Skip to main content

Full text of "USPTO Patents Application 09804625"

See other formats


(19) 



Europalsches Patentamt 
European Patent Office 
Office europeen des brevets 



(12) 



(11) EP 0 536 186 B1 

EUROPEAN PATENT SPECIFICATION 



(45) Date of publication and mention 
of the grant of the patent: 
21 .1 1 .2001 Bulletin 2001/47 

(21) Application number: 91911087.4 

(22) Date of filing: 15.05.1991 



(51) !ntCl7: C12N 15/12, C12P 21/02, 
A61K38/18 

(86) International application number: 
PCT/US 91/03 388 

(87) International publication number: 

WO 91/18098 (28.11.1991 Gazette 1991/27) 



CO 

CD 
00 



CO 
CO 
lO 

o 

0l 
LU 



(54) BONE AND CARTILAGE INDUCTIVE PROTEINS 

KNOCHEN- UND KNORPEL-BILDUNG HERVORRUFENDE PROTEINE 
PROTEINES D'INDUCTION OSSEUSE ET CARTILAGINEUSE 



(84) Designated Contracting States: 

AT BE CH DE DK ES FR GB GR IT LI LU NL SE 

(30) Priority: 16.05.1990 US 525357 
15.01.1991 US 641204 

(43) Date of publication of application: 
14.04.1993 Bulletin 1993/15 

(73) Proprietor: GENETICS INSTITUTE, INC. 
Cambridge, Massachusetts 02140 (US) 

(72) Inventors: 

• HEWICK, Rodney, M. 
Lexington, MA 02173 (US) 



• WANG, Jack, H. 
Lexington, MA 02173 (US) 

(74) Representative: VOSSIUS & PARTNER 
Postfach 86 07 67 
81634 MUnchen (DE) 



(56) References cited: 
WO-A-89/10409 
WO-A-92/07073 



WO-A-90/11366 



• PROC. NATL. ACAD. SCI. U.S.A., Vol. 86, June 
1989, Washington, US, pages 4554-4558, LYONS 
K. et al., "Vgr-1, a Mammalian Gene Related to 
Xenopus Vg-1, is a Member of the Transforming 
Growth Factor beta Gene Superfamily". 



CP 

m 
eg 

I 

o 
o 

3 



Note: Within nine months from the publication of the mention of the grant of the European patent, any person may give 
notice to the European Patent Office of opposition to the European patent granted. Notice of opposition shall be filed in 
a written reasoned statement. It shall not be deemed to have been filed until the opposition fee has been paid. (Art. 
99(1) European Patent Convention). 



Printed by Jouvc, 75001 PARIS (FR) 



EP 0 536 186 B1 



Description 

[0001] This application is a continuation-in-part of U.S. Serial No. 07/525,357 filed May 16, 1990 and U.S. Serial No. 
07/641,204 filed January 15, 1991. 
5 [0002] The present invention relates to a family of purified proteins which may exhibit the ability to induce cartilage 
and/or bone formation and processes for obtaining them. These proteins may be used to induce bone and/or cartilage 
formation and in wound healing and tissue repair. 

[0003] The invention provides a novel family of proteins termed BMP-8 proteins. Bovine and perhaps other species 
BMP-8 proteins are characterized by comprising at least one of the following sequences or one of the following se- 
10 quences with one or more modification(s) of O-linked or N-linked gtycosylation sites: 

(1) . Arg-His-Glu-Leu-Tyr-Val-Ser-Phe-Gln»Asp-Leu-Gly-Trp-Leu- 
is Asp-Trp-Val-Ile-Ala~Pro-Gln-Gly-Tyr (SEQ ID NO: 1) 

(2) . Leu-Ser-Ala-Thr-Ser-Val-Leu-Tyr-Tyr-Asp-iSer-Ser-Asn-Asn- 
20 Val-Xle-Leu-A'rg (SEQ ID NO; 2) 

(3). Ala-Cys-Cys-Ala-Pro-Thr-Lys (SEQ ID NO: 3) 

25 

(4) . Thr-Asn-Glu-Leu-Pro-Pro-Pro-Asn-Lys-Leu- 
3Q Pro-Gly-Ile-Phe-Asp-Asp-Val»His-Gly-Ser-His-Gly-Arg 
(SEQ ID NO: 4) 

and by the ability to induce the formation of cartilage and/or bone. 

[0004] The BMP-8 proteins of the invention may be further characterized by an apparent molecular weight of 28,000 
35 - 38,000 daltons as determined by sodium dodecyl sulfate polyacrylamide get electrophoresis (SDS-PAGE). Under 
reducing conditions in SDS-PAGE the protein reveals a region of approximately 14,000-20,000 daltons. 
[0005] The BMP-8 proteins may be further characterized by a DNA sequence encoding BMP-8 comprising at least 
one of the following DNA sequences 

40 

(1). 

GTG CAC CTG CTG AAG CCG CAC GCG GTC CCC AAG GCG TGC TGC GCG 
CCC ACC AAG CTG AGC GCC ACT TCC GTG CTC TAC TAC GAC AGC AGC AAC 
45 AAC GTC ATC CTG CGC AAG CAC CGC AAC ATG GTG GTC CGC GCC TGC GGC 
TGC CAC (SEQ ID NO: 7) 

50 

(2) 

GAC TGG GTC ATC GCC CCC CAA GGC TAC TCA GCC TAT TAC TGT GAA GGG 
GAG TGC TCC TTC CCG CTG GAC TCC TGC ATG AAC GCC ACC AAC CAC 
55 GCC ATC CTG CAG TCC CTG (SEQ ID NO: 9) 



2 



EP 0 536 186 B1 



(3) 

GAC GTC CAC GGC TCC CAC GGC CGG CAG GTG 

TGC CGT CGG CAC GAG CTG AGC TTC CAG GAC CTG GGC TGG CTG (SEQ 
ID NO: 11) 

[0006] It is contemplated that the proteins of the invention are capable of stimulating, promoting, or otherwise inducing 
cartilage and/or bone formation. 

[0007] The amino acid sequences set forth above are derived from a bovine bone preparation as further described 
herein. Based on knowledge of other "BMP" proteins it is expected that the human sequence is the same or homologous 
to the bovine sequences. The invention further includes human BMP-8 protein and the DNA encoding human BMP-8 
as disclosed herein in deposit #75010. 

[0008] The invention further includes methods for obtaining the DNA sequences encoding the BMP-8 proteins of the 
invention. This method entails utilizing the above amino acid sequences or portions thereof to design probes to screen 
libraries for the human gene or fragments thereof using standard techniques. 

[0009] The proteins of the invention may be produced by culturing a cell transformed with a DNA sequence encoding 
the BMP-8 protein and recovering and purifying from the culture medium a protein characterized by comprising at least 
one or the following sequences or one of the following sequences with one or more modification(s) of O-linked or N- 
linked glycosylation sites: 

(1) - Arg-His-Glu-Leu-Tyr-Val-Ser-Phc-Gln-Asp-Leu-Gly-T3T>-Leu« 

Asp-Trp-Val-Ile-Ala-Pro-Gln-Gly-Tyr (SEQ ID NO: 1) 

(2) . Leu»Ser-Ala-Thr-Ser-Val-Leu-Tyr-Tyr-Asp-Ser-Ser-Asn-Asn- 

Val-Ile-Leu-Arg (SEQ ID NO: 2) 

(3), Ala-Cys-Cys-Ala-Pro-Thr-Lys' (SEQ ID NO: 3) 

(4) • Thr-Asn-Glu-Leu-Pro-Pro-Pro-Asn-Lys-Leu- 

Pro-Gly-Ile-Ph.e-Asp-Asp-Val-His-Gly-Ser-His-Gly-Arg 
(SEQ ID NO: 4) 

and by the ability to induce the formation of cartilage and/or bone 

[0010] The expressed protein is isolated, recovered and purified from the culture medium. The purified expressed 
protein is substantially free from other proteinaceous materials with which it is co-produced, as well as from other 
contaminants. The recovered purified protein is contemplated to exhibit cartilage and/or bone formation activity. 
[001 1 ] It is further contemplated that the proteins of the invention demonstrate activity in the rat bone formation assay 
described below at a concentration of .5u. - 500|i g/gram of bone formed. It is further contemplated that these proteins 
demonstrate activity in this assay at a concentration of 1 jag - 50|ig/gram bone. More particularly, it is contemplated 
these proteins may be characterized by the ability of 1u,g of the protein to score at least +2 in the rat bone formation 
assay. 

[0012] Another aspect of the invention provides pharmaceutical compositions containing a therapeutically effective 
amount of a protein of the invention in a phamnaceutically acceptable vehicle or carrier. The compositions of the in- 
vention may be used to induce bone and/ or cartilage formation. These compositions may also be used for wound 
healing and tissue repair. Further compositions of the invention may include in addition to a protein of the present 
invention at least one othertherapeutically useful agent such as the proteins designated BMP-1 , BMP-2 (also previously 



EP 0 536 186 B1 



referred to as BMP-2A or BMP-2 Class I), BMP-3, BMP-4 (also previously referred to as BMP-2B or BMP-2 Class II) 
disclosed in PCT publications WO 88/00205 and WO 89/10409; and BMP-5, BMP-6, and BMP-7 disclosed in PCT 
publication WO 90/1 1 366. 

[0013] Other therapeutically useful agents include growth factors such as epidermal growth factor (EGF), fibroblast 
5 growth factor (FGF), and transforming growth factors (TGF-a and TGF-p). The compositions of the invention may also 
include an appropriate matrix, for instance, for supporting the composition and/or providing a surface for bone and/or 
cartilage growth. The matrix may provide slow release of the BMP protein and or the appropriate environment for 
presentation of the BMP protein. 

[0014] The compositions may be employed in methods for treating a number of bone and/or cartilage defects, and 
10 periodontal disease. They may also be employed in methods for treating various types of wounds and in tissue repair. 
These methods, according to the invention, entail administering to a patient needing such bone and/or cartilage for- 
mation, wound healing or tissue repair, a therapeutically effective amount of a protein of the invention. These methods 
may also entail the administration of a protein (or portion thereof) of the invention in conjunction with at least one of 
the "BMP" proteins (or portion thereof) disclosed in the co-owned applications described above. In addition, these 
is methods may also include the administration of a protein of the invention with other growth factors including EGF, FGF, 
TGF-a, and TGF-p. 

[0015] Still a further aspect of the invention are DNA sequences coding for expression of a BMP-8 protein of the 
invention. Such sequences include a sequence of nucleotides encoding at least one of the same or substantially the 
same peptide sequences reported above or fragments thereof. 

20 [0016] A further aspect of the invention provides vectors containing a DNA sequence encoding BMP-8 proteins of 
the invention as described above in operative association with an expression control sequence therefor. Host cells 
transformed with such vectors for use in producing BMP-8 proteins are also provided by the present invention. The 
host cells containing DNA sequences encoding BMP-8 may be employed in a novel process for producing a protein 
of the invention. The transformed host cells are cultured in a suitable culture medium and a protein of the invention is 

25 isolated and purified from the cells, cell lysate, or conditioned medium by conventional techniques. This process may 
employ a number of known cells, both prokaryotic and eukaryotic, as host cells for expression of the polypeptide. 
[0017] Other aspects and advantages of the present invention will be apparent upon consideration of the following 
detailed description and preferred embodiments thereof. 

30 Brief Description of the Drawing 

[0018] FIG. 1 illustrates an SDS-PAGE analysis of an osteoinductive fraction (28,000-38,000 daltons non-reduced) 
following reduction with dithiothreitol. 

35 Detailed Description of the Invention 

[0019] A purified BMP-8 cartilage/bone protein of the present invention is characterized by comprising at least one 
of the following sequences or one of the following sequences with one or more modification(s) of O-linked or N-linked 
glycosylation sites: 



40 



(1) 



Arg-His-Glu-Lcu-Tyr-Val-Ser-Phe-Gln-Asp-Leu-Gly-Trp-Leu- 
Asp-Trp-Val-Ile-Ala-Pro-Gln-Gly-Tyr (SEQ ID NO: 1) 



45 



(2) 



Leu-S er- Al a-Thr-S er- Val -Leu-Ty r-Tyr- Asp-S er-S er-Asn-Asn- 
Val-Ile-Leu-Arg (SEQ ID NO: 2) 



50 



(3) . Ala-Cys-Cys-Ala-Pro-Thr-Lys (SEQ ID NO: 3) 



55 



4 



EP 0 536 186 B1 



(4) , Thr-Asn-Glu- 
Pro-Gly-Ile 
(SEQ ID NO: 



Leu-Pro-Pro-Pro-Asn-Lys-Leu- 

Ph.e-Asp^sp-Val-His-Gly-Ser-His-Gly-Arg 

4) 



and by the ability to induce the formation of cartilage and/or bone. 

[0020] Purified BMP-8 proteins are substantially free from proteinaceous materials with which they are co-produced 
as well as from other contaminants. It is contemplated that their activity may be demonstrated by activity in the rat 
bone formation assay as described in Example III. It is further contemplated that these proteins demonstrate activity 
in the assay at a concentration of .5\i - 500u,g/gram of bone formed, it is further contemplated that these proteins 
demonstrate activity in this assay at a concentration of 1 jxg - 50ug/gram bone. The proteins may be further characterized 
by the ability of 1u.g to score at least +2 in this assay using either the original or modified scoring method. 
[0021] The proteins of the invention are further characterized by an apparent molecular weight of 28,000 - 38,000 
daltons as determined by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Under reducing 
conditions in SDS-PAGE the protein reveals a region of approximately 14,000-20,000 daltons. 
[0022] In a further aspect, the invention provides a method for obtaining the DNA sequences encoding BMP-8 bone/ 
cartilage proteins of the invention with the above described characteristics. The method for obtaining the DNA se- 
quences entails utilizing the amino acid sequences described above to design probes to screen libraries using standard 
techniques. The bovine sequence or the human gene thus identified may also be used as a probe to identify a human 
cell line or tissue which synthesizes the analogous cartilage/bone protein. A cDNA library is synthesized and screened 
with probes derived from the human or bovine coding sequences. The human sequence thus identified is transformed 
into a host cell, the host cell is cultured and the protein recovered, isolated and purified from the culture medium. The 
purified protein is predicted to exhibit cartilage and/or bone formation activity in the rat bone formation assay of Example 
III. 

[0023] The proteins provided herein atso include factors encoded by the above described sequences but into which 
modifications are naturally provided (e.g. allelic variations in the nucleotide sequence which may result in amino acid 
changes in the polypeptide) or deliberately engineered. Similarly, synthetic polypeptides which wholly or partially du- 
plicate continuous sequences of the amino acid residues of the BMP-8 proteins are encompassed by the invention. 
These sequences, by virtue of sharing primary, secondary, or tertiary structural and conformational characteristics with 
other cartilage/bone proteins of the invention may possess bone and/or cartilage growth factor biological properties in 
common therewith. Thus, they may be employed as biologically active substitutes for naturally-occurring proteins in 
therapeutic processes. 

[0024] Other specific mutations of the sequences of the proteins of the invention described herein involve modifica- 
tions of O-linked or N-linked glycosylation sites. For instance, the absence of glycosylation or only partial glycosylation 
results from amino acid substitution or deletion at the asparagine-Nnked glycosylation recognition sites present in the 
sequences of the proteins of the invention. The asparagine-linked glycosylation recognition sites comprise tripeptide 
sequences which are specifically recognized by appropriate cellular glycosylation enzymes. These tripeptide sequenc- 
es. are either asparagine-X-threonine or asparagine-X-serine, where X is usually any amino acid. A variety of amino 
acid substitutions or deletions at one or both of the first or third amino acid positions of a glycosylation recognition site 
(and/or amino acid deletion at the second position) results in non-glycosylation at the modified tripeptide sequence. 
Expression of such altered nucleotide sequences procedures variants which are not glycosylated at that site. 
[0025] The present invention also encompasses the novel DNA sequences, free of association with DNA sequences 
encoding other proteinaceous materials, and coding., on expression for the proteins of the invention. 
[0026] Another aspect of the present invention provides a novel method for producing the proteins of the invention. 
This method involves culturing a suitable cell line, which has been transformed with a DNA sequence coding for ex- 
pression of a protein of the invention, under the control of known regulatory sequences. Regulatory sequences include 
promoter fragments, terminator fragments and other suitable sequences which direct the expression of the BMP-8 
protein in an appropriate host cell. A purified BMP-8 protein of the present invention is recovered, isolated and purified 
from the culture medium. The purified protein is characterized by comprising at least one following sequences or one 
of the following sequences with one or more modification(s) of O-linked or N-linked glycosylation sites: 



(1) . Arg-His-Glu-L"eu-Tyr-Val-S.er-Phe-Gln-Asp-Leu--Gly-Trp-Leu- 
Asp-Trp-Val-Ile-Ala-Pro-Gln-Gly-Tyr (SEQ ID NO: 1) 



EP 0 536 186 B1 



(2) 



Leu-Ser-Ala-Thr-Ser-Val-Leu-Tyr-Tyr' 
Val-Ile-Leu-Arg (SEQ ID NO: 2) 



■Asp-Ser-Ser-Asn-Asn- 



5 



(3) 



Ala- 



Cys 



Cys 



Ala 



Pro 



Thr< 



Lys 



(SEQ ID 



NO: 3) 



10 



(4) . Thr-Asn-Glu-Leu-Pro-Pro-Pro-Asn-Lys-Leu- 
15 Pro-Gly-Ile-Phe-Asp-Asp-Val-His-Gly-Ser-His-Gly.-Arg 
(SEQ ID NO: 4) 

and by the ability to induce the formation of cartilage and/or bone. 

[0027] Suitable celts or cell lines may be mammalian cells, such as Chinese hamster ovary cells (CHO). The selection 
20 of suitable mammalian host cells and methods for transformation, culture, amplification, screening and product pro- 
duction and purification are known in the art. See, e.g., Gething and Sambrook, Nature, 293 :620-625 (1981), or alter- 
natively, Kaufman et al Mol. Cell. Biol. , 5(7):1 750-1 759 (1 985) or Howley et al, U.S. Patent 4,41 9,446. Another suitable 
mammalian cell line, which is described in the accompanying examples, is the monkey COS-1 cell line. The mammalian 
cell line CV-1 may also be suitable. Further exemplary mammalian host cells include particularly primate cell lines and 
25 rodent ceil lines, including.transformed cell lines. Normal diploid cells, cell strains derived from in vitro culture of primary 
tissue, as well as primary explants, are also suitable. Candidate cells may be genotypically deficient in the selection 
gene, or may contain a dominantly acting selection gene. Other suitable mammalian cell lines include but are not limited 
to , HeLa, mouse L-929 cells, 3T3 lines derived from Swiss, Balb-c or NIH mice, BHK or HaK hamster cell lines. 
[0028] Bacterial cells may also be suitable hosts. For example, the various strains of E. coli (e.g., HB101 , MC1061) 
30 are well-known as host cells in the field of biotechnology. Various strains of B. subtilis , Pseudomonas, other bacilli and 
the like may also be employed in this method. 

[0029] Many strains of yeast cells known to those skilled in the art may also be available as host cells for expression 
of the polypeptides of the present invention. Additionally, where desired, insect cells may be utilized as host cells in 
the method of the present invention. See, e.g. Miller et al, Genetic Engineering, 8:277-298 (Plenum Press 1986) and 

35 references cited therein. 

[0030] Another aspect of the present invention provides vectors for use in the method of expression of the proteins 
of the invention. Preferably the vectors contain the full novel BMP-8 DNA sequences described above which code for 
the novel cartilage/bone proteins of the invention. Additionally, the vectors also contain appropriate expression control 
sequences permitting expression of the protein sequences. Alternatively, vectors incorporating truncated or otherwise 

40 modified sequences as described above are also embodiments of the present invention and useful in the production 
of the proteins of the invention. The vectors may be employed in the method of transforming cell lines and contain 
selected regulatory sequences in operative association with the DNA coding sequences of the invention which are 
capable of directing the replication and expression thereof in selected host celts. Useful regulatory sequences for such 
vectors are known to those skilled in the art and may be selected depending upon the selected host cells. Such selection 

45 is routine and does not form part of the present invention. The components of the vectors, e.g. replicons, selection 
genes, enhancers, promoters, and the like, may be obtained from natural sources or synthesized by known procedures. 
See, Kaufman et al, J. Mol. Biol. , 159:511-521 (1 982); and Kaufman, Proc. Natl. Acad. Sci., USA , 82:689-"693 (1985). 
Host cells transformed with such vectors and progeny thereof for use in producing cartilage/bone proteins are also 
provided by the invention. 

50 [0031] A protein of the present invention, which induces cartilage and/or bone formation in circumstances where 
bone and/or cartilage is not normally formed, has application in the healing of bone fractures and cartilage defects in 
humans and other animals. Such a preparation employing a protein of the invention may have prophylactic use in 
closed as well as open fracture reduction and also in the improved fixation of artificial joints. De novo bone formation 
induced by an osteogenic agent contributes to the repair of congenital, trauma induced, or oncologic resection induced 

55 craniofacial defects, and also is useful in cosmetic plastic surgery. A protein of the invention may be used in the treat- 
ment of periodontal disease, and in other tooth repair processes. Such agents may provide an environment to attract 
bone-forming cells, stimulate growth of bone-forming cells or induce differentiation of progenitors of bone-forming cells, 
A variety of osteogenic, cartilage-inducing and bone inducing factors have been described. See, e.g. European patent 



6 



EP 0 536 186 B1 



applications 148,155 and 1 69,01 6 for discussions thereof, 

[0032] The proteins of the invention may also be used in wound healing and related tissue repair. The types of 
wounds include, but are not limited to burns, incisions and ulcers. (See, e.g. PCT Publication WO84/01 106 for discus- 
sion of wound healing and related tissue repair). 

5 [0033] A further aspect of the invention includes compositions for repairing fractures and other conditions related to 
bone and/or cartilage defects or periodontal diseases. In addition, the invention comprises compositions for wound 
healing and tissue repair. Such compositions comprise a therapeutically effective amount of at least one of the proteins 
of the invention in admixture with a pharmaceutically acceptable vehicle, carrier or matrix. It is expected that the proteins 
of the invention may act in concert with or perhaps synergistically with one another or with other related proteins and 

10 growth factors. Compositions of the invention therefore comprise one or more of the proteins of the present invention. 
Further compositions of the invention therefore comprise a therapeutic amount of at least one protein of the invention 
with a therapeutic amount of at least one of the other "BMP" proteins disclosed in co-owned and co-pending. U.S. 
applications described above. Such compositions of the invention may comprise proteins of the invention or portions 
thereof in combination with the above-mentioned "BMP" proteins or portions thereof. Such combination may comprise 

is individual molecules from each of the proteins or heteromolecules formed by portions of the respective proteins. A 
composition of the invention may therefore comprise a protein of the invention or a portion thereof linked with a portion 
of a different "BMP" as described above protein to form a heteromolecule. For example, a BMP-8 subunit may be linked 
to a subunit of BMP-2, BMP-3, BMP-4, BMP-5, BMP-6, BMP-7 or other BMP proteins. Such linkage may comprise 
disulfide bonds. 

20 [0034] Further compositions of the invention comprise the proteins of the invention or portions thereof in combination 
with other agents beneficial to the treatment of the bone and/or cartilage defect, wound, or tissue in question. These 
agents include various growth factors such as epidermal growth factor (EGF), fibroblast growth factor (FGF), platelet 
derived growth factor (PDGF), transforming growth factors (TGF-a and TGF-p), and insulin-like growth factor (IGF). 
Portions of these agents may also be used in compositions of the invention. 

25 [0035] The preparation and formulation of such physiologically acceptable protein compositions, having due regard 
to pH, isotonicity, stability and the like, is within the skill of the art. The therapeutic compositions are also presently 
valuable for veterinary applications due to the apparent lack of species specif jcity in cartilage and bone growth factor 
proteins. Domestic animals and thoroughbred horses in addition to humans are desired patients for such treatment 
with the proteins of the present invention. 

30 [0036] The composition of the invention can be administered topically, systematically, or locally as an implant or 
device. When administered, the therapeutic composition for use in this invention is, of course, in a pyrogen-free, phys- 
iologically acceptable form. Further, the composition may desirably be encapsulated or injected in a viscous form for 
delivery to the site of cartilage and/or bone or tissue damage. Topical administration may be suitable for wound healing 
and tissue repair. Preferably for bone and/or cartilage formation, the composition would include a matrix capable of 

35 delivering the cartilage/bone proteins of the invention to the site of bone and/or cartilage damage, providing a structure 
for the developing bone and cartilage and optimally capable of being reabsorbed into the body. Such matrices may be 
formed of materials presently in use for other implanted medical applications. 

[0037] The choice of matrix material is based on biocompatibtlity, biodegradability, mechanical properties, cosmetic 
appearance and interface properties. The particular application of the compositions of the invention will define the 

40 appropriate formulation. Potential matrices for the compositions may be biodegradable and chemically defined calcium 
sulfate, tricalciumphosphate, hydroxyapatite, polylactic acid and polyanhydrides. Other potential materials are biode- 
gradable and biologically well defined, such as bone or dermal collagen. Further matrices are comprised of pure proteins 
or extracellular matrix components. Other potential matrices are nonbiodegradable and chemically defined, such as 
sintered hydroxyapatite, bioglass, aluminates, or other ceramics. Matrices may be comprised of combinations of any 

4 5 of the above mentioned types of material, such as polylactic acid and hydroxyapatite or collagen and tricalciumphos- 
phate. The bioceramics may be altered in composition, such as in calcium-aluminate-phosphate and processing to 
alter pore size, particle size, particle shape, and biodegradability. 

[0038] The dosage regimen will be determined by the attending physician considering various factors which modify 
the action of the proteins of the invention. Factors which may modify the action of the proteins of the invention include 

so the amount of bone weight desired to be formed, the site of bone damage, the condition of the damaged bone, the 
size of a wound, type of damaged tissue, the patient's age, sex, and diet, the severity of any infection, time of admin- 
istration and other clinical factors. The dosage may vary with the type of matrix used in the reconstitution and the type 
or types of bone and/or cartilage proteins present in the composition. The addition of other known growth factors, such 
as EGF, PDGF, TGF-a, TGF-p, and IGF-I to the final composition, may also effect the dosage. 

55 [0039] Progress can be monitored by periodic assessment of cartilage and/or bone growth and/or repair. The 
progress can be monitored, for example, using x-rays, histomorphometric determinations and tetracycline labeling. 
[0040] The following examples illustrate practice of the present invention in recovering and characterizing bovine 
cartilage and/or bone proteins of the invention and employing these proteins to recover the corresponding human 



7 



EP 0 536 186 B1 



protein or proteins and in expressing the proteins via recombinant techniques. 
EXAMPLE I 

5 Isolation of Bovine Cartilage/Bone Inductive Protein 

[0041] Ground bovine bone powder (20-120 mesh, Colla-Tec) is prepared according to the procedures of M. R. Urist 
et al., Proc. Natl Acad, Sci USA , 70:3511 (1973) with elimination of some extraction steps as identified below. Ten kgs 
of the ground powder is demineralized in successive changes of 0.6N HCI at 4°C over a 48 hour period with vigorous 

10 stirring. The resulting suspension is extracted for 4 hours in 26 liters of 0.5M EDTA. The residue is washed two times 
with distilled water before its resuspension in 10 liters of 4M guanidine hydrochloride [GuCI], 1mM N-ethylmaleimide, 
1mM iodoaceticacid, 1mM phenylmethylsulfonyl fluoride as described in Clin. Orthop. Rel. Res. , 171 : 213 (1982). After 
16 to 20 hours the supernatant is removed and replaced with another 6 liters of GuCI buffer. The residue is extracted 
for another 8 hours. The final extraction with 6 liters of GuCI is carried out for 16 hours. 

15 [0042] The crude GuCI extracts are combined, filtered through a Pellicon apparatus with a 0.45mM Durapore tan- 
gential flow filter packet, concentrated approximately 50 times on a Amicon RA2000 apparatus with a 1 0,000 molecular 
weight cut-off membrane, and then dialyzed in 20mM Tris, 0.05M NaCI, 6M urea (pH7.1), the starting buffer for the 
first column. After extensive dialysis the protein is loaded on a 2 liter DEAE cellulose column and the unbound fractions 
are collected. 

20 [0043] The unbound fractions are concentrated and dialyzed against 50mM NaAc, 50mM NaCI (pH 4.6) in 6M urea. 
The unbound fractions are applied to a carboxymethyl cellulose column. Protein not bound to the column is removed 
by extensive washing with starting buffer, and the material containing protein having bone and/or cartilage formation 
activity as measured by the Rosen-modified Sampath - Reddi assay (described in Example III below) desorbedfrom 
the column by 50mM NaAc, 0.25mrvt NaCI, 6M urea (pH 4.6). The protein from this step elution is concentrated 20- to 

25 40- fold, then dialyzed extensively against 80mM KP0 4 , 6M urea (pH6.0). The sample is applied to an hydroxylapatite 
column (IBF) equilibrated in 80mM KP0 4 , 6M urea (pH6.0) and all unbound protein is removed by washing the column 
with the same buffer. Protein having bone and/or cartilage formation activity is eluted with 1 0Omfvl KP0 4 (pH7.4) and 
6M urea. 

[0044] The protein is diluted 5 fold with a 0.1 875 M NaCI, 6 M urea solution to a final concentration of 20 mM KP0 4 , 
30 1 50 mM NaCI, 6 M urea. This material is applied to a heparin - Sepharose column equilibrated in 20mM KPQ 4 , 150mM 
NaCI, 6M urea (pH7.4). After extensive washing of the column with starting buffer, a protein with bone and/or cartilage 
inductive activity is eluted by 20mM KP0 4 , 700mM NaCI, 6M urea (pH7.4). This fraction is concentrated 10-20 fold, 
dialyzed against 50mM NaAc, 6M urea (pH4.6), and applied to a Pharmacia MonoS HR column. The column is devel- 
oped with a gradient to 1 .0M NaCI, 50mM NaAc : 6M urea (pH4.6). All fractions with absorbance at 280 nm are pooled. 
35 This Mono S step is now believed to be dispensable and will be eliminated in the future. The material is applied to a 
4.7 x 30 cm Waters Prep Pak 500 C4 cartridge in 0.1 %TFA and the column developed with a gradient to 95% acetonitrile, 
0.1% TFA in 100 minutes at 45ml per minute. Fractions were assayed for cartilage and/or bone formation activity. 
[0045] Aliquots of the appropriate fractions are iodinated by one of the following methods: P. J. McConahey et al, 
Int. Arch. Allergy , 29:185-189 (1966); A. E. Bolton et al, Biochem J., 133:529 (1973); and D. F. Bowen-Pope, J. Biol. 
40 Chem. ; 237:5161 (1982). The iodinated proteins present in these fractions are analyzed by SDS gel electrophoresis. 

EXAMPLE II 

Characterization of Bovine Cartilage/Bone Inductive Factor 

45 

A. Molecular Weight 

[0046] Approximately 2.5mg protein from Example I from active BMP containing fractions in 0.1 % TFA and approx- 
imately 45% acetonitrile, is dried with a Savant Speed Vac concentrator and solubilized with Laemmli sample buffer, 

so loaded onto a 12.5% polyacrylamide gel and subjected to SDS-PAGE [Laemmli, U.K. Nature , 227:680-685 (1970)] 
without reducing the sample with dithiothreitol. The molecular weight is determined relative to iodinated Bio-Rad mo- 
lecular weight standards. Following autoradiography of the unfixed gel the approximate 28,000-38,000 dalton band is 
excised and the protein electrophoretically eluted from the gel [Hunkapillar et al Meth. Enzymol. 91227-236 (1983)]. 
Based on similar purified bone fractions as described in the co-pending "BMP" applications described above wherein 

55 bone and/or cartilage activity is found in the approximately 28,000-38,000 region, it is inferred that this band comprises 
bone and/or cartilage inductive fractions. 



8 



EP 0 536 186 B1 

B. Subunit Characterization 

[0047] The subunit composition of the isolated bovine bone protein is also determined. The eluted protein described 
above is fully reduced and alkylated in 2% SDS using iodoacetate and standard procedures. The fully reduced and 
5 alkylated sample is then further submitted to SDS-PAGE on a 1 2.5% gel and the resulting approximate 1 4,000-20,000 
dalton region having a doublet/triplet appearance located by autoradiography of the unfixed gel. A stiver stain [Merril 
e * a l» Science, 211 : 1 437 (1 981 )] version of the sample is shown in FIG. 1 along with molecular weight markers. The 
14,000-20,000 dalton region is indicated by the bracket. Thus the approximate 28,000-30,000 dalton protein yields a 
broad region of 14,000-20,000. 

10 

EXAMPLE III 

Rosen Modified Sampath-Reddi Assay 

15 [0048] A modified version of the rat bone formation assay described in Sampath and Reddi, Proc. Natl. Acad. Sci. 
U.S.A. , 80:6591-6595 (1983) is used to evaluate bone and/or cartilage activity of the proteins of the invention. This 
modified assay is herein called the Rosen-modified Sampath-Reddi assay. The ethanol precipitation step of the Sam- 
path-Reddi procedure is replaced by dialyzing (if the composition is a solution) or diafiltering (if the composition is a 
suspension) the fraction to be assayed against water. The solution or suspension is then redissolved in 0.1 % TFA, 

20 and the resulting solution added to 20mg of rat matrix. A mock rat matrix sample not treated with the protein serves 
as a control. This material is frozen and lyophiltzed and the resulting powder enclosed in #5 gelatin capsules. The 
capsules are implanted subcutaneously in the abdominal thoracic area of 21 - 49 day old male Long Evans rats. The 
implants are removed after 7-14 days. Half of each implant is used for alkaline phosphatase analysis [See, A. H. 
Reddi et al., Proc. Natl Acad Sci. , 69:1601 (1972)]. 

25 [0049] The other half of each implant is fixed and processed for histological analysis. Glycolmethacrylate sections 
(1 ujti) are stained with Von Kossa and acid fuschin or toluidine blue to score the amount of induced bone and cartilage 
formation present in each implant. The terms +1 through +5 represent the area of each histological section of an implant 
occupied by new bone and/or cartilage cells and newty formed bone and matrix. A score of +5 indicates that greater 
than 50% of the implant is new bone and/or cartilage produced as a direct result of protein in the implant. A score of 

30 44, +3, +2 and +1 would indicate that greater than 40%, 30%, 20% and 10% respectively of the implant contains new 
cartilage and/or bone. 

[0050] It is contemplated that the dose response nature of the cartilage and/or bone inductive protein containing 
samples of the matrix samples will demonstrate that the amount of bone and/or cartilage formed increases with the 
amount of cartilage/bone inductive protein in the sample. It is contemplated that the control samples will not result in 

35 any bone and/or cartilage formation . 

[0051] As with other cartilage and/or bone inductive proteins such as the above-mentioned "BMP" proteins, the bone 
and/or cartilage formed is expected to be physically confined to the space occupied by the matrix. Samples are also 
analyzed by SDS gel electrophoresis and isoelectric focusing followed by autoradiography. The activity is correlated 
with the protein bands and pi. To estimate the purity of the protein in a particular fraction an extinction coefficient of 1 

^0 OD/mg-cm is used as an estimate for protein and the protein is run on SDS PAGE followed by silver staining or radi- 
oiodination and autoradiography. 

EXAMPLE IV 

45 Bovine Protein Composition 

[0052] The gel slice of the approximate 14,000-20,000 dalton region described in Example MB is excised and the 
protein electrophoretically eluted from the gel (Hunkapillar, et al., Supra. ). This isolated protein sample is then depleted 
of SDS [Simpson, et al., Eur. J. Biochem. 165 :21-29 (1987)] by being bound to a 30 x 2.1 mm Brownlee RP-18 after 

5 o dilution with 5 volumes of 90% n-propanol. Protein is recovered by eluting with a step of 40% n-proponal, 0.1% TFA. 
The fractions containing the eluted protein peak are pooled and brought to near dryness in a savant Speed Vac con- 
centrator. The protein is then re-sol ubilized with 0.1 M ammonium bicarbonate and digested with 1 jig of TPCK - treated 
trypsin (Worthington) for 16 hours at 37°C. A second 1 jig dose of trypsin was added and digestion continued for 
another 4 hours. The resultant digest is then subjected to RPHPLC using a C4 Vydac RPHPLC column and 0.1%TFA- 

55 water, 0.1% TFA water-acetonitrile gradient. The resultant peptide peaks were monitored by UV absorbance at 214 
and 280 nm and subjected to direct amino terminal amino acid sequence analysis using an Applied Biosystems gas 
phase sequenator (Model 470A). Three tryptic fragments are isolated by standard procedures having the following 
amino acid sequence as represented by the amino acid standard three-letter symbols and where the amino acid in 



9 



EP 0 536 186 B1 

parentheses indicates uncertainty in the sequence: 

(1) . Arg-HiB-Glu-Leu-Tyr-Val-Ser-Phe-Gln-Asp-Leu-Gly-Trp-Leu- 
Asp-Trp-Val-Ile-Ala-Pro-Gln-Gly-Tyr (SEQ ID NO: 1) 



(2) . Iieu-Ser-Ala-Thr-Ser-Val-Leu-Tyr-Tyr-Asp-Ser-Ser-Asn-Asn- 
Val-Ile-Leu-Arg (SEQ ID NO: 2) 



(3). Ala~Cys-Cys-Ala-Pro-Thr-I,ys (SEQ ID NO: 3) 



(4) . Thr-Asn-Glu-Leu-Pro-Pro-Pro-Asn-Lys-Leu- 

Pro-Gly-Ile-Phe-Asp-Asp-Val-His-Gly-Ser-His-Gly-Arg 
(SEQ ID NO: 4) 

[0053] The four amino acid sequences identified above share homology with other BMP proteins BMP-2, BMP-3, 
and BMP-4 disclosed in PCT published applications WO 88/00205 and WO 89/10409, BMP-5, BMP-6, and BMP-7 
disclosed in USSN's 437,409, 490,033, and 438,919 filed November 15, 1989, November 15, 1989 and November 17, 
1989, respectively. Specifically, the above amino acid sequence 

(1) . Arg-His-Glu-Leu-Tyr- Val-Ser-Phe-Gln-Asp-Leu-Gly-Trp- 
Leu-Asp-Trp-Val-Ile-Ala-Pro-Gln-Gly-Tyr 

shares homology with BMP-2, BMP-3, BMP-4, BMP-5, BMP-6 and BMP-7 which contain the following human homol- 
ogous sequences: 

BMP-2 : Arg-His-Pro-Leu-Tyr-Val-Asp-Phe-Ser-Asp-Val-Gly-Trp- 
Asn-Asp-Trp-Ile-Val-Ala-Pro-Pro-Gly-Tyr 



BMP-3 : Arg-Arg-Tyr-Leu-Lys-Val-Asp-Phe-Ala-Asp-Ile-Gly-Trp- 
Ser-Glu-Trp-Ile-Ile-Ser-Pro-Lys-Ser-Phe 



BMP-4 : 



Arg-H is -S er-Leu-Tyr-Va 1 -Asp-Phe-S er-Asp-Val -Gly-Trp- 
Asn-Asp-Trp-Ile-Val-Ala-Pro-Pro-Gly-Tyr 



EP 0 536 186 B1 



BMP-5: Lys-His-Glu-Leu-Tyr-Val-Ser-Phe-Arg-Asp-Leu-Gly-Trp- 
Gln-Asp-Trp-Ile-Ile-Ala-Pro-Glu-Gly-Tyr 



BMP-6 : Lys-His-Glu-Leu-Tyr-Val-Ser-Phe-Gln-Asp-Leu-Gly-Trp- 
Gln-Asp-Trp-Ile-Ile-Ala-Pro-Lys-Glu-Tyr 



BMP-7 : Lys-His-Glu-Leu-Tyr-Val-Ser-Phe-Arg-Asp-Leu-GlyTrp- 
Gln-Asp-Trp-Ile-Ile-Ala-Pro-Glu-Gly-Tyr 

The second amino acid sequence 

(2) , Leu- (Ser) -Ala-Thr-Ser-Val-Leu-Tyr-Tyr-Asp-Ser-Ser-Asn- 
Asn-Val-Ile-Leu-Arg 

shares homology with the following human sequences of these BMP molecules: 

BMP-2 : Leu-Ser-Ala-Ile-Ser-Met-Iieu-Tyr-Leu-Asp-Glu-Asn-Glu- 
Lys-Val-Val-Leu-Lys 



BMP-3 : Met-Ser-Ser-Leu-Ser-Ile-Leu-Phe-Phe-Asp-Glu-Asn-Lys- 
Asn-Val-Val-Leu-Lys 



BMP-4 : Leu-Ser-Ala-Ile-Ser-Met-Leu-Tyr-Leu-Asp-Glu-Tyr-Asp- 
Lys-Val-Val-Leu-Lys 



BMP-5: Leu-Asn-Ala-Ile-Ser-Val-Leu-Tyr-Phe-Asp-Asp-Ser-Ser 
Glu-Val-Ile-Leu-Lys 



BMP- 6: Leu-Asn-Ala-Ile-Ser-Val-Leu-Tyr-Phe-Asp-Asp-Asn-Ser- 
Asn-Val -I le-Leu-Ly s 



11 



EP 0 536 186 B1 



BMP-7: Leu-Asn-Ala-Ile-Ser-Val-Leu-Tyr-Phe-Asp-Asp-Ser-Ser- 
Asn-Val-Ile-Leu-Lys 

5 

[0054] The third amino acid sequence 



10 (3). Ala-Cys-Cys-Ala-Pro-Thr-Lys 

shares homology with the following human sequences of these BMP molecules: 

15 

BMP-2 : Ala-Cys-Cys-Val-Pro-Thr-Glu 



20 BMP-3 : Pro-Cys-Cys-Val-Pro-Glu-Lys 

BMP-4: Ala-Cys-Cys-Val-Pro-Thr-Glu 

25 

- BMP-5 : Pro-Cys-Cys-Ala-Pro-Thr-Lys 

BMP-6 : Pro-Cys-Cys-Ala-Pro-Thr-Lys 

30 

BMP-7 : Pro-Cys-Cys-Ala-Pro-Thr-Gln 



[0055] The fourth amino acid sequence shares some homology (i.e. Asn-Glu-Leu-Pro-) with BMP-3, disclosed in 
PCT published applications WO 88/00205 and WO 89/10409. 

[0056] It is contemplated that the BMP-8 proteins of the invention will be structurally similar to these BMP proteins 
BMP-2 through BMP-7. It is contemplated that mature BMP-8 proteins comprise a dimer of disulfide linked polypeptide 
subunits. 

EXAMPLE V 

Isolation of DNA 

[0057] DNA sequences encoding BMP-8 proteins may be isolated using various techniques known to those skilled 
in the art. As described below, oligonucleotide probes may be designed on the basis of the amino acid sequence of 
the above-identified tryptic fragments and synthesized on an automatic DNA synthesizer. The probes may consist of 
pools of oligonucleotides or unique oligonucleotides designed from the tryptic sequences according to the method of 
R. Lathe, J. Mol. Biol. 183 (1):1-12 (1985). 

[0058] Based on the similarity of the three amino acid sequences described above to BMP-2 through BMP-7 it is 
contemplated that the BMP-8 proteins of the invention may have a structure in which amino acid sequence (3) and 
amino acid sequence (2) are located immediately adjacent to each other as follows: 



Ala-Cys-Cys-Ala-Pro-Thr-Lys-Leu- (Ser) -Ala-Thr-Ser-Val-Leu-Tyr- 
Tyr-Asp-Ser-Ser-Asn-Asn-Val-Ile-Leu-Arg 



12 



EP 0 536 186 B1 



[0059] The following four oligonucleotides are designed on the basis of the amino acid sequence of the above iden- 
tified tryptic fragment [BMP-B amino acid sequence (2) Leu-(Ser)-Ala-Thr-Ser-Val-Leu-Tyr-Tyr-Asp-Ser-Ser-Asn-Asn- 
Val-lle-Leu-Arg] and synthesized on an automated DNA synthesizer. 

#1: GACJCJAGAATNACRTTRTTNGANG 



#2: G^CTCTAGAATNACRTTRTTNGARC 



#3: GACTCTAGAATNACRTTRTTRCTNG 



#4: GACTCTAGAATNACRTTRTTRCTRC 



[0060] The first 9 nucleotides of oligonucleotides #1 through #4 (underlined) contain the recognition sequence for 
the restriction endonuclease Xbal in order to facilitate manipulation of a specifically amplified DNA sequence encoding 
the BMP-8 protein and thus are not derived from the amino acid sequence (2) presented above. 
[0061 ] The following oligonucleotide is designed on the basis of the amino acid sequence of another above identified 
tryptic fragment [BMP-8 amino acid sequence (3) Ala-Cys-Cys-Ala-Pro-Thr-Lys] and synthesized on an automated 
DNA synthesizer. 

#5: GCGG^TQCGCNTGYTGYGCNCCNAC 

[0062] The first 8 nucleotides of oligonucleotide #5 (underlined) contain the recognition sequence for the restriction 
endonuclease BamHI and for reasons described above are not derived from the amino acid sequence (3). 
[0063] The standard nucleotide symbols in the above identified probes are as follows: A,adenosine; C ; cytidine; -G, 
guanosine; T, thymidine; N, adenosine or cytidine or guanosine or thymidine; R, adenosine or guanosine; Y, cytidine 
or thymidine; and H, adenosine or cytidine or thymidine. 

[0064] Oligonucleotides #4 and #5 identified above are utilized as primers to allow the amplification of a specific 
nucleotide sequence from bovine genomic DNA. The amplification reaction is performed as follows: 
[0065] Bovine genomic DNA (source: bovine liver) is denatured at 1 00° C for 5 minutes and then chilled on ice before 
adding to a reaction mixture containing 200 u.M each deoxynucleotide triphosphates (dATP, dGTP, dCTP and dTTP), 
10 mM Tris-HCI pH 8.3, 50mM KCI, 1 .5 mM MgCI 2 , 0.001% gelatin, 1 ;25 units Taq-DNA polymerase, 100 pM oligonu- 
cleotide #4 and 1 00 pM oligonucleotide #5. This reaction mixture is incubated at 94° C for 2 minutes and then subjected 
to thermal cycling in the following manner. 1 minute at 94° C, 1 minute at 40 ° C, 1 minute at 72° C for three cycles 
then 1 minute at 94° C : 1 minute at 55 0 C, 1 minute at 72° C for thirty-seven cycles, followed by a 7 minute incubation 
at 72° C. 

[0066] The DNA which is specifically amplified by this reaction is ethanol precipitated, digested with the restriction 
endonucleases Xbal and BamHI and subjected to agarose gel electrophoresis. A region of the gel is excised, the DNA 
is electroeluted and an 80 base pair product is subcloned into the plasmid vector pGEM3 between the Xbal and BamHI 
sites of the polylinker. DNA sequence analysis of resulting subclones indicates that the specifically amplified DNA 
sequence product encodes the amino acid sequences set forth in tryptic fragments (2) and (3). 
[0067] The DNA sequence (SEQ ID NO: 5) and derived amino acid sequence (SEQ ID NO: 6) of this specifically 
amplified DNA fragment is as follows: 



13 



EP 0 536 186 B1 



(1) (24) 

GGATCCGCGTGCTGTGCTCCGAC C AAG CTG AGC GCC ACC TCC GTG CTC TAC 

Lys Leu Ser Ala Thr Ser Val Leu Tyr 

(58) (80) 
TAC GAC AGCAGCAACAATGTAATTCTAGA 
Tyr Asp 

[0068] Nucleotides 1 -24 of this sequence comprise a portion of oligonucleotide #5 and nucleotides 58-80 comprise 
a portion of the reverse compliment of oligonucleotide #4 utilized to perform the specific amplification reaction. Due to 
the function of oligonucleotides #4 and #5 in initiating the amplification reaction, they may not correspond exactly to 
the actual sequence encoding a BMP-8 protein and are therefore not translated in the above amino acid derivation. 
[0069] The following oligonucleotide probe is designed on the basis of the bovine DNA sequence set forth above 
and synthesized on an automated DNA synthesizer: 



#6 : AAGCTGAGCGCCACCTCCGTGCTCTACTAC 



[0070] This oligonucleotide probe is radioactively labeled with 32 P and employed to screen a bovine genomic library 
constructed in the vector X EMBL3. 400,000 recombinants of the bovine genomic library are plated at a density of 8000 
recombinants per plate on 50 plates. Duplicate nitrocellulose replicas of the recombinant bacteriophage plaques are 
made from these plates and amplified. The oligonucleotide probe #6 is hybridized to the amplified nitrocellulose replicas 
in SHB (Standard Hybridization Buffer)at 65 degrees C and washed with iX SSC, 0.1 % SDS at 65 degrees C. Eleven 
positively hybridizing recombinants are obtained and are plaque purified. Bacteriophage plate stocks are made and 
bacteriophage DNA is isolated from each of the eleven plaque purified recombinants. The oligonucleotide hybridizing 
region of one of the recombinants, designated X9800-10 is localized to a 0.4 kb Pstl fragment. This fragment is sub- 
cloned into a plasmid vector (pGEM-3) and DNA sequence analysis performed. The partial DNA sequence (SEQ ID 
NO: 7) and derived amino acid sequence (SEQ (D NO: 8) of this region of clone X9800-10 are shown in Table 1 .The 
bacteriophage AS800-10 was deposited with the American Type Culture Collection, 12301 Parklawn Drive, Rockville, 
MD "ATCC" under the accession #75011 on May 15, 1991 . This deposit meets the requirements of the Budapest Treaty 
of the International Recognition of the Deposit of Microorganisms for the Purpose of Patent Procedure and Regulations 
thereunder. 



Table 1 
30 

TGCCCGCTGCCCCCTCCCGCCCCCGCCAG GTG CAC CTG CTG AAG CCG CAC GCG 

Val His Leu Leu Lys Pro His Ala 



GTC CCC AAG GCG TGC TGC GCG CCC ACC AAG CTG AGC GCC ACT TCC GTG 
Val Pro Lys Ala Cvs Cys Ala Pro Thr Lvs Leu Ser Ala Thr Ser Val 



CTC TAC TAC GAC AGC AGC AAC AAC GTC ATC CTG CGC AAG CAC CGC AAC 
Leu Tvr Tvr Asp Ser Ser Asn Asn Val lie Leu Ara Lys His Arg Asn 

176 

ATG GTG GTC CGC GCC TGC GGC TGC CAC TGA GGOCCCAACTCCACCGGCAG 
MET Val Val Arg Ala Cys Gly Cys His 



[0071] It is noted that nucleotide 95 is a "T* whereas in the amplified DNA fragment described above the correspond- 



14 



EP 0 536 186 B1 



ing nucleotide is a "C". This ^9800-10 clone encodes at least a portion of the bovine BMP-8 protein of the invention. 
The BMP-8 peptide sequence from this clone is 49 amino acids in length and is encoded by the DNA sequence from 
nucleotide 30 through nucleotide 1 76. The amino acid sequence corresponding to tryptic fragments (2) and (3) isolated 
from bovine bone 28 to 30kD material is underlined in Table 1 . An in-frame stop codon (TGA) [nucleotides 177-179] 
indicates that this clone encodes the carboxy-terminal portion of the bovine BMP-8 protein of the invention. The nu- 
cleotides 1-29 are believed to be intron sequences based on the presence of a consensus splice site (a pyrimidine- 
rich stretch followed by the dinucleotide AG) as well as the lack of homology of the potentially encoded amino acids 
to other BMP proteins. 

[0072] The following two oligonucleotides are designed on the basis of the amino sequence of tryptic fragment (1) 
Arg-His-Glu-Leu-Tyr-Val-Ser-Phe-Gln-Asp-Leu-Gly-Tip-Leu-Asp-Trp-Val-lle-Ala-Pro-Gln-Gly-Tyr ((SEQ ID NO: 1) de- 
scribed above. 



#7: TGGGTNATHGCNCCNCA 



#8: ATHGCNCCNCARGGNTA 

[0073] These oligonucleotides hybridize to clone X9800-10 in SHB at 42 degrees C with washing in 5X SSC, 0.1 % 
SDS at 42 degrees C. A restriction fragment of clone X9800 : 10 containing the hybridizing region of both oligo #7 and 
#8 set forth above is subcloned into a plasmid vector (pGEM-3) and DNA sequence analysis performed. The partial 
DNA sequence (SEQ ID NO: 9) and derived amino acid sequence (SEQ ID NO: 10) of this region of clone X9800-10 
are shown in Table 2. 



Table 2 

51 

GGGGTGGGAG GGCACGTGGA TGGGACTCAC CTTCTCCCAC TACCCCCCAG GAC TGG 

AspTrp 



GTC ATC GCC CCC CAA GGC TAC TCA GCC TAT TAC TGT GAA GGG GAG TGC 
Val lie Ala Pro Gin Gly Tyr Ser Ala Tyr Tyr Cys Glu Gly Glu Cys 



TCC TTC CCG CTG GAC TCC TGC ATG AAC GCC ACC AAC CAC GCC ATC CTG 
Ser Phe Pro Leu Asp Ser Cys MET Asn Ala Thr Asn His Ala lie Leu 

161 

CAG TCC CTG GTCAGTACCTC 
Gin Ser Leu 



[0074] This region of clone X9800-10 encodes another portion of the bovine BMP-8 protein of the invention. The 
BMP-8 peptide sequence from this clone is 37 amino acids in length and is encoded by the DNA sequence from 
nucleotide 51 through nucleotide 1 61 . A portion of the amino acid sequence corresponding to tryptic fragment (1 ) (SEQ 
ID NO: 1) isolated from bovine bone 28 to 30kD material is underlined in Table 2. The nucleotides 1-50 are believed 
to be intron sequences based on the presence of a consensus splice site and lack of homology of the derived amino 
acid sequence to the remainder of the tryptic fragment (1). Similarly, the nucleotide sequences 162-172 are also be- 
lieved to be intron sequences. 

[0075] Another Pstl restriction fragment of clone X9800-1 0 is subcloned and sequenced in a similar manner to that 
described above. The partial DNA sequence (SEQ ID NO: 11) and derived amino acid sequence (SEQ ID NO:12) of 
this region of clone X9800-10 are shown in Table 3. 



EP 0 536 186 B1 



Table 3 

20 

CCCTTGCGTGTCCCCGCAG AC GAC GTC CAC GGC TCC CAC GGC CGG GAG GTG 

Asp Val His Glv Ser His Glv Arcr Gin Val 



99 

TGC CGT CGG CAC GAG CTG TAC GTG AGC TTC CAG GAC CTG GGC TGG CTG 
Cys Arg Arg His Glu Leu Tvr Val Ser Phe Gin Asp Leu Glv Trp Leu 



GTGAGTTCCGACTCTCCTTT 



[0076] This region of clone X9800-10 encodes another portion of the BMP-8 protein of the invention. The BMP-8 
peptide sequence from this clone is 26 amino acids in length and is encoded by the DNA sequence from nucleotide 
20 through nucleotide 99. The remaining portion of the amino acid sequence corresponding to tryptic fragment (1) 
isolated from bovine bone 28 to 30kD material is underlined in Table 3. It is also noted that this sequence encodes a 
peptide sequence comprising portion of the tryptic fragment (4) isolated from bovine bone 28 to 30kD material [(Thr)- 
Asn-Glu-Leu-Pro-Pro-(Pro)-Asn-Lys-Leu-(Pro)-Gly-lle-Ph ID NO: 4). 

The amino acid sequence corresponding to this tryptic peptide is also underlined in Table 3. The nucleotide sequences 
1-19 and 100-120 are believed to be intron sequences on the basis of reasons described previously. 
[0077] Based on the derived amino acid sequences set forth in Tables 1 , 2, and 3, the bovine BMP-8 protein of the 
invention is contemplated to be comprised of the amino acid sequence (SEQ ID NO: 13) present in Table 4. 



Table 4 

1 11 
Asp Val Eis Gly Ser His Gly Arg Gin Val Cys Arg Arg His Glu Leu 

Tyr Val Ser Phe Gin Asp Leu Gly Trp Leu Asp Trp Val lie Ala Pro 

Gin Gly Tyr Ser Ala Tyr Tyr Cys Glu Gly Glu Cys Ser Phe Pro Leu ■ 

Asp Ser Cys Met Asn Ala Thr Asn His Ala lie Leu Gin' Ser Leu Val 

His Leu Leu Lys Pro His Ala Val Pro Lys Ala Cys Cys Ala Pro Thr 

Lys Leu Ser Ala Thr Ser Val Leu Tyr Tyr Asp Ser Ser Asn Asn Val 

lie Leu Arg Lys His Arg Asn Met Val Val Arg Ala Cys Gly Cys His 

112 



[0078] This sequence is realized to be homologous to other BMP proteins. For example, the carboxy-terminal 
cysteine-rich region (amino acids #11 through #112 of Table 4) demonstrates the following amino acid identities: 55% 
to BMP-2; 41% to BMP-3; 55% to BMP-4; 74% to BMP-5; 75% to BMP-6; and 75% to BMP-7. 

EXAMPLE V 

Human BMP-8 

[0079] A 0.4 kb Pstl bovine genomic BMP-B fragment comprising the sequence set forth in Table 1 is radioactively 
labeled with 32 P and used as a probe to screen a human genomic library [Strategene Cloning Systems (catalog # 



16 



EP 0 536 186 B1 



944201 )] constructed in the vector XFIX. 1 ^00,000 recombinants of this human genomic library are plated at a density 
of 20,000 bacteriophage per plate. Duplicate nitrocellulose replicas of the recombinant bacteriophage plaques are 
made and hybridized to the bovine genomic probe in SHB at 65 degrees C and washed with 0.2X SSC, 0.1 % SDS at 
65 degrees C, Twenty-five positives are obtained and replated for secondaries. 

[0080] The following oligonucleotide probe is designed on the basis of nucleotide 57 through nucleotide 86 of the 
DNA sequence set forth in Table 2 and synthesized on an automated DNA synthesizer. 



#9: GTCATCGCCCCCCAAGGCTACTCAGCCTAT 

[0081] The following oligonucleotide probe is designed on the basis of nucleotide 20 through nucleotide 43 of the 
DNA sequence set forth in Table 3 and synthesized on an automated DNA synthesizer. 



#10: ACGACGTCCACGGCTCCCACGGCC 

[0082] One set of secondary filters is hybridized to probe #9 in SHB at 65 degrees C and washed in IX SSC, 0.1% 
SDS at 65 degrees C, the other set of secondary filters are hybridized to probe #1 0 in SHB at 50 degrees C and washed 
in 5X SSC, 0.1 % SDS at 50 degrees C. Two clones are found to hybridize to both oligonucleotide probes. The positive 
hybridization of oligonucleotides #9 and #10 to these two human genomic clones indicates that they contain at least 
a portion of the nucleotide sequence encoding the human equivalent of the BMP-8 protein of the invention. One of 
these clones is designated A.H8 12-1 and the bacteriophage was deposited with "ATCC" under the accession #75010 
on May 1 5, 1 991 . This deposit meets the requirements of the Budapest Treaty of the International Recognition of the 
Deposit of Microorganisms for the Purpose of Patent Procedure and Regulations thereunder. 
[0083] Once a recombinant bacteriophage containing DNA encoding a portion of the human cartilage and/or bone 
inductive factor molecule is obtained, the human coding sequence can be used as a probe to identify a human cell line 
or tissue which synthesizes the bone inductive factor. Alternatively, the bovine coding sequence can be used as a 
probe to identify such human cell line or tissue. Briefly described, RNA is extracted from a selected cell or tissue source 
and either electrophoresed on a formaldehyde agarose gel and transferred to nitrocellulose, or reacted with formalde- 
hyde and spotted on nitrocellulose directly. The nitrocellulose is then hybridized to a probe derived from a coding 
sequence of the bovine or human cartilage and/or bone inductive protein. mRNA is selected by oligo (dT) cellulose 
chromatography and cDNA is synthesized and cloned in lambda gt10 by established techniques (Toole et al., supra ). 
[0084] Additional methods known to those skilled in the art may be used to isolate the human and other species' 
cartilage/bone proteins of the invention. The procedures described above may be employed to isolate other related 
proteins of interest by utilizing the bovine or human proteins as a probe source. Such other proteins may find similar 
utility in, inter alia, fracture repair, wound healing and tissue repair. 

EXAMPLE VI 

Expression of the Cartilage/Bone Proteins 

[0085] In order to produce bovine, human or other mammalian proteins of the invention, the DNA encoding it, isolated 
as described above, is transferred into an appropriate expression vector and introduced into mammalian cells or other 
preferred eukaryotic or prokaryotic hosts by conventional genetic engineering techniques. Methods of transfection 
include electroporation, CaP0 4 precipitation, protoplast fusion, microinjection and lipofection. Once the host cells are 
transformed, stable transformants are then screened for expression of the product by standard immunological, biolog- 
ical or enzymatic assays. The presence of this DNA and mRNA encoding the BMP-8 polypeptides may be detected 
by standard procedures such as Southern and Northern blotting, high expressing cell lines are cloned or recloned at 
the appropriate level of selectivity to obtain a more homologous population of cells. 

[0086] Selected transformed host cells are cultured and the BMP-8 proteins of the invention expressed thereby are 
recovered, isolated and purified. Characterization of the expressed proteins is carried out using standard techniques. 
For example characterization may include pulse labeling with {35 S] methionine or cysteine and analysis by polyacry- 
lamide gel electrophoresis. The recombinantly expressed BMP-8 proteins are free of proteinaceous materials with 
which they are coproduced and with which they ordinarily are associated in nature, as well as from other contaminants, 
such as materials found in the cellular media. 

[0087] It is contemplated that the preferred expression system for biologically active recombinant human proteins of 



17 



EP 0 536 186 B1 



the invention will be stably transformed mammalian cells. For transient expression the cell line of choices is expected 
to be SV40 transformed African green monkey kidney C0S-1 to COS-7 which typically produce moderate amounts of 
the protein encoded within the plasmid for a period of 1 -4 days. It is further contemplated that the preferred mammalian 
cells will be CHO cells. 

[0088] One skilled in the art can construct mammalian expression vectors by employing the DNA sequences of the 
invention and known vectors, such as pCD [Okayama etal., Mol. Cell Biol. , 2:161-170 (1982)] and pJL3, pJL4 [Gough 
et al., EMBO J. , 4:645-653 (1985)]. The transformation of these vectors into appropriate host cells may result in ex- 
pression of the proteins of the invention. One skilled in the art could manipulate the sequences of the invention by 
eliminating or replacing the mammalian regulatory sequences flanking the coding sequence with bacterial sequences 
to create bacterial vectors for intracellular or extracellular expression by bacterial cells. For example, the coding se- 
quences could be further manipulated (e.g. ligated to other known linkers or modified by deleting non-coding sequences 
there-from or altering nucleotides therein by other known techniques). The modified coding sequence could then be 
inserted into a known bacterial vector using procedures such as described in T. Taniguchi et al., Proc. Natl Acad. Sci. 
USA, 77:5230-5233 (1980). This exemplary bacterial vector could then be transformed into bacterial host cells and a 
protein of the invention expressed thereby. For a strategy for producing extracellular expression of a cartilage and/or 
bone protein of the invention in bacterial cells., see, e.g. European patent application EPA 177,343. 
[0089] Similar manipulations can be performed for the construction of an insect vector [See, e.g. procedures de- 
scribed in published European patent application 155 : 476] for expression in insect cells. A yeast vector could also be 
constructed employing yeast regulatory sequences for intracellular or extracellular expression of the factors of the 
present invention by yeast cells. [See, e.g., procedures described in published PCT application WO86/00639 and 
European patent application EPA 123,289]. . . 

[0090] A method for producing high levels of a protein of the invention from mammalian cells involves the construction 
of cells containing multiple copies of the heterologous gene encoding proteins of the invention. The heterologous gene 
may be linked to an amplifiable marker, e.g. the dihydrofolate reductase (DHFR) gene for which cells containing in- 
creased gene copies can be selected for propagation in increasing concentrations of methotrexate (MTX) according 
to the procedures of Kaufman and Sharp, J. Mol. Biol. , 159:601-629 (1982). This approach can be employed with a 
number of different cell types. For example, a plasmid containing a DNA sequence for a protein of the invention in 
operative association with other piasmid sequences enabling expression thereof and the DHFR expression plasmid 
pAdA26SV(A)3 [Kaufman and Sharp, Mol. Cell. Biol. , 2:1304 (1982)] may be co-introduced into DH FR-deficient CHO 
cells, DUKX-BII, by calcium phosphate coprecipitation and transfection, electroperation or protoplast fusion. DHFR 
expressing transformants are selected for growth in alpha media with dialyzed fetal calf serum, and subsequently 
selected for amplification by growth in increasing concentrations of MTX (sequential steps in 0.02, 0.2, 1 .0 and 5uM 
MTX) as described in Kaufman et al., Mol Cell Biol. , 5:1750 (1983). Transformants are cloned, and the proteins of the 
invention are recovered, isolated, and purified from the culture medium. Biologically active protein expression is mon- 
itored by the Rosen-modified Sampath - Reddi rat bone formation assay described above in Example III. Protein ex- 
pression should increase with increasing levels of MTX resistance. Similar procedures can be followed to produce 
other related proteins. 

EXAMPLE VII 

Biological Activity of Expressed Cartilage/Bone Proteins 

[0091] To measure the biological activity of the expressed BMP-8 proteins obtained in Example VI above, the protein 
may be partially purified on a Heparin Sepharose column and further purified using standard purification techniques 
known to those skilled in the art. For example, post transfection conditioned medium supernatant collected from the 
cultures may be concentrated by ultrafiltration, dialyzed and applied to a Heparin Sepharose column. 
[0092] Further purification may be achieved by preparative NaDodS0 4 /PAGE [Laemmli, Nature 227 :680-685 (1 970)]. 
For instance, the protein is applied to a gel. Recovery may be estimated by adding L-[ 35 S]methionine-labeled BMP 
protein purified over heparin-Sepharose as described above. Protein may be visualized by copper staining of an ad- 
jacent lane [Lee, et al., Anal. Biochem. 166 :308-312 (1987)]. Appropriate bands are excised and extracted. 
[0093] The appropriate amount of the resulting solution is mixed with 20 mg of rat matrix and then assayed for in 
vivo bone and/or cartilage formation activity by the Rosen-modified Sampath - Reddi assay. A mock transfection su- 
pernatant fractionation is used as a control. The implants containing rat matrix to which specific amounts of human 
proteins of the invention have been added are removed from rats after seven days and processed for histological 
evaluation. Representative sections from each implant are stained for the presence of new bone mineral with von 
Kossa and acid fuchsin, and for the presence of cartilage-specific matrix formation using toluidine blue. The types of 
cells present within the section, as well as the extent to which these cells display phenotype are evaluated and scored 
as described in Example III. 



18 



EP 0 536 186 B1 



SEQUENCE LISTING 
[0094] 

(1) GENERAL INFORMATION: 

(i) APPLICANT: 

Hewick, Rodney M. 
Wang, Jack H. 

(ii) TITLE OF INVENTION: Bone and Cartilage Inductive Proteins 

(iii) NUMBER OF SEQUENCES: 13 

(iv) CORRESPONDENCE ADDRESS: 

(A) ADDRESSEE: Legal Affairs, Genetics Institute, Inc. 

(B) STREET: 87 CambridgePark Drive 

(C) CITY: Cambridge 

(D) STATE: MA 

(E) COUNTRY: USA 

(F) ZIP: 02140 

(v) COMPUTER READABLE FORM: 

(A) MEDIUM TYPE: Floppy disk 

(B) COMPUTER: IBM PC compatible 

(C) OPERATING SYSTEM: PC-DOS/MS-DOS 

(D) SOFTWARE: Patentln Release #1 .0, Version #1 .25 

(vi) CURRENT APPLICATION DATA: 

(A) APPLICATION NUMBER: US 

(B) FILING DATE: 15-MAY-1991 

(C) CLASSIFICATION: 

(viii) ATTORNEY/AGENT INFORMATION: 

(A) NAME: Kapinos, Ellen J. 

(B) REGISTRATION NUMBER: 32,245. 

(C) REFERENCE/DOCKET NUMBER: <al51 82X-PCT 

(ix) TELECOMMUNICATION INFORMATION: 

(A) TELEPHONE: 617-876-1170 

(B) TELEFAX: 617-876-5851 

(2) INFORMATION FOR SEQ ID NO:1 : 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 23 amino acids 

(B) TYPE: amino acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: unknown 

(ii) MOLECULE TYPE: peptide 



19 



EP 0 536 186 B1 

(iii) HYPOTHETICAL: NO 

(iv) ANTI-SENSE: NO 

5 (vi) ORIGINAL SOURCE: 

(F) TISSUE TYPE: Bone 
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: 

Arg His Glu Leu Tyr Val Ser Phe Gin Asp Leu Gly Trp Leu Asp Trp 
15 10 15 

15 val lie Ala Pro Gin Gly Tyr 

20 

(2) INFORMATION FOR SEQ ID NO:2: 
20 (i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 18 amino acids 

(B) TYPE: amino acid 

(C) STRANDEDNESS: single 
25 (D) TOPOLOGY: unknown 

(ii) MOLECULE TYPE: peptide 

(iii) HYPOTHETICAL: NO 

30 

(iv) ANTI-SENSE: NO 

(v) FRAGMENT TYPE: internal 

35 (vi) ORIGINAL SOURCE: 

(A) ORGANISM: Bos taurus 
(F) TISSUE TYPE: Bone 

40 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: 



Leu Ser Ala Thr Ser Val Leu Tyr Tyr Asp Ser Ser Asn Asn Val lie 
15 10 15 

45 

Leu Arg 



(2) INFORMATION FOR SEQ ID NO:3: 

50 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 7 amino acids 

(B) TYPE: amino acid 

55 (C) STRANDEDNESS: single 

(D) TOPOLOGY: unknown 

(ii) MOLECULE TYPE: peptide 



20 



EP 0 536 186 B1 



(iii) HYPOTHETICAL: NO 

(iv) ANTI-SENSE: NO 

5 (vi) ORIGINAL SOURCE: 

(A) ORGANISM: Bos taurus 
(F) TISSUE TYPE: Bone 

10 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: 



Ala Cys Cys Ala Pro Thr Lys 

1 5 

15 



(2) INFORMATION FOR SEQ ID NO:4: 
20 (i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 23 amino acids 

(B) TYPE: amino acid 

(C) STRANDEDNESS: single 
25 (D) TOPOLOGY: unknown 

(ii) MOLECULE TYPE: peptide 

(iii) HYPOTHETICAL: NO 

30 

(vi) ORIGINAL SOURCE: 

(A) ORGANISM: Bos taurus 
(F) TISSUE TYPE: Bone 

35 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: 

Thr Asn Glu Leu Pro Pro Pro Asn Lys Leu Pro Gly lie Phe Asp Asp 
40 1 5 10 15 

Val His Gly Ser His Gly Arg 
20 



^5 (2) INFORMATION FOR SEQ ID NO:5: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 80 base pairs 
so (B) TYPE: nucleic acid 

(C) STRANDEDNESS: double 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 

55 

(iii) HYPOTHETICAL: NO 

(iv) ANTI-SENSE: NO 



21 



EP 0 536 186 B1 



(vi) ORIGINAL SOURCE: 

(A) ORGANISM: Bos taurus 

(vii) IMMEDIATE SOURCE: 

(B) CLONE: acc30 

(viii) POSITION IN GENOME: 

(C) UNITS: bp 

(ix) FEATURE: 

(A) NAME/KEY: CDS 

(B) LOCATION: 25.. 57 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: 

GGATCCGCGT GCTGTGCTCC GACC AAG CTG AGC GCC ACC TCC GTG CTC TAC 

Lys Leu Ser Ala Thr Ser val Leu Tyr 
1 5 

TAC GAC AGCAGCAACA ATGTAATTCT AGA 



Tyr Asp 
10 



(2) INFORMATION FOR SEQ ID NO:6: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 11 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: 



Lys Leu Ser Ala Thr Ser Val Leu Tyr Tyr Asp 
1 5 10 

(2) INFORMATION FOR SEQ ID NO:7: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 199 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: double 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 



22 



EP 0 536 186 B1 

(Hi) HYPOTHETICAL: NO 
<vi) ORIGINAL SOURCE: 

(A) ORGANISM: Bos taurus 

(vii) IMMEDIATE SOURCE: 

(A) LIBRARY: Bovine genomic 

(B) CLONE: Lambda 9800-10 

(viii) POSITION IN GENOME: 

(C) UNITS: bp 

(ix) FEATURE: 

(A) NAME/KEY: exon 

(B) LOCATION: 30.. 199 

(ix) FEATURE: 

(A) NAME/KEY: intron 

(B) LOCATION: 1..29 

(ix) FEATURE: 

(A) NAME/KEY: CDS 

(B) LOCATION: 30.. 179 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: 

TGCCCGCTGC CCCCTCCOGC CCCCGCCAG GTG CAC CTG CTG AAG CCG CAC GCG 

Val His Leu Leu Lys Pro His Ala 
1 5 

GTC CCC AAG GCG TGC TGC GCG CCC ACC AAG CTG AGC GCC ACT TCC GTG 



Val Pro Lys Ala Cys Cys Ala Pro 
10 15 

CTC TAC TAC GAC AGC AGC AAC AAC 
Leu Tyr Tyr Asp Ser Ser Asn Asn 
25 30 

ATG GTG GTC CGC GCC TGC GGC TGC 
Met Val Val Arg Ala Cys Gly Cys 
45 

CAG 



(2) INFORMATION FOR SEQ ID NO:8: 
(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 49 amino acids 

(B) TYPE: amino acid 



Thr Lys Leu Ser Ala Thr Ser Val 
20 

GTC ATC CTG CGC AAG CAC CGC AAC 
Val He Leu Arg Lys His Arg Asn 
35 40 

CAC TGAGGCCCCA ACTCCACCGG 
His 

50 



23 



EP 0 536 186 B1 

(D) TOPOLOGY: linear 
(ii) MOLECULE TYPE: protein 
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8: 

Val His Leu Leu Lys Pro His Ala Val Pro Lys Ala Cys Cys Ala Pro 
15 io 15 

Thr Lys Leu Ser Ala Thr Ser Val Leu Tyr Tyr Asp Ser Ser Asn Asn 
20 25 30 

Val He Leu Arg Lys His Arg Asn Met Val Val Arg Ala Cys Gly Cys 
35 40 45 

His 



(2) INFORMATION FOR SEQ ID NO:9: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 172 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: double 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 

(iii) HYPOTHETICAL: NO 

(vi) ORIGINAL SOURCE: 

(A) ORGANISM: Bos taurus 

(vii) IMMEDIATE SOURCE: 

(A) LIBRARY: Bovine genomic 

(B) CLONE: Lambda 9800-10 

(viii) POSITION IN GENOME: 

(C) UNITS: bp 

(ix) FEATURE: 

(A) NAME/KEY: exon 

(B) LOCATION: 51. .161 

(ix) FEATURE: 

(A) NAME/KEY: intron 

(B) LOCATION: 1..50 

(ix) FEATURE: 

(A) NAME/KEY: intron 



24 



EP 0 536 186 B1 



w 



(B) LOCATION: 162..172 
(ix) FEATURE: 

(A) NAME/KEY: CDS 

(B) LOCATION: 51. .161 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9: 

GGGGTGGGAG GGCACGTGGA TGGGACTCAC CTTCTCCCAC TACCCCCCAG GAC TGG 56 

Asp Trp 
1- 

GTC ATC GCC CCC CAA GGC TAC TCA GCC TAT TAC TGT GAA GGG GAG TGC 104 
15 Val He Ala Pro Gin Gly Tyr Ser Ala Tyr Tyr Cys Glu Gly Glu Cys 
5 10 15 

TCC TTC CCG CTG GAC TCC TGC ATG AAC GCC ACC AAC CAC GCC ATC CTG 152 
Ser Phe Pro Leu Asp Ser Cys Met Asn Ala Thr Asn His Ala He Leu 
20 25 30 

20 

CAG TCC CTG GTCAGTACCT C 172 
Gin Ser Leu 
35 

25 (2) INFORMATION FOR SEQ ID NO:10: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 37 amino acids 
30 (B) TYPE: amino acid 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 

35 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10: 



Asp Trp Val lie Ala Pro Gin Gly Tyr Ser Ala Tyr Tyr Cys Glu Gly 
1 5 10 15 

Glu Cys Ser Phe Pro Leu Asp Ser Cys Met Asn Ala Thr Asn His Ala 
20 25 30 

lie Leu Gin Ser Leu 
35 



40 



45 



50 



55 



(2) INFORMATION FOR SEQ ID NO:11 : 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 119 base pairs 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: double 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: DNA (genomic) 
iii) HYPOTHETICAL: NO 



25 



EP 0 536 186 B1 



(vi) ORIGINAL SOURCE: 

(A) ORGANISM; Bos taurus 
vii) IMMEDIATE SOURCE: 

(A) LIBRARY: Bovine genous. 

(B) CLONE: Lambda 9800-10 

iii) POSITION IN GENOME: 

(C) UNITS: bp 
(ix) FEATURE: 

(A) NAME/KEY: exon 

(B) LOCATION: 20..99 

(ix) FEATURE: 

(A) NAME/KEY: intron 

(B) LOCATION: 1.. 19 

(ix) FEATURE: 

(A) NAME/KEY: intron 

(B) LOCATION: 100.. 119 

(ix) FEATURE: 

(A) NAME/KEY: CDS 

(B) LOCATION: 22. .99 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11: 



TGCGTG TCCCCGCAGA C GAC GTC CAC GGC TCC CAC GGC CGG CAG GTG 

Asp Val Eis Gly Ser His Gly Arg Gin Val 
- 1 5 10 

CGT CGG CAC GAG CTG TAC GTG AGC TTC CAG GAC CTG GGC TGG CTG 
Arg Arg His Glu Leu Tyr Val Ser Phe Gin Asp Leu Gly Trp Leu 
15 20 25 

GTTCCG ACTCTCCTTT 



INFORMATION FOR SEQ ID NO:12: 
[0095] 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 26 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: protein 



26 



EP 0 536 186 B1 

{xi) SEQUENCE DESCRIPTION: SEQ ID NO:12: 

Asp val His Gly Ser His Gly Arg Gin Val Cys Arg Arg His Glu Leu 

Tyr val Ser Phe Gin Asp Leu Gly Trp Leu 
20 25 

INFORMATION FOR SEQ ID NO:13: 
[0096] 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 112 amino acids 

(B) TYPE: amino acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(ii) MOLECULE TYPE: peptide 

(iii) HYPOTHETICAL: NO 
(vi) ORIGINAL SOURCE: 

(A) ORGANISM: Bos taurus 
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13: 



Asp Val His Gly Ser His Gly Arg Gin Val Cys Arg Arg His Glu Leu 
15 10 15 

Tyr Val Ser Phe Gin Asp Leu Gly Trp Leu Asp Trp Val lie. Ala Pro 
20 25 30 

Gin Gly Tyr Ser Ala Tyr Tyr Cys Glu Gly Glu Cys Ser Phe Pro Leu 
35 40 45 

Asp Ser Cys Met Asn Ala Thr Asn His Ala lie Leu Gin Ser Leu Val 
50 55 60 

His Leu Leu Lys Pro His Ala Val Pro Lys Ala Cys Cys Ala Pro Thr 
65 70 75 80 

Lys Leu Ser Ala Thr Ser Val Leu Tyr Tyr Asp Ser Ser Asn Asn Val 
85 . 90 95 

lie Leu Arg Lys His Arg Asn Met Val Val Arg Ala Cys Gly Cys His 
100 105 110 



27 



EP 0 536 186 B1 



Claims 

1 . A bone morphogenic protein (BMP-8) comprising at least one of the following sequences or one of the following 
sequences with one or more modification(s) of O-linked or N -I inked glycosylation sites: 

a) Arg-His -Glu- Leu- Tyr-Val -Ser- Phe -Gin-Asp- Leu- Gly-Trp- 
Leu-Asp-Trp-Val-Ile-Ala-Pro-Gln-Gly-Tyr (SEQ ID NO: 
1); 

b) Leu-Ser-Ala-Thr-Ser-Val-Leu-Tyr-Tyr-Asp-Ser-Ser-Asn- 
Asn-Val-Ile-Leu-Arg (SEQ ID NO: 2); or 

c) Ala-Cys-Cys-Ala-Pro-Thr-Lys (SEQ ID NO: 3) 

and being further characterized by the ability to induce the formation of cartilage and/or bone. 

2. The protein of claim 1 further characterized by an apparent molecular weight of 28,000-38,000 daltons as deter- 
mined by SDS-PAGE under non-reducing conditions and an apparent molecular weight of about 14,000-20,000 
daltons as determined by SDS-PAGE under reducing conditions. 

3. A DNA sequence encoding the protein of claim 1 or 2. 

4. An expression vector containing the DNA sequence of claim 3. 

5. A host ceil transformed with the vector of claim 4. 

6. The protein of claim 1 or 2 obtainable by the steps of: 

(a) culturing the host cell of claim 5; and 

(b) recovering, isolating and purifying from said culture medium said protein. 

7. A method for producing the protein of claim 1 or 2 said method comprising the steps of: 

(a) culturing the host cell of claim 5; and 

(b) recovering, isolating and purifying from said culture medium said protein. 

8. A pharmaceutical composition comprising an effective amount of the protein of claim 1 , 2 or 6 in admixture with a 
pharmaceutical^ acceptable carrier. 

9. The pharmaceutical composition of claim 8 for bone and/or cartilage formation. 

10. The pharmaceutical composition of claim 8 for wound healing and tissue repair. 

11. The composition of any one of claims 8 to 10 further comprising a matrix for supporting said composition and 
providing a surface for bone and/or cartilage formation. 

12. The composition of claim 11 wherein said matrix comprises a material selected from hydroxyapatite, collagen, 
polylactic acid or tricalcium phosphate. 

13. A method for obtaining a DNA sequence of claim 3 characterized in that 

(a) the amino acid sequence(s) defined in claim 1 are used to design nucleic acid probes to screen libraries; and 

(b) positive clones containing DNA sequences encoding a bone morphogenic protein (BMP-8) are isolated. 



28 



EP 0 536 186 B1 

14. A method for the preparation of a pharmaceutical composition comprising the combining of an effective amount 
of the protein of claim 1 , 2 or 6 with a pharmaceutical^ acceptable carrier. 

15. The method of claim 14 further comprising the combining with a matrix for supporting said composition and pro- 
viding a matrix for bone and/or cartilage formation. 

Patentanspriiche 

1 . Morphogenetisches Knochenprotein (BMP-8), das mindestens eine der foigenden Sequenzen, oder eine der fol- 
genden Sequenzen mit einer oder mehreren Modifikationen der O-verknupften oder N-verknupften Gtycosylie- 
rungsstellen umfaSt: 

(a) Arg-His-Glu-Leu-Tyr-Va!-Ser-Phe-Gln-Asp-Leu-GIy-Trp-Leu-Asp-Trp- 
Val-lle-Ala-Pro-Gln-Gly-Tyr (SEQ ID NO: 1 ); 

(b) Leu-Ser-Ala-Thr-Ser-Val-Leu-Tyr-Tyr-Asp-Ser-Ser-Asn-Asn-Val-lle- 
Leu-Arg (SEQ ID NO: 2); oder 

(c) Ala-Cys-Cys-Ala-Pro-Thr-Lys <SEQ ID NO: 3) 

und weiter durch die Fahigkeit charakterisiert wird, die Bildung von Knorpel und/oder Knochen zu induzieren. 

2. Protein nach Anspruch 1 , das weiter charakterisiert ist durch ein augenscheinliches Molekulargewicht von 28.000 
- 38.000 Dalton, bestimmt durch SDS-PAGE unter nicht-reduzierenden Bedingungen, und ein augenscheinliches 
Molekulargewicht von 14.000 - 20.000 Dalton, bestimmt durch SDS-PAGE unter reduzierenden Bedingungen. 

3. DNA-Sequenz, die das Protein nach Anspruch 1 oder 2 codiert. 

4. Expressionsvektor der die DNA-Sequenz nach Anspruch 3 enthalt. 

5. Wirtszelle, die mit dem Vektor nach Anspruch 4 transformiert ist. 

6. Protein nach Anspruch 1 oder 2, das erhaltlich ist durch die Schritte: 

(a) Zuchtung der Wirtszelle nach Anspruch 5; und 

(b) Gewinnung, Isolierung und Aufreinigung des Proteins aus dem Kulturmedium. 

7. Verfahren zur Herstellung des Proteins nach Anspruch 1 oder 2, wobei das Verfahren die Schritte umfaBt: 

(a) Zuchtung der Wirtszelle nach Anspruch 5; und 

(b) Gewinnung, Isolierung und Aufreinigung des Proteins aus dem Kulturmedium. 

8. Arzneimittel, das eine wirksame Menge des Proteins nach Anspruch 1 , 2 oder 6 im Gemisch mit einem pharma- 
zeutisch vertraglichen Trager umfaBt. 

9. Arzneimittel nach Anspruch 8 zur Knochen- und/oder Knorpelbildung. 

10. Arzneimittel nach Anspruch 8 zur Wundheilung undOewebereparatur. 

1 1 . Zusammensetzung nach einem der Anspriiche 8 bis 1 0, die weiter eine Matrix zur Unterstutzung der Zusammen- 
setzung und zur Bereitstellung einer Oberflache fur die Knochen- und/oder Knorpelbildung umfaflt. 



29 



EP 0 536 186 B1 

12. Zusammensetzung nach Anspruch 11, wobei die Matrix ein Material ausgewahlt aus Hydroxyapatit, Collagen, 
Polymilchsaure oder Tricalciumphosphat umfaBt. 

13. Verfahren, urn eine DNA-Sequenz nach Anspruch 3 zu erhalten, dadurch gekennzeichnet, daB 

(a) die Aminosauresequenz(en), definiert nach Anspruch 1 i , verwendet werden urn Nuclei nsauresonden zur 
Durchmusterung von Bibliotheken zu konstruieren; und 

(b) die positiven Clone, die DNA-Sequenzen enthalten, die ein morphogenetisches Knochenprotein (BMP-8) 
codieren, isoliert werden. 

14. Verfahren zur Herstellung eines Arzneimittels, umfassend die Kombination einer wirksamen Menge des Proteins 
nach Anspruch 1 , 2 oder 6 mit einem pharmazeutisch vertraglichen Trager. 

1 5. Verfahren nach Anspruch 14, das weiter die Kombination mit einer Matrix zur Unterstutzung der Zusammensetzung 
und zur Bereitstellung einer Matrix zur Knochen- und/oder Knorpelbildung umfaBt. 

Revendicatfons 

1. Une proteine pour la morphogenese osseuse (BMP-8) comprenant au moins une des sequences suivantes ou 
une des sequences suivantes avec une ou plusieurs modification(s) de sites de glycosylation O-lies ou N-lies : 

a) Arg-His-Glu-Leu-Tyr-Val-Ser-Phe-Gln-Asp-Leu-Gly-Trp-Leu»Asp- 
Tip-Val-Ile-Ala-Pro-Gln-Gly-Tyr (SEQ ID NO : I) ; 

b) Leu-Ser-Ala-Thr-Ser-Val-Leu-Tyr-Tyr-Asp-Ser-Ser-Asn-Asn-Var-Ue- 
Leu-Arg (SEQ ID NO : 2) ; ou 

c) Ala-Cys-Cys-Ala-Pro-Thr-Lys (SEQ ID NO : 3) 

et etant en outre caracterisee par la capacite a induire la formation de cartilage et/ou d'os. 

2. La proteine de ia revendication 1 , caracterisee en outre par une masse moleculaire apparente de 28 000 a 38 
000 daltons telle que determinee par SDS-PAGE en conditions non reductrices, et une masse moleculaire ap- 
parente d'environ 14 000 a 20 000 daltons telle que determinee par SDS-PAGE en conditions reductrices. 

3. Une sequence ADN codant la proteine de la revendication 1 ou 2. 

4. Un vecteur d'expression contenant la sequence ADN de la revendication 3. 

5. Une cellule note transformed par le vecteur de la revendication 4. 

6. La proteine de la revendication 1 ou 2 susceptible d'etre obtenue par les 6tapes de : 

(a) cultiver la cellule h6te de la revendication 5 ; et 

(b) recuperer, isoler et purifier ladite proteine a partir dudit milieu de culture. 

7. Une methode pour produire la proteine de la revendication 1 ou 2, ladite methode comprenant les etapes de : 

(a) cultiver la cellule hdte de la revendication 5 ; et 



30 



EP 0 536 186 B1 



(b) recup6rer, isoter et purifier ladite proteine a partir dudit milieu de culture. 

8. Une composition pharmaceutique comprenant une quantite efficace de la proteine de la revendication 1 , 2 ou 6 
en melange avec un vehicule pharmaceutiquement acceptable. 

9. La composition pharmaceutique de la revendication 8 pour la formation d'os et/ou de cartilage. 

10. La composition pharmaceutique de la revendication 8 pour la cicatrisation des blessures et la reconstruction des 
tissus. 

1 1 . La composition de I'une quelconque des revendications 8 a 1 0, comprenant en outre une matrice destinee a donner 
un support a cette composition et a fournir une surface pour la formation d'os et/ou de cartilage. 

12. La composition de la revendication 11 , dans laquelle ladite matrice comprend un materiau choisi parmi I'hydroxya- 
patite, le collagene, I'acide polylactique, ou le phosphate tricalcique. 

13. Une methode pour obtenir une sequence ADN de la revendication 3, caracterisee en ce que 

(a) la (les) s6quence(s) aminoacide(s) definies en revendication 1 sont utilisees pour construire des sondes 
d'acide nucleique pour cribler des banques ; et 

(b) les clones positifs contenant les sequences ADN codant une proteine pour la morphogenese osseuse 
(BMP-8) sont isoles. 

14. Une methode pour la preparation d' une. composition pharmaceutique comprenant la combinaison d'une quantite 
efficace de la proteine de la revendication 1 , 2 ou 6 avec un vehicule pharmaceutiquement acceptable. 

15. La methode de la revendication 14, comprenant en outre la combinaison avec une matrice destinee a donner un 
support a ladite composition et a fournir une matrice pour la formation d'os et/ou de cartilage. 



31 



EP 0 536 186 B1 



Figure 1 



52 Standard 




32 



This Page is Inserted by IFW Indexing and Scanning 
Operations and is not part of the Official Record 

BEST AVAILABLE IMAGES 

Defective images within this document are accurate representations of the original 
documents submitted by the applicant. 

Defects in the images include but are not limited to the items checked: 

□ BLACK BORDERS 

□ IMAGE CUT OFF AT TOP, BOTTOM OR SIDES 
□TfADED TEXT OR DRAWING 
^BLURRED OR ILLEGIBLE TEXT OR DRAWING 

□ SKEWED/SLANTED IMAGES 

□ COLOR OR BLACK AND WHITE PHOTOGRAPHS 

□ GRAY SCALE DOCUMENTS 

□ LINES OR MARKS ON ORIGINAL DOCUMENT 

□ REFERENCE(S) OR EXHIBIT(S) SUBMITTED ARE POOR QUALITY 

□ OTHER: 

IMAGES ARE BEST AVAILABLE COPY. 
As rescanning these documents will not correct the image 
problems checked, please do not report these problems to 
the IFW Image Problem Mailbox.