Skip to main content

Full text of "USPTO Patents Application 09804625"

See other formats


® 



Europaisches Patentamt 
European Patent Office 
Office europeen des brevets 



0 Publication number: 



0 531 448 B1 



0 



EUROPEAN PATENT SPECIFICATION 



© Date of publication of patent specification: 17.11.94 © Int. CI S: C08J 7/18, 008 K 7/02 

0 Application nunr^ber: 91911938.8 

0 Date of filing: 20.05.91 

0 International application number: 
PCT/US91/03540 



© International publication number: 
WO 91/18047 (2ai1.91 91/27) 



© MAMMALIAN EXPRESSION OF THE BMP-2 FAMILY. 



tn 

00 



CO 

in 



Q. 



© Priority: 24.05.90 US 528300 

0 Date of publication of application: 

17.03.93 Bulletin 93/11 

0 Publication of the grant of the patent: 

17.11.94 Bulletin 94/46 

© Designated Contracting States: 

AT BE CH DE DK ES FR GB GR IT LI LU NL SE 



References cited: 
EP-A- 0 376 785 
CA-A- 1 073 581 
US-A- 3 860 538 



WO-A-88/00205 
US-A. 3 676 401 
US-A-4 495 311 



PROCEEDINGS OF THE NATIONAL ACADEMY 
OF SCIENCES OF USA, voL 87, March 1990, 
Washington US, pp. 2220-2224, WANG, E.A. et 
al. 

MOLECULAR ENDOCRINOLOGY, vol. 5, no. 1, 
January 1991, BALTIMORE, US, pp. 149-155, 
HAMMONDS, R.G. et al. 



0 Proprietor: GENENTECH, INC. 
460 Point San Bruno Boulevard 
South San Francisco California 94080 (US) 

0 Inventor: HAMMONDS, R., Glenn 
7036 Norfolk Road 
Berkeley, CA 94705 (US) 
Inventor: MASON, Anthony, J. 
1446 Floribunda, 204 
Burllngame, CA 94010 (US) 

0 Representative: Armltage, Ian Michael et al 
MEWBURN ELLIS 
York House 
23 Kingsway 
London WC2B 6HP (GB) 



Note: Within nine months from the publication of the mention of the grant of the European patent, any person 
may give notice to the European Patent Office of opposition to the European patent granted. Notice of opposition 
shall be filed in a written reasoned statement. It shall not be deemed to have been filed until the opposition fee 
has been paid (Art. 99(1) European patent convention). 



Rank Xerox (UK) Business Services 

(3.10/3.O9/3.3.3t 



EP 0 531 448 B1 



Description 

Field of the Invention 

6 This invention relates to an improved method for expressing DNA encoding the bone morphogenetic 
protein-2 family in mammalian cells. 

Description of Related Art 

70 The disorders associated with bone loss present major public health problems for Western societies. 
Osteoporosis alone may affect 20 million Americans In the early years of the next century. Hence, there is 
wide interest in identifying factors or potential therapeutic agents that inhibit bone loss and stimulate the 
formation of healthy new bone. 

Bone is an extremely complex, but highly organized, connective tissue that is continuously remodeled 

75 during the life of an adult by cellular events that initially break it down (osteoclastic resorption) and then 
rebuild it (osteoblastic formation). This remodeling process occurs in discrete packets throughout the 
skeleton, i.e.. in both cortical bone and trabecular bone. It has recently been reported that mouse bone 
marrow cells can be stimulated to generate osteoclasts in the presence of parathyroid hormone-related 
protein or vitamin D. See Akatsu et al., Endocrinology , 125 : 20-27 (1989); TakahashI et al., Endocrinology . 

20 123: 2600-2602 <1988) and TakahashI et al., Endocrinology , 123 : 1504-1510 (1988). 

The currently available therapeutic agents known to stimulate bone formation are fluoride, estrogen, 
metabolites, and vitamin D. Fluoride clearly increases trabecular bone mass, but questions remain about the 
quality of the new bone formed, the side effects observed in some patients, whether there are beneficial 
effects on vertebral fracture rates, and whether increased fragility of cortical bone with subsequent 

25 propensity to hip fracture follows. 

Another approach Is using agents that promote resorption (parathyroid hormone) and then Interrupt 
resorption (calcitonin). One proposed, but not validated, such sequential therapeutic regimen is coherence 
therapy, where bone metabolic units are activated by oral phosphate administration and then resorption is 
inhibited by either diphosphonates or calcitonin. 

30 Within the past few years several factors that stimulate osteoblasts have been identified in bone, 
including transforming growth factor-^S (TGF-/S), fibroblast growth factor, platelet-derived growth factor, 
insulin-like growth factor-l, and ^2 macroglobulln. 

Other proteins stored in the bone matrix may also be Important for bone formation. When demineralized 
bone was injected into the muscle or subcutaneous tissue of rats, a cascade of events, including 

35 chondrogenesis. ensued. Urist, Science , 150 : 893 (1965). Since the 1960s several investigators have 
attempted to identify and characterize this activity and have provided an assay for purification of such 
activity. Reddi and Huggins, Proc. Natl. Acad. Sci. USA . 69: 1601-1605 (1972); Sampath and Reddi, Proc. 
Natl. Acad. Sci. USA . 78: 7599-7603 (1981). 

This assay served as the basis for purifying several novel proteins from bone In sufficient quantity and 

40 purity to provide amino acid sequence information, including osteogenin, a protein of 22 Kd {Sampath et al., 
Proc. Natl. Acad. Sci. USA , 84: 7109 (1987); Luyten et al.. J. Biol. Chem. . 264 : 13377-13380 (1989)] and a 
glycoprotein called osteoinductive factor [Bentz et al.. J. Cell. Biol. , 107: 162a (1989)]. See also Wang et al.. 
Proc. Natl. Acad. Sci. . 85: 9484-9488 (1988). Based on amino acid sequence data, clones encoding several 
proteins related by sequence similarity to TGF-j9 were isolated from bovine and human sources. Wozney et 

45 al., Science , 242 : 1528-1534 (1988); POT WO 88/00205 published January 14, 1988; U.S. 4,877.864 issued 
October 31, 1989. These latter proteins included BMP-2A (also known as BMP-2), BMP-2B (also known as 
BMP-4), and BMP-3. The sequence of tryptic peptides from osteogenin match the sequence reported for 
BMP-3. 

The TGF-/8 supergene family includes five distinct forms of TGF-j8 [Sporn and Roberts, in Peptide 
50 Growth Factors and Their Receptors , Sporn and Roberts, eds. (Springer-Verlag: Berlin, 1990) pp. 419-472], 
as well as the differentiation factors vgl [Weeks and Melton, Cell, 51^: 861-867 (1987)] and DPP-C 
polypeptide [Padgett et al.. Nature , 325 : 81-84 (1987)], the hormones actlvin and inhibin [Mason et al., 
Nature, 318: 659-663 (1985); Mason et al.. Growth Factors . 1: 77-88 (1987)], the Mullerlan-inhibiting 
substance, MIS [Gate et al., Cell. 45: 685-698 (1986)], the BMPs. and the developmentally regulated protein 
65 Vgr-1 [Lyons et al., Proc. Natl. Acad. Sci. USA . 86: 4554-4558 (1989)]. The subset BMP-2A and BMP-2B is 
approximately 75% homologous in sequence to DPP-C and may represent the mammalian equivalent of 
that protein. 



2 



EP 0 531 448 B1 



The proteins of the TGF-)3 supergene family are disulfide-linked homo- or heterodimers encoded by 
larger precursor polypeptide chains containing a hydrophobic signal sequence, a long and relatively poorly 
conserved N-terminal pro region of several hundred amino acids, a cleavage site (usually polybasic), and a 
shorter and more highly conserved C-terminal region. This C-terminal region corresponds to the processed 

6 mature protein and contains approximately 100 amino acids with a characteristic cysteine motif, i.e.. the 
conservation of seven of the nine cysteine residues of TGF-jS among all known family members. Although 
the position of the cleavage site between the mature and pro regions varies among the family members, the 
C-terminus of alt of the proteins is In the identical position, ending in the sequence Cys-X-Cys-X, but 
differing in every case from the TGF-j3 consensus C-terminus of Cys-Lys-Cys-Ser. Sporn and Roberts. 

70 1990. supra. 

The pro region of TGF-/3 associates non-covalently with the mature TGF-^g dimer (Wakefield et al.. J. 

Biol. Chem. . 263 : 7646-7654 (1988); Wakefield et al.. Growth Factors , 1: 203-218 (1989)]. and the pro 

regions are found to be necessary for proper folding and secretion of the active mature dimers of both. 

TGF-)8 and activin [Gray and Mason, Science , 247 : 1328-1330 (1990)]. The association between the mature 
75 and pro regions of TGF-^ masks the biological activity of the mature dimer. resulting in formation of an 

inactive latent form. Latency is not a constant of the TGF-j9 supergene family, since the presence of the pro 

region has no effect on activin or inhibin biological activity. 

A unifying feature of the biology of the proteins from the TGF-jS supergene family is their ability to 

regulate developmental processes. Regarding bone formation in vivo, of all the proteins in the TGF-^ 
20 supergene family, the BMPs and TGF-jS play the most major role. 

Recombinant TGF-^1 has been cloned [Derynck et al.. Nature , 316:701-705 (1985)] and expressed in 

Chinese hamster ovary cells [Gentry et al., Mol. Cell. Biol. , 7: 3418-3427 (1987)]. Additionally, recombinant 

human TGF-^2 [deMartin et al., EMBO J. , 6: 3673 (1987)], as well as human and porcine TGF-/33 [Derynck 

et al.. EMBO J. ,7: 3737-3743 (1988); ten Dijke et al., Proc. Natl. Acad. Sci. USA . 85: 4715 (1988)], have 
25 been cloned. Expression levels of the mature TGF-^1 protein in COS cells are increased by substituting a 

serine residue for cysteine residues located in the pro region of the TGF-^1 precursor. Brunner et al., J. 

Biol. Chem. . 264 : 13660-13664 (1989)]. 

BMP-2A and BMP-3 have been recombinantly produced in monkey COS-1 cells and Chinese hamster 

ovary cells by Wozney et al., supra However, the level of expression of BMP-2A and -2B cDNA is relatively 
30 low when the DNA is not amplified. Higher levels of BMP-2A protein expression in CHO cells have been 

obtained by amplification to a high copy number using methotrexate selection of dihydrofolate reductase. 

Wang et al., Proc. Natl. Acad. Sci. USA , 87: 2220-2224 (1990). 

Confirmation of the osteogenic activity of BMPs and commercial production thereof depend on the 

ability to produce useful amounts of active material by recombinant means of expression and development 
35 of methods to purify them in an active form. The ability to successfully reconstitute endochondral bone 

formation remains the standard by which to judge the osteogenic character of candidate factors. The 

biological activities of BMP-2A, BMP-3, and an unrelated molecule. BMP-1. were originally assessed in an 

implant model using material expressed in COS cells, resulting in only cartilage formation. Wozney et al., 

supra. More recently, the partially purified BMP-2A expressed in CHO cells was shown to require a dose of 
40 at least 600 ng/implant to Induce cartilage and bone formation. Wang et al.. 1990, supra. The osteogenic 

activities of BMP-2B and BMP-3 have not been established. 

It is an object of the present invention to provide purified BMP-2B in sufficient quantities to test for its 

osteogenic activity, and to produce it on a commercial scale. 

It is another object to improve the expression levels of BMP-2 DNA in mammalian cells without 
45 amplifying the DNA. 

It is still another object to achieve higher production of BMP-2 protein than was previously attained at a 
level of amplification equivalent to that previously employed. 

These and other objects will be apparent to those of ordinary skill in the art of molecular biology. 

50 Summary of the Invention 

Accordingly, this invention provides a DNA construct comprising DNA encoding a mature BMP-2 
upstream of which is DNA encoding a precursor portion of a mammalian protein other than that of BMP-2. 
Preferably, the precursor portion has at least 25% amino acid sequence identity to the native precursor 
55 portion of the BMP-2 in the region spanning the N-terminus of the BMP-2 precursor to the first cysteine 
residue in the mature BMP-2. 

In another aspect, this invention provides an expression vector comprising the above-described DNA 
construct and hosts transformed with such a vector. 



3 



EP 0 531 448 B1 



In a method for expressing DNA encoding a BMP-2 in mammalian cells, this invention also furnishes 
the improvement which comprises employing as the host the host transformed with the vector described 
above. 

Additionally, this invention provides a method for producing BMP-2 by culturing mammalian host cells 
5 transfected with the expression vector described above, the cells being capable of expressing the DNA 
construct of the vector, and recovering mature BMP-2 from the cells. Preferably, the recovery is from the 
host cell media (in which case the expression vector contains a signal sequence, whether native to the 
precursor or BMP-2 or heterologous to the precursor or BMP-2, that directs secretion of the mature BMP-2 
to the medium). 

10 The result of this method is dramatically improved expression levels of BMP-2 DNA in mammalian cells 
over that attainable using the BMP-2 precursor portion that is native to the BMP-2 to be produced. 

Brief Description of the Drawings 

T5 Figure 1 depicts the amino acid sequences of BMP-2A and BMP-2B and indicates the regions of 
sequence identity. The junction between the precursor portions and mature portions is shown by a vertical 
line with two arms. 

Figure 2 depicts the complete amino acid sequence of the chimera of the precursor portion of BMP-2A 
and the mature region of BMP-2B. 

20 Figure 3A depicts expression plasmid pRK5.bmp2/4-1.1. and Figure 3B depicts the junction region of 
the BMP-2A/2B hybrid insert. A portion of an alignment of BMP-2A and BMP-2B is shown with identical 
residues boxed. The coding sequence resulting from fusion of BMP-2A and BMP-2B is shaded showing the 
crossover point. The underlined sequence with an arrow indicates sequence confirmed by Edman degrada- 
tion of purified recombinant BMP-2B. 

25 Figure 4 depicts a fluorogram of an SDS-PAGE reducing gel of supernatants from human embryonic 
kidney cell line transfections with DNA encoding either the native BMP-2A molecule (lane 1), the chimeric 
BMP-2A/2B molecule (lane 2), the native BMP-2B molecule (lane 3), control pRK5 plasmid (lane 4), or no 
plasmid (lane 5). Figure 5 depicts graphs of calcium content (Fig. 5A) and alkaline phosphatase content 
(Fig. 5B) of implants in rats (harvested at 12 days) of demineralized bone powder (DBP) or guanidine-HCI- 

30 extracted DBP reconstituted with the indicated anriounts of mature recombinant BMP-2B or TGF-jS. The 
solid and cross-hatched bars presented for two doses are duplicate runs. 

Description of the Preferred Embodiments 

36 Definitions 

As used herein, the term "BMP-2" refers to the family of bone morphogenetic proteins of the type 2, 
derived from any species. Reference to BMP-2 herein Is understood to be a reference to any one of the 
currently identified forms, Including BMP-2A and BMP-2B (formerly called BMP-4) described by Wozney et 

40 al., supra, and WO 88/00205, supra, the sequences of which are shown in Figure 1, as well as to BMP-2 
species identified in the future. The term "BMP-2" also includes polypeptides derived, from the sequence of 
any known BMP-2 whose mature sequence is at least about 75% homologous with the sequence of a 
mature BMP-2, including DPP-C. Members of the BMP-2 family appear to be encoded as a larger precursor 
that shares a region of high homology near the N-terminus. 

45 As used herein, "precursor portion" refers to the polypeptide sequence derived from a prepro- 
mammalian protein representing either the pro-domain or prepro-domain without the mature protein. 
Candidate mammalian proteins having such precursor portions are those encoded as larger precursors that 
typically contain a signal sequence at their N-terminus followed by a dibasic amino acid cleavage site and a 
pro-region, followed by another dibasic amino acid cleavage site and the mature region of the protein. Thus, 

50 the precursor portion is that which is N-terminal to the mature N-terminus of the mammalian protein and 
may include the signal sequence for secretion of that protein. Preferably, the mammalian protein from which 
the precursor portion is derived is a member of the TGF-^ supergene family, as described above. 
Examples of suitable precursor portions are those wherein the signal sequence is followed by a sequence 
that represents a polypeptide region that after cleavage reassociates with the mature protein covalently or 

55 non-covalently, as in the case of insulin, relaxin, inhibin, activin, and TGF-/3. 

The expression "at least 25% amino acid sequence identity to the native precursor portion of the BMP- 
2 from the N-terminus of the BMP-2 precursor to the first cysteine residue in the mature region of the BMP- 
2" refers to a precursor portion that shares this minimum sequence identity to the relevant portion of the 



4 



EP 0 531 448 B1 



BMP-2 DNA being expressed. This sequence Identity can be readily calculated for BMP-2A and BMP-2B 
from the entire amino acid sequences shown in Figure 1. As examples, the precursor portion of BMP-2A 
shares 55% amino acid sequence identity to the native precursor portion of BMP-2B from the N-terminus of 
the BMP-2B precursor to the first cysteine residue in the mature region of the BMP-2B molecule, and vice- 

6 versa. The precursor of the protein vgr [Lyons et al., Proc. Natl. Acad. Scl. USA , 86: 4554-4558 (1989)], 
which is related to the product of an amphibian gene vgl expressed in frog oocytes, shares 25% homology 
with the relevant portion of BMP-2B. The protein decapenta-plegic gene complex from Drosophila , DPP-C 
[Padgett et al. Nature , 325 : 81-84 (1987)], shares 27% and 28% amino acid sequence identity with the 
relevant portions of BMP-2A and BMP-2B, respectively. Most preferred herein is the use of the BMP-2A 

70 prepro-domain as the precursor portion for secreting mature BMP-2B. 

Modes for Carrying Out the Invention 

The vectors and methods disclosed herein are suitable for use for expression in a wide range of 

75 mammalian host cell lines. 

In general, prokaryotes such as, e.g., E. coll strains are preferred for cloning, amplifying, or storing the 
vectors of interest. Vector DNA is easily obtainable from certain prokaryotes. E. coU K12 strain MM 294 
(ATCC No. 31,446) is particularly useful for this purpose, as are E. coli B and E. coli XI 776 (ATCC No. 
31,537). In general, plasmid vectors containing replicon and control sequences that are derived from 

20 species compatible with the host cell are used in connection with these prokaryotic hosts. The vector 
ordinarily carries a replication site, as well as marking sequences that are capable of providing phenotypic 
selection in transformed cells. For example, E. coli is typically transformed using pBR322. a plasmid 
derived from an E. coli species [see, e.g., Bolivar et al.. Gene , 2: 95 (1977)]. pBR322 contains genes for 
ampicillin and tetracycline resistance and thus provides easy means for identifying transformed cells. The 

25 pBR322 plasmid, or other microbial plasmid or phage, must also contain, or be modified to contain, 
promoters that can be used by the microbial organism for expression of the selectable marker genes. 

Cultures of cells derived from mammalian organisms are useful as expression hosts using tissue culture 
methods [ Tissue Culture , Academic Press, Kruse and Patterson, editors (1973)]. Examples of such useful 
host cell lines include monkey kidney CVI line transformed by SV40 sequences (COS-7, ATCC CRL 1651); 

30 human embryonic kidney line [293. Graham et al., J. Gen. Virol. , 36: 59 (1977)]; baby hamster kidney cells 
(BHK. ATCC CCL 10); Chinese hamster ovary cells [CHO, Uriaub and Chasin, Proc. Natl. Acad. Sci. USA , 
77: 4216 (1980)]; mouse Sertoli cells [TM4, Mather, Biol. Reprod. , 23: 243-251 (1980)]; monkey kidney cells 
(CVI, ATCC CCL 70): African green monkey kidney cells (VERO-76, ATCC CRL-1587); human cervical 
carcinoma cells (HELA, ATCC CCL 2); canine kidney cells (MDCK. ATCC CCL 34); buffalo rat liver cells 

35 (BRL 3A, ATCC CRL 1442); human lung cells (W138. ATCC CCL 75); human liver cells (Hep G2, HB 8065); 
mouse mammary tumor cells (MMT 060562, ATCC CCL51); rat hepatoma cells [HTC, Ml .54. Baumann et 
al., J. Cell. Biol. , 85: 1-8 (1980)]; and TRI celts [Mather et al.. Annals N.Y. Acad. Sci. , 383 : 44-68 (1982)]. 
The most preferred mammalian hosts herein are CHO and 293 cell lines. 

Expression vectors for such cells ordinarily will contain control regions, which are specific sequences at 

40 the 5' and 3' ends of eukaryottc genes that may be involved in the control of either transcription, RNA 
processing, or translation. At the 3' end of most eukaryotic genes is an AATAAA sequence that signals 
processing of the mRNA for polyadenylation addition. 

Thus, the vector will typically include a promoter located in front of the gene to be expressed, 
polyadenylation sites, and transcriptional terminator sequences, all described in further detail herein. The 

45 vector may optionally also include an origin of replication. Further, the vector may contain, after the 
promoter, a transcription initiation site located in front of an optional splice unit, which is in turn located 
before the encoding gene. 

Examples of suitable mammalian expression vectors are found in EP 307.247; 260,148; 309,237; and 
307,248- 

50 For use in mammalian cells, the control functions on the expression vectors are often provided by viral 
material. For example, commonly used promoters are derived from the genomes of polyoma, Adenovirus2, 
retroviruses, cytomegalovirus, and Simian Virus 40 '(SV40). Other promoters are those from heterologous 
sources, e.g., the beta actin promoter. The early and late promoters of SV40 virus are particularly useful 
because both are obtained easily from the virus as a fragment that also contains the SV40 viral origin of 

55 replication [Fiers et al., Nature . 273: 113 (1978)]. Smaller or larger SV40 fragments may also be used, 
provided there is included the approximately 250-bp sequence extending from the Hindlll site toward the 
Bgl l site located in the viral origin of replication. The immediate early promoter of the human 
cytomegalovirus is conveniently obtained as a Hindlll restriction fragment. Greenaway et al.. Gene , 18: 355- 



5 



EP 0 531 448 B1 



360 (1982). Further, it is also possible, and often desirable, to utilize promoter or control sequences 
nornnally associated with the desired gene sequence, provided such control sequences are compatible with 
the host cell systems. 

Transcription of a DNA encoding a desired heterologous polypeptide by higher eukaryotes is increased 
6 by inserting an enhancer sequence into the vector. The enhancer is a cis-acting element of DNA, usually 
about from 10 to 300 bp, that acts on a promoter to enhance its transcription-initiation activity. Enhancers 
are relatively orientation and position independent, having been found 5', [Laimins et al., Proc. Natl. Acad. 
Sci. USA , 78: 993 (1981)] and 3* [Lusky et al., Mol. Cell Bio. . 3: 1108 (1983)] to the transcription unit, within 
an intron [Banerji et al.. Cell, 33: 729 (1983)] as well as within the coding sequence itself [Osborne et al.. 
Mol. Cell Bio. . 4: 1293 (1984)]. Preferably, however, the enhancer element is located upstream of the 
promoter sequence for this invention.. Many enhancer sequences are now known from mammalian genes 
(globin, elastase, albumin, a-fetoprotein, and insulin). Typically, however, one will use an enhancer from a 
eukaryotic cell virus. Examples include the SV40 enhancer on the late side of the replication origin (bp 100- 
270), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication 
75 origin, and adenovirus enhancers. One preferred enhancer is the SV40 enhancer region. 

Expression vectors used in mammalian host cells will also contain polyadenylation sites. Examples of 
polyadenylation regions are those derived from viruses such as. e.g., the SV40 (early and late) or HBV. 

An origin of replication may be provided either by construction of the vector to include an exogenous 
origin, such as may be derived from SV40 or other viral (eg.. Polyoma, Adeno, VSV, BPV) source, or may 
20 be provided by the host cell. If the vector is integrated into the host cell chromosome, the latter is often 
sufficient. 

The expression vectors may suitably contain a selection gene, also termed a selectable marker. A 
selection gene encodes a protein necessary for the survival or growth of a host cell transformed with the 
vector. Examples of suitable selectable markers for mammalian cells include dihydrofolate reductase 
26 (DHFR), thymidine kinase (TK), or neomycin. When such selectable markers are successfully transferred 
into a mammalian host cell, the transformed mammalian host cell can survive if placed under selective 
pressure. 

There are two widely used distinct categories of selective regimes. The first category is based on the 
metabolism of a celt and the use of a mutant cell line that lacks the ability to grow independent of a 

30 supplemented medium. Two examples are CHO DHFR" cells and mouse LTK" cells. These cells lack the 
ability to grow without the addition of such nutrients as thymidine or hypoxanthine. Because these cells lack 
certain genes necessary for a complete nucleotide synthesis pathway, they cannot survive unless the 
missing nucleotides are provided in a supplemented medium. An alternative to supplementing the medium 
is to introduce an intact DHFR or TK gene into cells lacking the respective genes, thus altering their growth 

36 requirements. Individual cells that were not transformed with the DHFR or TK gene will not be capable of 
survival in non-supplemented medium. Therefore, direct selection of those cells requires cell growth in the 
absence of supplemental nutrients. 

The second category is dominant selection, which refers to a selection scheme that does not require 
the use of a mutant cell line. This method typically employs a drug to arrest growth of a host cell. Those 

40 cells that have a novel gene would express a protein conveying drug resistance and would survive the 
selection. Examples of drugs used in dominant selection include neomycin [Southern and Berg, J. Molec. 
Appl. Genet. , V. 327 (1982)], mycophenolic acid [Mulligan and Berg, Science , 209 : 1422 (1980)]. or 
hygromycin [Sugden et al., Mol. Cell. Biol. . 5: 410-413 (1985)]. The three examples given above employ 
bacterial genes under eukaryotic control to convey resistance to the appropriate drug, i.e., neomycin (641 8 

45 or geneticin), xgpt (mycophenolic acid), or hygromycin, respectively. 

Extremely good amounts of polypeptide are produced by transiently transfected cell cultures using the 
method of this invention. It is also expected that stable transformants would result in higher production 
levels of the BMP-2 than transformants with the native proBMP-2 sequence. Furthermore, the process 
herein is expected to enhance production levels further when the cells are cotransfected with a separate 

50 vector encoding a secondary coding sequence. One secondary coding sequence comprises dihydrofolate 
reductase (DHFR) that is affected by an externally controlled parameter, such as methotrexate (MTX), thus 
permitting control of expression by control of the MTX concentration. 

Typical Methodology Employable 

55 

Construction of suitable vectors containing the desired coding and control sequences employs standard 
recombinant techniques. Isolated plasmids or DNA fragments are cleaved, tailored, and re-tigated to form 
the desired plasmid. 



6 



EP 0 531 448 B1 



If flush ends are required, the cleaved DNA preparation may be treated for 30 minutes at 37 • C with 
DNA Polymerase I (Klenow fragment) or T4 DNA polymerase, phenol-chloroform extracted, and ethanol 
precipitated. 3' protruding ends are removed by the 3' to 5' exonucleolytic activity of either enzyme, and 
the 5* protruding ends are made flush by the 5' to 3' polymerase activity incorporating complementary 
6 nucleotide until the end of the fragment Is reached. 

Size separation of the cleaved . fragments may be performed using 6 percent polyacrylamide gel 
described by Goeddel et al., Nucleic Acids Res. , 8: 4057 (1980). 

For analysis to confirm correct sequences in plasmids constructed, the ligation mixtures are typically 
used to transform E, coll K12 strain 294 (ATCC 31,446) or other suitable E. coli strains, and successful 
10 transformants selected by ampicillin or tetracycline resistance where appropriate. Plasmids from the 
transformants are prepared and analyzed by restriction mapping and/or DNA sequencing by the method of 
Messing et al., Nucleic Acids Res. , 9: 309 (1981) or by the method of Maxam et al., Meth. Enzym , 65: 499 
(1980). 

If amplification of the sequences is desired, DHFR-protein-coding DNA sequences are introduced into 
75 the mammalian cell host and stable transfectants are selected in the medium. The host cell cultures are 
grown in the presence of approximately 200-500 nM concentrations of methotrexate, a competitive inhibitor 
of DHFR activity. The effective range of concentration is highly dependent, of course, upon the nature of the 
DHFR gene and the characteristics of the host. Clearly, generally defined upper and lower limits cannot be 
ascertained. Suitable concentrations of other folic acid analogs or other compounds that inhibit DHFR could 
20 also be used. MTX itself is, however, convenient, readily available, and effective. 

In order to simplify the examples and claims, certain frequently occurring methods will be referenced 
by shorthand phrases. 

"Transfection" refers to the taking up of an expression vector by a host cell whether or not any coding 
sequences are in fact expressed. Numerous methods of transfection are known to the ordinarily skilled 

25 artisan, for example. CaP04 and electroporation. Successful transfection is generally recognized when any 
indication of the operation of this vector occurs within the host cell. 

"Transformation" means introducing DNA into an organism so that the DNA is replicable, either as an 
extrachromosomal element or by chromosomal integrant. Depending on the host cell used, transformation is 
done using standard techniques appropriate to such cells. The calcium treatment employing calcium 

30 chloride, as described by Cohen. S.N. Proc. Natl. Acad. Sci . (USA), 69: 2110 (1972); Mandel et al., J. Mol. 
Biol. 53:154 (1970); and more recently Liljestrom et al.. Gene . 40: 241-246 (1985), is generally used for 
prokaryotes or other cells that contain substantial cell-wall barriers. For mammalian cells without such cell 
walls, the calcium phosphate precipitation method of Graham and van der Eb. Virology , 52: 456-457 (1978) 
is preferred. General aspects of mammalian cell host system transformations have been described by Axel 

35 in U.S. Pat. No. 4,399,216 issued August 16, 1983. Transformations into yeast are typically carried out 
according to the method of Van Solingen, et al., J. Bact. , 130: 946 (1977) and Hsiao, et al., Proc. Natl. Acad. 
Sci. (USA) 76: 3829 (1979). However, other methods for introducing DNA into cells such as by nuclear 
injection or by protoplast fusion may also be used. 

"Operably linked" refers to juxtaposition such that the normal function of the components can be 

40 performed. Thus, a coding sequence "operably linked" to control sequences refers to a configuration 
wherein the coding sequence can be expressed under the control of these sequences and wherein the DNA 
sequences being linked are contiguous and, in the case of a secretory leader, contiguous and in reading 
phase. For example, DNA for a presequence or secretory leader is operably linked to DNA for a 
polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide; a 

45 promoter or enhancer is operably linked to a coding sequence if it effects the transcription of the sequence; 
or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate 
translation. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, then 
synthetic oligonucleotide adaptors or linkers are used in accordance with conventional practice. 

"Control sequences" refers to DNA sequences necessary for the expression of an operably linked 

60 coding sequence in a particular host organism. The control sequences that are suitable for prokaryotes, for 
example, include a promoter, optionally an operator sequence, a ribosome binding site, and possibly, other 
as yet poorly understood sequences. Eukaryotic cells are known to utilize promoters, polyadenylation 
signals, and enhancers. 

"Expression system" refers to DNA sequences containing a desired coding sequence and control 
55 sequences in operable linkage, so that hosts transformed with these sequences are capable of producing 
the encoded proteins. To effect transformation, the expression system may be included on a vector; 
however, the relevant DNA may then also be integrated into the host chromosome. 



7 



EP 0 531 448 B1 



As used herein, "cell," "cell line," and "cell culture" are used interchangeably and all such designations 
include progeny. Thus, "transfornnants" or "transformed cells" includes the initial transformant and cultures 
derived therefrom without regard for the number of transfers. It is also understood that all progeny may not 
be precisely identical in DNA content, due to deliberate or Inadvertent mutations. Mutant progeny that have 

6 the same functionality as screened for in the originally transformed cell are included. Where distinct 
designations are intended, it will be clear from the context. 

"Plasmids" are designated by a lower case p preceded and/or followed by capital letters and/or 
numbers. The starting plasmids herein are commercially available, are publicly available on an unrestricted 
basis, or can be constructed from such available plasmids in accord with published procedures. In addition, 

70 other equivalent plasmids are known in the art and will be apparent to the ordinary artisan. 

"Digestion" of DNA refers to catalytic cleavage of the DNA with an enzyme that acts only at specific 
nucleotide sequences in the DNA. Such enzymes are called restriction enzymes, and the sequence for 
which each is specific is called a restriction site. The various restriction enzymes used herein are 
commercially available and their reaction conditions, cofactors, and other requirements as established by 

15 the enzyme suppliers are used. Restriction enzymes commonly are designated by abbreviations composed 
of a capital letter followed by other letters representing the microorganism from which each restriction 
enzyme originally was obtained and then a number designating the particular enzyme. In general, about 1 
ug of plasmid or DNA fragment is used with about 1-2 units of enzyme in about 20 ul of buffer solution. 
Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufac- 

20 turer. Incubation of about 1 hour at 37'C is ordinarily used, but may vary in accordance with the supplier's 
instructions. After incubation, protein is removed by extraction with phenol and chloroform, and the digested 
nucleic acid is recovered from the aqueous fraction by precipitation with ethanol. When appropriate, 
digestion with a restriction enzyme is followed by bacterial alkaline phosphatase-mediated hydrolysis of the 
terminal 5' phosphates to prevent the two ends of a DNA fragment from "circularizing," or forming a closed 

25 loop that would impede insertion of another DNA fragment at the restriction site. Unless othenArise stated, 
digestion of plasmids is not followed by 5* terminal dephosphorylation. Procedures and reagents for 
dephosphorylation are conventional [Maniatis et al.. Molecular Cloning : A Laboratory Manual (New York: 
Cold Spring Harbor Laboratory, 1982) pp. 133-134]. 

"Recovery or "isolation" of a given fragment of DNA from a restriction digest means separation of the 

30 digest on polyacrylamide or agarose gel by electrophoresis, identification of the fragment of interest by 
comparison of its mobility versus that of marker DNA fragments of known molecular weight, removal of the 
gel section containing the desired fragment, and separation of the gel from DNA. This procedure is known 
generally. For example, see R. Lawn et al., Nucleic Acids Res. 9: 6103-6114 (1981), and D.Goeddel et al.. 
Nucleic Acids Res. 8: 4057 (1980). 

35 "Ligation" refers to the process of forming phosphodiester bonds between two double-stranded nucleic 
acid fragments [T. Maniatis et al., 1982, supra, p. 146], Unless otherwise provided, ligation may be 
accomplished using known buffers and conditions with 10 units of T4 DNA ligase ("ligase") per 0.5 ug of 
approximately equimolar amounts of the DNA fragments to be ligated. 

"Preparation" of DNA from transformants means isolating plasmid DNA from microbial culture. Unless 

40 otherwise provided, the alkaline/SDS method of Maniatis et al., 1982. supra, p. 90, may be used. 

"Oligonucleotides" are short-length, single- or double- stranded polydeoxynucleotides that are chemi- 
cally synthesized by known methods [such as phosphotriester, phosphite, or phosphoramidite chemistry, 
using solid-phase techniques such as described in EP Pat. Pub. No. 266,032 published May 4, 1988, or via 
deoxynucleoside H-phosphonate intermediates as described by Froehler et al., Nucl. Acids Res. , 14: 5399- 

45 5407 (1986)]. They are then purified on polyacrylamide gels. 

The following example is intended to illustrate specific embodiments now known for practicing the 
invention, but the invention is not to be considered limited thereto. 

EXAMPLE 1 

50 

cDNAs for BMP-2A and BMP-2B were cloned from a human placental cDNA library constructed in 
lambda gtIO [Ullrich et a!.. Nature . 313 : 756-761 (1985)] using oligonucleotide probes based on the human 
nucleotide sequence [Wozney et al., supra] using standard cloning techniques [Sambrook et al., Molecular 
Cloning: A Laboratory Manual . Second Ed. (Cold Spring Harbor Laboratory, New York. 1989)]. The probes 
55 employed were as follows (where the initiator ATG is underlined and the direction from left to right is 5* to 



8 



EP 0 531 448 B1 



BMP-2A Probes 

CGACCAIfiGTGGCCGGGACCCGCTGTCTTCTAGCGTTGCTGCTTCCCCAGGTCCTCCTGG 
5 GCGGCGCG (for 5' end) 

AATGAAAAGGTTGTATTAAAGAACTATCAGGACATGGTTGTGGAGGGTTGTGGGTGTCGC 
(for 3' end) 

70 

BMP-2B Probes 

ATGATTCCTGGTAACCGAATGCTGATGGTCGTTTTATTATGCCAAGTCCTGCTAGGAGGC 
GCGAGCCATGCTAGTTTG (for 5' end) 

CAGGAGATGGTAGTAGAGGGATGTGGGTGCCGCTGAGATCAGGCAGTCCTTGAGGATAG 
ACAG (for 3' end) 

20 

No clones for BMP-3 were found in the human placental cDNA library using a similar approach to that 
above. Several cell, lines were screened for expression of BMP-3 RNA by polymerase chain reaction 
amplification of the RNA [Mullis et al., Cold Spring Harbor Symp. Quant. Biol. , 51^: 263-273 (1986)] using 

26 oligonucleotide primers based on the human nucleotide sequence [Wozney et al., supra]. One positive cell 
line, the NCI-H69 human small-cell lung carcinoma [Gazdar et al.. Cancer Res. , 40: 3502-3507 (1980)] was 
identified. A cDNA library was prepared from the mRNA and screened with oligonucleotide probes using 
standard techniques (Sambrook et al., supra). The probe sequences were as follows (where the direction 
from left to right is 5* to 3'): 

30 AGTGTCCCGCAGCGACGCCGGGAGCCGACGCGCCGCGCGGGTACCTAGCC (for 5' end) 
TACCCTAACATGACAGTAGAGTCTTGCGCTTGCAGATAACCTGGCAAAGA (for 3* end) 

Positive lambda gtIO clones were identified for BMP-2A, BMP-2B. and BMP-3 proteins, and these 
clones were sequenced. The sequenced clones encoding the BMP-2A and BMP-2B full-length proteins 
were digested with Sail. The expression vector pRK5 [EP 307,247 published 3/15/89] was also digested 

35 with Sail and the gel-isolated large fragment was ligated with the cDNA Sail digests encoding each BMP to 
create the expression plasmids pRK5.bmp2a and pRK5.bmp2b. for BMP-2A and BMP-2B, respectively. 

The sequenced clone encoding the BMP-3 full-length protein was digested with EcoRI. pRK5 was also 
digested with gcoRI and the gel-isolated large fragment was ligated with the cDNA EcoRI digest encoding 
BMP-3 to create the expression plasmid pRK5.bmp3. 

40 A human embryonic kidney cell line (293) (Graham et al., supra] was grown to confluence on 60-mm 
plates in F12;DMEM (1:1) medium (Gibco) containing 10% fetal calf serum (FCS) and transfected with one 
of the three BMP expression plasmids by the calcium phosphate method [Gorman, DNA Cloning . Vol. II (ed. 
Glover, D.), 143-190 (IRL, Oxford, 1985)]. More specifically. 5-10 ug of one of the three BMP plasmid DNAs 
was mixed with 1 ug of DNA encoding the VA RNA gene (Thimmappaya et al., Celj, 31: 543 (1982)) and 

45 dissolved in 250 til of 0.25 M CaCb. Added to this (dropwise while vortexing) was 250 ul of 50 mM HEPES 
(pH 7.35), 280 mM NaCi, 1.5 mM NaP04. and the precipitate was allowed to form for 5-10 min. at 25 'C. 
The suspended precipitate was then added to the cells and allowed to settle for 4-5 hours in the incubator. 
The medium was then aspirated off, the cell layer was washed with 5 ml of F12:DMEM (1:1). and 0.5 ml of 
20% glycerol In phosphate-buffered saline (PBS) was added for 30 sec. A total of 5 ml of F12:DMEM (1:1) 

50 containing 10% fetal bovine serum was added, aspirated off. and replenished. 24 to 48 hours later, the 10% 
fetal bovine serum medium was replaced with serum-free F12:DMEM (1:1) minus cysteine and methionine. 
The cells were incubated for 2 hours at 37*C in 5% CO2 in the presence of 200 uCi/ml ^ss-cysteine and 
200 uCi/ml 2^S-methionine. Then the cell layers were washed with PBS and F12:DMEM (1:1) containing 
cysteine and methionine was added and the cells were allowed to incubate for 5-7 hours. Conditioned 

65 medium was then collected, concentrated 5-fold by lyophilization, and loaded on a 15% SDS gel, which was 
soaked with Enhance® (New England Nuclear) gel scintillation fluid, dried, and exposed to film at -80 'C for 
12 hours. Metabolic labeling of the conditioned medium revealed detectable levels of expression that were 
low as compared with transfections of similar vectors containing activin or TGF-/8 cDNAs. 



9 



EP 0 531 448 B1 



Conditioned medium from the cells transfected with BMP-2A, BMP-2B, or BMP-3 was partially purified 
by heparin-Sepharose chromatography as follows. A 5-ml heparin-Sepharose CL6B (Pharmacia) column 
was initially equilibrated with 4 M urea. 20 mM TrisCI at pH 7. Then the conditioned medium In 4 M urea. 
20 mM TrisCI, pH 7, was loaded on the column. After loading, the fractions were eluted stepwise with 0, 0.1. 

5 0.5 and 2.0 M NaCI In 4 M urea, 20 mM TrisCI, pH 7. The bone-forming activity of the fractions of each 
step was assessed in vivo by the method of Sampath and Reddi, supra. Both BMP-2A and BMP-2B 
possessed easily demonstrable activity, but BMP-3 activity was more difficult to demonstrate. Not all 
transfections gave biologically active material. These data suggest that expression levels of BMP-3 are 
substantially lower than those of BMP-2A and BMP-2B using native precursors. 

70 Next, the role of the precursor region on formation and secretion of mature BMP-2B was examined. An 
expression plasmid containing DNA encoding the N-termlnal prodomain of BMP-2A spliced to the C- 
terminal mature growth factor domain of BMP-2B (the sequence of which is shown in Figure 2) was 
assembled. This hybrid BMP-2A/2B construct codes for a protein of 400 amino acids, consisting of residues 
1-268 from BMP-2A and residues 277-409 of BMP-2B. The hybrid was assembled from the BMP-2A 

T5 plasmid (pRK5.bmp2a) by removing the region from the Ball site to the Hindlll site and replacing it with the 
corresponding Ball to Hindlll fragment from the BMP-2B plasmid {pRK5.bmp2b). 

The resulting expression plasmid (designated pRK5.bmp2/4-1.1) is shown in Figure 3A. Nucleotide 
sequencing revealed two differences in the BMP-2A sequence compared to that reported in W088/00205 
supra: a substitution of A for G at base 261 relative to the ATG start codon, which is silent, and an A for T 

20 substitution at base 570 that results in an Arg instead of a Ser at residue 190. (The sequence in Figure 1 
does not reflect the newly found difference at position 190.) The 2A/2B insert sequence is shown in Figure 
38. E. coli MM294 cells transformed with this plasmid (£. coli MM294/pRK5.bmp2/4-1.1) were deposited 
with the American Type Culture Collection on May 23, 1990 under ATCC Accession No. 68.330. 

pRK5.bmp2/4-1.1. as well as pRK5.bmp2a and pRK5.bmp2b for comparative purposes, were used to 

25 transfect 293 cells using the same procedure as described above, and the transfected cells were 
metabolically labeled using the same procedure as described above, except that they were labeled for four 
hours with 250 uCi/ml each of the ^^s-labeled methionine and cysteine. They were then applied to a 10% 
SDS-PAGE gel (reduced) using the procedure described above. Figure 4 is the fluorogram exposed for 12 
hours at -80 'C of this gel (reduced) of conditioned media (5 ul/lane) from the 293 cells transfected with 

30 plasmids containing either BMP-2A (lane 1), BMP-2A/2B (lane 2). BMP-2B (lane 3). control pRK5 plasmid 
(lane 4), or no plasmid (lane 5). 

For the hybrid, strong bands were found at 36 kD and 23 kD corresponding to the pro and mature 
forms, respectively. The full-length BMP-2A construct expressed mostly the 36-kD band of the pro form 
with a small amount of the 18-kD mature form, while for the full-length BMP-2B construct, only a small 

36 amount of the 23-kD mature band was found. Thus, greatly enhanced expression of the DNA encoding the 
BMP-2B mature dimer was observed over expression with the native prodomains. 

Biologically active recombinant BMP-2B homodimers were purified from 3-10 liters of conditioned 
medium from 293 cultures (in 150-mm dishes) transiently transfected with pRK5.bmp2/4-1 .1 and DNA 
encoding the VA RNA gene [Thimmappaya et al., supra) as described above but using 28 ug 

40 pRK5.bmp2/4-l.1 and 8 UQ VA gene per dish. One hour after glycerol shock, the media was replaced with 
serum-free medium [F12:DMEM (1:1) supplemented with 5 ug/ml human transferrin, 10 ug/ml insulin, and 
optionally 10 ng/ml epidermal growth factor, Mather, Biol. Reprod. . 23: 243 (1980)] (20 ml of media in each 
plate). The cells were incubated for 24 hours, the media was harvested, and then fresh medium was added; 
the cells were incubated again for 24 hours, the medium was harvested and fresh medium was added; and 

45 this cycle was repeated once again for a total of three harvests at 24, 48, and 72 hours. 

Under the conditions of harvesting, the BMP-2B accumulates in the medium to about 200 ng/ml, while 
background protein levels remain relatively low, as estimated by the intensity of silver-stained SDS-PAGE 
gels of the conditioned medium. The protein was purified as follows: A 30-ml heparin-Sepharose CL6B 
column (Pharmacia) was initially equilibrated with 4 M urea, 20 mM TrisCI at pH 7. Then the conditioned 

50 medium in 4 M urea, 20 mM TrisCI, pH 7, was loaded on the column. The fractions were eluted with a 500- 
ml gradient of 0 to 0.5 M NaCI in 4 M urea, 20 mM TrisCI, pH 7. One major protein band appeared on the 
SDS-PAGE gel of the pooled fractions, with an estinaated 70-80% purity. 

The pooled fractions were concentrated with an Amicon Centricon® 10 concentrator about 10-fold, then 
diluted about 10-foId with 4 M urea, 20 mM Tris, pH 7. The diluted material was loaded onto a 1-ml 

55 Pharmacia Mono-Q HR 5/5 column and was eluted with a 0 to 0.3 M NaCI gradient (30 ml) in 4 M urea, 20 
mM Tris, pH 7. The peak fractions were pooled, and determined to be about 95% pure by SDS-PAGE. The 
pooled fractions were dialyzed against 0.1 M acetic acid, lyophilized, and redissolved in 1 ml of 0.1 M 
acetic acid. 



10 



EP 0 531 448 B1 



In cases where the purity of the Mono-Q column eluate was judged unsatisfactory, an additional HPLC 
purification step was employed. This step involved loading the pooled fractions from the Mono-Q column 
directly on a Vydac C4 RP-HPLC column (100 x 2.1 mm). The HPLC column was eluted with a 30-ml 
gradient of 0 to 40% N-propanol, 0.1 to 0.06% trifluoroacetic acid. The pooled material from this third step 

5 was approximately 95% pure, as judged by SDS gel electrophoresis. This material was lyophilized and 
redissolved as described above. Final yield of purified mature BMP-2B was determined by quantitative 
amino acid analysis; the preparation with the three steps yielded 10 ug/liter of conditioned medium, or 
approximately 5% overall based on SDS gel analysis. 

N-terminal amino acid sequencing of the purified mature BMP-26 showed a single amino terminal 

10 sequence beginning at residue 285 of BMP-2A/2B (residue 294 of BMP-2B). Sequence data was collected 
for 18 cycles, and matched exactly that shown underlined in Fig. 3B. No minor sequence was observed. 
The prominent 36-Kd band observed in the SDS gel of the transfected supernatants was identified as the 
pro region by amino terminal sequencing after transfer to PVDV membranes. Cleavage of the signal 
sequence between residues 23 and 24 (...LLGGAAGI LVPELGRRKFAAA) was as predicted by the weight 

76 matrix method of von Heijne, Nucl. Acid Res. , 144: 683-690 (1986). No cleavage at the nearby RRK 
sequence was observed. 

Recombinant BMP-2B is a disulfide-linked dimer, as shown by a decrease in apparent molecular weight 
on SDS gel electrophoresis from 33 Kd in the absence of reductants to 23 Kd in the presence of reductants. 
BMP-2B has two consensus sites for N-glycosylation. 

20 The HPLC-purified recombinant BMP-2B was tested in the bone formation assay of Reddi and 
Sampath, supra, along with TGF-)3 and a control. In this assay the implants placed into rats were 25 mg 
demineralized bone powder (DBP) or 25 mg guanidine-HCI-extracted DBP reconstituted with 0, 0.5, 2.0, or 
6.0 ug of the purified recombinant BMP-2B or 1 ug recombinant mature human TGF-^1 (U.S. Pat. No. 
4,886,747 issued December 12, 1989). The implants were harvested at 12 days, and the calcium content 

25 (Fig. 5A) was measured by atomic absorption spectrophotometry and the alkaline phosphatase content (Fig. 
5B) was measured by hydrolysis of p-nitrophenyl phosphate. Duplicate experiments of the 0.5 and 2.0 
doses of BMP-2B indicated by solid and cross-hatched bars in Fig. 5 were performed. 

A significant increase in calcium content (even over DBP, which contains some BMP) was seen with the 
2 ug dose of BMP-2B, while the 0.5 ug dose was sufficient to increase alkaline phosphatase. After a 12-day 

30 harvest, implants of guanidine-HCI-extracted DBP alone or reconstituted with 1 ug of purified recombinant 
BMP-2B were fixed and mounted without decalcification. Three-micron sections were cut and stained with 
haematoxylin and eosin. Microscopic examination of these stained sections showed abundant bone 
formation in implants reconstituted with BMP-2B as indicated by the presence of calcium deposits. Implants 
reconstituted with vehicle alone did not form bone. 

36 A construct of the BMP-2A prodomain with the BMP-3 mature region prepared as described above (by 
replacing the small Ball to Hind I II fragment of pRK5.bmp2a with the corresponding Ball-Hindlll fragment 
from pRK5.bmp3) was transfected into 293 cells as described above. In this case, the expression level was 
no better than the expression levels of the native prosequences for BMP-2A and BMP-3. This experiment 
shows that the BMP-2A prodomain does not improve expression levels of every member of the entire BMP 

40 family, but rather is effective in enhancing expression of DNA encoding the BMP-2 family. 

The ability of the heterologous precursor region to improve secretion of the biologically active dimer 
may reflect a preference of the BMP-2A precursor region for the BMP-2B mature growth factor sequence. It 
certainly indicates the importance of the precursor region in proper expression and folding of the 
biologically active mature dimer form in the BMP-2 family. 

45 

Deposit of Materials 

The following culture has been deposited with the American Type Culture Collection, 12301 Parklawn 
Drive, Rockville, MD, USA (ATCC): 

50 



Strain 


ATCC Dep. No. 


Deposit Date 


MM294/pRK5.bmp2/4-1 .1 


68,330 


May 23, 1990 



This deposit was made under the provisions of the Budapest Treaty on the International Recognition of 
the Deposit of Microorganisms for the Purpose of Patent Procedure and the Regulations thereunder 
(Budapest Treaty). This assures maintenance of a viable culture for 30 years from the date of deposit. The 
organism will be made available by ATCC under the terms of the Budapest Treaty, and subject to an 



11 



EP 0 531 448 B1 



agreement between Genentech, Inc. and ATCC, which assures permanent and unrestricted availability of 
the progeny of the culture to the public upon issuance of the pertinent U.S. patent or upon laying open to 
the public of any U.S. or foreign patent application, whichever comes first, and assures availability of the 
progeny to one determined by the U.S. Commissioner of Patents and Trademarks to be entitled thereto 

5 according to 35 USC § 122 and the Commissioner's rules pursuant thereto (including 37 CFR § 1.14 with 
particular reference to 886 OG 638). 

In respect of those designations in which a European patent is sought, a sample of the deposited 
microorganism will be made available until the publication of the mention of the grant of the European 
patent or until the date on which the application has been refused or withdrawn or is deemed to be 

70 withdrawn, only by the issue of such a sample to an expert nominated by the person requesting the 
sample. (Rule 28(4) EPC) 

The assignee of the present application has agreed that if the culture on deposit should die or be lost 
or destroyed when cultivated under suitable conditions, it will be promptly replaced on notification with a 
viable specimen of the same culture. Availability of the deposited strain is not to be construed as a license 

75 to practice the invention in contravention of the rights granted under the authority of any government in 
accordance with its patent laws. 

The foregoing written specification is considered to be sufficient to enable one skilled in the art to 
practice the invention. The present invention is not to be limited in scope by the construct deposited, since 
the deposited embodiment is intended as a single illustration of one aspect of the invention and any 

20 constructs that are functionally equivalent are within the scope of this invention. The deposit of material 
herein does not constitute an admission that the written description herein contained is inadequate to enable 
the practice of any aspect of the invention, including the best mode thereof, nor is it to be construed as 
limiting the scope of the claims to the specific illustration that it represents. Indeed, various modifications of 
the invention in addition to those shown and described herein will become apparent to those skilled in the 

26 art from the foregoing description and fall within the scope of the appended claims. 



30 



36 



40 



45 



50 



55 



12 



EP 0 531 448 B1 



SEQUENCE LISTING 

(1) GENERAL INFORMATION: 

(i) APPLICANT: GENENTECH, INC. 
(ii) TITLE OF INVENTION: Manunalian Expression of the BMP-2 Family 
(iii) NUMBER OF SEQUENCES: 12 

(iv) CORRESPONDENCE ADDRESS: 

(A) ADDRESSEE: Genentech, Inc. 

(B) STREET: 460 Point San Bruno Blvd 

(C) CITY: South San Francisco 

(D) STATE: California 

(E) COUNTRY: USA 

(F) ZIP: 94080 

(V) COMPUTER READABLE FORM: 

(A) MEDIUM TYPE: 5,25 inch, 360 Kb floppy disk 

(B) COMPUTER: IBM PC compatible 

(C) OPERATING SYSTEM: PC-DOS/MS-DOS 

(D) SOFTWARE: pat in (Genentech) 

(vi) CURRENT APPLICATION DATA: 

(A) APPLICATION NUMBER: 

(B) FILING DATE: 

(C) CLASSIFICATION: 

(vii) PRIOR APPLICATION DATA: 

(A) APPLICATION NUMBER: U.S. Ser. No. 07/528,300 

(B) FILING DATE: 24 May 1990 

(viii) ATTORNEY /AGENT INFORMATION: 
<A) NAME: Hasak, Janet £. 
<B) REGISTRATION NUMBER: 28,616 

(C) REFERENCE/DOCKET NUMBER: 623 

(ix) TELECOMMUNICATION INFORMATION: 
<A) TELEPHONE: 415/266-1896 

(B) TELEFAX: 415/952-9881 

(C) TELEX: 910/371-7168 

(2) INFORMATION FOR SEQ ID N0:1: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 68 bases 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY; linear 

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:1: 



CGACCATGGT GGCCGGGACC CGCTGTCTTC TAGCGTTGCT GCTTCCCCAG 50 



GTCCTCCTGG GCGGCGCG 68 



(2) INFORMATION FOR SEQ ID NO: 2: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 60 bases 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 



13 



EP 0 531 448 B1 



(xi) SEQUENCE DESCRIPTION: SEQ ID N0:2: 



AATGAAAAGG TTGTATTAAA GAACTATCAG GACATGGTTG TGGAGGGTTG 50 



TGGGTGTCGC 60 



(2) INFORMATION FOR SEQ ID NO: 3: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 78 bases 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3: 



ATGATTCCTG GTAACCGAAT GCTGATGGTC GTTTTATTAT GCCAAGTCCT 50 



GCTAGGAGGC GCGAGCCATG CTAGTTTG 78 



(2) INFORMATION FOR SEQ ID NO: 4: 

(i) SEQUENCE CHARACTERISTICS: 
(A) LENGTH: 63 bases 
<B) TYPE; nucleic acid 

(C) STRANDEDNESS: single 

( D ) TOPOLOGY : 1 inear 

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:4: 



CAGGAGATGG TAGTAGAGGG ATGTGGGTGC CGCTGAGATC AGGCAGTCCT 50 



TGAGGATAGA CAG 63 



(2) INFORMATION FOR SEQ ID NO: 5: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 50 bases 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: 



AGTGTCCCGC AGCGACGCCG GGAGCCGACG CGCCGCGCGG GTACCTAGCC 50 



(2) INFORMATION FOR SEQ ID NO: 6: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 50 bases 

(B) TYPE: nucleic acid 

(C) STRANDEDNESS: single 

(D) TOPOLOGY: linear 



14 



EP 0 531 448 B1 



(xi) SEQUENCE DESCRIPTION: SEQ ID N0:6: 

TACCCTAACA TGACAGTAGA GTCTTGCGCT TGCAGATAAC CTGGCAAAGA 50 

5 

(2) INFORMATION FOR SEQ ID NO: 7: 

(i) SEQUENCE CHARACTERISTICS: 
(A) LENGTH: 20 amino acids 
70 (B) TYPE: amino acid . 

(D) TOPOLOGY: linear 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7; 

Leu Leu Gly Gly Ala Ala Gly Leu Val Pro Glu Leu Gly Arg Arg 
1 5 10 15 

Lye Phe Ala Ala Ala 
20 



76 



(2) INFORMATION FOR SEQ ID NO: 8: 

(i) SEQUENCE CHARACTERISTICS: 
20 (A) LENGTH: 396 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8: 

Met Val Ala Gly Thr Arg Cys Leu Leu Ala Leu Leu Leu Pro Gin 
25 . I 5 10 15 

Val Leu Leu Gly Gly Ala Ala Gly Leu Val Pro Glu Leu Gly Arg 
20 25 30 



Arg Lys Phe Ala Ala Ala Ser Ser Gly Arg Pro Ser Ser Gin Pro 

35 40 45 

Ser Asp Glu Val Leu Ser Glu Phe Glu Leu Arg Leu Leu Ser Met 

50 55 60 

Phe Gly Leu Lys Gin Arg Pro Thr Pro Ser Arg Asp Ala Val Val 

65 70 75 

Pro Pro Tyr Met Leu Asp Leu Tyr Arg Arg His Ser Gly Gin Pro 

80 85 90 

Gly Ser Pro Ala Pro Asp His Arg Leu Glu Arg Ala Ala Ser Arg 

95 100 105 

Ala Asn Thr Val Arg Ser Phe His His Glu Glu Ser Leu Glu Glu 

110 115 120 

Leu Pro Glu Thr Ser Gly Lys Thr Thr Arg Arg Phe Phe Phe Asn 

125 130 135 

Leu Ser Ser lie Pro Thr Glu Glu Phe lie Thr Ser Ala Glu Leu 

45 140 145 150 

Gin Val Phe Arg Glu Gin Met Gin Asp Ala Leu Gly Asn Asn Ser 

155 160 165 



30 



35 



40 



50 



Ser Phe His His Arg lie Asn lie Tyr Glu lie He Lys Pro Ala 
170 175 180 

Thr Ala Asn Ser Lys Phe Pro Val Thr Ser Leu Leu Asp Thr Arg 



56 



15 



EP 0 531 448 B1 



185 190 195 

Leu Val Asn Gin Asn Ala Ser Arg Trp Glu Ser Phe Asp Val Thr 
200 205 210 

Pro Ala Val Met Arg Trp Thr Ala Gin Gly His Ala Aen His Gly 
215 220 225 

Phe Val Val Glu Val Ala His Leu Glu Glu Lya Gin Gly Val Ser 
230 235 240 

Lya Arg His Val Arg He Ser Arg Ser Leu Hia Gin Asp Glu His 
245 250 255 

Ser Trp Ser Gin He Arg Pro Leu Leu Val Thr Phe Gly His Asp 
260 265 270 

Gly Lys Gly His Pro Leu Hie Lys Arg Glu Lys Arg Gin Ala Lys 
275 280 285 

His Lys Gin Arg Lye Arg Leu Lys Ser Ser Cys Lya Arg His Pro 
290 295 300 

Leu Tyr Val Asp Phe Ser Asp Val Gly Trp Asn Asp Trp He Val 
305 310 315 

Ala Pro Pro Gly Tyr His Ala Phe Tyr Cys His Gly Glu Cys Pro 
320 325 330 

Phe Pro Leu Ala Asp His Leu Asn Ser Thr Asn His Ala He Val 
335 340 345 

Gin Thr Leu Val Asn Ser Val Asn Ser Lys He Pro Lys Ala Cys 
350 355 360 

Cys Val Pro Thr Glu Leu Ser Ala He Ser Met Leu Tyr Leu Asp 
365 370 375 

Glu Asn Glu Lys Val Val Leu Lys Asn Tyr Gin Asp Met Val Val 
380 385 390 

Glu Gly Cys Gly Cys Arg 
395 396 

(2) INFORMATION FOR SEQ ID NO: 9: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 409 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:9: 

Met He Pro Gly Asn Arg Met Leu Met Val Val Leu Leu Cys Gin 
15 10 15 

Val Leu Leu Gly Gly Ala Ser His Ala Ser Leu He Pro Glu Thr 
20 25 30 

Gly Lys Lys Lys Val Ala Glu He Gin Gly His Ala Gly Gly Arg 
35 40 45 

Arg Ser Gly Gin Ser His Glu Leu Leu Arg Asp Phe Glu Ala Thr 
50 55 60 

Leu Leu Gin Met Phe Gly Leu Arg Arg Arg Pro Gin Pro Ser Lys 
65 70 75 



16 



EP 0 531 448 B1 



70 



Ser Ala Val lie Pro Asp Tyr Met Arg Asp Leu Tyr Arg Leu Gin 
80 85 90 

Ser Gly Glu Glu Glu Clu Glu Gin lie His Ser Thr Gly Leu Glu 
95 100 105 

Tyr Pro Glu Arg Pro Ala Ser Arg Ala Asn Thr Val Arg Ser Phe 
110 115 120 

His Hie Glu Glu His Leu Glu Asn lie Pro Gly Thr Ser Glu Aan 
125 130 135 

Ser Ala Phe Arg Phe Leu Phe Asn Leu Ser Ser lie Pro Glu Asn 
140 145 150 

Glu Val lie Ser Ser Ala Glu Leu Arg Leu Phe Arg Glu Gin Val 
155 160 165 

Asp Gin Gly Pro Asp Trp Glu Arg Gly Phe His Arg lie Asn lie 
170 175 180 

Tyr Glu Val Met Lys Pro Pro Ala Glu Val Val Pro Gly Hie Leu 
185 190 195 

He Thr Arg Leu Leu Asp Thr Arg Leu Val His His Asn Val Thr 
200 205 210 

Arg Trp Glu Thr Phe Asp Val Ser Pro Ala Val Leu Arg Trp Thr 
215 220 225 

Arg Glu Lys Gin Pro Asn Tyr Gly Leu Ala He Glu Val Thr His 
25 230 235 240 

Leu His Gin Thr Arg Thr His Gin Gly Gin His Val Arg He Ser 
245 250 255 



75 



20 



30 



35 



40 



45 



50 



Arg Ser Leu Pro Gin Gly Ser Gly Asn Trp Ala Gin Leu Arg Pro 

260 265 270 

Leu Leu Val Thr Phe Gly His Asp Gly Arg Gly Hie Ala Leu Thr 

275 280 285 

Arg Arg Arg Arg Ala Lys Arg Ser Pro Lys His His Ser Gin Arg 

290 295 300 

Ala Arg Lys Lys Asn Lys Asn Cys Arg Arg His Ser Leu Tyr Val 

305 310 315 

Asp Phe Ser Asp Val Gly Trp Asn Asp Trp He Val Ala Pro Pro 

320 325 330 

Gly Tyr Gin Ala Phe Tyr Cys His Gly Asp Cys Pro Phe Pro Leu 

335 340 345 

Ala Asp His Leu Asn Ser Thr Aan His Ala He Val Gin Thr Leu 

350 355 360 

Val Asn Ser Val Asn Ser Ser He Pro Lys Ala Cya Cys Val Pro 

365 370 375 

Thr Glu Leu Ser Ala He Ser Met Leu Tyr I*eu Asp Glu Tyr Asp 

380 385 390 

Lys Val Val Leu Lys Asn Tyr Gin Glu Met Val Val Glu Gly Cys 

395 400 405 

Gly Cys Arg 

409 



56 



17 



EP 0 531 448 B1 



{2) INFORMATION FOR SEQ ID NO:10: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 400 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10: 

Met Val Ala Gly Thr Arg Cys Leu Leu Ala Leu Leu Leu Pro Gin 

15 10 15 

Val Leu Leu Gly Gly Ala Ala Gly Leu Val Pro Glu Leu Gly Arg 

20 25 30 

Arg Lye Phe Ala Ala Ala Ser Ser Gly Arg Pro Ser Ser Gin Pro 

35 40 45 

Ser Asp Glu Val Leu Ser Glu Phe Glu Leu Arg Leu Leu Ser Met 

50 55 60 

Phe Gly Leu Lys Gin Arg Pro Thr Pro Ser Arg Asp Ala Val Val 

65 70 75 

Pro Pro Tyr Met Leu Asp Leu Tyr Arg Arg His Ser Gly Gin Pro 

80 85 90 

Gly Ser Pro Ala Pro Asp His Arg Leu Glu Arg Ala Ala Ser Arg 

95 100 105 

Ala Asn Thr Val Arg Ser Phe His His Glu Glu Ser Leu Glu Glu 

110 115 120 

Leu Pro Glu Thr Ser Gly Lys Thr Thr Arg Arg Phe Phe Phe Asn 

125 130 135 

Leu Ser Ser lie Pro Thr Glu Glu Phe lie Thr Ser Ala Glu Leu 

140 145 150 

Gin Val Phe Arg Glu Gin Met Gin Asp Ala Leu Gly Asn Asn Ser 

155 160 165 

Ser Phe His His Arg lie Asn He Tyr Glu He He Lys Pro Ala 

170 175 180 

Thr Ala Asn Ser Lys Phe Pro Val Thr Arg Leu Leu Asp Thr Arg 

185 190 195 

Leu Val Asn Gin Asn Ala Ser Arg Trp Glu Ser Phe Asp Val Thr 

200 205 210 

Pro Ala Val Met Arg Trp Thr Ala Gin Gly His Ala Asn His Gly 

215 220 225 

Phe Val Val Glu Val Ala His Leu Glu Glu Lys Gin Gly Val Ser 

230 235 240 

Lys Arg His Val Arg He Ser Arg Ser Leu His Gin Asp Glu His 

245 250 255 

Ser Trp Ser Gin He Arg Pro Leu Leu Val Thr Phe Gly His Asp 

260 265 270 

Gly Arg Gly His Ala Leu Thr Arg Arg Arg Arg Ala Lys Arg Ser 

275 280 285 

Pro Lys His His Ser Gin Arg Ala Arg Lys Lys A^n Lys Asn Cys 

290 295 300 



18 



EP 0 531 448 B1 



70 



75 



Arg Arg His Ser Leu Tyr Vai Asp Phe Set Asp Val Gly Trp Asn 
305 310 315 

Asp Trp lie Val Ala Pro Pro Gly Tyr Gin Ala Phe Tyr Cys His 
320 325 330 

Gly Asp Cys Pro Phe Pro Leu Ala Asp His Leu Asn Ser Thr Asn 
335 340 345 

His Ala He Val Gin Thr Leu Val Asn Ser Val Asn Ser Ser He 
350 355 360 

Pro Lys Ala Cys Cys Val Pro Thr Glu Leu Ser Ala He Ser Met 
365 370 375 

Leu Tyr Leu Asp Glu Tyr Asp Lys Val Val Leu Lys Asn Tyr Gin 
380 385 390 

Glu Met Val Val Glu Gly Cys Gly Cys Arg 
395 400 

(2) INFORMATION FOR SEQ ID NO: 11: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 56 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(xi) SEQUENCE DESCRIPTION: SEQ ID NOrll: 

Lys Arg His Val Arg He Ser Arg Ser Leu His Gin Asp Glu His 
1 5 10 15 

Ser Trp Ser Gin He Arg Pro Leu Leu Val Thr Phe Gly His Asp 
20 25 30 

30 Gly Lys Gly His Pro Leu His Lys Arg Glu Lys Arg Gin Ala Lys 

35 40 45 

His Lys Gin Arg Lys Arg Leu Lys Ser Ser Cys 
50 55 56 



20 



25 



35 



40 



(2) INFORMATION FOR SEQ ID NO: 12: 

(i) SEQUENCE CHARACTERISTICS: 

(A) LENGTH: 60 amino acids 

(B) TYPE: amino acid 
(D) TOPOLOGY: linear 

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 12: 

Gly Gin His Val Arg He Ser Arg Ser Leu Pro Gin Gly Ser Gly 
15 10 15 

Asn Asn Ala Gin Leu Arg Pro Leu Leu Val Thr Phe Gly His Asp 
45 20 25 30 

Gly Arg Gly His Ala Leu Thr Arg Arg Arg Arg Ala Lys Arg Ser 
35 40 45 

Pro Lys His His Ser Gin Arg Ala Arg Lys Lys Asn Lys Asn Cys 
50 5 0 5 5 60 



Claims 

55 Claims for the following Contracting States : AT, BE, CH, DE, DK, FR, GB, GR, IT, LI, LU, NL, SE 

1. A DNA hybrid construct comprising in the 5' to 3* direction a DNA sequence for the precursor portion 
of BMP-2A operably linked to a DNA sequence encoding mature BMP-2B. 



19 



EP 0 531 448 B1 



2. The DNA construct of claim 1 wherein the precursor portion comprises a signal sequence. 

3. The DNA construct of claim 1 or claim 2 wherein both the BMP-2A and BMP-2B are human BMPs. 
5 4. An expression vector comprising the DNA construct of any one of claims 1 to 3. 

5. An expression vector that is pRK5.bmp2/4-1.1, available from deposit ATCC 68,330. 

6. A mammalian host cell transformed with the expression vector of claim 4. 

70 

7. A mammalian host cell transformed with the expression vector of claim 5. 

8. An E.coli host cell transformed with the expression vector of claim 5. 

76 9. A method for expressing DNA encoding mature BMP-2B in mammalian cells, comprising employing the 
host cell of claim 6. 

10. A method for expressing DNA encoding mature BMP-2B in mammalian cells, comprising employing the 
host cell of claim 7. 

20 

Claims for the following Contracting State : ES 

1. A method which comprises construction of DNA hybrid construct comprising in the 5' to 3* direction a 
DNA sequence for the precursor portion of BMP-2A operably linked to a DNA sequence encoding 

25 mature BMP-2B. 

2. The method of claim 1 wherein the precursor portion comprises a signal sequence. 

3. The method of claim 1 or claim 2 wherein both the BMP-2A and BMP-2B are human BMPs. 

30 

4. A method which comprises construction of an- expression vector comprising a DNA hybrid construct 
comprising in the 5* to 3' direction a DNA sequence for the precursor portion of BMP-2A operably 
linked to a DNA sequence encoding mature BMP-2B. 

36 5. A method according to claim 4 wherein the precursor portion comprises a signal sequence. 

6. A method according to claim 4 or claim 5 wherein both the BMP-2A and BMP-2B are human BMPs. 

7. A method comprising transformation of a mammalian host cell with an expression vector comprising a 
40 DNA hybrid construct comprising in the 5* to 3' direction a DNA sequence for the precursor portion of 

BMP-2A operably linked to a DNA sequence encoding mature BMP-2B. 

8. A method according to claim 7 wherein the precursor portion comprises a signal sequence. 

45 9. A method according to claim 7 or claim 8 wherein both the BMP-2A and BMP-2B are human BMPs. 

10. A method comprising transforming a mammalian host cell with expression vector pRK5.bmp 2/4-1.1, 
available from deposit ATCC 68,330. 

50 11. A method comprising transforming a E.coli host celt with expression vector pRK5.bmp 2/4-1.1, available 
from deposit ATCC 68,330. 

12. A method for expressing DNA encoding mature BMP-2B in mammalian cells, comprising employing a 
mammalian host cell transformed with a DNA hybrid construct comprising in the 5* to 3' direction a 

65 DNA sequence for the precursor portion of BMP-2A operably linked to a DNA sequence encoding 
mature BMP-2B. 

13. A method according to claim 12 wherein the precursor portion comprises a signal sequence. 



20 



EP 0 531 448 B1 



14. A method according to claim 12 or clairri 13 wherein both the BMP-2A and BMP-2B are human BMPs. 

15. A method for expressing DNA encoding mature BMP-2B in mammalian cells, comprising employing a 
mammalian host cell transformed with expression vector pRK5.bmp 2/4-1.1, available from deposit 

6 ATCC 68.330. 

PatentansprUche 

Patentanspriiche fur folgende Vertragsstaaten : AT, BE, CH, DE, DK, FR, GB, GR, IT, LI, LU, NL, SE 

70 1. DNA-Hybrid-Konstrukt, das in der 5' zu 3*-Rtchtung eine DNA-Sequenz fur den Vorlauferabschnitt von 
BMP-2A, die operabel mit einer fur reifen BMP-2B kodierenden DNA-Sequenz verbunden ist, aufweist. 

2. DNA-Konstrukt nach Anspruch 1, worin der VorlSuferabschnitt eine Signalsequenz aufweist. 

76 3. DNA-Konstrukt nach Anspruch 1 Oder 2, worin sowohl BMP-2A als auch BMP-2B menschliche BMPs 
sind. 

4. Expressionsvektor, umfassend das DNA-Konstrukt nach einem der Anspruche 1 bis 3. 
20 5. Expressionsvektor, der pRK5.bmp2/4-1.1 ist, erhaltlich vom Depot ATCC 68.330. 

6. Saugetienwirtszelle, transformiert mit dem Expressionvektor nach Anspruch 4. 

7. Saugetierwirtszelle, transformiert mit dem Expressionvektor nach Anspruch 5. 

25 

8. E.coli-Wirtszelle, transformiert mit dem Expressionvektor nach Anspruch 5. 

9. Verfahren zum Exprimieren von fUr reifen BMP-2B kodierender DNA in Saugetierzellen, das die 
Verwendung der Wirtszelle nach Anspruch 6 umfaBt. 

30 

10. Verfahren zum Exprimieren von fur reifen BMP-2B kodierender DNA in Saugetierzellen, das die 
Verwendung der Wirtszelle nach Anspruch 7 umfaBt. 

Patentanspriiche fur folgenden Vertragsstaat : ES 

35 

1. Verfahren, umfassend das Konstruieren eines DNA-Hybrid-Konstrukts, das in der 5' nach 3*-Richtung 
eine DNA-Sequenz fQr den Vorlauferabschnitt von BMP-2A, die operabel mit einer fur reifen BMP-2B 
kodierenden DNA-Sequenz verbunden ist, aufweist. 

40 2. Verfahren nach Anspruch 1, worin der Vorlauferabschnitt eine Signalsequenz aufweist. 

a Verfahren nach Anspruch 1 Oder 2, worin sowohl BMP-2A als auch BMP-2B menschliche BMPs sind. 

4. Verfahren, umfassend das Konstruieren eines Expressionsvektors, umfassend ein DNA-Hybrid-Kon- 
45 strukt, das in der 5' nach 3'-Richtung eine DNA-Sequenz fur den Vorlauferabschnitt von BMP-2A, die 

operabel mit einer fur reifen BMP-2B kodierenden DNA-Sequenz verbunden ist, aufweist. 

5. Verfahren nach Anspruch 4, worin der Vorlauferabschnitt eine Signalsequenz aufweist. 

50 6. Verfahren nach Anspruch 4 oder 5, worin sowohl BMP-2A als auch BMP-2B menschliche BMPs sind. 

7. Verfahren, umfassend die Transforrnation einer Saugetierwirtszelle mit einem Expressionsvektor, um- 
fassend ein DNA-Hybrid-Konstrukt, das in der 5* nach 3*-Richtung eine DNA-Sequenz fur den Vorlau- 
ferabschnitt von BMP-2A, die operabel mit einer fur reifen BMP-2B kodierenden DNA-Sequenz 

56 verbunden ist, aufweist. 

8. Verfahren nach Anspruch 4, worin der Vorlauferabschnitt eine Signalsequenz aufweist. 



21 



EP 0 531 448 B1 



9. Verfahren nach Anspruch 4 oder 5, worin sowohl BMP-2A als auch BMP-2B menschliche BMPs sind. 

10. Verfahren, umfassend das Transformieren einer Saugetterwirtszelle mit dem Expressionsvektor 
pRK5.bmp2/4-1.1, erhSltlich vom Depot ATCC 68.330. 

5 

11. Verfahren, umfassend das Transformieren einer E.coli-Wirtszelle mit dem Expressionsvektor 
pRK5.bmp2/4-1.1, erhaltlich vom Depot ATCC 68.330. 

12. Verfahren zum Exprimieren von fUr reifen BMP-2B kodierender DNA in Saugetierzellen. umfassend die 
10 Verwendung einer Saugetierwirtszelle, die mit einem DNA-Hybrid-Konstrukt, das in der 5* zu 3*- 

Richtung eine DNA-Sequenz fOr den Vorlauferabschnitt von BMP-2A. die operabel mit einer fOr reifen 
BMP-2B kodierenden DNA-Sequenz verbunden ist, aufweist, transformiert wurde. 

13. Verfahren nach Anspruch 12, worin der Vorlauferabschnitt eine Signalsequenz aufweist. 

15 

14. Verfahren nach Anspruch 12 oder 13, worin sowohl BMP-2A als auch BMP-2B menschliche BMPs sind. 

15. Verfahren zum Exprimieren von fur reifen BMP-2B kodierender DNA in Saugetierzellen, umfassend die 
Verwendung einer Saugetierwirtszelle, die mit dem Expressionsvektor pRK5.bmp2/4-1.1, erhSltlich vom 

20 Depot ATCC 68.330, transformiert wurde. 

Revendlcatlons 

Revendicatlons pour les Etats contractants sulvants : AT, BE, CH, DE, DK, FR, GB, GR, IT, LI, LU, 
NL, SE 

26 

1. Produit hybride d'assemblage d'ADN comprenant, dans le sens 5'^ 3*, une sequence d'ADN pour la 
portion servant de precurseur de la BMP-2A llee de maniere fonctionnelle a une sequence d'ADN 
codant pour la BMP-2B mature. 

30 2. Produit d'assemblage d'ADN suivant la revendication 1, dans lequel la portion servant de precurseur 
comprend une sequence signal. 

3. Produit d'assemblage d'ADN suivant la revendication 1 ou la revendication 2, dans lequel la BMP-2A et . 
la BMP-2B sont des BMP humaines. 

36 

4. Vecteur d'expression comprenant le produit d'assemblage d'ADN suivant I'une quelconque des 
revendications 1 a 3. 

5. Vecteur d'expression qui est le pRK5.bmp 2/4-1.1, disponible sous le numdro de d^pot ATCC 68 330. 

40 

6. Cellule-hote de mammif^re, transform^e avec le vecteur d'expression suivant la revendication 4. 

7. Cellule-hote de mammif§re, transform^e avec le vecteur d'expression suivant la revendication 5. 

45 8. Cellule-h6te de E. coli transform^e avec le vecteur d'expression suivant la revendication 5. 

9. Precede pour I'expression d'un ADN codant pour la BMP-2B mature dans des cellules de mammlfere. 
comprenant I'utilisation de la cellule-hote suivant la revendication 6. 

50 10. Proc6d6 pour I'expression d'un ADN codant pour la BMP-2B mature dans des cellules de mammif§re, 
comprenant Tutilisation de la cellule-hote suivant la revendication 7. 

Revendications pour I'Etat contractant suivant : ES 

56 1. Proc^d^ qui comprend la construction d'un produit hybride d'assemblage d'ADN comprenant, dans le 
sens 5' h 3', une sequence d'ADN pour la portion servant de precurseur de la BMP-2A lide de maniere 
fonctionnelle h une sequence d'ADN codant pour la BMP-2B mature. 



22 



EP 0 531 448 B1 



2. Precede suivant la revendication 1, dans lequel la portion servant de pr^curseur comprend una 
sequence signal. 

3. Proc^d^ suivant la revendication 1 ou la revendication 2, dans lequel la BMP-2A et la BMP-2B sont des 
5 BMP humaines. 

4. Precede qui comprend la construction d'un vecteur d'expression comprenant un produit hybride 
d 'assemblage d*ADN comprenant, dans le sens 5* St 3', une sequence d'ADN pour la portion servant de 
precurseur de la BMP-2A \\6e de maniere fonctionnelle a une sequence d*ADN codant pour la BMP-2B 

70 mature. 

5. Proced^ suivant la revendication 4, dans lequel la portion servant de precurseur comprend une 
sequence signal. 

75 6. Proc^d^ suivant la revendication 4 ou la revendication 5, dans lequel la BMP-2A et la BMP-2B sont des 
BMP humaines. 

7. Precede comprenant la transformation d*une cellule-hote de mammifere avec un vecteur d'expression 
comprenant un produit hybride d'assemblage d'ADN comprenant, dans le sens 5' ^ 3', une sequence 

20 d'ADN pour la portion servant de precurseur de la BMP-2A li^e de maniere fonctionnelle a une 
sequence d*ADN codant pour la BMP-2B mature. 

8. Procede suivant la revendication 7, dans lequel la portion servant de precurseur comprend une 
sequence signal. 

26 

9. Proc^d^ suivant la revendication 7 ou la revendication 8, dans lequel la BMP-2A et la BMP-2B sont des 
BMP humaines. 

10. Procede comprenant la transformation d*une cellule-hote de mammifere avec le vecteur d'expression 
30 pRK5.bmp 2/4-1 .1 , disponible sous le num^ro de d6p6t ATCC 68 330. 

11. Proc4d§ comprenant la transformation d'une cellule-h6te de E. coli avec le vecteur d'expression 
pRK5.bmp 2/4-1.1, disponible sous le numero de depot ATCC 68 330. 

36 12. Procede pour I'expression d'un ADN codant pour la BMP-2B mature dans des cellules de mammifere, 
comprenant Tutilisation d'une cellule-hote de mammifere transformee avec un produit hybride d'assem- 
blage d'ADN comprenant, dans le sens 5' a 3', une sequence d'ADN pour la portion servant de 
precurseur de la BMP-2A Ii6e de maniere fonctionnelle a une sequence d'ADN codant pour la BMP-2B 
mature. 

40 

13. Proc4d6 suivant la revendication 12, dans lequel la portion servant de precurseur comprend une 
sequence signal. 

14. Procede suivant la revendication 12 ou la revendication 13, dans lequel la BMP-2A et la BMP-2B sont 
45 des BMP humaines. 

15. Procede pour Texpression d'un ADN codant pour la BMP-2B mature dans des cellules de mammifere, 
comprenant I'utilisation d'une cellule-hote de mammifere transformee avec le vecteur d'expression 
pRK5.bmp 2/4-1.1, disponible sous le numero de depot ATCC 68 330. 

50 



56 



23 



EP 0 531 448 B1 



o 






1 


o. 




oco 


or 






cnt— ♦ 


f— 


Q- 


LU 


^> 




ooo 


UJ 


Q_ 


_J 




UJ 


U. 




a. 


LU 


2^ 






LU 


CO 






CD 




> 


to* 


OO 


«c 


>o 


zn 


oo 




LUCTi 



0« CS O LU 

2^ OO O* O 

OC* DC >-* >- 

I =c z: 
^» ^ 

<t a. -J* — I 

o oo >• > 

ai» oc 0>* > 

OLU <a:o K>LU QO 

_^ „^ , oooc* alien z >-cn 

a: _jcn o*x* <c.-i cm^ qccn uj* lui^ 

QC* QC ooa.* o- 3r oi o* 

>-♦ >- t I Q- I OC —J* —J 

o-J« —I i*:* ^ I »— ^* 

I tt: I > Q- *a: SI* 

SI* s: UJ* UJ 31* rn ooo* co 

al Q «— iO ^ oco f^<x* <co 

CU* Q-O zoo to* COOOl CO* oooo 

> .00 — * ^f—* OQ* cacsif —J* — iro 

>» > cDQi* or r^3:* 3Z I LU o 

OQ CO '-lie ' 1 H-* H- S:! 9r 

CO* CO oo u? ' >♦ > o* o 

QU* Q- CO —1* _J OtJ* t-> 

I— O Z LU —I* -J UD«X* <X 

ol* S z :x o-* CL.O N^^* 

a;* oro to cao QC* oir^ O-* Q^t:; 

^ 0<X • U3C3* O ^ CO 

_l» _J tOQ O CslOO <X CO* CO 

oo* CD r-40 o :x 3: ^* ^ 

a^u-* LL SI > CO z >* > 

^* ^ O* O 3= O oo* CO 

CO C3 LU* LU LU oo OZ* Z 

_l* —I QC* CZJ CD Ln>* > 

u_ o» C30 ro— I* —JO 

_JO QutD I—* I— to 

QCio o— I* icsj o* oro 

If-H LPkOO* CO >* > 

LU CMQc:* 0£ ♦ •— » 

<x CO* CO <r* «a: 

(/> 1-^* i 3C* IC 

CO a:* z* z 



_J* 


1 


U.* 


a: 


1— o 


> 


-J 






LU* 


LU 


O— J* 


U.* 


LL. 


LALU* 


OliJ 




r-*<C* 


LHCO 


C3il 


CO* 


— i 


_J 




> 


—J - 


•» 


LU* 


UJ 


LL. 




31 


UJ* 


OO* 


OOO 


LU 


Q_ 


otn 


1— 


O 


CD 


OQ-* 


CO* OO 


cr*— .* 


OCO 


or 


»-HOO* 




Qc: 


oo* 


o£ 


CD 


-J* 


L3* 


CD 


z* 


CO 


<a: 


u.« 


CO 


=c 


u. 


«x 


CDO 


Ll_* 


<a: 


O^ 


cz:* 


t 




ooc 


1 


LU 




<x* 








> 




o:^* 




CD 






OO* 


on 




* 



LL 



> 31* 3C ^OO* OO 

UJ QC OO roz* zo 

ZO CDLT* I* — I LTV 

LULH OOO OCNJ oc* rcro 

Q_«— I cr> in Q* ciJ 

CVJCD h~ <C 

OO C3 — I* — I 

OO h- Q-* Q- 

_j LU O 4-* U- 

Z LU m OQ-* a. 

U_ —J* —I K^C->* C-> 

I rn* nio rouj cao 

u_0 <a: I — •=3" CD* cD-=T 

cti-a- o>* x\j ^* 

LL.1— I f^LU* LU C->* C-> 

<X CM>- ^ >-• 

OO > <C LU* 

z LU —I «x 

LU CD* CD HI o 

OO :r o>-* >- 

. . I— Z* Z CMCD* CD 

tD* CD LU CD «=C Q-CD fOCX.* Q-O 

_j J— o Q_* Q_0 31 or^ Q-* O-r^ 

LU* Luro —I ocD ^csi ^* 

a.* Q- OLU Z<— i CN<3 LU >* > 

> —I CMLU* LU CN*a: QC tr* 

— — ' I* — » t* t: SI S 

CD OO OO ZE :s* 3= «♦ s 

<cm <s: UJ* LU ^* or, ^ 

I m LU* LU SI —I ors* :s 

O I CO 31* 3= >* > ^CD* cp_^ 

oii* S IE* 31 <3:* <CO hrv>* >o 

CD* CDO LU* LUO Q-* O-Csl Q* QCSl 

CD* CDCNI CO* COCSJ 0^— COCnJ CO* OOfA 

__|» ^ OQC* CCfH 1>* > . LU* LU 

_j* I r-i>* > csm* ca ca* o 

>♦ > .—II—* H- U-* LU >♦ > 

a* o z* z OO J— >-* >- 

n <C* <C LU* LU — t* — I 

_i* _j QC* a: 3:* 3 ocu OO 

_j* I CO* OO oc* or 03I* in 

o-j > <x* <c OO h- o food* oco 

Zi or* ocr-i oz* zcg cj* <->ro oc* or 

_J _l OLU* LU»-» OO 31 OO Z CJ* CJ 

O SI O I Q- CMZ 3: I ^ J^I R 

S* S .-H I >- >♦ > OO Z C->* CJ 

tr z I UJ —I* —I i^* ^ O* CD 

cD» ^ --J* Ij or* _I ^ UJ* UJ 

S of I CD H-* I— OC* QC 0>* > 

5- 31 OO —I* — lo cr»oi* Qio rasi* sio 

O CSJ O O 

cvj -3- 

mjD CD^ CD-Q CUXD fO-O 

(NJCsJ CsJCM CN4CSI 9^9^ 



24 



EP 0 531 448 B1 




o Dt: 
o o 

u 



o o 



o 

00 



Q 



o 
m 



M 

< 

u 

04 



O M 
VD CO 

ro CO 



CO 



25 



EP 0 531 448 B1 



FIG. 3A 



pUC118 



CMV 

IgG splice 
Sail 




BMP-2a/2b 



Ball 



SVE 
poly (A) 



Hindm 



BMP-2A 
241 



■ . .EBMslSJlQpEHlW^lPuWG^ 



1 1 



-H 



. . .GQ HVRISRSL PQGSGNNAaL RPLLVTFiGH BGRGMTRRF 
2^9 ^ — :L^^_=^tj3&--. 

BMP-2B T 

2A/2B junction 

FIG. 3B 




RQAl 
"BS 




R<W.KS-SC 
gAgfKNK^ 



mature BMP-26 



26 



EP 0 531 448 B1 




EP 0 531 448 B1 



40 




BMP-2B TGF-B 
^g/implant 

FIG. 5 A 



200 




0 0.5 2.0 6.0 1 DBP 



BMP^2B TGF-B 
}xg/implant 

FIG. 5B 



28 



This Page is Inserted by IFW Indexing and Scanning 
Operations and is not part of the Official Record 

BEST AVAILABLE IMAGES 

Defective images within this document are accurate representations of the original 
documents submitted by the applicant. 

Defects in the images include but are not limited to the items checked: 

□ BLACK BORDERS 

□ IMAGE CUT OFF AT TOP, BOTTOM OR SIDES 
□TfADED text or DRAWING 
[^BLURRED OR ILLEGIBLE TEXT OR DRAWING 

□ SKEWED/SLANTED IMAGES 

□ COLOR OR BLACK AND WHITE PHOTOGRAPHS 

□ GRAY SCALE DOCUMENTS 

□ LINES OR MARKS ON ORIGINAL DOCUMENT 

□ REFERENCE(S) OR EXHIBIT(S) SUBMITTED ARE POOR QUALITY 

□ OTHER: ; 

IMAGES ARE BEST AVAILABLE COPY. 
As rescanning these documents will not correct the image 
problems checked, please do not report these problems to 
the IFW Image Problem Mailbox.