protein are formed by using 
a tri-functional or poly-functional linker. The homopolymer can be conjugated to two or more of these functional groups 
with one remaining functional group of the linker being attached to the ob protein. Among these linkers are those poly- 

50 functional linkers having amine and carboxy functional groups. Amine groups can conjugate with the functionalized 
hydroxy group of the polyethylene or polypropylene glycol to form an amide linkage. Carboxy groups can conjugate with 
the amine groups on the ob protein to form an amide bond and with the functionalized hydroxy group on the glycol to 
form an ester. Among the many types of linking groups which can be utilized to form the conjugate between the ob pro- 
tein and the PEG are those disclosed in U.S. Patents Nos. 4,902,502, 5.034,514, 4,609,546, 5,122,614 and 4,847,325. 

55 



9 



EP0 741 187 A2 

In accordance with an especially preferred embodiment of this invention are those conjugates of the formulas 



R'OCHjCHjtOCHjCHa)^ O C- 



-NH 



(CH 2 ) 4 



CH 



ROCH 2 CH 2 (OCH 2 CH2) n O C NH 

O 

and 



RO(CH 2 CH 2 0) n CH 2 CH 2 C NH- 



I-A 



-NH P 



I-B 



where P is the murine or human ob protein described herein; and n and n' are integers whose sum is from 300 to 1200 
so that the average molecular weight of all PEG units is from 1 5 to 60 kDa and the total molecular weight of the conju- 
gate is from 30 kDa to 80 kDa; and R and FT are lower alkyl. 

The compounds of formula l-A and l-B can be prepared from the known polymeric materials 



R'OCHjOtyOCHjCHj)?- 



-NH 



(CH^ 



CH 



RQCH 2 CH 2 (OCH 2 CH2)„ O C NH 

O 



r 

o 



•O- N 




n-A 



and 



10 



EP0 741 187 A2 



? RO(CH 2 CH 2 0) n CH 2 CH : 




n-B 



by condensing them with the murine or human ob protein of this invention. Any conventional method of reacting an acti- 
vated ester with an amine to form an amide can be utilized. In the reaction illustrated above, the exemplified succinim- 
idyl ester is a leaving group causing the amide formation. Where the compound of formula ll-B is utilized to produce the 

15 compound of formula I-6, the reaction with the murine or human ob protein of this invention is carried out in the same 
manner described in connection with the conversion of the compound of formula 1 1 -A to the compound of formula I- A. 
These succinimidyl esters such as the compound of formula 1 1- A to produce conjugates with proteins are disclosed in 
Monfardini et al. Bioconjugate Chem., 6, 62-69 (1995). 

In the case of the compound of formula l-A, the sum of n and n' are from 300 to 1500 so as to produce a conjugate 

20 having a total average molecular weight of PEG units of from 1 5 to 60 kDa and preferably from 35 to 45 kDa. In the pre- 
ferred embodiment of formula l-A the sum of n and n' is from about 800 to 1200 with the average sum of n and n* being 
from 850 to 1000. Generally, the preferred ratio of n to n' in the compounds of formula l-A and ll-A is from 0.5 to 1 .5 with 
from 0.8 to 1 .2 being preferred. In the case of the compound of formula l-B, n is preferably between 300 to 1 500 to pro- 
duce a compound having from 300 to 1 500 PEG units with a total molecular weight of from 1 5 to 60 kDa and preferably 

25 from 35 to 45 kDa. In the preferred embodiment n is from about 850 to 1000. 

The human or murine ob proteins prepared in accordance with this invention may be prepared in pharmaceutical 
compositions suitable for injection with a compatible pharmaceutically acceptable carrier or vehicle by methods known 
in the art. Any conventional carrier material can be utilized. The carrier material can be an organic or inorganic one suit- 
able for enteral, percutaneous or parenteral administration. Suitable carriers include water, gelatin, gum arabic, lactose, 

30 starch, magnesium stearate, talc, vegetable oils, polyalkylene-glycols, petroleum jelly and the like. Furthermore, the 
pharmaceutical preparations may contain other pharmaceutically active agents. Additional additives such as flavouring 
agents, preservatives, stabilizers, emulsifying agents, buffers and the like may be added in accordance with accepted 
practices of pharmaceutical compounding. Among the preferred carriers for formulating the homogeneous ob proteins 
of the invention are human serum albumin, human plasma proteins, etc. 

35 Administration of recombinant homogeneous ob protein, be it human or murine or a combination thereof, results in 
decreased food intake and weight toss in obese humans and animals. Therefore, administration of the ob protein 
replenishes this protein which is important in the regulation of body weight. The pharmaceutical compositions contain- 
ing the human or murine ob proteins may be formulated at a strength effective for administration by various means to a 
human or animal patient experiencing abnormal fluctuations in body weight, either alone or as part of an adverse med- 

40 ical condition or disease, such as type II diabetes meflrtus. A variety of administrative techniques by injection may be 
utilized, among them subcutaneous, intravenous and intraperitoneal injections. Average quantities of the ob protein 
may vary and in particular should be based upon the recommendations and prescription of a qualified physician or vet- 
erinarian. 

The human or murine ob proteins prepared in accordance with this invention may also be used in screening meth- 
45 ods for identifying ob protein receptor(s). 

The Examples provided below are not intended to limit the invention in any way. 

BRIEF DESCRIPTION OF THE DRAWINGS 

so Figure 1 is a schematic of the two clones for human ob protein; i.e., hob dl and hob c!2 t which schematics depict 
the location and types of restriction sites located at the 5' and 3' ends of the human ob cDNA sequence. 
Figure 2 is a schematic of the construction of the pLPPsOmpA mob expression vector. 
Figure 3 is a schematic of the construction of the pLPPsOmpA hob1 expression vector. 

55 



11 



EP0741 187 A2 



Example 1 

Obtaining the Human ob cDNA. 

5 The human ob cDNA was obtained by screening a commercially available lambda phage cDNA library ("Clontech") 
made from RNA derived from human adipocyte tissue. From this library, two lambda phages each containing approxi- 
mately a 2.5 kilobase fragment corresponding to the human ob cDNA sequence were obtained through hybridization of 
lambda phage libraries. By this technique, two clones were identified, i.e.. hob1 cDNA and hob2 cDNA. The human ob 
gene was subcloned into the plasmid vector DNA pBluescriptSk' commercially available from Stratagene. The resulting 

10 vectors containing these human ob gene sequences were called pBluescriptSkhobl and pBluescriptSK"hob2. 

The human ob gene sequence in this pBluescriptSk hobl and pBluescriptSKhob2 were verified by nucleotide 
sequencing. The amino acid sequences of the protein deduced from the nucleotide sequencing corresponded to the 
human ob protein encoded by SEQ ID. NO. 4 and as published by Zhang, Y et al., supra. The pBluscriptSk hobl had 
a T-C mutation after the stop codon of the hob1 cDNA. This mutation resulted in the loss of the Stul restriction site oth- 

15 erwise predicted to be present in the nucleotide sequence of hob 1 as follows: 

hob I 

. . . GGG . TGC . TGA GGCCT TGA. . . 

20 

Gly Cys stop 

oBluscriptSk -hobl 
25 - • . GGG . TGC . TGA GGCCC TGA. . . 

Gly Cys stop 



30 DBlueseriptSTc^h^ - 

. . . GGG . TGC . TGA GGCCT TGA 
Gly Cys stop 

35 

Since this mutation in pBluescriptSk hobl is located after the stop codon of the human ob cDNA sequence it does 
not lead to a change in the amino acid sequence of the human ob protein as published by Zhang, Y. et al., supra. 

As far as the nucleotide sequence of the cDNA present in pBluescriptSK'hob2 is concerned, it was demonstrated 
40 by restriction enzyme analysis that this plasmid has the Stul restriction site located after the stop codon of the human 
ob cDNA sequence. 

In addition to the fact that pBluescriptSk hobl has a mutation in the Stul restriction site following the stop codon, 
the pBluescriptSk hobl also has an EcoRI restriction site after the ORF in hob1 cDNA which is absent in the hob2 
cDNA (See Figure 1.). 

45 

Example g 

Plasmid Construction for Murine ob Protein (mob) 

so Murine ob cDNA of SEQ ID NO. 1 was obtained by the procedure of Zhang, Y et al., supra, and thereafter inserted 
into the pCDNA3 vector commercially available from Invitrogen (San Diego, California, USA). The murine ob gene thus 
obtained was used to construct the expression vector pLPPsOmpA-mob for expression of the murine ob protein (mob). 
This expression vector and its construction is detailed in Figure 2. 

The first stage of construction was to achieve the fusion of the signal-coding sequence from sOmpA gene to the 

55 mature coding region of the murine ob gene, i.e., without its natural signal-sequence. The DNA fragment of 501 bp 
encoding the mature murine ob protein inserted in the pCDNA3 vector was amplified from the vector by the polymerase 
chain reaction (PCR) using Vent DNA polymerase (New England Biolabs), a forward primer (primer 1) starting with the 
first nucleotide of the codon encoding valine (which is the first amino acid in the mature mob) (Zhang, Y. et al., supra), 



12 



EP0 741 187A2 



and a reverse primer {primer 2) corresponding to the region of the mob containing the stop codon of mob. Primer 2 also 
contained a sequence corresponding to a Hind III restriction site. 

Primer 1 : 5' GTG CCT ATC CAG AAA GTC 3' Val Pro lie Glu Lys Val 

5 

Primer 2: 5' TCCC AAGCTT TjQAGCATTCAGGGCTAAC 3* Hindlll stop 

The amplified 501 bp DNA fragment was purified by agarose gel electrophoresis and phosphorylated using T4 
polynucleotide kinase f Boehringer") and next digested with the restriction enzyme Hindlll to create a 5' protruding end 
10 at the position of the primer 2. The obtained fragment had a blunt end corresponding to the first nucleotide of the cDNA 
encoding mature mob, and a 5* protruding end corresponding to a cleaved Hindlll site. 

Next, the sOmpA plasmid pTIOsOmpArPDI obtained by the methods of De Sutter, K. et al., supra, was fused to the 
mob gene to create a pTIOsOmpAmob plasmid. To carry this out, the mob fragment was cloned by ligation using T4 
ligase ("New England-Biolabs") into the pTIOsOmpArPDI vector DNA which was previously digested with the restriction 
is enzymes Nael and Hindlll by methods known in the art [Sambrook, J. et al., in "Molecular Cloning: A Laboratory Man- 
ual" Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989]; This 
pTIOsOmpArPDI plasmid was derived from plasmid p714 [Parker and Wiley, Gene 83, 117-134 (1989)]. This plasmid 
contained the cDNA encoding mature rat protein disulfide isomerase (rPDI) cDNA fused to the sOmpA sequence. 
This fusion of the last codon in sOmpA (alanine) to the first codon in the cDNA of mature rPDI (glycine) created a 
20 Nael restriction site which after cleavage with Nael released the last codon in the sOmpA sequence and the first codon 
in the cDNA encoding rPDI sequence as blunt ends. 

Nael 

25 5' GCC / GGC 3* 

Ala Gly 
sOmpA cDNA / mature rPDI cDNA 

30 

A Hindlll site exists at the end of the cDNA encoding rPDI. Therefore, further digestion of this plasmid with Hindlll 
released the major part of the rPDI cDNA and created a 5' protruding end compatible with one of the ends of the PCR 
fragment. The resulting plasmid where the cDNA encoding the rPDI was replaced by the cDNA encoding mature mouse 

35 ob was called pT1 OsOmpAmob and is depicted in Figure 2. 

The ligated DNA was introduced in E. coli strain MC1061 using standard electroporation and the obtained colonies 
were screened for the presence of the murine ob DNA fragment by restriction enzyme analysis. Clone pT1 OsOmpAmob 
had the sequence encoding the mature murine ob protein fused to the sequence encoding sOmpA. 

Next, the expression of mob in E. coli in this pT1 OsOmpAmob was placed under the control of both the lipoprotein 

40 promoter (P f pp) and the lac promoter-operator (PO|a C ). To do this, the hybrid gene sOmpA-mob sequence was trans- 
ferred from the plasmid pT1 OsOmpAmob to the plasmid vector pLPPsOmpArPDI by standard procedures described in 
De Sutter et al., supra. The pLPPsOmpArPDI plasmid was derived, as already mentioned hereinbefore, from plasmid 
p714 [Parker and Wiley, Gene 83, 117-134 (1989)]. For this step, the plasmid pTIOsOmpAmob DNA was cleaved with 
the restriction enzymes Xbal and Hindlll. The fragment containing the sOmpA-mob encoding DNA was then ligated into 

45 the plasmid pLPPsOmpArPDI from which the sOmpA-rPDI encoding DNA was previously removed by cleavage with 
the restriction enzymes Xbal and Hindlll. The resulting plasmid was called pLPPsOmpAmob. 

Example 3 

so Expression of murine ob protein in E. coli f MCI 061) 

Expression of the murine ob protein in E. coli was achieved as follows. The pLPPsOmpAmob plasmid constructed 
in accordance with Example 2 was inserted by electroporation into an E. coli strain MC1061 . The E. coli cells (MC1061) 
harboring the plasmid pLPPsOmpAmob were grown up overnight at 28° C in Luria-Bertania f Difco Laboratories") 
55 medium supplemented with the antibiotic carbenicillin (100 ng/ml, "Beecham"). This culture was then used as an inoc- 
ulum (100-fold dilution) for a 30 ml overnight culture at 28° C in the same medium. This culture was then diluted 100- 
fold in 3 jiter (e.g., 6 x 0.5 I in 1 liter erlenmeyer flasks) in the above medium and snaked at 28° C in a New Brunswick 
air shaker (300 rpm) for about 4 hours until a density of Agoo 0.3 to 0.5 was reached. At this time, the lac promoter was 
induced by addition of 2 mM final concentration of isopropyl-p-D-thiogalactopyranoside (IPTG, "Boehringer") as 



13 



EP0 741 187 A2 



described in De Sutter et al„ supra. The cells were further incubated at 28° C for about 5 hours until the cell density 
reached Agoo of 1 .3 to 1 .5. Next the cells were collected by centrifugation in a JA10 rotor (Beckman centrifuge models 
J2-21 or J2-21M) for 6 min. at 6750 rpm (8000 x g) at 4° C. The supernatant was removed and the cell pellet was resus- 
pended rapidly in 250 ml icecold osmotic shock buffer (100 mM Tris-HCI, pH 7.4 containing 20% sucrose 10mM EDTA) 

5 and incubated on ice for 10 to 20 min as described by Koshland and Botstein, supra. 

Thereafter, the suspension was transferred to plastic centrifuge tubes and the cells collected by centrifugation at 
8200 rpm (8000 x g) for 5 min. at 4° C in a JA20 rotor. The supernatant was removed, and the cell pellet rapidly resus- 
pended in 120 ml icecold water under vigorous shaking and incubated on ice for an additional 10 min. The suspension 
was then centrifuged in the JA20 rotor for 6 min. at 4° C at 1 1 ,500 rpm (1 6,000 x g) and the supernatant corresponding 

w to the periplasmic fraction (osmotic shock fluid) was collected (approx. 1 20 ml). Sodium azide and Tris-HCI (pH 7.5) was 
added to a final concentration of 0.05% and 50 mM respectively. The osmotic shock fluid containing the murine ob pro- 
tein was stored at -20° C until further use. 

Example 4 

Expression of murine ob protein in E. coli (MC1Q61) 

Expression of murine ob protein was achieved in accordance with the procedure described in Example 3, except 
triacilline (100>ig/ml) was the antibiotic used to supplement the Luria-Bertaria medium (rather than carbenicillin). 

20 

Example 5 

Purification of murine ob protein from the E. coli osmotic fluid 

25 The murine ob protein located in the 120 ml frozen osmotic shock fluid in accordance with Example 4 was purified 
as follows. The 120 ml osmotic shock fluid containing the murine ob protein was thawed and centrifuged at 4° C for 20 
min at 16,000 rpm in a JA20 rotor to remove insoluble debris. The supernatant was then loaded directly onto a column 
containing a 30 ml bedvolume Q-Sepharose Fast Flow ("Pharmacia") preequilibrated with 50 mM Tris-HCI (pH 7.5) 
buffer. After washing with the 50 mM Tris-HCI (pH 7.5) buffer, the mob protein was eluted with 50 mM Tris-HCI (pH 7.5) 

30 buffer containing 0.1 M NaCI. 

Next, solid (NH 4 ) 2 S0 4 was added to the material eluted from the Q-Sepharose Fast Flow containing column to a 
final concentration of 1.0 M and the mixture was loaded onto a column containing 7.5 ml bedvolume Butyl-Sepharose 
Fast Flow ("Pharmacia") preequilibrated with 50 mM Tris-HCI (pH 7.5) buffer containing 1.0 M (NH 4 ) 2 S0 4 . After washing 
with Tris-HCI (pH 7.5) buffer containing 1 .0 M (NH 4 ) 2 S0 4 , the mob protein was eluted by applying a gradient from 1 .0 M 

35 (NH 4 ) 2 S0 4 in 50 mM Tris-HCI (pH 7.5) buffer to 20% ethylene glycol in water. The mob protein eluted from the Butyl- 
Sepharose Fast Flow column at the very end of the gradient, while most contaminants eluted much earlier. The purity 
of the mob protein at this stage was 90% as estimated by silver-stained polyacrylamide gel electrophoresis (PAGE). 

The mob protein in the material eluted from the Butyl-Sepharose Fast Flow containing column was then further 
purified by gel filtration chromatography. To do this, mouse ob protein was concentrated at 4° C to a volume of 1 ml on 

40 a YM10 ("Amicon") membrane using a 8MC concentrating unit ("Amicon") , and was applied to a column (1.0 cm x 50 
cm) containing 39 ml GlOO-Sephadex ("Pharmacia") preequilibrated in phosphate buffered saline. The fractions con- 
taining the mob protein were then pooled and the protein concentrated on a YM10 membrane. At this stage, the mob 
protein was more than 95% pure as estimated by PAGE and silver staining. SDS-PAGE revealed a single protein band 
at Mr 15,000. 

45 

Example 6 

Sequence Analysis of murine ob protein 

so N-terminal amino acid sequence of the murine ob protein obtained and purified by the procedures of Examples 2, 
3, 4 and 5 described above was performed according to the procedure of Laemli, U.K., supra. After electrotransfer of 
the electrophoresed proteins to a poly(4-vinyl N-methylpyrtdinium iodide) -coated glass fiber sheet as described by 
Bauw, G. et al., J. Biol. Chem. 7, 194-196 (1988), the band of protein with Mr 15,000 was excised from the membrane 
and the N-terminal amino acid sequence was determined by Edman degradation on a 470A gas-phase sequenator 

55 equipped with a 120A on-line phenyrthiohydantoin amino acid analyzer ("Applied Biosystems"). The N-terminal amino 
acid sequence of the murine ob protein was obtained by the above described procedures was Val-Pro-lle-GIn corre- 
sponding to the mature murine ob protein of SEQ ID NO: 3. 



14 



EP0 741 187 A2 



Example 7 

Construction of Expression Vector for Human ob Protein (hob) 

5 The human ob gene obtained in accordance with the procedures of Example 1 was utilized to construct an expres- 
sion vector pLPPsOmpAhobl for expression of the human ob protein. This construction was similar to the construction 
of pLPPsOmpAmob described in Example 2 and is detailed in Figure 3. A three-fragment ligation was required to com- 
plete the DNA fragment containing the entire mature human ob coding sequence. 

In the first stage of the construct, a hob nucleotide sequence starting with the first nucleotide of the codon encoding 

10 the first amino acid of the mature human ob protein (valine) was fused to the signal-coding sequence from OmpA 
(sOmpA), so that the sOmpA sequence is upstream of the 5' end of the hob nucleotide coding sequence. This DNA 
fragment was obtained by amplification in a PCR mixture containing plasmid pBluescriptSK'hobl, Vent DNA polymer- 
ase, and two primers. The forward primer (primer 1) started with the first nucleotide of the codon encoding the first 
amino acid of mature human ob protein, and the reverse primer (primer 2) contained the sequence of the human cDNA 

is containing the stop codon. The amplification reaction yielded a DNA fragment of 501 bp containing the sequence 
encoding the mature human ob protein. The 5' end of this DNA fragment was then phosphorylated with T4 polynucle- 
otide kinase and digested with the restriction enzyme Hindlll, yielding a 353 bp DNA fragment having a blunt end cor- 
responding to the first nucleotide of the cDNA encoding mature hob (position corresponding to the primer 1), and a 5' 
protruding end corresponding to a cleaved Hindlll site. This 353 bp DNA fragment was purified by agarose gel electro- 

20 phoresis and cloned in the pTIOsOmpArPDI plasmid which has been previously digested with the restriction enzymes 
Nae I and Hindlll. The resulting plasmid pT10sOmpAhob1 (partial) has the DNA fragment encoding a part of the mature 
human ob protein (amino-terminal part) fused to the sequence encoding sOmpA. 

25 Primer 1: 5' GTGCCCATCCAAAAAGTC 3' 

Primer2: 5' TCCCAAGCTTTCAGCACCCAGGGCTGAG 3' 

stop 

30 

In a second step, the DNA sequence encoding the carboxy terminal part of the human ob protein, i.e., fragment 2, 
was ligated to the DNA fragment encoding the amino-terminal part of mature hob, and the resulting fragment encoding 
the entire mature hob sequence fused to the sOmpA was transferred to plasmid pLPPsOmpArPDI to bring expression 

35 of mature human ob protein in E.coli under the control of the lipoprotein promoter and the lacpromoter-operator. To do 
this, the plasmid pT1 OsOmpAhobl (partial) was digested with Xbal and Hindlll and the 400 bp DNA fragment 1 of hob 
was isolated by agarose gel electrophoresis (fragment 1). Next the plasmid pBluescriptSK'hobl was cleaved with Hin- 
dlll and EcoR1, and the 450 bp was isolated by agarose gel electrophoresis (fragment 2). Finally, the plasmid pLPP- 
sOmpArPDI was cleaved with Xbal and EcoRI, and the vector fragment isolated by agarose gel electrophoresis 

40 (fragment 3). The DNA fragments 1 , 2 and 3 were then ligated to each other and the ligation mixture introduced into E. 
coli strain MC1061. The colony containing the final plasmid construct pLPPsOmpAhobl was used for expression and 
secretion of mature human ob protein. 

Example 8 

45 

Expression of human ob protein in E. coli (MC1061) 

The pLPPSOmpAhobl constructed in accordance with Example 7 was used to transform E. coli strain MC1061 for 
expression of the human ob protein in soluble biologically active form in the periplasm of the host E. coli cells. Insertion 

so of the plasmid into these host E. coli cells was performed by electroporation. The E. coli cells (MC1061) harboring the 
plasmid pLPPsOmpAhobl were grown at 28° C in Luria-Bertania ("Difco Laboratories") medium supplemented with the 
antibiotic car bene ill in (100 ^g/ml, "Beecham") to the proper density, after which the lac promoter was induced by addi- 
tion of 2 mM final concentration of isopropyl-p-D-thiogalactopyranoside (IPTG, "Boehringer") as described in De Sutter 
et al., supra. The cells were further grown until the cell density reached 1 .3 Aeoo- Next the cells were collected by cen- 

55 trifugation (8000xg at 4° C) and the cell pellet was resuspended rapidly in icecold osmotic shock buffer (100 mM Tris- 
HCI, pH 7.4 containing 20% sucrose and 10mM EDTA) and incubated on ice for 10 min as described by Koshland and 
Botstein, supra. 

Thereafter, the cells were again collected by centrifugation as above and the cell pellet was resuspended in icecold 
water and incubated on ice for 10 min. The suspension was then centrifuged for 5 min. at 16,000 x g and the superna- 



15 



EP0 741 187 A2 



tant (osmotic shock fluid) was collected. Sodium azide and Tris-HCI (pH 7.5) was added to a final concentration of 
0.05% and 50 mM, respectively. The osmotic shock fluid containing the human ob protein was stored at -20° C until fur- 
ther use. 

s Example 9 

Expression of human ob protein in E. coii (Mc1061) 

Expression of the human ob protein was achieved by using the procedure of Example 8, except triacilline (100 
10 ng/ml) was used as the antibiotic to supplement the Luria-Bertaria medium rather than carbenicillin. 

Example 10 

Purification of human ob protein from the E. coli osmotic fluid 

15 

To purify the human ob protein in the osmotic shock fluid of Example 9 t NaCI was added to the fluid to a final con- 
centration of 0.1 M and the fluid was then loaded directly onto a column containing a 30 ml bedvolume Q-Sepharose 
Fast Flow ("Pharmacia") preequilibrated with 50 mM Tris-HCI (pH 7.5) buffer. 

Next, solid (NH 4 ) 2 S0 4 was added to the flow-through material eluted from the Q-Sepharose Fast Flow containing 

20 column to a final concentration of 1 .0 M and the mixture was loaded onto a column containing 7.5 ml bedvolume Butyl- 
Sepharose Fast Flow ("Pharmacia") preequilibrated with 50 mM Tris-HCI (pH 7.5) buffer containing 1.0 M (NH 4 ) 2 S0 4 . 
After washing with Tris-HCI (pH 7.5) buffer containing 1.0 M (NH 4 ) 2 S04, the hob protein was eluted by applying a gra- 
dient from 1 .0 M (NH4)2S04 in 50 mM Tris-HCI (pH 7.5) buffer to 20% ethylene glycol in water. The hob protein eluted 
from the Butyl-Sepharose Fast Flow column at the very end of the gradient, while most contaminants elute much earlier. 

25 The purity of the hob protein at this stage was 90% as estimated by silver-stained polyacrylamtde gel electrophoresis 
(PAGE). 

The hob protein in the material eluted from the Butyl-Sepharose Fast Flow containing column was then further puri- 
fied by gel filtration chromatography. To do this, human ob protein was concentrated at 4° C to a volume of 1 ml on a 
YM10 ("Amicon) membrane using a 8MC concentrating unit ("Amicon"), and was applied to a column (1 .0 cm x 50 cm) 
30 containing 39 ml G1 00-Sephadex ("Pharmacia") preequilibrated in phosphate buffered saline. The fractions containing 
the hob protein were then pooled and the protein was concentrated on a YM1 0 membrane. At this stage, the hob protein 
was more than 95% pure as estimated by PAGE and silver staining. SDS PAGE analysis of the eluate revealed a single 
protein band at Mr 15,000. 

35 Example 11 

Purification of human ob protein from the E. coli osmotic fluid 

To purify the human protein in the osmotic shock fluid of Example 9 the procedure of Example 10 was used with 
40 the following exception: Prior to adding solid (NH4) 2 S0 4 to the flow-through material, the following steps were carried 
out with regard to the osmatic shock fluid of Example 9. 

The human ob protein in the osmotic shock fluid of Example 9 was loaded directly onto a column containing a 30 
ml bedvolume Q-Sepharose Fast Flow ("Pharmacia) prequilibrated with 50 mM Tris-HCI (ph 7.5) buffer. After washing 
with the 50 mM Tris-HCI (pH 7.5) buffer, the hob protein was eluted with 50 mM Tris-HCI (pH 7.5) buffer containing 0.1 
45 MNaCL 

Example 12 

Segues Analysis pf human ob protein 

50 

N-terminal amino acid sequence of the human ob protein purified and obtained by the procedures of Examples 7- 
1 1 described above was performed according to the procedure of Laemli, U.K., supra. After electrotransfer of the elec- 
trophoresed proteins to a poty(4-vinyl N-methypyridtnium iodide)-coated glass fiber sheet as described by Bauw et al., 
supra, the band of protein with Mr 15,000 was excised from the membrane and the N-terminal amino acid sequence 
55 was then determined by Edman degradation on a 470A gas-phase sequenator equipped with a 120A on-line phenylth- 
iohydarttoin amino acid analyzer ("Applied Biosystems"). The N-terminal amino acid sequence of the hob protein 
obtained by the above described procedures was Val-Pro-lle-GIn corresponding to the mature human ob protein of 
SEQIDNO:6. 



16 



EP0741 187 A2 



Example 13 

Biological Activity of Murine ob protein: Intracerebroventricular (ICV) injection in ob/ob mice. 

5 The biological activity of the mature murine ob protein purified in accordance with Example 5 was determined using 
the ICV method as follows. Infusion cannulas were implanted into the lateral ventricle of the brains of anesthetized 
female obese ob/ob mice (age 6-13 weeks) using the following coordinates (2 mm lateral of midline; 0.6 mm with 
respect to bregma; 2 mm down) based on the methods of Haley and Mc Cormick, supra! The end of the cannula was 
mounted on the skull using a jeweler screw and dental cement. Mice were individually housed in plastic cages with free 

io access to food (except for the night prior to ICV injection) and water. Following recovery from surgery as assessed by 
daily food intake and body weight gain, mice were studied on several occasions following the intracerebroventricular 
(ICV) injection of 1 ui of one of the following test solutions: 

1) artificial CSF; 
is 2) bacterial control solution; 

3) ob protein (0.6 to 1 ug/mouse); or 

4) no infusion. 

The injection of one of the above test solutions ICV into each mice was followed by 1 nl of artificial CSF to clear the 
20 cannula. For purposes of this experiment, the bacterial control solution was an sample identically processed and pre- 
pared in accordance with the procedures outlined for Examples 2-4, except that the plasmid inserted in the E. coli bac- 
teria was absent the murine ob gene. 

Mice were fasted for 18 hours (overnight) prior to ICV injection. Mice were lightly restrained and a 10 jil Hamilton 
syringe fitted with a piece of precalibrated polyethylene (PE) tubing (PE20) was used to inject 1 \x\ of the test solution 
25 into the cannula placed in the lateral ventricle. Mice were then immediately placed in a test cage with a food dish con- 
taining a pre-weighted amount of pelleted mouse chow and a water bottle. Mice were visually observed and food intake 
was measured for the next seven hours. Food intake measurements were obtained at 0.5, 1 , 2, 3, 4, 6 and 7 hours post- 
ICV injection. Body weight for each animal was measured prior to the ICV injection and 24 hours later. Successful can- 
nula placement was documented by an increase in 2 hour food intake following ICV injection of 10 ug Neuropeptide Y 
30 in 2 hour fasted mice according to Morley, J.E. et al., American J. Physiol. 253, 516-522 (1987). 
The results of the ICV test described above were as follows: 

A. Reduction of Food Intake 

35 During the first 30 minutes following ICV injection almost all mice ate with a short latency and consumed approxi- 
mately 0.5 grams. Mice which received no injection or artificial CSF continued to eat throughout the next 6.5 hours and 
reached a cumulative 7 hour intake of 3.2 grams (Table 1). In contrast, the mice treated with ob protein ICV stopped 
eating after the first 30 min and did not eat again. Thus, their cumulative food intake remained suppressed over the next 
6.5 hours at approximately 0.5 grams (Table 1). Mice receiving the vehicle control solution ICV also stopped eating after 

40 30 min., and only began eating again between 6 and 7 hours. 

B. Reduction in Body Weight Gain 

The 24 hour change in body weight of the mice injected with vehicle control was slightly reduced from that of arti- 
45 f icial CSF injected or non-injected mice (Table 1). However, the percent change in body weight of the mice injected with 
ob protein was near zero and was significantly reduced compared to the vehicle control injected mice (Table 1). 

C. Conclusion 

so The observed effect of direct administration of recombinant mouse ob protein (1.1 ug/mouse in 1 ul to the brain) 
.. was a sustained and significant reduction in food intake and body weight gain of female ob/ob mice. This demonstrates 
that ob protein can act directly on the brain and is consistent with the effect of the ob protein when injected intraperito- 
neal. This example also confirms the biological activity of bacterially expressed recombinant murine ob protein in 
female obese ob/ob mice in accordance with the invention. 

55 



17 



EP0 741 187 A2 



TABLE 1 



Treatments 


Food Intake 
(0.7 hr) 


Body Weight 
Gain (0-24 hr) 




g 


%** 


g 


% 


Aifrf ical CSF 


3.2 ± 0.2 


100 


3.8 ± 0.3 


100 


Vehicle Control 


0.9 ±0.3 


28.1 


2.9 ±0.2 


76 


ob Protein (1u,g/mouse) 


o.s±o.r 


15.6 


0.3 ±0.5* 


8 



* indicates significant differences between ob protein and artificial 
Cerebro Spinal Fluid (CSF) groups with p<0.05 
** indicates percent of control 



Example 14 

so Biological Activity of Murine ob protein Intravenous (IV) in ob/ob Mice 

The biological activity of the murine ob protein obtained and purified in accordance with Examples 2, 3, 4 and 5 was 
tested by intravenous (IV) injection in obese ob/ob mice as follow. 

Male and female obese ob/ob mice (6-13 weeks old) were implanted with chronic jugular cannulas under pentobar- 

25 brtal anesthesia (80 mg/kg body weight) according to the method of Mokhtarian A., et at.. Physiol. Behav. 54, 895-898 
(1993). Mice were individually housed in plastic cages under constant environment conditions with a 12 hr dark/12 hr 
light cycle. Body weights were measured in fusion daily and the patency of cannulas was verified and maintained every 
other day by infusion of ^ 0.1 ml sterile heparin/saline solution (50 U/ml in 0.9% saline). After complete recovery from 
surgery, assessed by body weight gain, the mice were fasted 16-18 hours (overnight). The next morning, mice were 

30 weighed and placed in test cages for 45 minutes for acclimatization before the experiment. Water was available conti- 
nously. Mouse ob protein (3u,g in 0.1 ml) or an equal volume of vehicle control or saline (0.9%) solution was injected 
intravenously. Awake mice were lightly restrained and 0.5 ml insulin syringes were used to inject 0.1 ml of the test solu- 
tion followed by 0.05 ml heparin/saline. Trials were separated by at least 3 days. Mice were then immediately replaced 
in the test cage with a pre-weighted petri dish containing a pellet of mouse chow. Mice were visually observed and food 

35 intake was measured for the next seven hours at 0.5, 1 , 2, 3, 4, 6 and 7 hrs post-l V injection. Body weight was measured 
before the IV injection and again 24 hrs later. Two separate groups of cannulated mice (1 1 ob/ob and 12 lean) were 
used in five individual trials. Most mice received mouse ob protein and one or both control injections in counterbalanced 
order. Two separate preparations of mouse ob protein were used in this experiment. The data reported here are a com- 
bination of the results of these individual replications. 

A. Results 

The results of the above experiment are as follows: 

During the first 30 minutes following IV injection most obese and lean mice ate with a short latency and consumed 
45 approximately 0.3-0.5 grams. Food intake in saline and vehicle control injected obese mice increased throughout the 
experiment. The cumulative food intake of obese ob/ob mice injected with vehicle control was not different from the food 
intake of similarly fasted obese mice that were injected with saline. In contrast, the food intake of the obese ob/ob mice 
injected with recombinant ob protein was significantly reduced and remained suppressed at 57% of control (Table 2). 
No other behavioral effects were observed in the vehicle control and ob protein groups throughout the 7 hr observation 
so period. As expected, the 24 hr post-injection body weight gain was not different in the treatment groups (Table 2) due 
to the limited duration of action of a single IV bolus of mouse ob protein. 

B. Conclusions 

55 These results demonstrate that recombinant mouse ob protein significantly reduced cumulative 7 hr food intake fol- 
lowing IV administration (3 ug/mouse) in obese ob/ob mcie. The ability of recombinant mouse ob protein to reduce food 
intake in obese ob/ob mice is consistent with the food intake results obtained following repeated IP injection of the ob 
protein in obese ob/ob mice. This example also confirms the biological activity of bacterially expressed recombinant 
mouse ob protein in female obese ob/ob mice. 



18 



EP0 741 187 A2 



TABLE 2 



Table 2: IV Administration of Murine ob Protein in ob/ob Mice 


Treatments 


Food Intake (0-7 hr) 


Body Weight 
Gain (0-24 hr) 




9 


%** 


g 


% 


Saline (n = 4) 


1.8 ±0.2 




2.910.3 




Vehicle Control (n = 7) 


1.4±0.3 


100 


2.210.6 


100 


ob Protein (1 pg/mouse) (n = 8) 


0.810.2* 


57 


1.410.6 


64 


Data are mean ± sem. n = indicates the number of individual mice, sem 
means "standard error of the mean", 



* indicates significant differences between ob protein and artificial CSF 

groups with p<0.05. 

" indicates percent of control 



Example 1 5 

25 Biological Activity of the Murine ob Protein: Repeated IP Injection in ob/ob mice. 

The biological activity of the murine ob protein obtained and purified in accordance with Examples 2-5 was tested 
by repeated intraperitoneal (IP) injection in obese ob/ob mice as follows. 

Three groups of six female obese ob/ob mice were studied. Mice were housed in plastic cages (three per cage) 
30 under constant environmental conditions with a 12 hour dark/12 hour light cycle. Twenty-four (24) hour food intake and 
body weight were measured every day. Following an adaptation period to environmental conditions and daily handling 
and injections, the mice were sorted into three treatment groups. Each mouse received two intraperitoneal (IP) injec- 
tions each treatment day (shortly before the beginning of the dark phase of the dark/light cycle and three hours into the 
dark phase) of the 0.1 ml of the following test solutions: 

35 

1) saline (0.9%); 

2) bacterial control solution; or 

3) murine ob protein (3 ug/0.1 ml). 

40 The bacterial control solution was a sample identically processed and prepared in accordance with the procedures out- 
lined for Examples 2-4 to obtain and purify murine ob protein, except that the plasmid inserted in the E. coli bacteria 
was absent the murine ob gene. Mice were treated twice daily for five days and then received no treatment for two days. 
Food intake of each cage was measured at 2, 3, 5 and 24 hours following the first IP injection on each treatment day. 

45 A. Results 

Reduction of Food Intake 

Food intake was not different in the saline and bacterial control injected mice on treatment and non-treatment days 
so throughout the one week experiment (Table 3). However, food intake was reduced in the six mice injected with 6 ug ob 
protein on treatment days throughout the experiment. The reduction in food intake was observed at 2, 3, 5 and 24 hours 
after the first injection on treatment days in the mice receiving ob protein group compared to the bacterial control and 
saline control groups. 

55 Reduction of Body Weight Gain 

The cumulative body weight gain over the five treatment days of the ob protein group was -3.3 +/- 0.7 grams com- 
pared to -0.9 +/- 0.2 grams in the saline and -0.7 +/- 0.4 grams in the bacterial control groups (Table 3). 



19 



EP0741 1S7A2 



Conclusion 

This example demonstrates that two daily IP injections of bacterially expressed recombinant murine ob protein (6 
jig/mouse/day) resulted in a significant, sustained reduction of food intake and a significant decrease in the rate of 
5 weight gain of treated female ob/ob mice compared to saline and bacterial control treated ob/ob mice. These results 
demonstrate the bacterial expressed murine ob protein is biologically active and has the expected anti-obesity effects 
on genetically obese ob/ob mice in accordance with this invention. In Table 3 the 2 and 5 hour results are the mean 
daily food intake while the 24 hour results shown are the 5 day cumulative food intake. 

10 

TABLE 3 



Table 3: Repeated IP Administration of Murine ob Protein in ob/ob Mice 


Treatment 


Food Intake (grams/3 mice) 


Body Weight 
Gain 




2hr 


5hr 


24 hr 


grams 




g 


% of control 


g 


% of control 


g 


% of control 




No Injection 


5.510.5 




14.5 ±0.5 




44.3 1 3.5 




-0.910.2 


Control 


7.0 ± 0.5 


100 


16.5 ± 1.5 


100 


49.5 1 6.1 


100 


-0.7 1 0.4 


ob Protein 


3.5 ± 0.5* 


50 


5.511.0* 


33 


25.5 1 4.6* 


52 


-3.3 1 0.7* 


Data are mean ± sem for six ob/ob mice in each group. Food intake is mean cumulative intake for cages of three mice 
during the five days of treatment at 2, 5 and 24 hr after the first IP injection. Body weight gain is the cumulative 
change in body weight during the five days of treatment. 



* indicates significant differences between ob protein and vehicle groups with p<0.05. 



30 

Example 16 

P'QiQqical Activity of Human ob Protein; Intracerebro ventricular (ICV) Injection in ob/ob Mice 

35 

The methods used to determine biological activity of Human ob protein by intracerebroventricular ICV injection in 
ob/ob Mice were the same as Example 1 3 except that the test solutions were: 

Recombinant human ob protein produced in Example 1 1 (0.05^g) in phosphate buffered saline (PBS) containing 
40 0.1% mouse serum albu mi n ; and 

PBS containing 0.1% (w/v) mouse serum albumin (albumin control) as the vehicle control solution. 

A. Reduction of Food Intake 

45 During the first 30 minutes following ICV injection almost all mice ate with short latency and consumed approxi- 
mately 0.5 grams. Mice which received no injection continued to eat throughout the next 6.5 hours and reached a com- 
ulative 7 hour intake of 1.8 grams (Table 4). Mice receiving the albumin control solution ICV also stopped eating after 
30 minutes and only began eating again between 3 and 7 hours. In contrast, the mice treated with human ob protein 
ICV ate significantly less in the first 30 minutes (0.2 grams) and ate very small amounts during the next 6.5 hours. Thus, 

so their cumulative food intake remained suppressed over the next 6.5 hours at approximately 0.4 grams (Table 4). 

B. Reduction in Body Weight Gain 

The 24 hour change in body weight of the mice injected with vehicle control was slightly reduced from that of arti- 
55 f icial CSF injected or non-injected mice (Table 4). However, the percent change in body weight of the mice injected with 
human ob protein was near zero (Table 4). 



20 



EP0 741 187 A2 



C. Conclusion 

The observed effect of direct administration of recombinant human ob protein (0.05 ng/mouse in 1ul) to the brain 
to lead to a substained and significant reduction in food intake and body weight gain of female ob/ob mice demonstrates 
5 that ob protein can act directly on the brain and is consistent with the effect of ob protein when injected IP. This example 
also confirms the biological activity of bacterially expressed recombinant human ob protein in female obese ob/ob mice. 



TABLE 4 



Table 4: ICV Administration of Human ob Protein in Ob/Ob Mice 


Treatments 


Food Intake (0.7 hr) 


Body Weight 
Gain (0-24 hr) 




g 


%** 


9 


%" 


No Injection (n = 3) 


1.8±0.2 




3.1 ± 0.4 




Albumin Control (n = 3) 


1.0 ±0.4 


100 


1.7 ±0.6 


100 


Human ob Protein (1 ng/mouse) (n = 5) 


0.4 ±0.2* 


40 


0±0.8 


0 


Data are mean ± sem. N = indicates the number of individual mice. 



• indicates significant differences between human ob protein and artificial CSF groups 
with p<0-05. 

** indicates percent of control 



25 



Example 17 

30 Biological Activity of ob Protein in Obese Human Subjects: Reduction of Test Meal Intake Following IV Administration. 

The biological activity of the murine and human ob proteins obtained and purified in accordance with Examples 7- 
1 1 respectively, is determined by measuring test meal intake following IV administration to humans as follows. 

Lean and obese human volunteers are presented with test meals of fixed caloric content in an eating laboratory on 

35 two occasions using the method of Muurahainen, N.E. et al., supra. At least one hour prior to meal presentation, an ind- 
welling IV catheter is placed in the antecubitat or forearm vein and is kept open with a heparin lock. Visual-analog hun- 
ger rating are obtained 15 minutes before, 15 minutes after meal presentation, and at the conclusion of the test meal. 
Murine or human ob protein or saline is then infused IV 20 minutes prior to meal presentation. Each subject is instructed 
to eat as much of the test meal as they wish until they are satisfied. The amount of the test meal ingested by each sub- 

40 ject is measured. Each subject then receives infusions of either human ob protein (0.5 mg/kg body weight), murine ob 
protein (0.5 mg/kg body weight) or saline and the difference in amount of the test meal ingested under these conditions 
is calculated. In the human or murine ob protein group, there is a reduced amount of meal consumed by at least 20%. 

Ex ample 19 

45 

Biological Activity of ob Protein in Obese Human Subjects: Induction of Weight Loss by Repeated IV Administration. 

The biological activity of the murine and human ob proteins obtained and purified in accordance with Examples 7- 
1 1 , respectively, is determined by measuring weight loss following repeated IV administration of the ob protein, accord- 

so ing to the following method. 

A placebo controlled, double blind weight loss study using the methods of Drent, M.L. et al., supra, is performed. 
Obese subjects with Body mass index (BMI) greater than 27 are weighed and then placed on a diet with 1500 Kcal for 
a 2-4 week run-in period. At the end of the run-in period, all obese subjects that lost at least 1 kg body weight are ran- 
domized into two treatment groups matched for weight loss during the run-in phase. Subjects receive daily IV adminis- 

55 tration of either human or murine ob protein (0.5 mg/kg/day) or placebo (saline) for at least 6 weeks. Body weigh is 
recorded weekly. Those subjects receiving human or murine ob protein have a significant reduction in body weight than 
the placebo group after 6 weeks of treatment. 



21 



EP0 741 187 A2 



Example 19 

A. Preparation of Polyethylene Glycol Conjugated ob Protein From E. coli Cells 

s 50 g of E. coli cell pellet prepared as described in Example 8 prior to resuspension was suspended with 1 1 of 50mM 
Tris-HCI (pH 8.5) containing 5mM EDTA. The suspension was incubated for 15 minutes at 37°C, diluted with an addi- 
tional 11 of 50mM Tris-HCI (pH 8.5) containing 5mM EDTA. Thereafter, the suspension was homogenized using a 
homogenizer for 15 minutes at 50% power setting. The suspension was clarified by cerrtrifugation at 8,000 rpm, 4°C, 
for one hour. The pellet was discarded. The supernatant was diluted with water to a conductivity of 1.8mS. and applied 

to directly onto a column packed with 200ml of Q-Sepharose Fast Flow (strong anionic ion exchange resin), preequili- 
brated with 50mM Tris-HCI (pH 8.5). After washing with the equilibration buffer, the adsorbed ob protein was eluted from 
the column with the same equilibration buffer which additionally contained lOOmM NaCI. The eluate obtained after 
treating the column with the equilibration buffer containing sodium chloride was called Q-Sepharose Eluate. 

Solid NaCI was added to the Q-Sepahrose Eluate to reach the final conductivity to 82mS. After this, the eluate was 

15 applied onto a Hydrophobic Interaction Column (HIC) packed with 200m! butyl-Sepharose Fast Flow, preequilibrated 
with 50mM Tris-HCI (pH 8.5) containing 1M NaCI. The unadsorbed materials were washed away with equilibration 
buffer and the adsorbed ob protein was eluted with 50mM ammonium acetate (pH 6.9) to produce HIC eluate. The ob 
protein in the HIC eluate was determined to be 95% pure by reverse phase HPLC. The purified ob protein was concen- 
trated to 3.7 mg/ml using a sizing membrane (YM-10). The sizing membrane was a membrane which retained mole- 

20 cules of 10,000 daltons or greater. After this concentration step, by using a sizing membrane, the ob protein was 
diafiltered into lOOmM borate buffer (pH 8.0) which was used as the ob stock solution. 

b. Peqyiatiop of Human ob Protein 

25 In carrying out this pegylation reaction, the PEG^-NHS reagent of formula ll-A wherein R is CH 3 , the sum of n and 
n' range from 820 to 1040 with the average sum being about 930 and having an average molecular weight of 40 kDa 
which was purchased from Shearwater Polymers, Huntsville, Alabama was utilized. This was a mixture of PEG 2 -NHS 
reagents of formula ll-A where the ratio of n to n* is approximately 1.0 and the sum of n and n* in this mixture ranged 
from 820 to 1040 units with the average molecular weight of the PEG chain in this mixture being approximately 20kDA 

30 so that the average molecular weight of the reagent is approximately 40kDA with the average sum of n and n' in this 
mixture being about 930. To 2 mg or 0.54 ml of the 3.7 mg/ml purified human ob stock solution prepared above in part 
A [125 nmoles ob protein], there was added 250 nmoles of the aforementioned PEG2.NHS reagent solution. This solu- 
tion consisted of 10 mg or 0.1 ml of the 100mg/ml PEG2-NHS reagent solution in 1mM HCI. The total reaction mixture 
was made up to 0.67ml by adding 100mM borate pH5.0. Final molar ratio of protein to reagent was 1 :2. This mixture 

35 was stirred at 4°C for 4 hours and the reaction was stopped by the addition of 1 jJ of glacial acetic acid to produce a 
final pH of 4.5. The resulting reacting mixture (0.67mL) was diluted with water to form a 27 ml solution which was loaded 
onto a column containing 1.7ml of carboxy methylated cationic exchange resin (Perseptives, Framingham, Massachu- 
setts), The column was equilibrated with 3.3 ufvl HEPES/MES/Sodium acetate buffer, pH 5.0. The diluted reaction mix- 
ture was applied to the column and unadsorbed PEG2-NHS reagent was washed off the column. The adsorbed 

40 pegylated and unmodified ob proteins were eluted with step salt gradients [15 column volumes each] of 80, 150 and 
500mM NaCI. 2ml of these eluates were separately collected in sequence and the samples of each fraction were sub- 
jected to an SDS-PAGE analysis. From this analysis, the eluants were classified as highly pegylated conjugates, 
desired branched mono-PEG-ob (PEG^-ob) and unmodified ob protein. Each of these fractions were pooled into the 
classifications set forth above and the second pool containing the desired branched mono-PEG2-ob protein. This 

45 desired protein had the structure of compound of formula l-A wherein the sum of n and n* was approximately 820-1 040, 
with the average sum being about 930, R and R' are CH 3 and the average molecular weight of each PEG chain was 
about 20 kilodaltons. The pegylated product had an average molecular weight of about 56 kDA. The pool containing the 
PEG2-ob was concentrated to 3.7 mg/ml using a YM 10 membrane. YM 10 is a sizing membrane which retains mole- 
cules having molecular weight of 10,000 daltons or greater. After the sizing step, concentrated material was diafiltered 

so into a PBS buffer (pH 7.3) and stored frozen at -20°C. This stored product was the pegylated ob protein of Formula l-A 
where the sum of n and n* was approximately 820 to 1040 and the average molecular weight of each ob chain was 
approximately 20kDA. The average molecular weight of the PEG protein in this ob protein conjugate mixture was 
56kDA. 

55 



22 



EP0741 187A2 

Example 20 

Biological Assay of Peavlated Human ob Protein: Single IP Injection in ob/ob Mice 
s Methods 

Two groups of six mice female obese ob/ob mice were studied. Mice were housed in plastic cages (three/cage) 
under constant environmental conditions with a 12 hr dark/12 hr light cycle. 24 hr food intake and body weight were 
measured every day. Following an adaptation period to environmental conditions, daily handling and injections, the 

w mice were sorted into two treatment groups. Each mouse received one intraperitoneal (IP) injections on day 1 of the 
experiment Qust before the beginning of the dark phase of the dark/light cycle) of the 0.1 ml of the following solutions: 
Saline (0.9%); human ob protein stock solution prepared in part A of Example 19 (30 ug/0.1 ml); pegylated control solu- 
tion (an identically processed and purified sample without human ob protein) or pegylated ob protein (30 u.g/0.1 ml) pre- 
pared as described in Example 19. Mice were injected only once, on day 1 . Daily food intake of the cage and the body 

is weight of each mouse was measured for the next three days and again on day 6. 

Results 

A) Reduction of Food Intake 

20 

Daily food intake was not different in the saline and pegylation control injected mice on the single treatment and two 
subsequent days (Table 5). However, daily intake was reduced in the six mice injected with 30 ug human ob protein and 
pegylated human ob protein on the treatment day (5.2, 8.2 vs 1 1 .9, 1 1 .4 g) compared to the saline and pegylated con- 
trol injected mice. The food intake of the mice injected with human ob protein returned to control levels, while the food 
25 intake of the mice injected with pegylated human ob protein remained reduced on the subsequent days of the experi- 
ment. The reduction in food intake was observed 48 hrs after the single injection in the pegylated human ob protein 
group. The cumulative 24 hr food intake over the three days of the experiment was significantly reduced to 49% of con- 
trol in the pegylated human ob protein compared to the saline and pegylation control group. 

30 B) Reduction of Body Weight Gain 

Change in body weight was not different in the saline and pegylation control injected mice on the single treatment 
and two subsequent days (Table 6). However, body weight was reduced in six mice injected with 30 ug human ob pro- 
tein and pegylated human ob protein on the treatment day (-0.9, -0.7 vs 0.1, 0.3 g) compared to the saline and 

35 pegylated control injected mice. The body weight of the mice injected with human ob protein returned to control levels, 
while the body weight of the mice injected with pegylated human ob protein continued to decrease on the subsequent 
days of the experiment: The continued reduction in body weight was observed 48 hrs after the single injection in the 
pegylated human ob protein group. The cumulative change in body weight over the six days of the experiment was -1 .6 
grams compared to 0.4 grams in the ob protein group, 0.7 grams in the saline and 1.1 ± 0.2 grams pegylation control 

40 groups (Table 6). 

Conclusion 

This example demonstrates that a single IP injection of pegylated human ob protein (30 ^ig/mouse) resulted in a 
45 significant, sustained reduction of food intake and a significant decrease in body weight of treated female ob/ob mice 
over three days compared to saline and pegylation control treated ob/ob mice. These results demonstrate the pegylated 
human ob protein has sustained, potent biologically active and has the expected antiobesity effects on genetically 
obese ob/ob mice. 

50 



55 



23 



EP 0 741 187 A2 



Table 5 



Daily Food Intake of a Single IP Administration of Pegylated Human ob Protein in ob/ob Mice 


Treatment 


Food Intake (3 mice/day) 




day 1 


day 2 


day 3 




9 


o% f control 


g 


% of control 


g 


% of control 


Saline 


11.9 


100 


13.7 


100 


13.6 


100 


ob Protein 


5.2 


43.7 


11.7 


85.4 


12.5 


92 


Pegylated Control 


11.4 


95.8 


4.5 


106 


13.4 


99 


Pegylated ob Protein 


8.2 


68.9 


6.0 


43.8 


4.9 


36 



Data are mean for six ob/ob mice in each group. Food intake is mean daily food intake for cages of three mice on each 
day of the experiment after the single IP injection on day 1. Note persistent reduction in daily food intake only in the 
pegylated ob protein group. 

20 

Table 6 



Change in Body Weight of a Single IP Administration of 
Pegylated Human ob Protein in ob/ob Mice 


Treatment 


Change in Body Weight (grams) 




day 1 


day 2 


day 3 


day 6 


Saline 


0.1 


0.6 


0.01 


-0.01 


ob Protein 


-0.9 


1.1 


0.2 


ND 


Pegylated Control 


0.3 


0.4 


0.6 


-0.2 


Pegylated ob Protein 


•0.7 


-0.6 


-0.9 


0.6 



35 

Data are mean for six ob/ob mice in each group. Mice received a single IP injection on Day 1 only. Change in body 
weight is the change in body weight on each of the days of the experiment. Note persistent weight loss only in the 
pegylated ob protein group. ND in the Table indicates not determined. 



24 



EP0 741 187 A2 



SEQUENCE LISTING 



5 (1) GENERAL INFORMATION: 

(i) APPLICANT: 

(A) NAME: F. HOFFMANN- LA ROCHE AG 

(B) STREET: Grenzacherstrasse 124 

(C) CITY: Basle 
10 (D) STATE: BS 

(E) COUNTRY: Switzerland 

(F) POSTAL CODE (ZIP) : CH-4070 

(G) TELEPHONE: 061 - 688 42 56 

(H) TELEFAX: 061 - 688 13 95 

(I) TELEX: 962292/965542 hlr ch 

15 

(ii) TITLE OF INVENTION: Recombinant Obese (ob) Proteins 



(iii) NUMBER OF SEQUENCES: 8 

20 (iv) COMPUTER READABLE FORM: 

(A) MEDIUM TYPE: Floppy disk 

(B) COMPUTER : Apple Macintosh 

(C) OPERATING SYSTEM: System 7.1 (Macintosh) 

(D) SOFTWARE: Word 5.0 

25 

(2) INFORMATION FOR SEQ ID NO:l: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 702 base pairs 

(B) TYPE: nucleic acid 
30 (C) STRANDEDNESS : single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: cDNA 

(iii) HYPOTHETICAL: NO 

35 

(iv) ANTI-SENSE: NO 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l: 



45 



50 



CAAGGTGCAA 


GAAGAAGAAG 


ATCCCAGGGA 


GGAAAATGTG 


CTGGAGACCC 


CTGTGTCGGT 


60 


TCCTGTGGCT 


TTGGTCCTAT 


CTGTCTTATG 


TTCAAGCAGT 


GCCTATCCAG 


AAAGTCCAGG 


120 


ATGACACCAA 


AACCCTCATC 


AAGACCATTG 


TCACCAGGAT 


CAATGACATT 


TCACACACGC 


180 


AGTCGGTATC 


CGCCAAGCAG 


AGGGTCACTG 


GCTTGGACTT 


CATTCCTGGG 


CTTCACCCCA 


240 


TTCTGAGTTT 


GTCCAAGATG 


GACCAGACTC 


TGGCAGTCTA 


TCAACAGGTC 


CTCACCAGCC 


300 


TGCCTTCCCA 


AAATGTGCTG 


CAGATAGCCA 


ATGACCTGGA 


GAATCTCCGA 


GACCTCCTCC 


360 


ATCTGCTGGC 


CTTCTCCAAG 


AGCTGCTCCC 


TGCCTCAGAC 


CAGTGGCCTG 


CAGAAGCCAG 


420 



25 



EP0741 107 A2 



10 



AGAGCCTGGA TGGCGTCCTG GAAGCCTCAC TCTACTCCAC AGAGGTGGTG GCTTTGAGCA 480 

GGCTGCAGGG CTCTCTGCAG GACATTCTTC AACAGTTGGA TGTTAGCCCT GAATGCTGAA 540 

GTTTCAAAGG CCACCAGGCT CCCAAGAATC ATGTAGAGGG AAGAAACCTT GGCTTCCAGG 600 

GGTCTTCAGG AGAAGAGAGC CATGTGCACA CATCCATCAT TCATTTCTCT CCCTCCTGTA 660 

GACCACCCAT CCAAAGGCAT GACTCCACAA TGCTTGACTC AA 702 
(2) INFORMATION FOR SEQ ID NO: 2: 



(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 167 amino acids 

(B) TYPE: amino acid 

« (C) STRANDEDNESS: not relevant 

(D) TOPOLOGY: unknown 

(ii) MOLECULE TYPE: peptide 

<iii) HYPOTHETICAL: NO 

20 

(iv) ANTI-SENSE: NO 



25 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2: 

Met Cys Trp Arg Pro Leu Cys Arg Phe Leu Trp Leu Trp Ser Tyr Leu 
1 5 10 15 

Ser Tyr Val Gin Ala Val Pro He Gin Lys Val Gin Asp Asp Thr Lys 
30 20 25 30 

Thr Leu He Lys Thr He Val Thr Arg He Asn Asp He Ser His Thr 
35 40 4S 

Gin Ser Val Ser Ala Lys Gin Arg Val Thr Gly Leu Asp Phe He Pro 
35 50 55 60 

Gly Leu His Pro He Leu Ser Leu Ser Lys Met Asp Gin Thr Leu Ala 
65 70 75 80 

Val Tyr Gin Gin Val Leu Thr Ser Leu Pro Ser Gin Asn Val Leu Gin 
40 . 8 5 9 0 9 5 

He Ala Asn Asp Leu Glu Asn Leu Arg Asp Leu Leu His Leu Leu Ala 
100 105 110 

Phe Ser Lys Ser Cys Ser Leu Pro Gin Thr Ser Gly Leu Gin Lys Pro 
45 115 120 125 

Glu Ser Leu Asp Gly Val Leu Glu Ala Ser Leu Tyr Ser Thr Glu Val 
130 135 140 

Val Ala Leu -Ser Arg Leu Gin Gly Ser Leu Gin Asp He Leu Gin Gin 
50 145 150 155 160 

Leu Asp Val Ser Pro Glu Cys 
165 



55 



26 



EP0 741 187 A2 



10 



15 



20 



25 



30 



35 



40 



45 



50 



55 



(2) INFORMATION FOR SEQ ID NO: 3: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 146 amino acids 

(B) TYPE: amino acid 

(C) STRANDEDNESS : not relevant 

(D) TOPOLOGY: unknown 

(ii) MOLECULE TYPE: peptide 
(iii) HYPOTHETICAL: NO 
(iv) ANTI-SENSE: NO 



<xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3: 

Val Pro lie Gin Lys Val Gin Asp Asp Thr Lys Thr Leu lie Lys Thr 
1 5 10 15 

lie Val Thr Arg He Asn Asp He Ser His Thr Gin Ser Val Ser Ala 
20 25 30 

Lys Gin Arg Val Thr Gly Leu Asp Phe lie Pro Gly Leu His Pro He 
35 40 45 

Leu Ser Leu Ser Lys Met Asp Gin Thr Leu Ala Val Tyr Gin Gin Val 
50 55 60 

Leu Thr Ser Leu Pro Ser Gin Asn Val Leu Gin He Ala Asn Asp Leu 
65 70 75 80 

Glu Asn Leu Arg Asp Leu Leu His Leu Leu Ala Phe Ser Lys Ser Cys 
85 90 95 

Ser Leu Pro Gin Thr Ser Gly Leu Gin Lys Pro Glu Ser Leu Asp Gly 
100 105 110 

Val Leu Glu Ala Ser Leu Tyr Ser Thr Glu Val Val Ala Leu Ser Arg 
115 120 125 

Leu Gin Gly Ser Leu Gin Asp He Leu Gin Gin Leu Asp Val Ser Pro 
130 135 140 

Glu Cys 
145 

<2) INFORMATION FOR SEQ ID NO: 4: 

<i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 690 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

<ii) MOLECULE TYPE: cDNA 
(iii) HYPOTHETICAL: NO 
(iv) ANTI- SENSE: NO 



27 



EP0 741 187 A2 



10 



15 



20 



25 



30 



<xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4: 

GTTGCAAGGC CCAAGAAGCC CATCCTGGGA AGGAAAATGC ATTGGGGAAC CCTGTGCGGA 60 

TTCTTGTGGC TTTGGCCCTA TCTTTTCTAT GTCCAAGCTG TGCCCATCCA AAAAGTCCAA 120 

GATGACACCA AAACCCTCAT CAAGACAATT GTCACCAGGA TCAATGACAT TTCACACACG 180 

CAGTCAGTCT CCTCCAAACA GAAAGTCACC GGTTTGGACT TCATTCCTGG GCTCCACCCC 240 

ATCCTGACCT TATCCAAGAT GGACCAGACA CTGGCAGTCT ACCAACAGAT CCTCACCAGT 300 

ATGCCTTCCA GAAACGTGAT CCAAATATCC AACGACCTGG AGAACCTCCG -GGATCTTCTT 360 

CACGTGCTGG CCTTCTCTAA GAGCTGCCAC TTGCCCTGGG CCAGTGGCCT GGAGACCTTG 420 

GACAGCCTGG GGGGTGTCCT GGAAGCTTCA GGCTACTCCA CAGAGGTGGT GGCCCTGAGC 480 

AGGCTGCAGG GGTCTCTGCA GGACATGCTG TGGCAGCTGG ACCTCAGCCC TGGGTGCTGA 540 

GGCCTTGAAG GTCACTCTTC CTGCAAGGAC TACGTTAAGG GAAGGAACTC TGGCTTCCAG 600 

GTATCTCCAG GATTGAAGAG CATTGCATGG ACACCCCTTA TCCAGGACTC TGTCAATTTC 660 

CCTGACTCCT CTAAGCCACT CTTCCAAAGG 690 
(2) INFORMATION FOR SEQ ID NO: 5: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 167 amino acids 

(B) TYPE: amino acid 

(C) STRANDEDNESS : not relevant 

(D) TOPOLOGY :. unknown 



(ii) MOLECULE TYPE: peptide 
(iii) HYPOTHETICAL: NO 
35 (iv) ANTI- SENSE: NO 



40 



45 



50 



55 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5: 

Met His Trp Gly Thr Leu Cys Gly Phe Leu Trp Leu Trp Pro Tyr Leu 
1 5 10 15 

Phe Tyr Val Gin Ala Val Pro He Gin Lys Val Gin Asp Asp Thr Lys 
20 25 30 

Thr Leu He Lys Thr He Val Thr Arg He Asn Asp He Ser His Thr 
35 40 45 

Gin Ser Val Ser Ser Lys <31n Lys Val Thr Gly Leu Asp Phe He Pro 
50 55 60 

Gly Leu His Pro He Leu Thr Leu Ser Lys Met Asp Gin Thr Leu Ala 
65 70 75 80 



28 



EP0 741 187 A2 



Val Tyr Gin Gin lie Leu Thr Ser Met Pro Sex Arg Asn Val lie Gin 
85 90 95 

He Ser Asn Asp Leu Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala 
100 105 110 

Phe Ser Lys Ser Cys His Leu Pro Trp Ala Ser Gly Leu Glu Thr Leu 
115 120 125 

Asp Ser Leu Gly Gly Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val 
130 135 140 

Val Ala Leu Ser Arg Leu Gin Gly Ser Leu Gin Asp Met Leu Trp Gin 
145 150 155 160 

Leu Asp Leu Ser Pro Gly Cys 
165 

>) INFORMATION FOR SEQ. ID NO: 6: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 146 amino acids 

(B) TYPE: amino acid 

(C) STRANDEDNESS : not relevant 

(D) TOPOLOGY: unknown 

(ii) MOLECULE TYPE: peptide 
(iii) HYPOTHETICAL: NO 
(iv) ANTI-SENSE: NO 



{xi} SEQUENCE DESCRIPTION: SEQ ID NO: 6: 

Val Pro He Gin Lys Val Gin Asp Asp Thr Lys Thr Leu He Lys Thr 
1 5 10 15 

He Val Thr Arg He Asn Asp He Ser His Thr Gin Ser Val Ser Ser 
20 25 30 

Lys Gin Lys Val Thr Gly Leu Asp Phe He Pro Gly Leu His Pro He 
35 40 45 

Leu Thr Leu Ser Lys Met Asp Gin Thr Leu Ala Val Tyr Gin Gin He 
50 55 60 

Leu Thr Ser Met Pro Ser Arg Asn Val He Gin He Ser Asn Asp Leu 
65 70 75 80 

Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys 
85 90 95 

His Leu Pro Trp Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly -Gly 
100 105 110 

Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg 
115 120 125 



£9 



EP0 741 187 A2 



Leu Gin Gly Ser Leu Gin Asp Met Leu Trp <51n Leu Asp Leu Ser Pro 
130 135 140 

5 Gly Cys 

145 

(2) INFORMATION FOR SEQ ID NO:7: 

10 (i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 63 base pairs 

(B) TYPE: nucleic acid 

(C) STRAND EDNESS : double 

(D) TOPOLOGY: linear 

15 (ii) MOLECULE TYPE: DNA (genomic) 

(iii) HYPOTHETICAL: NO 
(iv) ANTI-SENSE: NO 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: 
25 ATGAAAAAGA CAGCTATCGC GATTGCAGTG GCACTGGCTG GTTTCGCTAC CGTAGCGCAG 60 

GCC 63 
(2) INFORMATION FOR SEQ ID NO: 8: 

30 (i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 21 amino acids 

(B) TYPE: amino acid 

(C) STRANDEDNESS: not relevant 

( D ) TOPOLOGY : unknown 

35 

(ii) MOLECULE TYPE: peptide 
(iii) HYPOTHETICAL: NO 
An (iv) ANTI-SENSE: NO 



(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8: 

45 

Met Lys Lys Thr Ala He Ala He Ala Val Ala Leu Ala -Gly Phe Ala 
1 5 10 15 

Thr Val Ala Gin Ala 



55 . Claims 



1. Homogeneous biologically active human obese protein or fragment thereof, which fragment has the biological 
activity of said protein. 



30 



EP0 741 187 A2 



2. The protein or fragment of claim 1, wherein the biological activity of said protein or fragment is characterized by 
reducing food intake in mammals and reducing rate of weight gain in mammals. 

3. The protein of claim 1 comprising SEQ ID NO: 6. 

5 

4. Recombinant biologically active human obese protein free of other mammalian proteins or fragment thereof, which 
fragment has the biological activity of said protein. 

5. The protein or fragment of claim 4, wherein the biological activity of said protein is characterized by reducing food 
10 intake in mammals and reducing rate of weight gain in mammals. 

6. The protein of claim 4 comprising SEQ ID NO: 6. 

7. Homogeneous biologically active murine obese protein or fragment thereof, which fragment has the biological 
15 activity of said protein. 

8. The protein or fragment of claim 7, wherein the biological activity of said protein or fragment is characterized by 
reducing food intake in mammals and reducing rate of weight gain in mammals. 

20 9. The protein of claim 7 comprising SEQ ID NO: 3. 

10. Recombinant biologically active murine obese protein free of other mammalian proteins or fragment thereof, which 
fragment has the biological activity of said protein. 

25 11. The protein of claim 10, wherein the biological activity of said protein is characterized by reducing food intake in 
mammals and reducing rate of weight gain in mammals. 

12. The protein of claim 10 comprising SEQ ID NO: 3. 

30 13. An expression vector comprising: 

a) a promoter sequence, and 

b) a DNA sequence encoding a fusion protein, which fusion protein comprises the murine ob protein of SEQ 
ID NO: 3 or the human ob protein of SEQ ID NO: 6, and the signal peptide for the outer membrane protein A 

35 of E. coli, 

which expression vector is capable of expressing the fusion protein in Escherichia coli host cells. 

14. The expression vector of claim 13, wherein the promoter sequence consists of both a lac-promoter operator and a 
40 lipoprotein promoter. 

15. A fusion protein comprising the murine obese protein or the human obese protein, and the signal peptide for the 
outer membrane protein A of Escherichia coli. 

45 16. A fusion protein of claim 15, wherein the murine obese protein comprises SEQ ID NO: 3 and wherein the human 
obese protein comprises SEQ ID NO: 6. 

17. A DNA sequence comprising a first and second part, wherein: 

so (a) the first part is the sOmpA gene sequence of SEQ ID NO: 7 encoding the sOmpA peptide; and 

(b) the second part is the nucleotide sequence encoding the murine ob protein or the nucleotide sequence 
encoding the human ob protein. 

18. The DNA sequence of claim 17, wherein the murine ob protein comprises SEQ ID NO: 3. 

55 

19. The DNA sequence of claim 17, wherein the human ob protein comprises SEQ ID NO: 6. 

20. An Escherichia coli host organism transformed with the expression vector of claim 13. 



31 



EP0 741 187 A2 



21. A method of producing biologically active recombinant human or murine obese protein free of other mammalian 
proteins comprising the steps of: 

a) constructing an expression vector having a promoter sequence, and a ONA sequence encoding a fusion 
protein, which fusion protein comprises SEQ ID NO: 3 or SEQ ID NO: 6, and the signal peptide for the outer 
membrane protein A of E. coli; 

b) inserting the expression vector into an E. coli host cell to transform the E. coli host cell; 

c) expressing the fusion protein in the E. coli host cell; and 

d) treating the E. coli host cell with cold osmotic shock buffer to liberate the murine or human ob protein free of 
other mammalian proteins and free of the signal peptide. 



22. The human ob gene sequence comprising SEQ ID NO. 4. 



23. A method of producing homogeneous biologically active recombinant human or murine obese protein comprising 
subjecting the osmotic fluid containing the human or murine obese protein to a combination of anion exchange col- 
umn chromatography, hydrophobic interaction column chromatography and gel filtration. 

24. A composition comprising one or more conjugates of polyethylene glycol and/or polypropylene glycol linked to a 
human or murine ob protein as claimed in claims 1 to 12 the average molecular weight of the polyethylene or poly- 
propylene glycol units in said conjugates within said composition being between 15 kDa to 60 kDa. 

25. A composition comprising one or more conjugates of the formula: 

O 

n 

R'OCHjOfyOCHjCHjJff O C NH 



(CH2) 4 

I-A 

CH 

ROCHzCHjtOCB^CH^ O C NH C NH P 



r 



wherein P is a human or murine ob protein as claimed in claims 1 to 12, n and n* are integers having a sum of from 
300 to 1500, the average molecular weight of the polyethylene glycol units in said conjugates within said composi- 
tion being from 15 kDa to 60 kDa, and R and R' are lower alkyl. 

26. A composition of claim 25 wherein the sum of n and n' are from about 800 to 1200 and the average molecular 
weight of the polyethylene glycol units in said conjugate within said composition being from 35 to 45 kDa. 



27. A composition comprising one or more conjugates of the formula: 



O 

RO(CH 2 CH 2 0) n CH 2 CH 2 C NH P 



32 



EP0 741 187 A2 



wherein P is a human or murine ob protein as claimed in claims 1 to 12, n is an integer having a sum of from 300 
to 1500, the average molecular weight of the polyethylene glycol units in said conjugates within said composition 
being from 1 5 kDa to 60 kDa, and R is tower alky I. 

5 28. A composition of claim 27 wherein n is from about 850 to 1000 and the average molecular weight of the polyethyl- 
ene glycol units in said conjugates within said composition being from 35 to 45 kDa. 

29. The human or murine ob protein as claimed in claims 1 to 12 or a composition as claimed in claims 24-28 as ther- 
apeutically active agents. 

10 

30. The human or murine ob protein as claimed in claims 1 to 12 or a compositions as claimed in claims 24-28 as ther- 
apeutically active agents for the treatment, prevention and control of obesity and associated diseases. 

31. A pharmaceutical composition comprising a human or murine ob protein as claimed in claims 1 to 12 or a compo- 
is srtion as claimed in claims 24-28 and a compatible pharmaceutical ly acceptable carrier material. 

32. The use of a human or murine ob protein as claimed in claims 1 to 12 or a composition as claimed in claims 24-28 
for the preparation of pharmaceutical compositions. 

20 33. The use of a human or murine ob protein as claimed in claims 1 to 12 or a composition as claimed in claims 24-28 
for the preparation of pharmaceutical compositions for the treatment, prevention and control of obesity and associ- 
ated diseases. 

34. The use of a human or murine ob protein as claimed in claims 1 to 12 for identifying ob protein receptor(s). 

25 

35. The use of an expression vector as claimed in claims 13 and 14 for producing human or murine ob protein as 
claimed in claims 1 to 12. 

36. The use of a DNA sequence as claimed in claims 1 7 to 19 for producing human or murine ob protein as claimed in 
30 claims 1 to 12. 

37. The use of the Escherichia coli host organism for producing human or murine ob protein as claimed in claims 1 to 
12. 

35 38. Homogeneous biologically active recombinant human or murine ob protein whenever prepared -by a process as 
claimed in claim 21 or 23. 



40 



45 



50 



55 



33 



EP0 741 187 A2 



Figure 1 




hob cM 



hob cl 2 



34 



EP0 741 187 A2 



Figure 2 




PCR 
Kinase/ Hindlll 

> 



mob 



451 bp fragment 



Ligation 



Xbal 



Nael 




Nael/ Hindlll 
% isolate vector fragment 
> 

'^■Hndlll 



Xbal 




*^+findlll 



Xbal /Hindlll 
Isolate mob fragment 



Xbal 




Ligation 



Xbal 



^ Xbal /Hindlll 
2 Isolate vector fragment 
> 

'^Hndlll 




Hndlll 



35 



EP0 741 187 A2 



Figure 3 

1 




36 



(19) 



J 



I 



(12) 



Europdisches Patentamt 
European Patent Office 
Off fee europ^en des brevets (11) EP 0 741 187 A3 

EUROPEAN PATENT APPLICATION 



(88) Date of publication A3: 

11.12.1996 Bulletin 1996/50 

(43) Date of publication A2: 

06.11.1996 Bulletin 1996/45 

(21) Application number: 96106408.6 

(22) Date of filing: 24.04.1996 



(51) Int. CI. 6 : C12N 15/12, C12N 15/62, 
C12N 15/70, C12N1/21, 
C07K 14/47, A61K 38/17, 
A61K 47/48 

//(C12N1/21, C12R1:19) 



(84) 


Designated Contracting States: 


(72) Inventors: 




AT BE CH DE DK ES Fl FR GB GR IE IT LI LU MC 


• Campfteld, Arthur 




NLPTSE 


Verona, N.J. 07044 (US) 






• Devos, Ren6 


(30) 


Priority: 05.05.1995 US 435777 


B-8400Oostende(BE) 




07.06.1995 US 484629 


• Guisez, Yves 


(71) 




B-8200 St. Andries Brugge (BE) 


Applicant: F. HOFFMANN-LA ROCHE AG 




4070 Basel (CH) 





(54) Recombinant obese (Ob) proteins 

(57) Proteins which modulate body weight of ani- 
mals and humans for the treatment, prevention and con- 
trol of obesity and associated diseases or conditions, 
and the recombinant expression of these biologically 
active proteins in purified and homogeneous forms. 



CO 
< 

oo 



<3- 

o 

Q. 

LU 



Primed by Rank Xerox (UK) Business Services 
2.13.9/34 



EP0 741 187 A3 



Europea " P " ,en, EUROPEAN SEARCH REPORT Nm "" 
Quia EP 96 10 6408 



DOCUMENTS CONSIDERED TO BE RELEVANT 




Category 


Citation of document with indication, where appropriate, 
of relevant passages 


Relevant 
to datm 


CLASSIFICATION OF THE 
APPLICATION (IM.CL6) 


A 

P.X 
D,X 

E 


GENE, 

vol. 141, no. 2, April 1994, AMSTERDAM 
NL. 

pages 163-170, XP000604713 
K. DE SUTTER ET AL.: "Production of 
enzymatically active rat protein disulfide 
isomerase in Escherichia coli 0 

* page 167, right-hand column, paragraph 2 

- page 168, right-hand column, paragraph 2 
* 

EP-A-0 510 356 (HOFFMANN LA ROCHE) 28 
October 1992 

* the whole document * 

W0-A-96 G5309 (UNIV ROCKEFELLER ; FRIEDMAN 
JEFFREY M (US); ZHANG YIYING (US); PROE) 
22 February 1996 

* SeqID's 2, 4, 95, 97 * 

* claims; examples * 

NATURE, 

vol. 372, no. 6505, 1 December 1994, 
LONDON GB, 

pages 425-432, XP002O036O7 

Y. ZHANG ET AL.: "Positional cloning of 

the mouse ob gene and its human homologue" 

* figure 6 * 

WO-A-96 22308 (ZYMOGENETICS INC ;UNIV 
WASHINGTON (US); WEIGLE DAVID S {US); 
KUIJP) 25 July 1996 

* SeqID's 2, 4, 6 * 

* claims; examples * 

-/-- 


14-16 

24-28 

1-23, 
30-38 

1 

1-23, 
30-38 


C12N15/12 
C12N15/62 
C12N15/70 
C12N1/21 
C07K14/47 
A61K38/17 
A61K47/48 
//(C12N1/21, 
C12R1:19) 


TECHNICAL FIELDS 
SEARCHED (IntCI.6) 


C12N 
C07K 
A61K 


The present search report has been drawn up for all claims 


Ptw of tcvtk Dtfe «f CMpfatlM «f lie aev* Cxnter 

THE HAGUE 15 October 1996 Fuhr, C 


CATEGORY OF CITED DOCUMENTS T : theory or principle underlying the Invention 

E : earlier patent iocuroeot, but publishes' oa, or 
X : particularly relevant if taken alone after the filing date 
Y : particularly relevant if combined with another D : document cited in the application 
document of the same category L : document cited for other reasons 

A : technological background 

0 : Doo-written disclosure A : member of the same patent family, corresponding 
P : intermediate document document 



EP0 741 187 A3 



European Patent 
Office 



EUROPEAN SEARCH REPORT 



Application N ember 

EP 96 10 6408 



DOCUMENTS CONSIDERED TO BE RELEVANT 



Category 



Citation of document with indication, where appropriate, 
of relevant passages 



Relevant 

tO 4 



CLASSIFICATION OF THE 
APPLICATION (IM.CL6) 



EP-A-0 725 078 {LILLY CO ELI) 7 August 
1996 

* SeqID's 2, 8, 29 * 

* claims; examples * 

EP-A-0 725 079 (LILLY CO ELI) 7 August 
1996 

* SeqID's 2, 3, 5, 7, 9, 10, 11 

* claims; examples * 



1-23, 
30-38 



1-23, 
30-38 



TECHNICAL FIELDS 
SEARCHED (lntCI.6) 



The present search report has been drawn up for ail claims 



Plan of March 

THE HAGUE 



Data of mpletaw •* the wares 

15 October 1996 



Fuhr, C 



CATEGORY OF CITED DOCUMENTS 

X : particularly relevant if taken alone 

Y : particularly relevant if combined with another 

document of the lame category 
A : tecnncJogkal background 
O : non-written disclosure 
P : Intermediate document 



T : theory or principle underlying the Invention 
E : earlier patent document, bat published on, or 

after the riling date 
D : document cited In the application 
L : document cited for other reasons 

A : member of the same patent family, corresponding 
document 



This Page is Inserted by IFW Indexing and Scanning 
Operations and is not part of the Official Record 

BEST AVAILABLE IMAGES 

Defective images within this document are accurate representations of the original 
documents submitted by the applicant. 

Defects in the images include but are not limited to the items checked: 

□ BLACK BORDERS 

□ IMAGE CUT OFF AT TOP, BOTTOM OR SIDES 
□f FADED TEXT OR DRAWING 
^BLURRED OR ILLEGIBLE TEXT OR DRAWING 

□ SKEWED/SLANTED IMAGES 

□ COLOR OR BLACK AND WHITE PHOTOGRAPHS 

□ GRAY SCALE DOCUMENTS 

□ LINES OR MARKS ON ORIGINAL DOCUMENT 

□ REFERENCE(S) OR EXHIBIT(S) SUBMITTED ARE POOR QUALITY 

□ OTHER: 

IMAGES ARE BEST AVAILABLE COPY. 
As rescanning these documents will not correct the image 
problems checked, please do not report these problems to 
the IFW Image Problem Mailbox.