Skip to main content

Full text of "USPTO Patents Application 09804625"

See other formats


(19) 



J 



Europaisches Patentamt 
European Patent Office 
Office europeen des brevets 



(12) 



(11) EP 0 429 570 B1 

EUROPEAN PATENT SPECIFICATION 



(45) Date ot publication and mention 
of the grant of the patent: 
14.01.1998 Bulletin 1998/03 

(21) Application number: 90905830.7 

(22) Dateof filing: 27.03.1990 



(51) Intel 6: C12P 21/00, A61K 38/27, 
C07K 14/00 

(86) International application number: 
PCT/US90/01630 

(87) Internationa! publication number: 

WO 90/1 1 366 (04.1 0.1 990 Gazette 1 990/23) 



(54) OSTEOINDUCTIVE COMPOSITIONS 

OSTEOINDUKTIVE 2USAIVIMENSET2UNGEN 
COMPOSITIONS OSTEOINDUCTRICES 



(84) Designated Contracting States: 

AT BE OH DE DK £S PR GB IT LI LU NL SE 

(30) Priority: 28.03.1989 US 329610 
04.05.1989 US 347559 
23.06.1989 US 370544 
23.06.1989 US 370547 
23.06.1989 US 370549 
15.11.1989 US 437409 

17.11.1989 US 438919 

07.03.1990 US 490033 

(43) Date of publication of application: 
05.06.1991 Bulletin 1991/23 

(73) Proprietor: GENETICS INSTITUTE, INC. 
Cambridge, Massachusetts 02140 (US) 

(72) Inventors: 

• WANG, Elizabeth, A. 
Carlisle, MA 01741 (US) 



QQ 
O 

lO 

O) 
CM 

o 

Q. 
LU 



• WOZNEY, John, M. 
Hudson, MA 01749 (US) 

• ROSEN. Vickl, A. 
Brookllne, MA 02146 (US) 

• CELESTE, Anthony, J. 
Hudson, MA 01479 (US) 

(74) Representative: VOSSIUS & PARTNER 
Postf ach 86 07 67 
81634 Munchen(DE) 



(56) 



References cited: 
EP-A- 0 212 474 
WO-A-89/09787 
WO-A-91/05802 



WO-A-88/00205 
WO-A-89/10409 
US-A- 4 789 732 



Proc. Natl. Acad. ScL, vol. 85, no. 24, 1988; Wang, 
Elisabeth A et al.: "Purification and 
characterization of other distinct bone-inducing 
factors", see pages 9484, 9488 



Note: Within nine months from the publication of the mention of the grant of the European patent, any person may give 
notice to the European Patent Office of opposition to the European patent granted. Notice of opposition shall be filed in 
a written reasoned statement. It shall not be deenrwd to have been filed until the opposition fee has been paid. (Art. 
99(1) European Patent Convention). 



Prtnted by Jouve. 7S001 PARIS (FR) 



EP 0 429 570 B1 



Description 

The present invention relates to proteins having utility in the formation of bone and/or cartilage. In particular the 
invention relates to a number of families of purified proteins, termed BMP-5, BMP-6 and BMP-7 protein families (wherein 
5 BMP is Bone Morphogenic Protein) and processes for obtaining them. These proteins exhibit the ability to induce 
cartilage and/or bone formation. They may be used to induce bone and/or cartilage formation and in wound healing 
and tissue repair 

WO 89/09787 discloses a partial nucleic acid and a partial amino acid sequence for a protein which Is designated 
as "OP-1'. Two different forms of the OP-1 sequence are disclosed, that is the genomic DNA with introns (Fig. 1 A) 
10 with no indication of an open reading frame or the positions of the introns or exons and an undefined sequence region 
between positions 1880 and 1920, and in Figure 1 B, a sequence that should correspond to part of the cDNA sequence 
with an overall length of 314 nucleotides. The partial amino acid sequence of OP-1 is disclosed on page 9. 

WO 91/05802 discloses the genomic sequence of OP-1 from position 1 to 1822 and the derived amino acid se- 
quence encoding the full length protein with a length of 431 amino acids. Furthermore, the region corresponding to the 
IS mature form of the protein is indicated in Figure 2 and also on page 26 and designated as OP1-18. 

The invention provides a family of BMP-5 proteins. Purified human BMP-5 proteins are substantially free from 
other proteins with which they are co-produced, and characterized by an amino acid sequence comprising from amino 
acid #323 to amino acid #454 set forth in Table Ml. This amino acid sequence #323 to #454 is encoded by the DNA 
sequence comprising nucleotide #1665 to nucleotide #2060 of Table 111. BMP-5 proteins may be further characterized 
20 by an apparent molecular weight of 28,000-30,000 daltons as determined by sodium dodecyl sulfate polyacrylamide 
gel electrophoresis (SDS-PAGE). Under reducing conditions in SDS-PAGE the protein electrophoreses with a molec- 
ular weight of approximately 14,000 - 20,000 daltons. It is contemplated that these proteins are capable of stimulating, 
promoting, or otherwise inducing cartilage and/or bone formation. 

Human BMP-5 proteins of the invention may be produced by cutturing a cell transformed with a DNA sequence 
2S containing the nucleotide sequence the same or substantially the same as the nucleotide sequence shown in Table III 
comprising nucleotide #699 to nucleotide #2060. BMP-5 proteins comprising the amino acid sequence the same or 
substantially the same as shown in Table III from amino acid # 323 to amino acid # 454 are recovered, isolated and 
purified from the culture medium. 

The invention provides a family of BMP-6 proteins. Purified human BMP-6 proteins, substantially free from other 
30 proteins with which they are co-produced and are characterized by an amino acid sequence comprising acid #382 to 
amino acid #51 3 set forth in Table IV. The amino acid sequence from amino acid #382 to #513 is encoded by the DNA 
sequence of Table IV from nucleotide #1 303 to nucleotide #1698. These proteins nnay be further characterized by an 
apparent molecular weight of 28,000-30,000 dattons as determined by sodium dodecyl sulfate polyacrylamide gel 
electrophoresis (SDS-PAGE). Under reducing conditions in SDS-PAGE the protein electrophoreses with a molecular 
35 weight of approximately 14,000 - 20,000 daltons. It is contemplated that these proteins are capable of stimulating 
promoting, or otherwise inducing cartilage and/or bone formation. 

Human BMP-6 proteins of the invention are produced by culturing a cell transformed with a DNA sequence com- 
prising nucleotide #160 to nucleotide #1698 as shown in Table 111 or a substantially similar sequence. BMP-6 proteins 
comprising amino acid #382 to amino acid #51 3 or a substantially similar sequence are recovered. Isolated and purified 
40 from the culture medium. 

The invention provides a family of BMP-7 proteins. Which includes purified human BMP-7 proteins, substantially 
free from other proteins with which they are co-produced. Human BMP-7 proteins are characterized by an amino acid 
sequence comprising amino acid #300 to amino acid #431 set forth in Table V. This amino acid sequence #300 to #431 
is encoded by the DNA sequence of Table V from nucleotide #994 to #1389. •8MP-7 proteins may be further charac- 
45 terized by an apparent molecular weight of 28,000-30,000 daltons as determined by sodium dodecyl sulfate polyacr- 
ylamide get electrophoresis (SDS-PAGE). Under reducing conditions in SDS-PAGE the protein electrophoreses with 
a molecular weight of approximately 14,000 - 20,000 daltons. It is contemplated that these proteins are capable of 
stimulating, promoting, or othenrt^ise inducing cartilage and/or bone formation. 

Human BMP-7 proteins of the invention may be produced by culturing a cell transformed with a DNA sequence 
50 containing the nucleotide sequence the same or substantially the same as the nucleotide setquence shown in Table V 
comprising nucleotide # 97 to nucleotide #1389. BMP-7 proteins comprising the amino acid sequence the same or 
substantially the same as shown in Table V from amino acid #300 to amino acid #431 are recovered, isolated and 
purified from the culture medium. 

The invention further provides a method wherein the proteins described above are utilized for obtaining related 
55 human protein/s or other mammalian cartilage and/or bone formation protein/s. Such methods are known to those 
skilled in the art of genetic engineering. One method for obtaining such proteins Involves utilizing the human BMP-5, 
BMP-6 and BMP-7 coding sequences or portions thereof to design probes for screening human genomic and/or cDNA 
libraries to isolate human genomic and/or cDNA sequences. Additional methods within the art may employ the bovine 



2 



EP 0 429 570 B1 



and human BMP proteins of the invention to obtain other mammalian BMP cartilage and/or bone tormation proteins. 

Having identified the nucleotide sequences, the proteins are produced by cult u ring a cell transformed with the 
nucleotide sequence. This sequence or portions thereof hybridizes under stringent conditions to the nucleotide se- 
quence of either BMP-5, BMP-6 or BMP-7 proteins and encodes a protein exhibiting cartilage and/or bone formation 
5 activity. The expressed protein is recovered and purified from the culture medium. The purified BMP proteins are 
substantially free from other proteinaceous materials with which they are co-produced, as well as from other contam- 
inants. 

BMP-5, BMP-6 and BMP-7 proteins may be characterized by the ability to promote, stimulate or otherwise induce 
the formation of cartilage, and/or bone formation. It is further contemplated that the ability of these proteins to induce 

TO the formation of cartilage and/or bone may be exhibited by the ability to demonstrate cartilage and/or bone formation 
activity in the rat bone formation assay described below. It is further contemplated that the proteins of the invention 
demonstrate activity in this rat bone formation assay at a concentration of 1 0^g - 500|ig/gram of bone formed. More 
particularly, it is contemplated these proteins may be characterized by the ability of 1fig of the protein to score at least 
+2 in the rat bone formation assay described below using either the original or modified scoring method. 

75 Another aspect of the invention provides pharmaceutical compositions containing a therapeutically effective 

amount of a BMP-5, BMP-6 or BMP-7 protein in a pharmaceutical ly acceptable vehicle or carrier. Further compositions 
comprise at least one BMP-5, BMP-6 or BMP-7 protein. It is therefore contemplated that the compositions may contain 
more than one of the BMP proteins of the present invention as BMP-5, BMP-6 and BMP-7 proteins may act in concert 
with or perhaps synergistically with one another. The compositions of the invention are used to induce bone and/or 

20 cartilage formation. These compositions may also be used for wound healing and tissue repair. 

Further compositions of the invention may include in addition to a BMP-5, BMP-6 or BMP-7 protein of the present 
invention at least one other therapeutically useful agent such as the proteins designated BMP-1 , BMP-2 (also having 
been designated in the past as BMP-2A. BMP-2 Class I), BMP-3 and BMP-4 (also having been designated in the past 
as BMP-2B and BMP-2 Class II) disclosed in co-owned International Publication W088/00205 published 14 January 

25 1988 and International Publication W089/10409 published 2 November 1989. Other therapeutically useful agents in- 
clude growth factors such as epidermal growth factor (EGF), fibroblast growth factor (FGF), transforming growth factors 
(TGF-a and TGF-P), and platelet derived growth factor (PDGF). 

The compositions of the invention may also include an appropriate matrix, for instance, for delivery and/or support 
of the composition and/or providing a surface for bone and/or cartilage tormation. The matrix may proide solw release 

30 of the BMP protein and/or the appropriate environment for presentation of the BMP protein of the invention. 

The compositions of the invention may be employed in methods for treating a number of bone and/or cartilage 
defects, and periodontal disease. They may also be employed in methods for treating various types of wounds and in 
tissue repair These methods, according to the invention, entail administering a composition of the invention to a patient 
needing such bone and/or cartilage formation, wound healing or tissue repair. The method therefore involves admin- 

35 istration of a therapeutically effective amount of a protein of the invention. These methods may also entail the admin- 
istration of a protein of the invention in conjunction with at least one of the "BMP" proteins disclosed in the co-owned 
applications described above. In addition, these methods may also include the administration of a protein of the inven- 
tion with other growth factors including EGF, FGF, TGF-a, TGF-p, and PDGF 

Still a further aspect of the invention are DNA sequences coding for expression of a protein of the invention. Such 

40 sequences include the sequence of nucleotides in a 5' to 3' direction illustrated in Tables III - V or DNA sequences 
which hybridize under stringent conditions with the DNA sequences of Tables III - Vand encode a protein demonstrating 
ability to induce cartilage and/or bone formation. Such cartilage and/or bone formation may be demonstrated in the rat 
bone formation assay described below. It is contemplated that these proteins may demonstrate activity in this assay 
at a concentration of 10 |ig - 500 ^ig/gram of bone formed. More particularly, it is contemplated that these proteins 

^5 demonstrate the ability of 1 ^ig of the protein to score at least +2 in the rat bone formation assay Finally, allelic or other 
variations of the sequences of Tables III - V whether such nucleotide changes result in changes in the peptide sequence 
or not, are also included in the present invention. 

A further aspect of the invention provides vectors containing a DNA sequence as described above in operative 
association with an expression control sequence therefor. These vectors may be employed in a novel process for 

^0 producing a protein of the invention in which a cell line transformed with a DNA sequence directing expression of a 
protein of the invention in operative association with an expression control sequence therefor, is cultured in a suitable 
culture medium and a protein of the invention is recovered and purified therefrom. This claimed process may employ 
a number of known cells, both prokaryotic and eukaryotic, as host cells for expression of the polypeptide. The revovered 
BMP proteins are purified by isolating them from other proteinaceous materials with which they are co-produced as 

55 well as from other contaminants. 

Other aspects and advantages of the present invention will be apparent upon consideration of the following detailed 
description and preferred embodiments thereof. 



3 



EP0 429 570 Bl 



Detailed Description of the Invention 

Purified hunnan BMP-5 proteins nnay be produced by culturing a host cell transfornned with the DNA sequence of 
Table III. The expressed BMP-5 proteins are isolated and purified from the culture medium. Purified human BMP-5 

5 proteins are expected to be characterized an amino acid sequence comprising amino acid #323 to #454 as shown in 
Table III. Purified BMP-5 human cartilage/bone proteins of the present invention are therefore produced by culturing 
a host cell transformed with a DNA sequence comprising nucleotide #699 to nucleotide #2060 as shown in Table III or 
substantially homologous sequences operatively linked to a heterologous regulatory control sequence and recovering 
and purifying from the culture medium a protein comprising the amino acid sequence as shown in Table III from amino 

10 acid #323 to amino acid #454 or a substantially homologous sequence. 

In further embodiments the DNA sequence comprises the nucleotides encoding amino acids #323-#454. BMP-5 
proteins may therefore be produced by culturing a host cell transformed with a DNA sequence comprising nucleotide 
#1665 to nucleotide #2060 as shown in Table III or substantially homologous sequences operatively linked to a heter- 
ologous regulatory control sequence and recovering and purifying from the culture medium a protein comprising amino 

>5 acid #323 to amino acid #454 as shown in Table III or a substantially homologous sequence. The purified human BMP- 
5 proteins are substantially free from other proteinaceous materials with which they are co-produced, as well as from 
other contaminants. 

Purified human BMP-6 proteins may be produced by culturing a host cell transformed with the DNA sequence of 
Table IV. The expressed proteins are isolated and purified from the culuture medium. Purified human BMP-6 proteins 

20 of the invention are expected to be characterized by an amino acid sequence comprising amino acid #382 to #51 3 as 
set forth in Table IV. These purified BMP-6 human cartilage/bone proteins of the present invention are therefore pro- 
duced by culturing a host cell transformed wrth a DNA sequence comprising nucleotide #160 to nucleotide #1698 as 
set forth in Table IV or substantially homologous sequence operatively linked to a heterologous regulatory control 
sequence and recovering, isolating and purifying from the culture medium a protein comprising amino acid #382 to 

2S amino acid #51 3 as set forth in Table IV or a substantially homologous sequence. 

Further embodiments may utilize the DNA sequence comrising the nucleotides encoding amino acids #382 - #51 3. 
Purified human BMP-6 proteins may therefore be produced by culturing a host cell transformed with the DNA sequence 
comprising nucleotide #1303 to #1698 as set forth in Table IV or substantially homologous sequences operatively 
linked to a heterologous regulatory control sequence and recovering and purifying from the culture medium a protein 

30 comprising amino acid #382 to #513 as set forth in Table IV or a substantially homologous sequence. The purified 
human BMP-6 proteins are substantially free from other proteinaceous materials with which they are co-produced, as 
well as from other contaminants. 

Purified human BMP-7 proteins may be produced by culturing a host cell transformed with the DNA sequence of 
Table V. The expressed proteins are isolated and purified from the culture medium. Purified human BMP-7 proteins 

35 are expected to be characterized by an amino acid sequence comprising amino acid #300-#431 as shown In Table V 
These purified BMP-7 human cartilage/bone proteins of the present invention are therefore produced by culturing a 
CHO cell transfornned with a DNA sequence comprising nucleotide #97 to nucleotide #1389 as shown in Table V or 
substantially homologous sequences operatively linked to a heterologous regulatory control sequence and recovering, 
isolating and purifying from the culture medium a protein comprising the amino acid sequence as shown in Table V 

40 from amino acid #300 to amino acid #431 or a substantially homologous sequence. 

Further emodiments may utilize the DNA sequence comprising the nucleotides encoding amino acids #300 - #431 . 
Purified BMP-7 proteins may be produced by culturing a host cell transformed with a DNA comprisiing the DNA sequence 
as shown in Table V from nucleotide #994 - #1389 or substantially homologous sequences operatively linked to a 
heterologous regualtory control sequence and recovering, and purifying from the culture medium a protein comprising 

4S the amino acid sequence as shown in Table V from amino acid #300 to amino acid #431 or a substantially homologous 
sequence. The purified human BMP-7 proteins are substantially free from other proteinaceous materials from which 
they are co-produced, as well as from other contaminants. 

BMP-5, BMP-6 and BMP-7 proteins are further characterized by the ability to demonstrate cartilage and/or bone 
formation activity. This activity may be demonstrated, for example, in the rat bone formation assay as described in 

so Example III. It is further contemplated that these proteins demonstrate activity in the assay at a concentration of 10 lag 
- 500 Ig/gram of bone formed. The proteins may be further characterized by the ability of l^ig to score at least +2 in 
this assay using either the original or modified scoring method descirbed further herein below. 

BMP-5, BMP-6 and BMP-7 proteins may be further characterized by an apparent molecular weight of 
28,000-30,000 daltons as determined by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). 

55 Under reducing conditions in SDS-PAGE the protein electrophoresis with a molecular weight of approximately 
14,000-20,000 daltons. 

The proteins provided herein also include factors encoded by the sequences similar to those of Tables III - V but 
into which modifications are naturally provided (e.g. allelic variations in the nucleotide sequence which may result in 



4 



EP 0 429 570 B1 



amino acid changes in the polypeptide) or deliberately engineered. Similarly, synthetic polypeptides which wholly or 
partially duplicate continuous sequences of the amino acid residues of Tables III -V are encompassed by the invention. 
These sequences, by virtue of sharing primary, secondary, or tertiary structural and conformational characteristics with 
other cartilage/bone proteins of the invention may possess bone and/or cartilage growth factor biological properties in 

5 common therewith. Thus, they may be employed as biologically active substitutes for naturally -occurring proteins in 
therapeutic processes. Other specific mutations of the sequences of the proteins of the invention described herein 
involve modifications of a glycosylation site. These modification may involve O-linked or N-l inked glycosylation sites. 
For instance, the absence of glycosylation or only partial glycosylation results from amino acid substitution or deletion 
at the asparagine-linked glycosylation recognition sites present in the sequences of the proteins of the invention, as 

10 shown in Table III - V. The asparagine-linked glycosylation recognition sites comprise tripeptide sequences which are 
specifically recognized by appropriate cellular glycosylation enzymes. These tripeptide sequences are either aspar- 
agine-X-threonine or asparagine-X-serine, where X is usually any amino acid. A variety of amino acid substitutions or 
deletions at one or, both of the first or third amino acid positions of a glycosylation recognition site-(and/or amino acid 
deletion at the second position) results In non-glycosylation at the modified tripeptide sequence. Expression of such 
altered nucleotide sequences produces variants which are not glycosylated at that site. 

The present invention also encompasses the novel DNA sequences, free of association with DNA sequences 
encoding other proteinaceous materials, and coding on expression for the proteins of the invention. These DNA se- 
quences include those depicted in Tables III - V in a 5' to 3' direction. Further included are those sequences which 
hybridize under stringent hybridization conditions [see, T Maniatis et al, Molecular Cloning (A Laboratory Manual) . 

20 Cold Spring Harbor Laboratory (1982), pages 387 to 389] to the DNA sequence of Tables III - V and demonstrate 
cartilage and/or bone formation activity in the rat bone formation assay. An example of one such stringent hybridization 
condition Is hybridization at[6- 4 x SSC at 65°C, followed by a washing in 0.1 x SCC at 65°C for an hour. Alternatively, 
an exemplary stringent hybridization condition is in 50% formamide, 4 x SCC at 42*C. 

Similarly, DNA sequences which encode proteins similar to the protein encoded by the sequences of Tables III - 

^5 V, but which differ in codon sequence due to the degeneracies of the genetic code or allelic variations (naturally- 
occurring base changes in the species population which may or may not result in an amino acid change) also encode 
the proteins of the invention described herein. Variations in the DNA sequences of Tables II) - V which are caused by 
point mutations or by induced modifications (including insertion, deletion, and substitution) to enhance the activity, half- 
life or production of the polypeptides encoded thereby are also encompassed in the invention. 

30 In a further aspect, the invention provides a method for obtaining related human proteins or other mammalian 

BMP-5, BMP-6 and BMP-7 proteins. One method for obtaining such proteins entails, for instance, utilizing the human 
BMP-5, BMP-6 and BMP-7 coding sequence disclosed herein to probe a human genomic library using standard tech- 
niques for the human gene or fragments thereof. Sequences thus identified may also be used as probes to identify a 
human cell line or tissue which synthesizes the analogous cartilage/bone protein. A cDNA library is synthesized and 

35 screened with probes derived from the human or bovine coding sequences. The human sequence thus identified is 
transformed into a host cell, the host cell is cultured and the protein recovered, isolated and purified from the culture 
medium. The purified protein is predicted to exhibit cartilage and/or bone formation activity in the rat bone formation 
assay of Example III. 

Another aspect of the present invention provides a novel method for producing the BMP-5, BMP-6 and BMP-7 

40 proteins of the invention. The method of the present invention involves cutturing a suitable cell or cell line, which has 
been transformed with a DNA sequence as described above coding for expression of a protein of the invention, under 
the control of known regulatory sequences. Regulatory sequences include promoter fragments, terminator fragments 
and other suitable sequences which direct the expression of the protein in an appropriate host celt. Methods for culturing 
suitable cell lines are within the skill of the art. The transformed cells are cultured and the BMP proteins expressed 

45 thereby are recovered, isolated and purified from the culture medium using purification techniques known to those 
skilled in the art. The purified BMP proteins are substantially free from other proteinaceous materials with which they 
are co-produced, as well as other contaminants. Purified BMP proteins of the invention are substantially free froin 
materials with which the proteins of the invention exist in nature. 

Suitable cells or cell lines may be mammalian cells, such asChinese hamster ovary cells (CHO). The selection of 

so suitable mammalian host cells and methods for transformation, culture, amplification, screening and product production 
and purification are known in the art. See, e.g., Gething and Sambrook, Nature . 293:620-625 (1981), or alternatively. 
Kaufman et al. MoLCelLBioL 5(7): 1 750-1 759 ( 1 985) or Howley et al, U.S. Patent 4,41 9,446. Other suitable mammalian 
cell lines include but are not limited to the monkey COS-1 cell line and the CV-1 cell line. 

Bacterial cells may also be suitable hosts. For example, the various strains of E. coli (e.g., HB101, MC1061) are 

ss wetl-known as host cells in the field of biotechnology. Various strains of B. subtilis . Pseudomonas. other bacilli and the 
like may also be employed in this method. 

Many strains of yeast cells known to those skilled in the art may also be available as host cells for expression of 
the polypeptides of the present invention. Additionally, where desired, insect cells may be utilized as host cells in the 



5 



EP 0 429 570 B1 



method of the present invention. See, e.g. Miller at al, Genetic Engineering . 8:277-298 (Plenum Press 1986) and 
references cited therein. 

Another aspect of the present invention provides vectors for use in the method of expression of the proteins of the 
invention. The vectors contain the novel DNA sequences which code for the BMP-5, BMP-6 and BMP-7 proteins of 

5 the invention. Additionally, the vectors also contain appropriate expression control sequences permitting expression 
of the protein sequences. Alternatively, vectors incorporating truncated or modified sequences as described above are 
also embodiments of the present invention and useful in the production of the proteins of the invention. The vectors 
may be employed in the method of transforming cell lines and contain selected regulatory sequences in operative 
association with the DNA coding sequences of the invention which are capable of directing the replication and expres- 

10 sion thereof in selected host cells. Useful regulatory sequences for such vectors are known to those skilled in the art 
and may be selected depending upon the selected host cells. Such selection is routine and does not form part of the 
present invention. Host cells transformed with such vectors and progeny thereof for use in producing BMP-5, BMP-6 
and BMP-7 proteins are also provided by the invention. 

One skilled in the art can construct mammalian expression vectors by employing the DNA sequences of the in- 

is vention and known vectors, such as pCD [Okayama et ai.. Mol. Cell Biol. , 2:161-170 (1982)] and pJL3, pJL4 [Gough 
et al.. EMBO J.. 4:645-653 (1985)]. Similarly, one skilled in the art could nnaniputate the sequences of the invention by 
eliminating or replacing the mammalian regulatory sequences flanking the coding sequence with bacterial sequences 
to create bacterial vectors for intracellular or extracellular expression by bacterial cells. For example, the coding se- 
quences could be further manipulated (e.g. ligated to other known linkers or modified by deleting non-coding sequences 

20 there-from or altering nucleotides therein by other known techniques). The modified coding sequence could then be 
inserted into a known bacterial vector using procedures such as described in T. Taniguchi et al., Proc. Natl Acad. Sci. 
USA, 77:5230-5233 (1980). This exemplary bacterial vector could then be transformed into bacterial host cells and a 
protein of the invention expressed thereby. For a strategy for producing extracellular expression of a cartilage and/or 
bone protein of the invention in bacterial cells., see, e.g. European patent application EPA 177,343. 

25 Similar manipulations can be performed for the construction of an insect vector [See, e.g. procedures described 

in published European patent application 155,476) for expression in insect celts. A yeast vector could also be con- 
structed employing yeast regulatory sequences for intracellular or extracellular expression of the factors of the present 
invention by yeast cells. (See, e.g., procedures described in published PCT application W086/00639 and European 
patent application EPA 123,289]. 

30 A method for producing high levels of a protein of the invention from mammalian cells involves the construction 

of cells containing multiple copies of the heterologous gene encoding proteins of the invention. The heterologous gene 
may be linked to an amplifiable marker, e.g. the dihydrofolate reductase (DHFR) gene for which cells containing in- 
creased gene copies can be selected for propagation in increasing concentrations of methotrexate (MTX) according 
to the procedures of Kaufman and Sharp, J. Mol. Biol. , 159:601-629 (1982). This approach can be employed with a 

35 number of different cell types. 

For instance, a plasmid containing a DNA sequence for a protein of the invention in operative association with 
other plasmid sequences enabling expression thereof and the DHFR expression plasmid pAdA26SV(A)3 [Kaufman 
and Sharp. Mol. Cell. Biol.. 2:1304 (1982)] may be co-introduced into DHFR-deficient CHO cells, DUKX-Blt, by calcium 
phosphate coprecipitation and transfection, electroperation or protoplast fusion. DHFR expressing transformants are 

40 selected for growth in alpha media with dialyzed fetal calf serum, and subsequently selected for amplification by growth 
in increasing concentrations of MTX (sequential steps in 0.02, 0.2, 1.0 and 5uM MTX) as described in Kaufman et al., 
Mol Cell Biol.. 5:1750 (1983). Protein expression should increase with increasing levels of MTX resistance. 

Transformants are cloned, and the proteins of the invention are recovered, isolated, and purified from the culture 
medium. Characterization of expressed proteins may be carried out using standard techniques. For instance, charac- 

45 terization may include pulse labeling with [35®] methionine or cysteine, or polyacrylamide gel electrphoresis. Biologically 
active protein expression is monitored by the Rosen-modified Sampath - Reddi rat bone formation assay described 
above in Example 111. Similar procedures can be followed to produce other related proteins. 

A protein of the present invention, which induces cartilage and/or bone formation in circumstances where bone 
and/or cartilage is not normally formed, has application in the healing of bone fractures and cartilage defects in humans 

50 and other animals. A preparation employing a protein of the invention may have prophylactic use in ctosed as well as 
open fracture reduction and also in the improved fixation of artificial joints. De novo bone formation induced by an 
osteogenic agent contributes to the repair of congenital, trauma induced, or oncologic resection induced craniofacial 
defects, and also is useful in cosmetic plastic surgery. A protein of the invention may be used in the treatment of 
periodontal disease, and in other tooth repair processes. Such agents may provide an environment to attract bone- 

55 forming cells, stimulate growth of bone-forming cells or induce differentiation of progenitors of bone-forming cells. A 
variety of osteogenic, cartilage-inducing and bone inducing factors have been described. See, e.g. European Patent 
Applications 148,155 and 169,016 for discussions thereof. 

The proteins of the invention may also be used in wound healing and related tissue repair. The types of wounds 



6 



EP 0 429 570 B1 



include, but are not limited to burns, incisions and ulcers. See, e.g. PCT Publication W084/01106 tor discussion ot 
wound healing and related tissue repair. 

A further aspect of the invention includes pharmaceutical compositions, which can preferably be used for repairing 
fractures and other conditions related to bone and/or cartilage defects or periodontal diseases. In addition, the invention 
s comprises pharmaceutical compositions for wound healing and tissue repair. Such compositions comprise a therapeu- 
tically effective amount of at least one of the BMP proteins BMP-5, BMP-6 and BMP-7 of the invention in admixture 
with a pharmaceutically acceptable vehicle, carrier or matrix. 

It is expected that the proteins of the invention may act in concert with or perhaps synergistically with one another 
or with other related proteins and growth factors. Therapeutic methods and compositions of the invention therefore 
10 comprise one or more of the proteins of the present invention. Further therapeutic methods and compositions of the 
invention therefore comprise a therapeutic amount of at least one protein of the invention with a therapeutic amount 
of at least one of the other "BMP" proteins Bf^P-1 , BMP-2. BMP-3 and BMP-4 disclosed in co-owned Published Inter- 
national Applications WO88/00205 and WO89/1P409 as mentioned above. Such methods and compositions of the 
invention may comprise proteins of the invention or portions thereof in combination with the above-mentioned "BMP" 
'5 proteins or portions thereof. 

Such combination may comprise individual separate molecules of the proteins or heteromolecules such as het- 
erodimers formed by portions of the respective proteins. For example, a method and composition of the invention may 
comprise a BMP protein of the present Invention or a portion thereof linked with a portion of another "BMP" protein to 
form a heteromolecule. 

20 Further pharmaceutical compositions of the invention comprise the proteins of the invention or portions thereof in 

combination with other agents beneficial to the treatment of the bone and/or cartilage defect, wound, or tissue in ques- 
tion. These agents include various growth factors such as epidermal growth factor (EGF), fibroblast growth factor 
(FGF), platelet derived growth factor (PDGF), transforming growth factors (TGF-a and TGF-p), K-fibroblast growth 
factor (kFGF), parathyroid hormone (PTH), leukemia inhibitory factor (LIF/HILDA; DIA) and insulin-like growth factor 

2S (IGF-I and IGF-II). Portions of these agents may also be used in compositions of the invention. 

The preparation and formulation of such physiologically acceptable protein compositions, having due regard to 
pH, isotonicity, stability and the like, is within the skill of the art. The therapeutic compositions are also presently valuable 
for veterinary applications due to the apparent lack of species specificity in cartilage and bone growth factor proteins. 
Domestic animals and thoroughbred horses in addition to humans are desired patients for such treatment with the 

30 proteins of the present invention. 

The composition can be administered topically, systemically, or locally as an implant or device. When administered, 
the therapeutic composition for use in this invention is, of course, in a pyrogen-free, physiologically acceptable form. 
Further, the composition may desirably be encapsulated or injected in a viscous form for delivery to the site of cartilage 
and/or bone or tissue damage. Topical administration may be suitable for wound healing and tissue repair- 
as Preferably for bone and/or cartilage formation, the composition would include a matrix capable of delivering the 
BMP proteins of the invention to the site of bone and/or cartilage damage, providing a structure for the developing 
bone and cartilage and optimally capable of being resorbed into the body The matrix may provide slow release of the 
BMP proteins or other factors comprising the composition. Such matrices may be formed of materials presently in use 
for other implanted medical applications. 

40 The choice of matrix material is based on blocompatibility, biodegradability, mechanical properties, cosmetic ap- 

pearance and interface properties. The particular application of the compositions of the invention will define the ap- 
propriate formulation. Potential matrices for the compositions may be biodegradable and chemically defined calcium 
sulfate, tricalciumphosphate, hydroxyapatite, polylactic acid and polyanhydrides. Other potential materials are biode- 
gradable and biologically well defined, such as bone or dermal collagen. Further matrices are comprised of pure proteins 

4S or extracellular matrix components. Other potential matrices are nonbiodegradable and chemically defined, such as 
sintered hydroxyapatite, bioglass, aluminates, or other ceramics. Matrices may be comprised of combinations of any 
of the above mentioned types of material, such as polylactic acid and hydroxyapatite or collagen and tricalciumphos- 
phate. The bioceramics may be altered in composition, such as in calcium-aluminate-phosphate and processing to 
alter pore size, particle size, particle shape, and biodegradability 

^0 The dosage regimen will be determined by the attending physician considering various factors which modify the 

action of the proteins of the invention. Factors which may modify the action of the proteins of the invention include the 
amount of bone weight desired to be formed, the site of bone damage, the condition of the damaged bone, the size of 
a wound, type of damaged tissue, the patient's age, sex, and diet, the severity of any infection, time of administration 
and other clinical factors. The dosage may vary with the type of matrix used in the reconstitution and the type or types 

55 of bone and/or cartilage proteins present in the composition. The addition of other known growth factors, such as EGF, 
PDGF, TGF-a, TGF-p, and IGF-I and IGF-II to the final composition, may also effect the dosage. 

Progress can be monitored by periodic assessment of cartilage and/or bone growth and/or repair. The progress 
can be monitored, for example, using x-rays, histomorphometric determinations and tetracycline labeling. 



7 



EP 0 429 570 B1 



The following examples illustrate practice of the present invention in recovering and characterizing bovine cartilage 
and/or bone proteins of the invention and employing these proteins to recover the corresponding human protein or 
proteins and in expressing the proteins via recombinant techniques. 

5 EXAMPLE I 

Isolation of Bovine Cartilage/Bone Inductive Protein 

Ground bovine bone powder (20-120 mesh, Helitrex) is prepared according to the procedures of M. R. Urist et al., 
10 Proc. Natl Acad. Sci USA . 70:351 1 (1 973) with elimination of some extraction steps as identified below Ten kgs of the 

ground powder is demineralized in successive changes of 0.6N HCI at 4°C over a 48 hour period with vigorous stirring. 

The resulting suspension is extracted for 16 hours at 4°C with 50 liters of 2M CaClg and lOmM ethylenedlamine- 

tetraacetic acid [EDTA], and followed by extraction for 4 hours in 50 liters of 0.5M EDTA. The residue is washed three 

times with distilled water before its resuspension In 20 titers of 4M guanidine hydrochloride [GuCI], 20mM Tris (pH 7.4), 
15 imM N-ethylmaleimide, ImM iodoacetamide, ImM phenylmethylsulfonyl fluorine as described in Clin. Orthop. Rel. 

Res. , 171: 213 (1982). After 16 to 20 hours the supernatant is removed and replaced with another 10 liters of GuCI 

buffer The residue is extracted for another 24 hours. 

The crude GuCI extracts are combined, concentrated approximately 20 times on a Pelllcon apparatus with a 10,000 

molecular weight cut-off membrane, and then dialyzed in 50nM Tris, 0.1M NaCI, 6M urea (pH7.2), the starting buffer 
20 for the first column. After extensive dialysis the protein Is loaded on a 4 liter DEAE cellulose column and the unbound 

fractions are collected. 

The unbound fractions are concentrated and dialyzed against 50mM NaAc, 50mM NaCI (pH 4.6) in 6M urea. The 
unbound fractions are applied to a carboxymethyl cellulose column. Protein not bound to the column is removed by 
extensive washing with starting buffer, and the material containing protein having bone and/or cartilage formation ac- 

2S tivity as measured by the Rosen-modified Sampath-Reddi assay (described in Example III below) desorbed from the 
column by 50mM NaAc, 0.25mM NaCI, 6M urea (pH 4.6). The protein from this step elution is concentrated 20- to 40- 
fold, then diluted 5 times with BOmM KPO4, 6M urea (pH6.0). The pH of the solution is adjusted to 6.0 with 500mM 
K2HP04. The sample is applied to an hydroxylapatite column (LKB) equilibrated in 80mM KPO4, 6M urea (pH6.0) and 
all unbound protein is removed by washing the column with the same buffer Protein having bone and/or cartilage 

30 formation activity Is eluted with lOOmM KPO4 (pH7,4) and 6M urea. 

The protein is concentrated approximately 10 times, and solid NaCI added to a final concentration of 0.1 5M. This 
material is applied to a heparin - Sepharose column equilibrated in 50mM KPO4, 1 50mM NaCI, 6M urea (pH7.4). After 
extensive washing of the column with starting buffer, a protein with bone and/or cartilage inductive activity is eluted by 
50mM KPO4, 700mM NaCI, 6M urea (pH7.4). This fraction is concentrated to a minimum volume, and 0.4ml allquots 

55 are applied to Superose 6 and Superose 1 2 columns connected in series, equilibrated with 4M GuCI, 20mM Tris (pH7.2) 
and the columns developed at a flow rate of 0.25ml/min. The protein demonstrating bone and/or cartilage inductive 
activity corresponds to an approximate 30,000 dalton protein. 

The above fractions from the superose columns are pooled, dialyzed against 60mM NaAc, 6M urea (pH4.6), and 
applied to a Pharmacia MonoS HR column. The column is developed with a gradient to 1 .OM NaCI, 50mM NaAc, 6M 

40 urea (pH4.6). Active bone and/or cartilage formation fractions are pooled. The material is applied to a 0.46 x 25cm 
Vydac C4 column in 0.1% TFA and the column developed with a gradient to 90% acetonitrile, 0.1% TFA (31 .5% ace- 
ton itrile, 0.1% TFA to 49.5% acetonitrile, 0.1% TFA in 60 minutes at 1ml per minute). Active material is eluted at ap- 
proximately 40-44% acetonitrile. Fractions were assayed for cartilage and/or bone formation activity. The active material 
is further fractionated on a MonoQ column. The protein is dialyzed against 6M urea, 25mMdiethanolamine. pH 8.6 

45 and then applied to a 0.5 by 6 cm MonoQ column (Pharmacia) which Is developed with a gradient of 6M urea, 25mM 
diethanolamine, pH 8.6 and 0.5 M NaCI, 6M urea, 25mM diethanolamine, pH 8.6. Fractions are brought to pH3.0 with 
10% trifluoroacetic acid (TFA). Allquots of the appropriate tractions are iodinated by one of the following methods: R 
J. McConahey et al. Int. Arch. Allergy, 29:185-189 (1966); A. E. Bolton et al, Blochem J. , 133:529 (1973); and D. F 
Bowen-Pope, J. Biol. Chem., 237:5161 (1 982). The iodinated proteins present in these fractions are analyzed by SDS 

so get electrophoresis. 

EXAMPLE II 

Characterization of Bovine Cartilage/Bone Inductive Factor 

55 

A. Molecular Weight 

Approximately 5^g protein from Example I In 6M urea, 25mM diethanolamine, pH 8.6, approximately 0.3 M NaCI 



8 



EP 0 429 570 B1 



is made 0.1% with respect to SDS and dialyzed against 50 mM tris/HCI 0.1% SDS pH 7.5 for 16 hrs. The dialyzed 
material is then electrophorectically concentrated against a dialysis membrane [Hunkapillar et al Meth. Enzymol. 91: 
227-236 (1 983)] with a small amount of 1 1 25 labelled counterpart. This material (volume approximately 1 0O^I) is loaded 
onto a 12% polyacrylamide gel and subjected to SDS-PAGE [Laemmli, U.K. Nature . 227:680-685 (1970)] without re- 

5 ducing the sample with dithiothreitol. The molecular weight is determined relative to prestained molecular weight stand- 
ards (Bethesda Research Labs). Following autoradiography of the unfixed gel the approximate 28,000-30,000 dalton 
band is excised and the protein electrophoretically eluted from the gel (Hunkapillar et al supra ). Based on similar purified 
bone fractions as described in the co-pending "BMP" applications described above wherein bone and/or cartilage 
activity is found in the 28,000-30,000 region, it is inferred that this band comprises bone and/or cartilage inductive 

10 fractions. 

B. Subunit Characterization 

The subunit composition of the isolated bovine bone protein is also determined. The eluted protein described 
15 above is fully reduced and alkylated in 2% SDS using iodoacetate and standard procedures and reconcentrated by 
electrophoretic packing. The fully reduced and alkylated sample is then further submitted to SDS-PAGE on a 12% gel 
and the resulting approximate 14,000-20,000 dalton region having a doublet appearance located by autoradiography 
of the unfixed gel. A faint band remains at the 28,000-30,000 region. Thus the 28,000-30,000 dalton protein yields a 
broad region ot 1 4,000-20,000 which may otherwise also be interpreted and described as comprising two broad bands 
20 of approximately 14,000-16,000 and 16.000-20,000 daltons. 

EXAMPLE III 

Rosen Modified Sampath-Reddi Assay 

25 

A modified version of the rat bone formation assay described in Sampath and Reddi, Proc. Natl. Acad. Sci. U.S. 
A., 80:6591 -6595 (1 983) is used to evaluate bone and/or cartilage activity of the proteins of the invention. This modified 
assay is herein called the Rosen-modified Sampath-Reddi assay. The ethanol precipitation step of the Sampath-Reddi 
procedure is replaced by dialyzing (if the composition is a solution) or diafiltering (if the composition is a suspension) 

50 the fraction to be assayed against water The solution or suspension is then redissolved in 0. 1 % TFA, and the resulting 
solution added to 20mg of rat matrix. A mock rat matrix sample not treated with the protein serves as a control. This 
material is frozen and lyophilized and the resulting powder enclosed in #5 gelatin capsules. The capsules are implanted 
subcutaneously in the abdominal thoracic area of 21 - 49 day old male Long Evans rats. The implants are removed 
after 7-14 days. Half of each implant is used for alkaline phosphatase analysis (See, A. H. Reddi et al., Proc. Natl 

35 Acad Sci.. 69:1601 (1972)]. 

The other half of each implant is fixed and processed for histological analysis. Glycolmethacrylate sections (l^m) 
are stained with Von Kossa and acid fuschin or toluidine blue to score the amount of induced bone and cartilage 
formation present in each implant. The terms +1 through -i-5 represent the area of each histological section of an implant 
occupied by new bone and/or cartilage cells and newly formed bone and matrix. Two scoring methods are herein 

40 described. In the first scoring method a score of +5 indicates that greater than 50% of the implant is new bone and/or 
cartilage produced as a direct result of protein in the implant. A score of +4, +3, +2 and +1 would indicate that greater 
than 40%, 30%, 20% and 10% respectively of the implant contains new cartilage and/or bone. The second scoring 
method (which hereinafter may be referred to as the modified scoring method) is as follows: three non-adjacent sections 
are evaluated from each implant and averaged. "+/-*■ indicates tentative identification of cartilage or bone; Vl " indicates 

^5 >10% of each section being new cartilage or bone; "+2", >25%; V3", >50%: "+4", -75%; "+5", >80%. The scores of 
the individual implants are tabulated to indicate assay variability. 

It is contemplated that the dose response nature of the cartilage and/or bone inductive protein containing samples 
of the matrix samples will demonstrate that the amount of bone and/or cartilage formed increases with the amount of 
cartilage/bone inductive protein in the sample. It is contemplated that the control samples will not result in any bone 

50 and/or cartilage formation. 

As with other cartilage and/or bone inductive proteins such as the above-mentioned "BMP' proteins, the bone and/ 
or cartilage formed is expected to be physically confined tothe space occupied by the matrix. Samples are also analyzed 
by SDS gel electrophoresis and isoelectric focusing followed by autoradiography The activity is correlated with the 
protein bands and pi. To estimate the purity of the protein in a particular fraction an extinction coefficient of 1 OD/mg- 

55 cm is used as an estimate for protein and the protein is run on SDS-PAGE followed by silver staining or radioiodination 
and autoradiography. 



9 



EP 0 429 570 B1 

EXAMPLE IV 

A. Bovine Protein Composition 

The gel slice of the approximate 14,000-20,000 dalton region described in Example IIB is fixed with methanol- 
acetic acid-water using standard procedures, briefly rinsed with water, then neutralized with 0.1M ammonium bicarbo- 
nate. Following dicing the gel slice with a razor blade, the protein is digested from the gel matrix by adding 0.2 pg of 
TRCK-treated trypsin (Worthington) and incubating the gel for 16 hr. at 37 degrees centigrade. The resultant digest is 
then subjected to RPHPLC using a C4 vydac RPHPLC column and 0.1% TFA-water 0.1% TFA water-acetonitrile 
gradient. The resultant peptide peaks were monitored by UV absorbance at 214 and 280 nm and subjected to direct 
amino terminal amino acid sequence analysis using an Applied Biosystems gas phase sequenator (Model 470A). One 
tryptic fragment is isolated by standard procedures having the following amino acid sequence as represented by the 
amino acid standard three-letter symbols and where "Xaa" indicates an unknown amino acid the amino acid in paren- 
theses indicates uncertainty in the sequence: 



Xaa-His-Glu-Leu-Tyr-Val-Ser-Phe-(Ser) 



The following four oligonucleotide probes are designed on the basis of the amino acid sequence of the above- 
identified tryptic fragment and synthesized on an automated DNA synthesizer. 



PROBE #1: GTRCTYGANATRCANTC 
PROBE #2: GTRCTYGANATRCANAG 



PROBE #3: GTRCTYAAYATRCANTC 
PROBE #4: GTRCTYAAYATRCANAG 

The standard nucleotide symbols in the above identified probes are as follows: A.adenosine; C.cytosine; G, gua- 
nine; T.thymine; N, adenosine or cytosine or guanine or thymine; R.adenosine or guanine; and Ycytosine or thymine. 

Each of the probes consists of pools of oligonucleotides. Because the genetic code is degenerate (more than one 
codon can code for the same amino acid), a mixture of oligonucleotides is synthesized that contains all possible nu- 
cleotide sequences encoding the amino acid sequence of the tryptic. These probes are radioactively labeled and em- 
ployed to screen a bovine cDNA library as described below. 

B. Bovine BMP-5 

Poly(A) containing RNA is isolated by oligo(dT) cellulose chromatography from total RNA isolated from fetal bovine 
bone cells by the method of Gehron-Robey et al in Current Advances in Skeietoqenesis. Elsevier Science Publishers 
(1985). The total RNA was obtained from Dr. Marion Young, National Institute of Dental Research, National Institutes 
of Health. A cDNA library is made in lambda gtIO (Toole et al supra ) and plated on 50 plates at 8000 recombinants 
per plate. These recombinants (400,000) are screened on duplicate nitrocellulose filters with a combination of Probes 
1,2,3, and 4 using the Tetramethylammonium chloride (TMAC) hybridization procedure (see Wozney et al Science . 
242 : 1528-1534 (1988)]. Twenty-eight positives are obtained and are replated for secondaries. Duplicate nitrocellulose 
replicas again are made. One set of filters are screened with Probes #1 and #2; the other with Probes #3 and #4. Six 
positives are obtained on the former, 21 positives with the latter One of the six, called HEL5, is plague purified, a phage 
plate stock made, and bacteriophage DNA isolated. This DNA is digested with EcoRI and subcloned into Ml 3 and 
pSP65 (Promega Btotec, Madison, Wisconsin) [Melton, et al. Nucl. Acids Res. 12: 7035-7056 (1984)]. The DNA se- 
quence and derived amino acid sequence of this fragment is shown in Table I. 

DNA sequence analysis of this fragment in Ml 3 indicates that it encodes the desired tryptic peptide sequence set 
forth above, and this derived amino acid sequence is preceded by a basic residue (Lys) as predicted by the specif rcity 



10 



EP 0 429 570 B1 



of trypsin. The underlined portion of the sequence in Table I from amino acid #42 to #48 corresponds to the tryptic 
fragment identified above from which the oligonucleotide probes are designed. The derived amino acid sequence Ser- 
Gly-Ser-His-Gln-Asp-Ser-Ser-Arg as set forth in Table t from amino acid #15 to #23 is noted to be similar to a tryptic 
fragment sequence Ser-Thr-Pro-Ala-Gln-Asp-Val-Ser-Arg found in the 28,000 - 30,000 dalton purified bone preparation 
as described in the "Bf^P" Publications W088/00205 and W089/10409 mentioned above. This fragment set forth in 
Table I is a portion of the DNA sequence which encodes a bovine BMP-5 protein. The DNA sequence shown in Table 
I indicates an open reading frame from the 5' end of the clone of 420 base pairs, encoding a partial peptide of 140 
amino acid residues (the first 7 nucleotides are of the adaptors used in the cloning procedure). An in^rame stop codon 
(TAA) indicates that this clone encodes the carboxy-terminal part of bovine BMP-S. 



TABLE I 



1 TCTAGAGGTGAGAGCAGCCAACAAGAGAAAAAATCAAAACCGCAATAAATCCGGCTCTCAT € 1 
LeuGluValArgAlaAlaAsnLysArgLysAsnGlnAsnArqAsnLvs SerGlvSerHifi 
(1) (15) 



6 2 CAGGACTCCTCTAGAATGTCCAGTGTTGGAGATTATAACACCAGTGAACAAAAACAAGCC 12 

GlnAspSerSerAraMetiSerSerVa1fl1yAgpTyy&cy^T>^yCai^r!ii^/^1nLy5GlnAla 
(23) 



122 TGTAAAAAGCATGAACTCTATGTGAGTTTCCGGGATCTGGGATGGCAGGACTGGATTATA 18 
CvsLvsLvsHisGluLeuTvrV alSerPheA rQAspLeuGlyTrpm nAgpTr-pTi o 
(42) (48) 

182 GCACCAGAAGGATATGCTGCATTTTATTGTGATGGAGAATGTTCTTTTCCACTCAATGCC 2 4 
AlaProGluGlyTyrAlaAlaPheTyrCysAspGlyGluCysSerPheProLeuAsnAla 

242 CATATGAATGCCACCAATCATGCOITAGTTCAGACTCTGGTTCACCTGATGTTTCCTGAC 3 0 
HisMetAsnAlaThrAsnHisAlalleValGlnThrLeuValHisLeuMetPheProAsp 



3 02 CACGTACCAAAGCCOTGCTGCGCGACAAACAAACTAAATGCCATCTCTGTGTTGTACTTT 3 6 
HlsValProLysProCysCysAlaThrAsnLysLeuAsnAlalleSerValLeuTyrPhe 



362 GATGACAGCTCCAATGTCATTTTGAAAAAGTACAGAAATATGGTCGTGCGTTCGTGTGGT 4 2 
AspAspSerSerAsnVallleLeuLysLysTyrArgABnMetValValArgSerCysGly 

422 TGCCACTAATAGTGCATAATAATGGTAATAAGAAAAAAGATCTGTATGGAGGTTTATGA 4 8 
CyeHisEnd 

(140) 

481 CTACAATAAAAAATATCTTTC<;G ATAAAAGGGG AATTTAAT AAAATTAGTCTGGCTC ATT 5 4 
541 TCATCTCTGTAACCTATGTACAAGAGCATGTATATAGT 578 



C. BovineBMP-6 

The remaining positive clones (the second set containing 21 positives) isolated with Probes #1, #2, #3, and #4 
described above are screened with HEL5 and a further clone is identified that hybridizes under reduced hybridization 
conditions [5x SSC, 0.1% SDS, SXOenhardt's, 100 ng/ml salmon sperm DNA standard hybridization buffer (SHB) at 
65''C, wash in 2XSSC 0.1% SDS at 65'*C]. This clone is plaque purified, a phage plate stock made and bacteriophage 
DNA isolated. The DNA sequence and derived amino acid sequence of a portion of this clone is shown in Table II. This 
sequence represents a portion of the DNA sequence encoding a bovine BMP-6 cartilage/bone protein of the invention. 

The first underlined portion of the sequence in Table II from amino acid #97 - amino acid #105 corresponds to the 
tryptic fragment found in the 28,000-30,000 dalton purified bovine bone preparation (and its reduced form at approxi- 



11 



EP 0 429 570 B1 



matety 18.000-20,000 dalton reduced form) as described in the "BMP" Publications W088/00205 and W089/10409 
mentioned above. The second underlined sequence in Table II from amino acid #124 - amino acid #130 corresponds 
to the tryptic fragment identified above from which the oligonucleotide probes are designed. 

The DNA sequence ot Table 11 indicates an open reading frame of 666 base pairs starting from the 5' end of the 
5 sequence of Table 11, encoding a partial peptide of 222 amino acid residues. An in-frame stop codon (TGA) indicates 
that this clone encodes the carboxy-terminal part of a bovine BMP-6 protein. Based on knowledge of other BMP proteins 
and other proteins in the TGF-p family, it is predicted that the precursor polypeptide would be cleaved at the three basic 
residues (ArgArgArg) to yield a mature peptide beginning with residue 90 or 91 of the sequence of Table II. 

10 



IS 



20 



25 



30 



35 



40 



45 



SO 



12 



EP 0 429 570 B1 



TABLE U 



9 18 27 36 45 54 

CIG CIG QGC AOG OCT GCT GIG TOG GOC TCk GAG GC3G QGC TGG CDS GAG TIT GAC 
Leu Leu Gly Uir Arg Ala Val Trp Ala Ser Glu Ala Gly Trp Leeu Glu Fhe Asp 
(1) 

63 72 81 90 99 108 

ATC AOG GOC AOC AGO AAC CIG TGG GIC CIG ACT OOG GAG CAC AAC ATG GGG CIG 
He Thr Ala Thr Ser Asn Leu Trp Val Leu Ihr Pro Gin His Asn WEI Gly leu 

117 126 135 144 153 162 

GAG CIG AGO GIG GIC AOG OCT GAT GGG CIC AGO ATC AGC OCT GGG GOC GOG GGC 
Gin leu Ser V£d Val Ihr Arg Asp Gly Leu Ser He Ser Tro Gly Ala Ala Gly 

171 180 189 198 207 216 

CIG GIG GGC AOG GACGGCOOCTACGACAAGCAGOOCTTC ATG GIG GOC TIC TTC 
Leu Val Gly Arg Asp Gly Fro Hyr Asp lys Gin Pro Fhe MET Val Ala Fhe File 

225 234 243 252 261 270 

AAG GOC ACT GAG GTC CAC GIG CGC ACT GOC OOG TOG GOC 000 GGG OGG OGC OGG 
lys Ala Ser Glu Val His Val Arg Ser Ala Arg Ser Ala Gly Arg Arg Arg 

279 288 297 306 315 324 

CAG CAG GOC OGG AAC OGCTOCACCOOGGOCCAGGACGIG TOG OGG GOC TOC AGC 
Gin Gin Ala Arg Asn Arg Ser Thr Pro Ala Gin Asp Val Ser Arcr Ala Ser Ser 

(97) (105) 
333 342 351 360 369 378 

GCC TCA GAC TAC AAC AGC AGC GAG CIG AAG AOG GOC TOO OGG AAG CAT GAG CIC 
Ala Ser Asp lyr Asn Ser Ser Glu Leu I^ Thr Ala cys Arg lys His Glu Leu 

(121) (124) 
387 396 405 414 423 432 

TAC GIG AGC TIC CAG GAC CTG GGG TGG CAG GAC TGG ATC ATT GOC OCC AAG GGC 
Tvr Val Ser Ihe Gin Asp Leu Gly Trp Gin Asp Trp He He Ala Pro lys Gly 
(130) 

441 450 459 468 477 486 

lAC GCT GOC AAC TAC TCTGACGGAGAATCTTOGTICOCTCrC AAC GCA CAC ATG 
lyr Ala Ala Asn Tyr Cys Asp Gly Glu Cys Ser Ihe Pro leu Asn Ala His MET 

495 504 513 522 531 540 

AAC GCT AOC AAC CAT GCC ATC GIG CAG ADC CTG GTT CAC CTC ATG AAC GOC GAG 
Asn Ala Thr Asn His Ala He Val Gin Thr Leu Val His Leu HEP Asn Pro Glu 



13 



EP 0 429 570 B1 



TXBIE II 











(page 2 of 2) 










549 


558 


567 576 


585 


594 


TAC 


GIC 

VcLL 


OOC 

xXw 


AAA OQS TOC 

IJfB xXu L.yS 


IGC GOS OOC AOS AAA CnG 

Cys aIA rXu IZjx Uyo JJSU 


AAC GOC ATC 

%<5ri &1» Tla 
ASn nla xj.e 


TOG GTC Crc 

Gav- t7a1 Tm« 

oGX^ VoX JUEfU 






603 


612 


621 630 


639 


648 


TAC 


TTC 
Hie 


GAC 
Asp 


GAC AAC !IOC 
Asp Asn ser 


AAT GIC ATC CIG AAG AAG 
A&n Val lie Lgu lys lys 


1AC OGG AAC 
oyr Arg Asn 


KTG GTC Glk 
MET Val val 






657 


666 


676 686 


696 


706 



OGA GOS OCT GGG TCC CAC OGACTOtaCSQG TCAGTOGCIG GGGAOGCTST GCACACACIG OCTQGACia: 
Arg Ala Cys Gly His 

(222) 

726 736 746 756 766 776 786 

20 IGGAICAOST OOSOCmAG OOCACAGAGG OCOOOSGGAC ACAGGAOGAG AOOOOGAGGC CAOCTiaSGC 

796 806 816 826 836 846 856 

roGOGTTOGC CnrOOGOOC AAOGCAGAOC OGAAGGGAOC CICT00300C mUTlUA Ql OOCSTCAGOST 

2s 866 876 886 

roXGAOIAGC CATOGGGCTC TAGGAAGCAG CACIOGAG 



30 EXAMPLE V 

A. Human Protein Composition 

Human celt lines which synthesize BMP-5 and/or BMP-6 mRNAs are identified in the following manner. RNA is 
35 isolated from a variety of human cell lines, selected for poly(A)-containing RNA by chromatography on oligo(dT) cel- 
lulose, electrophoresed on a formaldehyde-agarose gel, and transferred to nitrocellulose. A nitrocellulose replica of 
the gel is hybridized to a single stranded Ml 3 ^^p-iabeled probe corresponding to the above mentioned BMP-5 EcoRl- 
Bglll fragment containing nucleotides 1-465 of the sequence of Table I. A strongly hybridizing band is detected in the 
lane corresponding to the human osteosarcoma cell line U-20S RNA. Another nitrocellulose replica is hybridized to a 
40 single stranded M13 ^^p-iabeled probe containing the Pstl-Smal fragment of bovine BMP-6 (corresponding to nucle- 
otides 106-261 of Table II). It is found that several RNA species in the lane corresponding to U-20S RNA hybridize to 
this probe. 

A cDNA Library is made in the vector lambda ZAP (Stratagene) from U-20S poly(A)-containing RNA using estab- 
lished techniques (Toole et al.). 750,000 recombinants of this library are plated and duplicate nitrocellulose replicas 

45 made. The Smal fragment of bovine BMP-6 corresponding to nucleotides 259-751 of Table II is labeled by nick-trans- 
lation and hybridized to both sets of filters in SHB at 65°C. One set of filters is washed under stringent conditions (0.2X 
SSC, 0.1% SDS at 65''C). the other under reduced stringency conditions (1X SSC, 0.1% SOS at 65''C). Many duplicate 
hybridizing recombinants (approximately 162) are noted. 24 are picked and replated for secondaries. Three nitrocel- 
lulose replicas are made of each plate. One is hybridized to the BMP-6 Smal probe, one to a nick-translated BMP-6 

50 Pstl-SacI fragment (nucleotides 106-378 of Table II), and the third to the nick-translated BMP-5 Xbal fragments (nu- 
cleotides 1 -76 of Table I). Hybridization and washes are carried out under stringent conditions. 

B. Human BMP-5 Proteins 

55 17 clones that hybridize to the third probe more strongly than to the second probe are plaque purified. ON A se- 

quence analysis of one of these, U2-16, indicates that it encodes human BMP-5. U2-16 was deposited with the Amer- 
ican Type Culture Collection (ATCC), Rockville, Maryland on June 22, 1989 under accession number ATCC 68109. 
This deposit as well as the other deposits described herein are made under the provisions of the Budapest Treaty on 



14 



EP 0 429 570 B1 



the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure and the Regu- 
lations thereunder (Budapest Treaty). U2-16 contains an insert of approximately 2.1 Kb. The DNA sequence and de- 
rived amino acid sequence of U2-16 is shown below in Table III. This clone is expected to contain all of the nucleotide 
sequence necessary to encode human BMP-5 proteins. The cDNA sequence of Table III contains an open reading 

5 frame of 1362 bp, encoding a protein of 454 amino acids, preceded by a 5' untranslated region of 700 bp with stop 
codons in all frames, and contains a 3' untranslated region of 90 bp following the in frame stop codon (TAA). 

This protein of 454 amino acids has a molecular weight of approximately 52,000 daltons as predicted by its amino 
acid sequence, and is contemplated to represent the primary translation product. Based on knowledge of other BMP 
proteins and other proteins within the TGF-p family, it is predicted that the precursor polypeptide would be cleaved at 

10 the tribasic peptide Lys Arg Lys yielding a 132 amino acid mature peptide beginning with amino acid #323 "Asn". The 
processing of BMP-5 into the mature form is expected to involve dimerization and removal of the N-terminal region in 
a manner analogous to the processing of the related protein TGF-p [L.E. Gentry, et ai., Molec. & Cell. Biol. 8:4162 
(1988); R. Dernyck, et al., Nature 316:701(1985)]. 

It is contemplated therefore that the mature active species of BMP-5 comprises a homodimer of 2 polypeptide 

15 subunits each subunit comprising amino acid #323 - #454 with a predicted molecular weight of approximately 1 5,000 
daltons. Further active BMP-5 species are contemplated, for example, proprotein dimers or proprotein subunits linked 
to mature subunits. Additional active species may comprise amino acid #329 - #454 such species including homologous 
the tryptic sequences found in the purified bovine material. Also contemplated are BMP-5 proteins comprising amino 
acids #353-#454 thereby including the first conserved cysteine residue. 

20 The underlined sequence of Table III from amino acid #329 to #337 Ser-Ser-Ser-His-Gln-Asp-Ser-Ser-Arg shares 

homology with the bovine sequence of Table I from amino acid #15 to #23 as discussed above in Example tV. Each 
of these sequences shares homology with a tryptic fragment sequence Ser-Thr-Pro-Ala-Gln-Asp-Val-Ser-Arg found in 
the 28,000 - 30,000 dalton purified bone preparation (and its reduced form at approximately 18,000 - 20,000 daltons) 
as described in the "BMP" published applications WO88/00205 and WO89/10409 mentioned above. 

25 The underlined sequence of Table III from amino acid #356 to #362 His-Glu-Leu-Tyr-Val-Ser-Phe corresponds to 

the tryptic fragment identified in the bovine bone preparation described above from which the oligonucleotide probes 
are designed. 

30 



35 



40 



45 



50 



55 



15 



EP 0 429 570 B1 



TABLE III 



10 


20 


30 


40 


50 


CTGGTATATT 


TGTGCCTGCT 


GGAGGTGGAA 


TTAACAGTAA 


GAAGGAGAAA 


60 


70 


80 


90 


100 


GGGATTGAAT 


GGACTTACAG 


GAAGGATTTC 


AAGTAAATTC 


AGGGAAACAC 


110 


120 


130 


140 


150 


ATTTACTTGA 


ATAGTACAAC 


CTAGAGTATT 


ATTTTACACT 


AAGACGACAC 


160 


170 


180 


190 


200 


AAAAGATGTT 


AAAGTTATCA 


CCAAGCTGCC 


GGACAGATAT 


ATATTCCAAC 


210 


220 


230 


240 


250 


ACCAAGGTGC 


AGATCAGCAT 


AGATCTGTGA 


TTCAGAAATC 


AGGATTTGTT 


260 


270 


280 


290 


300 


TTGGAAAGAG 


CTCAAGGGTT 


6AGAAGAACT 


CAAAAGCAAG 


TGAAGATTAC 


310 


320 


330 


340 


350 


TTTGGGAACT 


ACAGTTTATC 


AGAAGATCAA 


CTTTTGCTAA 


TTCAAATACC 


360 


370 


380 


390 


400 


AAA6GCCTGA 


TTATCATAAA 


TTCATATAGG 


AATGCATAGG 


TCATCTGATC 


410 


420 


430 


440 


450 


AAATAATATT 


AGCCGTCTTC 


TGCTACATCai 


ATGCAGCAAA 


AACTCTTAAC 


460 


470 


480 


490 


500 


AACTGTG6AT 


AATTGGAAAT 


CTGAGTTTCA 


GCTTTCTTAG 


AAATAACTAC 


510 


520 


530 


540 


550 


TCTTGACATA 


TTCCAAAATA 


TTTAAAATAG 


GACAGGAAAA 


TCGGTGAG6A 


560 


570 


580 


590 


600 


TGTTGTGCTC 


AGAAATGTCA 


CTGTCATGAA 


AAATA6GTAA 


ATTTGTTTTT 


610 


620 


630 


640 


650 


TCAGCTACTG 


GGAAACTGTA 


CCTCCTAGAA 


CCTTAGGTTT 




660 


670 


680 


690 


700 


AAGAGGACAA 


GAAGGACTAA 


AAATATCAAC 


TTTTGCTTTT 


GGACAAAA 



16 



EP 0 429 570 B1 



TABLE III 
(page 2 Of 4) 

701 710 719 728 737 

ATG CAT CTG ACT GTA TTT TTA CTT AAG GGT ATT GTG GGT TTC CTC 

MET His Leu Thr Val Phe Leu Leu Lys Gly lie Val Gly Phe Leu 

(1) 

746 755 764 773 782 

TGG AGC TGC TGG GTT CTA GTG GGT TAT GCA AAA GGA GGT TTG GGA 

Trp Ser Cys Trp Val Leu Val Gly Tyr Ala Lys Gly Gly Leu Gly 

791 800 809 818 827 

GAC AAT CAT GTT CAC TCC AGT TTT ATT TAT AGA AGA CTA CGG AAC 

Asp Asn His Val His Ser Ser Phe He Tyr Arg Arg Leu Arg Asn 

836 845 854 863 872 

CAC GAA AGA CGG GAA ATA CAA AGG GAA ATT CTC TCT ATC TTG GGT 

His Glu Arg Arg Glu He Gin Arg Glu He Leu Ser He Leu Gly 

881 890 899 908 917 

TTG CCT CAC AGA CCC AGA CCA TTT TCA CCT GGA AAA ATG ACC AAT 

Leu Pro His Arg Pro Arg Pro Phe Ser Pro Gly Lys Gin Ala Ser 

926 935 944 953 962 

CAA GCG TCC TCT GCA CCT CTC TTT ATG CTG GAT CTC TAC AAT GCC 

Ser Ala Pro Leu Phe MET Leu Asp Leu Tyr Asn Ala MET Thr Asn 

971 980 989 998 1007 

GAA GAA AAT CCT GAA GAG TCG GAG TAC TCA GTA AGG GCA TCC TTG 

Glu Glu Asn Pro Glu Glu Ser Glu Tyr Ser Val Arg Ala Ser Leu 

1016 1025 1034 1043 1052 

GCA GAA GAG ACC AGA GGG GCA AGA AAG GGA TAC CCA GCC TCT CCC 
Ala Glu Glu Thr Arg Gly Ala Arg Lys Gly Tyr Pro Ala Ser Pro 

1061 1070 1079 1088 1097 

AAT GGG TAT CCT CGT CGC ATA CAG TTA TCT CGG ACG ACT CCT CTG 
Asn Gly Tyr Pro Arg Arg He Gin Leu Ser Arg Thr Thr Pro Leu 

1106 1115 1124 1133 1142 

ACC ACC CAG AGT CCT CCT CTA GCC AGC CTC CAT GAT ACC AAC TTT 
Thr Thr Gin Ser Pro Pro Leu Ala Ser Leu His Asp Thr Asn Phe 

1151 1160 1169 1178 1187 

CTG AAT GAT GCT GAC ATG GTC ATG AGC TTT GTC AAC TTA GTT GAA 
Leu Asn Asp Ala Asp MET Val MET Ser Phe Val Asn Leu Val Glu 

1196 1205 1214 1223 1232 

AGA GAC AAG GAT TTT TCT CAC CAG CGA AGG CAT TAC AAA GAA TTT 
Arg Asp Lys Asp Phe Ser His Gin Arg Arg His Tyr Lys Glu Phe 



17 



EP 0 429 570 B1 



TABLE III 
(page 3 of 4) 

1241 1250 1259 1268 1277 

CGA TTT GAT CTT ACC CAA ATT CCT CAT GGA GAG GCA GTG ACA GCA 
Arg Phe Asp I-eu Thr Gin lie Pro His Gly Glu Ala Val Thr Ala 

1286 1295 1304 1313 1322 

GCT GAA TTC CGG ATA TAC AAG GAC CGG AGC AAC AAC CGA TTT GAA 
Ala Glu Phe Arg lie Tyr Lys Asp Arg Ser Asn Asn Arg Phe Glu 

1331 1340 1349 1358 1367 

AAT GAA ACA ATT AAG ATT AGC ATA TAT CAA ATC ATC AAG GAA TAC 
Asn Glu Thr lie Lys lie Ser He Tyr Gin He He Lys Glu Tyr 

1376 1385 1394 1403 1412 

ACA AAT AGG GAT GCA GAT CTG TTC TTG TTA GAC ACA AGA AAG GCC 
Thr Asn Arg Asp Ala Asp Leu Phe Leu Leu Asp Thr Arg Lys Ala 

1421 1430 1439 1448 1457 

CAA GCT TTA GAT GTG GGT TGG CTT GTC TTT GAT ATC ACT GTG ACC 
Gin Ala Leu Asp Val Gly Trp Leu Val Phe Asp He Thr Val Thr 

1466 1475 1484 1493 1502 

AGC AAT CAT TGG GTG ATT AAT CCC CAG AAT AAT TTG GGC TTA CAG 
Ser Asn His Trp Val He Asn Pro Gin Asn Asn Leu Gly Leu Gin 

1511 1520 1529 1538 1547 

CTC TGT GCA GAA ACA GGG GAT GGA CGC AGT ATC AAC GTA AAA TCT 
Leu Cys Ala Glu Thr Gly Asp Gly Arg Ser He Asn Val Lys Ser 

1556 1565 1574 1583 1592 

GCT GGT CTT GTG GGA AGA CAG GGA CCT CAG TCA AAA CAA CCA TTC 
Ala Gly Leu Val Gly Arg Gin Gly Pro Gin Ser Lys Gin Pro Phe 

1601 1610 1619 1628 1637 

ATG GTG GCC TTC TTC AAG GCG AGT GAG GTA CTT CTT CGA TCC GTG 
MET Val Ala Phe Phe Lys Ala Ser Glu Val Leu Leu Arg Ser Val 

1646 1655 1664 1673 1682 

AGA GCA GCC AAC AAA CGA AAA AAT CAA AAC CGC AAT AAA TCC AGC 
Arg Ala Ala Asn Lys Arg Lys Asn Gin Asn Arg Asn Lys §er Ser 

(323) (329) 

1691 1700 1709 1718 1727 

TCT CAT CAG GAC TCC TCC AGA ATG TCC AGT GTT GGA GAT TAT AAC 
Ser His Gin Asp Ser Ser Ara MET Ser Ser Val Gly Asp Tyr Asn 

(337) 



18 



EP 0 429 570 B1 



TABLE III 
(page 4 of 4) 

1736 1745 1754 1763 1772 

ACA AGT GAG CAA AAA CAA GCC TGT AAG AAG CAC GAA CTC TAT GTG 
Thr Ser Glu Gin Lys Gin Ala Cys Lys Lys His Glu Leu Tvr Val 

(356) 

1781 1790 1799 1808 1817 

AGC TTC CGG GAT CTG GGA TGG CAG GAC TGG ATT ATA GCA CCA GAA 
Ser Phe Arg Asp Leu Gly Trp Gin Asp Trp He He Ala Pro Glu 
(362) 

1826 1835 1844 1853 1862 

GGA TAC GCT GCA TTT TAT TGT GAT GGA GAA TGT TCT TTT CCA CTT 
Gly Tyr Ala Ala Phe Tyr Cys Asp Gly Glu Cys Ser Phe Pro Leu 

1871 1880 1889 1898 1907 

AAC GCC CAT ATG AAT GCC ACC AAC CAC GCT ATA GTT CAG ACT CTG 
Asn Ala His MET Asn Ala Thr Asn His Ala He Val Gin Thr Leu 

1916 1925 1934 1943 1952 

GTT CAT CTG ATG TTT CCT GAC CAC GTA CCA AAG CCT TGT TGT GCT 
Val His Leu MET Phe Pro Asp His Val Pro Lys Pro Cys Cys Ala 

1961 1970 1979 1988 1997 

CCA ACC AAA TTA AAT GCC ATC TCT GTT CTG TAC TTT GAT GAC AGC 
Pro Thr Lys Leu Asn Ala He Ser Val Leu Tyr Phe Asp Asp Ser 

2006 2015 2024 2033 2042 

TCC AAT GTC ATT TTG AAA AAA TAT AGA AAT ATG GTA GTA CGC TCA 
Ser Asn Val He Leu Lys Lys Tyr Arg Asn MET Val Val Arg Ser 

(450) 

2051 2060 2070 2080 2090 2100 

TGT GGC TGC CAC TAATATTAAA TAATATTGAT AATAACAAAA AGATCTGTAT 
Cys Gly cys His 
(454) 

2110 2120 2130 2140 2150 

TAAGGTTTAT GGCTGCAATA AAAAGCATAC TTTCAGACAA ACAGAAAAAA AAA 



The tryptic sequence His-Glu-Leu-Tyr-Val-Ser-Phe-(Ser) described above is noted to be similar to the sequence 
His-Pro-Leu-Tyr-Val-Asp-Phe-Ser found in the bovine and human cartilage/bone protein BMP-2A sequence, for in- 
stance as described in Publication WO 88/00205. Human BMP-5 shares homology with other BMP molecules as well 
as other members of the TGF-p superfamily of molecules. The cysteine-rich carboxy-terminal 1 02 amino acid residues 
of human BMP-5 shares the following homologies with BMP proteins disclosed herein and In Publications WO 88/00205 
and WO 89/10409 described above: 61% identity with BMP-2; 43% identity with BMP-3, 59% identity with BMP-4; 91 % 
identity with BMP-6; and 88% identity with BMP-7. Human BMP-5 further shares the following homologies: 38% identity 
with TGF-P3: 37% identity with TGF-P2; 36% identity with TGF-pl: 25% Identity with Mullerian Inhibiting Substance 
(MIS), a testicular glycoprotein that causes regression of the Mullerian duct during development of the male embryo; 
25% identity with inhibin a; 38% identity with inhibin Pg; 45% identity with inhibin P;^; 56% identity with Vgl, a Xenopus 
factor which may be involved in mesoderm Induction in early embryogenesis (Weeks and Melton, Cell 51 :861-867 
(1 987)); and 57% identity with Dpp the product of the Drosophila decapentaptegic locus which is required for dorsal- 
ventral specification in early embryogenesis and is involved in various other developmental processes at later stages 
of development [Padgett, et al.. Nature 325 :61-64 (1987)]. 



19 



EP 0 429 570 B1 



C. Human BMP-6 Proteins 

Six clones which hybridize to the second probe described in Example V.A. more strongly than to the third are 
picked and transformed into plasmids. Restriction mapping, Southem blot analysis, and DNA sequence analysis of 

s these plasmids Indicate that there are two classes of clones. Clones U2-7 and U2-10 contain human BMP-6 coding 
sequence based on their stronger hybridization to the second probe and closer DNA homology to the bovine BMP-6 
sequence of Table il than the other 4 clones. DNA sequence data derived from these clones indicates that they encode 
a partial polypeptide of 132 amino acids comprising the carboxy-terminus of the human BMP-6 protein. U2-7 was 
deposited with the American Type Culture Collection (ATCC), Rockville, Maryland on June 23, 1989 under accession 

10 number 68021 under the provisions of the Budapest Treaty. 

A primer extended cDN A library is made from U-2 OS mRN A using the oligonucleotide GGAATCCAAGGCAGAAT- 
GTG. the sequence being based on the 3' untranslated sequence of the human BMP-6 derived from the clone U2-10. 
This library is screened with an oligonucleotide of the sequence CAG AGTCGTAATCGC, derived from the BMP-6 coding 
sequence of U2-7 and U2-10. Hybridization is in standard hybridization buffer (SHB) at 42 degrees centigrade, with 

IS wash conditions of 42 degrees centigrade, 6X SSC, 0.1% SDS. Positively hybridizing clones are isolated. The DNA 
insert of one of these clones, PEH6-2, indicates that it extends further in a 5' direction than either U2-7 or U2-10. A 
primer extended cDNA library constructed from U-20S mRNA as above is screened with an oligonucleotide of the 
sequence GCCTCTCCCCCTCCGACGCCCCGTCCTCGT derived from the sequence near the 5* end of PEH6-2. Hy- 
bridization is at 65 degrees centigrade in SHB, with washing at 65 degrees centigrade in 2X SSC. 0.1% SDS. Positively 

20 hybridizing recombinants are isolated and analyzed by restriction mapping and DNA sequence analysis. 

The 5' sequence of the insert of one of the positively hybridizing recombinants, PES834#7, is used to design an 
oligonucleotide of the sequence CTGCTGCTCCTCCTGCTGCCGGAGCGC. A random primed cDNA library [synthe- 
sized as for an oligo (dT) primed library except that (dN)e is used as the primer] is screened with this oligonucleotide 
by hybridization at 65 degrees centigrade in SHB with washing at 65 degrees centigrade in IX SSC, 0.1% SDS. A 

25 positively hybridizing clone. RP10. is identified, isolated, and the DNA sequence sequence from the 5' end of its insert 
is determined. This sequence is used to design an Oligonucletide of the sequence TCGGGCTTCCTGTACCGGCG- 
GCTCAAGACGCAGGAGAAGCGGGAGATGCA. A human placenta cDNA library (Stratagene catalog #936203) is 
screened with this oligonucleotide by hybridization in SHB at 65 degrees centigrade, and washing at 65 degrees cen- 
tigrade with 0.2 X SSC, 0.1% SDS. A positively hybridizing recombinant designated BMP6C35 is isolated. DNA se- 

30 quence analysis of the insert of this recombinant indicates that it encodes the complete human BMP-6 protein. 
BMP6C35 was deposited with the American Type Culture Collection, 12301 Parklawn Drive, Rockville. Maryland USA 
on March 1, 1990 under Accession Number 68245 under the provisions of the Budapest Treaty. 

The DNA and derived amino acid sequence of the majority of the insert of BMP6C35 is given in Table IV This DNA 
sequence contains an open reading frame of 1539 base pairs which encodes the 51 3 amino acid human BMP-6 protein 

35 precursor. The presumed initiator methionine codon is preceded by a 5'untranslated sequence of 159 base pairs with 
stop codons in all three reading frames. The stop codon at nucleotides 1699-1701 is followed by at least 1222 base 
pairs of 3' untranslated sequence. It is noted that U2-7 has a C residue at the position corresponding to the T residue 
at position 1221 of BMP6C35; U2-7 also has a C residue at the position corresponding to the G residue at position 
1253 of BMP6C35. These do not cause amino acid differences in the encoded proteins, and presumably represent 

40 allelic variations. 

The oligonucleotide TCGGGCTTCCTGTACCGGCGGCTCAAGACGCAGGAGAAGCGGGAGATGCA is used to 
screen a human genomic library (Toole et al supra ), by hybridizing nitrocellulose replicas of 1 X 10^ recombinants with 
the oligonucleotide in SHB at 65 degrees centigrade, and washing at 65 degrees centigrade with 0.2 X SSC, 0.1% 
SDS. Positively hybridizing clones are purified. The oligonucleotide hybridizing region is localized to an approximately 

45 1 .5 kb Pst I fragment. DNA sequence analysis of this fragment confirms the 5' sequence indicated in Table IV. 

The first underlined portion of the sequence in Table IV from amino acid #388 to #396, Ser-Thr-Gln-Ser-Gln-Asp- 
Val-Ala-Arg, corresponds to the similar sequence Ser-Thr-Pro-Alg-Gln-Asp-Val-Ser-Arg of the bovine sequence de- 
scribed above and set forth in Table II. The second underlined sequence in Table IV from amino acid #415 through 
#421 His-Glu-Leu-Tyr-Val-Ser-Phe, corresponds to the tryptic fragment identified above from which the oligonucleotide 

so probes are designed. The tryptic sequence His-Glu-Leu-Tyr-Val-Ser-Phe-(Ser) is noted to be similar to a. sequence 
found in other BMP proteins for example the sequence His-Pro-Leu-Tyr-Val-Asp-Phe-Ser found in the bovine and 
human cartilage/bone protein BMP-2 sequence as described in Publication WO 88/00205. BMP^ therefore represents 
a new member of the BMP subfamily of TGF-p like molecules which includes the molecules BMP-2, BMP-3, BMP-4 
described in Publications WO 88/00205 and WO 89/10409, as well as BMP-5 and BMP-7 described herein. 

ss Based on knowledge of other BMP proteins, as well as other proteins in the T-GF-p family, BMP-6 is predicted to 

be synthesized as a precursor molecule and the precursor polypeptide would be cleaved between amino acid #381 
and amino acid #382 yielding a 1 32 amino acid mature polypeptide with a calculated molecular weight of approximately 
15Kd. The mature form of BMP-6 contains three potential N-linked glycosylation sites per polypeptide chain as does 



20 



EP 0 429 570 B1 



BMP-5. 

The processing of BMP-6 into the mature form is expected to involve dimerization and removal of the N-terminal 
region in a manner analogous to the processing of the related protein TGF-p (L,E. Gentry, et al., (1988); R. Dernyck, 
et al., (1985) supra ). It is contemplated that the active BMP-6 protein molecule is a dimer. It is further contemplated 
that the mature active species of BMP-5 comprises protein molecule is a homodimer comprised of two polypeptide 
subunits each subunit comprising amino acid #382 - #51 3 as set forth in Table IV. Further active species of BMP-6 are 
contemplated such as phoprotein dimers or a proprotein subunit and a mature subunit. Additional active BMP-5 proteins 
may comprise amino acid #388 - #513 thereby including the tryptic fragments found in the purified bovine material. 
Another BMP-5 protein of the invention comprises amino acid #41 2 - #51 3 thereby Including the first conserved cystine 
residue. 



21 



EP 0 429 570 B1 



TABLE IV 

10 20 30 40 50 

CGACCATGAG AGATAAGGAC TGAGGGCCAG GAAGGGGAAG CGAGCCCGCC 



60 70 80 90 100 

GAGAGGTGGC GGGGACTGCT CACGCCAAGG GCCACAGCGG CCGCGCTCC6 



110 120 130 140 150 

GCCTCGCTCC GCCGCTCCAC GCCTCGCCGG ATCCGCGGGG GCAGCCCGfGC 



159 168 177 186 195 

CGGGCGGGG ATG CCG GGG CTG GGG CGG AGG GCG CAG TGG CTG TGC 
MET Pro Gly Leu Gly Arg Arg Ala Gin Trp Leu Cys 
(1) 

204 213 222 231 240 

TGG TGG TGG GGG CTG CTG TGC AGC TGC TGC GGG CCC CCG CCG CTG 
Trp Trp Trp Gly Leu Leu Cys Ser Cys Cys Gly Pro Pro Pro Leu 



249 258 267 276 285 

CGG CCG CCC TTG CCC GCT GCC GCG GCC GCC GCC GCC GGG GGG CAG 
Arg Pro Pro Leu Pro Ala Ala Ala Ala Ala Ala Ala Gly Gly Gin 



294 303 312 321 330 

CTG CTG GGG GAC GGC GGG AGC CCC GGC CGC ACG GAG CAG CCG CCG 
Leu Leu Gly Asp Gly Gly Ser Pro Gly Arg Thr Glu Gin Pro Pro 



339 348 357 366 375 

CCG TCG CCG CAG TCC TCC TCG GGC TTC CTG TAC CGG CGG CTC AAG 
Pro Ser Pro Gin Ser Ser Ser Gly Phe Leu Tyr Arg Arg Leu Lys 



384 393 402 411 420 

ACG CAG GAG AAG CGG GAG ATG CAG AAG GAG ATC TTG TCG GTG CTG 
Thr Gin Glu Lys Arg Glu MET Gin Lys Glu lie Leu Ser Val Leu 



429 

GGG CTC CCG 
Gly Leu Pro 



438 

CAC CGG CCC 
His Arg Pro 



447 

CGG CCC CTG 
Arg Pro Leu 



456 

CAC GGC CTC 
His Gly Leu 



465 

CAA CAG CCG 
Gin Gin Pro 



22 



EP 0 429 570 B1 



Table IV 
(page 2 of 6) 

474 483 492 501 510 

CAG CCC CCG GCG CTC CGG CAG CAG GAG GAG CAG CAG CAG CAG CAG 
Gin Pro Pro Ala Leu Arg Gin Gin Glu Glu Gin Gin Gin Gin Gin 



519 528 537 546 555 

CAG CTG CCT CGC GGA GAG CCC CCT CCC GGG CGA CTG AAG TCC GCG 
Gin Leu Pro Arg Gly Glu Pro Pro Pro Gly Arg Leu Lys Ser Ala 



564 573 582 591 600 

CCC CTC TTC ATG CTG GAT CTG TAC AAC GCC CTG TCC GCC GAC AAC 
Pro Leu Phe MET Leu Asp Leu Tyr Asn Ala Leu Ser Ala Asp Asn 



609 618 627 636 645 

GAC GAG GAC GGG GCG TCG GAG GGG GAG AGG CAG CAG TCC TGG CCC 
Asp Glu Asp Gly Ala Ser Glu Gly Glu Arg Gin Gin Ser Trp Pro 



654 663 672 681 690 

CAC GAA GCA GCC AGC TCG TCC CAG CGT CGG CAG CCG CCC CCG GGC 
His Glu Ala Ala Ser Ser Ser Gin Arg Arg Gin Pro Pro Gly Ser 



699 708 717 726 735 

GCC GCG CAC CCG CTC AAC CGC AAG AGC CTT CTG GCC CCC GGA TCT 
Pro Pro Gly Ala Ala His Pro Leu Asn Arg Lys Ser Leu Leu Ala 



744 753 762 771 780 

GGC AGC GGC GGC GCG TCC CCA CTG ACC AGC GCG CAG GAC AGC GCC 
Gly Ser Gly Gly Ala Ser Pro Leu Thr Ser Ala Gin Asp Ser Ala 



789 798 807 816 825 

TTC CTC AAC GAC GCG GAC ATG GTC ATG AGC TTT GTG AAC CTG GTG 
Phe Leu Asn Asp Ala Asp MET Val MET Ser Phe Val Asn Leu Val 



834 843 852 861 870 

GAG TAC GAC AAG GAG TTC TCC CCT CGT CAG CGA CAC CAC AAA GAG 
Glu Tyr Asp Lys Glu Phe Ser Pro Arg Gin Arg His His Lys Glu 



879 888 897 906 915 

TTC AAG TTC AAC TTA TCC CAG ATT CCT GAG GGT GAG GTG GTG ACG 
Phe Lys Phe Asn Leu Ser Gin lie Pro Glu Gly Glu Val Val Thr 



23 



EP 0 429 570 B1 



Table IV 
(page 3 of 6) 



924 933 942 951 960 

GCT GCA GAA TTC CGC ATC TAG AAG GAG TGT GTT ATG GGG AGT TTT 
Phe Arg lie Tyr Lys Asp Cys Val MET Ala Ala Glu Gly Ser Phe 



969 978 987 996 1005 

AAA AAC CAA ACT TTT CTT ATC AGC ATT TAT CAA GTC TTA CAG GAG 
Lys Asn Gin Thr Phe Leu lie Ser lie Tyr Gin Val Leu Gin Glu 

1014 1023 1032 1041 1050 

CAT CAG CAC AGA GAC TCT GAC CTG TTT TTG TTG GAC ACC CGT GTA 
His Gin His Arg Asp Ser Asp Leu Phe Leu Leu Asp Thr Arg Val 



1059 1068 1077 1086 1095 

GTA TGG GCC TCA GAA GAA GGC TGG CTG GAA TTT GAC ATC ACG GCC 
Val Trp Ala Ser Glu Glu Gly Trp Leu Glu Phe Asp lie Thr Ala 

1104 1113 1122 1131 1140 

ACT AGC AAT CTG TGG GTT GTG ACT CCA CAG CAT AAC ATG GGG CTT 
Thr Ser Asn Leu Trp Val Val Thr Pro Gin His Ash MET Gly Leu 

1149 1158 1167 1176 1185 

CAG CTG AGC GTG GTG ACA AGG GAT GGA GTC CAC GTC CAC QCC CGA 
Gin Leu Ser Val Val Thr Arg Asp Gly Val His Val His Pro Arg 

1194 1203 1212 1221 1230 

GCC GCA GGC CTG GTG GGC AGA GAC GGC COT TAG GAT AAG CAG CCC 
Ala Ala Gly Leu Val Gly Arg Asp Gly Pro Tyr Asp Lys Gin Pro 



1239 1248 1257 1266 1275 

TTC ATG GTG GCT TTC TTC AAA GTG AGT GAG GTC CAC GTG CGC ACC 
Phe MET Val Ala Phe Phe Lys Val Ser Glu Val His Val Arg Thr 

1284 1293 1302 1311 1320 

ACC AGG TCA GCC TCC AGC CGG CGC CGA CAA CAG AGT CGT AAT CGC 
Thr Arg Ser Ala Ser Ser Arg Arg Arg Gin Gin Ser Arg Asn Arg 

(382) 

1329 1338 1347 1356 1365 

TCT ACC CAG TCC CAG GAC GTG GCG CGG GTC TCC AGT GCT TCA GAT 
Ser Thr Gin Ser Gin Asp Val Ala Ara Val Ser Ser Ala Ser Asp 
(388) 



24 



EP 0 429 570 B1 



Table IV 
(page 4 of 6) 

1374 1383 1392 1401 1410 

TAG AAC AGO AGT GAA TTG AAA ACA GCC TGC AGG AAG CAT GAG CTG 
Tyr Asn Sex Ser Glu Leu Lys Thr Ala Cys Arg Lys His Glu Leu 

(412) 

1419 1428 1437 1446 1455 

TAT GTG AGT TTC CAA GAC CTG GGA TGG CAG GAC TGG ATC ATT GCA 
Tvr Val Ser Phe Gin Asp Leu Gly Trp Gin Asp Trp lie lie Ala 



1464 1473 1482 1491 1500 

CCC AAG GGC TAT GOT GCC AAT TAC TGT GAT GGA GAA TGC TCC TTC 
Pro Lys Gly Tyr Ala Ala Asn Tyr Cys Asp Gly Glu Cys Ser Phe 



1509 1518 1527 1536 1545 

CCA CTC AAC GCA CAC ATG AAT GCA ACC AAC CAC GCG ATT GTG CAG 
Pro Leu Asn Ala His MET Asn Ala Thr Asn His Ala He Val Gin 



1554 1563 1572 1581 1590 

ACC TTG GTT CAC CTT ATG AAC CCC GAG TAT GTC CCC AAA CCG TGC 
Thr Leu Val His Leu MET Asn Pro Glu Tyr Val Pro Lys Pro Cys 



1599 1608 1617 1626 1635 

TGT GCG CCA ACT AAC CTA AAT GCC ATC TCG GTT CTT TAC TTT GAT 
Cys Ala Pro Thr Lys Leu Asn Ala He Ser Val Leu Tyr Phe Asp 



1644 1653 1662 1671 1680 

GAC AAC TCC AAT GTC ATT CTG AAA AAA TAC AGG AAT ATG GTT GTA 
Asp Asn Ser Asn Val He Leu Lys Lys Tyr Arg Asn MET Val Val 



1689 1698 1708 1718 1728 

AGA GCT TGT GGA TGC CAC TAACTCGAAA CCAGATGCTG GGGACACACA 
Arg Ala Cys Gly Cys His 

(513) 

1738 1748 1758 1768 1778 

TTCTGCCTTG GATTCCTAGA TTACATCTGC CTTAAAAAAA CACGGAAGCA 



1788 1798 1808 1818 1828 

CAGTTGGAGG TGGGACGATG AGACTTTGAA ACTATCTCAT GCCAGTGCCT 



1838 



1848 



1858 



1868 



1878 



25 



EP 0 429 570 B1 



Table IV 
(page 5 of 6) 

5 TATTACCCAG GAAGATTTTA AAGGACCTCA TTAATAATTT GCTCACTTGG 



1888 1898 1908 1918 1928 

TAAATGACGT GAGTAGTTGT TGGTCTGTAG CAAGCTGAGT TTGGATGTCT 

1938 1948 1958 1968 1978 

GTAGCATAAG GTCTGGTAAC TGCAGAAACA TAACCGTGAA GCTCTTCCTA 

IS 

1988 1998 2008 2018 2028 

CCCTCCTCCC CCAAAAACCC ACCAAAATTA GTTTTAGCTG TAGATCAAGC 



2038 2048 2058 2068 2078 

TATTTGGGGT GTTTGTTAGT AAATAGGGAA AATAATCTCA AAGGAGTTAA 



2088 2098 2108 2118 2128 

ATGTATTCTT GGCTAAAGGA TCAGCTGGTT CAGTACTGTC TATCAAAGGT 



2138 2148 2158 2168 2178 

AGATTTTACA GAGAACAGAA ATCGGGGAAG TGGGGGGAAC GCCTCTGTTC 

30 



2188 2198 2208 2218 2228 

AGTTCATTCC CAGAAGTCCA CAGGACGCAC AGCCCAGGCC ACAGCCAGGG 

35 

2238 2248 2258 2268 2278 

CTCCACGGGG CGCCCTTGTC TCAGTCATTG CTGTTGTATG TTCGTGCTGG 

40 

2288 2298 2308 2318 2328 

AGTTTTGTTG GTGTGAAAAT ACACTTATTT CAGCCAAAAC ATACCATTTC 

2338 2348 2358 2368 2378 

TACACCTCAA TCCTCCATTT GCTGTACTCT TTGCTAGTAC CAAAAGTAGA 



2388 2398 2408 2418 2428 

CTGATTACAC TGAGGTGAGG CTACAAGGGG TGTGTAACCG TGTAACACGT 

so 

2438 2448 2458 2468 2478 

GAAGGCAGTG CTCACCTCTT CTTTACCAGA ACGGTTCTTT GACCAGCACA 



26 



EP 0 429 570 B1 



Table IV 
(page 6 of 6) 

2488 2498 2508 2518 2528 

TTAACTTCTG GACTGCCGGC TCTAGTACCT TTTCAGTAAA GTGGTTCTCT 



2538 2548 2558 2568 2578 

GCCTTTTTAC TATACAGCAT ACCACGCCAC AGGGTTAGAA CCAACGAAGA 



2588 2596 2608 2618 2628 

AAATAAAATG AGGGTGCCCA GCTTATAAGA ATGGTGTTAG GGGGATGAGC 



2638 2648 2658 2668 2678 

ATGCTGTTTA TGAACGGAAA TCATGATTTC CCTGTAGAAA GTGAGGCTCA 



2688 2698 2708 2718 2728 

GATTAAATTT TAGAATATTT TCTAAATGTC TTTTTCACAA TCATGTGACT 



2738 2748 2758 2768 2778 

GGGAAGGCAA TTTCATACTA AACTGATTAA ATAATACATT TATAATCTAC 



2788 2798 2808 2818 2828 

AACTGTTTGC ACTTACAGCT TTTTTTGTAA ATATAAACTA TAATTTATTG 



2838 2848 2858 2868 2878 

TCTATTTTAT ATCTGTTTTG CTGTGGCGTT GGGGGGGGGG CCGGGCTTTT 



2888 2898 2908 2918 

GGGGGGGGGG GTTTGTTTGG GGGGTGTCGT GGTGTGGGCG GGCGG 



Comparision of the sequence ot murine Vgr-1 [Lyons, et al.. PNAS 86 :4554 (1 989)] to human BMP-6 reveals a degree 
of amino acid sequence identity greater than 92% The murine Vgr-1 is likely the murine homologueof BMP^. Human 
BMP-6 shares homology with other BMP molecules as well as other members of the TGF-p superfamily ot molecules. 
The cysteine-rich carboxy-termlnal 102 amino acid residues ot human BMP-6 shares the following homologies with 
BMP proteins disclosed herein and in Publications WO 88/00205 and WO 89/10409: 61% identity with BMP-2; 44% 
identity with BMP-3, 60% identity with BMP-4; 91% identity with BMP-5; and 87% identity with BMP-7. Human BMP- 
6 further shares the following homologies: 41 % identity with TGF-p3; 39% identity with T<3F-p2; 37% identity with TGF- 
pi ; 26% identity with Mullerian Inhibiting Substance (MIS), a testicular glycoprotein that causes regression of the Mul- 
lerian duct during development of the male embryo; 25% identity with inhibin a ; 43% identity with inhibin Pg; 49% 
identity with inhibin p;^; 58% identity with Vgl, a Xenopus factor which may be involved in mesoderm induction in early 
embryogenesis (Weeks and Melton, (1987) Supra l: and 59% identity with Dpp the product of the Drosophila decap- 
entaplegic locus which is required for dorsal-ventral specification in early embryogenesis and is involved in various 
other developmental processes at later stages of development [Padgett, et al., (1987) supral 



27 



EP 0 429 570 B1 



D. Human BMP-7 Proteins 

The other four clones of Exannple V.C. above which appear to represent a second class of clones encode a novel 
polypeptide which we designate as Bf^P-7. One of these clones, U2-5. was deposited with the ATCC on June 22, 1 989 
under accession number ATCC 68020 under the provisions of the Budapest Treaty. This clone was determined not to 
contain the entire coding sequence for BMP-7. An oligo of the squence GCGAGCAATGGAGGATCCAG (designed on 
the basis of the 3' noncoding sequence of U2-5) was used to make a primer-extended cDNA library from U-2 OS mRNA 
(Toole, et al ). 500,000 recombinants of this library were screened with the oligonucleotide GATCTCGCGCTGCAT 
(designed on the basis of the BMP-7 coding sequence) by hybridization in SHB at 42° and washing in 5X SSC, 0.1% 
SDS at 42°. Several hybridizing clones were obtained. DNA sequence analysis and derived amino acid sequence of 
one of these clones, PEH7-9, is given in Table V. PEH7-9 was deposited with the American Type Culture Collection 
(ATCC), Rockville, Maryland on November 17, 1 989 under accession number ATCC 68182 under the provisions of the 
Budapest Treaty. PEH7-9 contains an Insert of 1448 base pairs. This clone, PEH7-9, is expected to contain all of the 
nucleotide sequence necessary to encode BMP-7 proteins. The cDNA sequence of Table V contains an open reading 
frame of 1292 base pairs, encoding a protein of 43r amino acids, preceded by a 5' untranslated region of 96 base 
pairs with stop codons in all frames, and contains a 3* untranslated region of 60 base pairs following the in frame stop 
codon TAG. 

This protein of 431 amino acids has a molecular weight of 49,000 daltons as predicted by its amino acid sequence 
and is contemplated to represent the primary translation product. Based on knowledge of other BMP proteins as well 
as other proteins within the TGF-p family, it is predicted that the precursor polypeptide would be cleaved between 
amino acid #299 and #300, yielding a 1 32 amino acid mature peptide. 

It is contemplated that processing of BMP-7 to the mature form involves dimerization of the proprotein and removal 
of the N-terminal region in a manner analogous to the processing of the related protein TGF-B [LE. Gentry, et al., 
(1988) Supra and; R. Dernyck. et al., (1985) supra] . It is comtemplated therefore that the mature active species of 
BMP-7 comprises a homodimer of 2 polypeptide subunits each subunit cmprising amino acid #300 - #431 as shown 
in Table V with a calculated weight of 15,000 daltons. Other active BMP-7 species are contemplated, for example, 
protein dimers or proprotein subunits linked to mature subunits. Additional active species may comprise amino acids 
#309 - #431 of Table V such species including the tryptic sequences found in the purified bovine material. Also con- 
templated are BMP-7 proteins comprising amino acids #330-#431 thereby including the first conserved cysteine res- 
idue. 

The underlined sequence of Table V from amino acid #309 - #31 4 Asn-Gln-Glu-Ala-Leu-Arg is the same sequence 
as that of tryptic fragment #5 found in the 28,000 - 30,000 dalton purified bone preparation as described in the "BMP" 
Publications WO 88/00205 and WO 89/1 0409 mentioned above. The underlined sequence of Table V from amino acid 
#333-#339 His-Glu-Leu-Tyr-Val-Ser-Phe corresponds to the tryptic fragment identified in the bovine bone preparation 
described above from which the oligonucleotide probes are designed. 



28 



EP 0 429 570 B1 



TPiJSLE V 



10 20 30 40 50 

GTCACOGAGC GGCJGOGGAOG GOOSOdCOC OOCICIGOCA CCTGCGG03G 

60 70 80 90 99 

TC0GGG0CX3G GAGCOOQGftG OOOGGG?EAGC GOGTftGAlSOC GGOGOG AIG 

MET 
(1) 

108 117 126 135 144 

CAC GIG OGC TCA CIG OGA GCT GCG GOG CX3G CAC AGC TTC GTC GOG 
His Val Arg Ser Leu Arg Ala Ala Ala Pro His Ser Ihe Val Ala 

153 162 171 180 189 

CTC TGG GCA OOC CIG TIC CIG CIG 03C TOO GOC CIG GOC GAC TTC 
Leu Trp Ala Pro Leu Rie Leu Leu Arg Ser Ala Leu Ala Asp Hie 

198 207 216 225 234 

AGO CIG GAC AAC GAG GIG CAC TOG AGC TIC ATC CAC COG OGC CIC 
Ser Leu Asp Asn Glu Val His Ser Ser Hie He His Arg Arg Leu 

243 252 261 270 279 

OGC AGC CAG GAG OGG OGG GAG ATG CAG OGC GAG ATC CTC TOC ATT 
Arg Ser Gin Glu Arg Arg Glu MET Gin Arg Glu He Leu Ser lie 

288 297 306 315 324 

TIG OGC TTG OOC CAC OGC COG OGC COS CAC dC CAG GGC AAG CAC 
Leu Gly Leu Fro His Arg Fro Arg Pro His Leu Gin Gly lye His 

333 342 351 360 369 

AAC TOG QCk OOC ATG TIC ATG CIG GAC CIG TAC AAC GOC ATS GOG 
Asn Ser Ala Fro MET Hie MET Leu Asp Leu Asn Ala MET Ala 

378 387 396 405 414 

GIG GAG GAG GGC GGC GGG OOC OGC GGC CAG GGC TIC TOC TAC OOC 
Val Glu Glu Gly Gly Gly Pro Gly Gly Gin Gly Ihe Ser Tyr Fro 

423 432 441 450 459 

TAC AAG GOC GIC TIC AGT ADC CAG GGC OOC OCT CIG GOC AGC CTG 
lyr lys Ala Val Hie Ser Thr Gin Gly Pro Pro Leu Ala Ser Leu 

468 477 486 495 504 

CAA GAT AGC CAT TTC CIC ADC GAC GOC GAC A3G GIC ATG AGC TIC 
Gin Asp Ser His Hie Leu Bir Asp Ala Asp MET Val MET Ser Hie 

513 522 531 540 549 

GTC AAC CIC GIG GAA CAT GAC AAG GAA TIC TIC CAC OCA OGC TAC 
Val Asn Leu Val Glu His Asp Lys Glu Hie Hie His Pro Arg lyr 



29 



EP 0 429 570 B1 



Table V 
(page 2 of 3} 



558 567 576 585 594 

CAC CAT CGA GAG TIC OGG TIT GAT CIT TCX: AAG ATC OCA GAA OGG 
His His keg Glu Rie Arg Bie ^isp l£u Ser lys lie 'Pro Glu Gly 

603 612 621 630 639 

GAA GOT GIC AOG GCA GOC GAA TIC CQ6 ATC TAC AAG GAC TAC AIC 
Glu Ala Val Thr Ala Ala Glu Rie Arg He Tyr lys Asp Tyr He 

648 657 666 675 684 

OSGGAAOGCTICGACAATGAGAOGTICaOG AIC AGC GTT TAT GAG 
Arg Glu Arg Fhe Asp Asn Glu Dir Ffie Arg lie Ser Val Tyr Gin 

693 702 711 720 729 

GIG CIC GAG GAG CAC TIG GGC AGG GAA TOG GAT dC ITC GIG CTC 
Val Lea Gin Glu His Leu Gly Arg Glu Ser Asp Leu Fbe Leu Ibu 

738 747 756 765 774 

GAC AGC a?r ACC dC TOG GOC TOS GAG GAG GGC TOG dG GIG TFT 
Asp Ser Arg Ihr Leu Trp Ala Ser Glu Glu Gly Trp Leu Val Ilie 

783 792 801 810 819 

GAC ATC ACA GOC AOC AGC AAC CAC TOG GIG GIC AAT OOS OX CAC 
Asp He Thr Ala Sir Ser Asn His Trp Val V€d Asn Rno Arg His 

828 837 846 855 864 

AACCTSGGCCIGCAGCICTOSGIGGAGAaSCTCGATGGGGA^ 
Asn Leu Gly Leu Gin Leu Ser Val Glu Tttr l£u Asp Gly Gin Ser 

873 882 891 900 909 

ATCAACCOCAAGTTGGOGGGCCIGAIT GGG OGG GAC GGG OOC CAG 
He Asn Pro lys Leu Ala Gly Leu He Gly Arg His Gly Pro Gin 

918 927 936 945 954 

AAC AAG CAG OOC TTC ATS GIG GOT TIC TIC AAG GOC AOG GAG GTC 
Asn lys Gin Tro Ite MET Val Ala Fhe Rie lys Ala Ihr Glu Val 

963 972 981 990 999 

GAC TTC OGC AGC ATC OGG TOC AOS GGG AGC AAA CAG OOC AGC CAG 
His Bie Arg Ser He Arg Ser Ihr Gly Ser lys Gin Arg Ser Gin 

(300) 

1008 1017 1026 1035 1044 

AACOGCT0CAAGAa;O0CAAGAACCAGGAAGOCCIGOt3GAIGGOC 
Asn Arg Ser lys Ihr Pro lys Asn Gin Glu Ala Leu Arcr MET Ala 

(309) 

1053 1062 1071 1080 1089 

AACGTGGCAGAGAACAGCAGCAGCGACCAG AOG CAG GOC TGT AAG 
Asn Val Ala Glu Asn Ser Ser Ser Asp Gin Arg Gin Ala cys lys 

(330) 



30 



EP 0 429 570 B1 



Table V 
(page 3 of 3) 



1098 1107 1116 1125 1134 

AAG CAC GAG CIG TAT GTC AGC TIC OGA GAC CTG QGC TOG CAG GAC 
Lys His Glu Leu Tyr Val R>e Arg Asp Lai Gly Ttp Gin Asp 

1143 1152 1161 1170 1179 

TOG Arc ATC GOG OCT GAA QGC TAC GOC GOC TAC TAC TGTT GAG GGG 
Trp lie lie Ala Pro Glu Gly rryr Ala Ala Tyr lyr cys Glu Gly 

1188 1197 1206 1215 1224 

GAG TGT QCC TTC OCT CIG AAC TOC TAC AIG AAC GOC AOC AAC CAC 
Glu Cys Ala Rie Pro Leu Asn Ser Tyr MET Asn Ala Ihr Asn His 

1233 1242 1251 1260 1269 

GCC ATC GTG CAG AOG CIG GTC CAC TIC ATC AAC COG GAA AOG GIG 
Ala He Val Gin Thr Leu Val His Hie lie Asn Pro He Ser Val 

1278 1287 1296 1305 1314 

OOC AAG OOC TGC TGT GOG OOC AOG CAG CIC AAT GOC ATC TOC GIC 
Pro lys Pro Cys cys Ala Pro Uir Gin Leu Asn Ala He Ser Val 

1323 1332 1341 1350 1359 

dC OAC TIC GAT GAC AGC TOC AAC GIC ATC CIG AAG AAA TAC AGA 
Leu lyr R)e Asp Asp Ser Ser Asn Val He Leu lys lys Tyr Axg 

1368 1377 1386 1399 

AAC ATG GIG GTC OGG GOC TST QGC TGC CAC TAGCTOdCC 
Asn MET Val Val Arg Ala cys Gly cys His 

(431) 

1409 1419 1429 1439 1448 

GAGAATTCAG ACOdTIGGG GCCAAGTUT TdGGATOCT OCATIGCTC 



Like BMP-5 and BMP-6, human BMP-7 shares homology with other BMP molecules as well as other members of 
the TGF-p superfamily of molecules. The cysteine-rich carboxy-terminal 102 amino acids residues of human BMP-7 
shares the following homologies with BMP proteins herein and in Publications WO 88/00205 and WO 89/10409 de- 
scribed above: 60% identity with BMP-2; 43% identity with BMP-3, 58% identity with BMP-4, 87% identity with BMP- 
6; and 88% identity with BMP-5. Human BMP-7 further shares the following homologies: 40% identity with TGF-P3; 
40% identity with TGF-P2; 36% identity with TG F-pi ; 29% identity with Mullerian Inhibiting Substance (MIS), a testicular 
glycoprotein that causes regression of the Mullerian duct during development of the male embryo; 25% identity with 
inhibin-a; 44% identity with inhibin-Pe; 45% identity with inhibin-p^; 57% identity with Vgl, a Xenopus factor which may 
be involved in mesoderm induction in early embryogenesis [Weeks adn Melton, (1987) Supra. 1 ; and 58% identity with 
Dpp the product of the Drosophila decapentaplegic locus which is required for dorsal-ventral specification in early 
embryogenesis and is involved in various other developmental processes at later stages of development [Padgett, et 
al.. (1987) Supra. ]. 

The invention encompasses the genomic sequences of BMP-5, BMP-6 and BMP-7. To obtain these sequences 
the cDNA sequences described herein are utilized as probes to screen genomic libraries using techniques known to 
those skilled in the art. 

The procedures described above and additional methods known to those skilled in the art may be employed to 



31 



EP 0 429 570 B1 



isolate other related proteins of interest by utilizing the bovine or human proteins as a probe source. Such other proteins 
may find similar utility in, inter alia, fracture repair, wound healing and tissue repair. 

EXAMPLE VI 

5 

Expression of BMP Proteins 

In order to produce bovine, human or other mammalian BMP-5, BMP-6 or BMP-7 proteins of the invention, the 
DNA encoding it is transfected into an appropriate expression vector and introduced into mammalian cells or other 

10 preferred eukaryotic or prokaryotic hosts by conventional genetic engineering techniques. It is contemplated that the 
preferred expression system for biologically active recombinant human proteins of the invention will be stably trans- 
formed mammalian cells. For transient expression, the cell line of choice is SV40 transformed African green monkey 
kidney COS-1 or COS-7 which typically produce moderate amounts of the protein encoded within the plasmid for a 
period of 1 -4 days. For stable high level expression of BMP-5, BMP-6 or BMP-7 the preferred cell line is Cinese hamster 

15 Ovary (CHO). It is therefore contemplated that the preferred mammalian cells will be CHO cells. 

The transformed host cells are cultured and the BMP proteins of the invention expressed thereby are recovered, 
isolated and purified. Characterization of expressed proteins is carried out using standard techiques. For example, 
characterization may include pulse labeling with pS^] methionine or cysteine and analysis by polyacrylamide electro- 
phoresis. The recombinantty expressed BMP proteins are free of proteinaceous materials with which they are co- 

20 produced and with which they ordinarily are associated in nature, as well as from other contaminants, such as materials 
found in the culture media. 

A. Vector Construction 

2S As described above, numerous expression vectors known in the art may be utilized in the expression of BMP 

proteins of the invention. The vector utilized in the following examples is pMT2l , a derivitive of pMT2, though other 
vectors may be suitable in practice of the invention. 

pMTg is derived from pMT2-VWF, which has been deposited with the American Type Culture Collection (ATCC), 
Rockville, MD (USA) under accession number ATCC 67122 under the provisions of the Budapest Treaty. EcoRl diges- 

30 tion excises the cDNA insert present in pMT-VWF, yielding pMT2 in linear fomn which can be ligated and used to 
transform E. Coli HB 1 01 or DH-5 to ampicillin resistance. Plasmid pMT2 DNA can be prepared by conventional meth- 
ods. 

pMT21 is then constructed using loopout/in mutagenesis [Morinaga, et al.. Biotechnology 84 :636 (1984)]. This 
removes bases 1075 to 1170 (inclusive). In addition it inserts the following sequence: 5' TCGA 3'. This sequence 
35 completes a new restriction site, Xhol. This plasmid now contains 3 unique cloning sites PstI, EcoRI, and Xhol. 

In addition, pMT21 is digested with EcoRV and Xhol, treating the digested DNA with Klenow fragment of DNA 
polymerase I and figating Clal linkers (NEBio Labs, CATCGATG). This removes bases 2171 to 2420 starting from the 
Hindlll site near the SV40 origin of replication and enhancer sequences of pMT2 and introduces a unique Cla t site, 
but leaves the adenovirus VAI gene intact. 

40 

B. BMP-5 Vector Construction 

A derivative of the BMP-5 cDNA sequence set forth in Table III comprising the the nucleotide sequence from 
nucleotide #699 to #2070 is specifically amplified. The oligonucleotides CG ACCTGCAGCCACCATGCATCTGACTGTA 

45 and TGCCTGCAGTTTAATATTAGTGGCAGC are utilized as primers to allow the amplification of nucleotide sequence 
#699 to #2070 of Table III from the insert of clone U2-1 6 described above in Example V. This procedure introduces the 
nucleotide sequence CGACCTGCAGCCACC immediately proceeding nucleotide #699 and the nucleotide sequence 
CTGCAGGCA immediately following nucleotide #2070. The addition of these sequences results in the creation of PstI 
restriction endonuclease recognition sites at both ends of the amplified DNA fragment. The resulting amplified DNA 

50 product of this procedure is digested with the restriction endonuclease PstI and subcloned into the PstI site of the pMT2 
derivative pMT21 described above. The resulting clone is designated H5/5/pMT. 

The insert of H5/5/pMT is excised by PstI digestion and subcloned into the plasmid vector pSP65 at the PstI site 
resulting in BMP5/SP6. BMP5/SP6 and U2-16 are digested with the restriction endonucleases Nsil and Ndel to excise 
the portion of their inserts corresponding to nucleotides #704 to #1876 of Table 111. The resulting 1173 nucleotide Nsil- 

55 Ndei fragment of clone U2-16 is ligated into the Nsil-Ndel site of BMP5/SP6 from which the corresponding 1173 nu- 
cleotide Nsil-Ndel fragment had been removed. The resulting clone is designated BMPSmix/SP64. 

Direct DNA sequence analysis of BMP5mix/SP64 is performed to confirm identity of the nucleotide sequences 
produced by the amplification to those set forth in Table III. The clone BMP5mix/SP64 is digested with the restriction 



32 



EP 0 429 570 B1 



endonuclease PstI resulting in the excision of an insert comprising the nucleotides #699 to #2070 of Table III and the 
additional sequences containing the PstI recognition sites as described above. The resulting 1 382 nucleotide PstI 
fragment is subcloned into the PstI site of the pMT2 derivative pMT21 . This clone is designated BMP5mix/pMT21#2. 

5 C. BMP-6 Vector Construction 

A derivative of the BMP-6 cDN A sequence set forth in Table IV comprising the nucleotide sequence from nucleotide 
#160 to #1706 is produced by a series of techniques known to those skilled in the art. The clone BMP6C35 described 
above in Example V is digested with the restriction endonucleases Apal and TaqI, resulting in the excision of a 1476 . 

10 nucleotide portion of the insert comprising nucleotide #231 to #1703 of the sequence set forth in Table IV. Synthetic 
olignucloetides with Sail restriction endonuclease site converters are designed to replace those nucleotides corre- 
sponding to #160 to #230 and-#1704 to #1706 which are not contained In the 1476 Apal-TaqI fragment of the BMP-6 
cDNA sequence. Oligonucleotide/Sall converters conceived to replace the missing 5' (TCGACCCACCATGCCG- 
GGGCTGGGGCGGAGGGCGCAGTGGCTGTG CTGGTGGT GGGGGCTGTGCTGCAGCTGCTGCGGGCC and 

IS CGCAGCAGCTGGACAGCAGCCCCCACCACCAGCACAGCCACTGCGCC CTCCGGCCCAG CCCCGGCATGGT- 
GGG)and 3' (TCGACTGGTTT and CGAAACCAG) sequences are annealed to each other independently. The annealed 
5' and 3' converters are then ligated to the 1476 nucleotide Apal-TaqI described above, creating a 1563 nucleotide 
fragment comprising the nucleotide sequence from #160 to #1706 of Table IV and the additional sequences contrived 
to create Salt restriction endonuclease sites at both ends. The resulting 1 563 nucleotide fragment is subcloned Into 

20 the Sail site of pSP64. This clone is designated BMP6/SP64#15. 

DNA sequence analysis of BMP6/SP64#1 5 is performed to confirm identity of the 5' and 3' sequences replaced 
by the converters to the sequence set forth in Table IV. The insert of BMP6/SP64#1 5 is excised by digestion with the 
restriction endonuclease Sail. The resulting 1563 nucleotide Sail fragment is subcloned into the Xhol restriction endo- 
nuclease site of the pMT2 derivative pMT21 and designated herein as BMP6/pMT21. 

D. BMP-7 Vector Construction 

A derivative of the BMP-7 sequence set forth in Table V comprising the nucleotide sequence from nucleotide #97 
to #1402 is specifically amplified. The oligonucleotides CAGGTCGACCCAGCATGCACGTGCGCTCA and TCTGTC- 

30 G ACCTCGG AGG AGCTAGTGGC are utilized as primers to allow the amplification of nucleotide sequence #97 to #1 402 
of Table V from the insert of clone PEH7-9 described above. This procedure generates the insertion of the nucleotide 
sequence CAGGTCGACCCACC immediately preceeding nucleotide #97 and the insertion of the nucleotide sequence 
GTCGACAGA immediately following nucleotide #1402. The addition of these sequences results in the creation of a 
Sail restriction endonuclease recognitiori site at each end of the amplified DNA fragment. The resulting amplified DNA 

35 product of this procedure is digested with the restriction endonuclease Sail and subcloned into the Sail site of the 
plasmid vector pSP64 resulting in Br^P7/SP6#2. 

The clones BMP7/SP6#2 and PEH7-9 are digested with the restriction endonucleases Ncol And StuI to excise the 
portion of their inserts corresponding to nucleotides #363 to #1081 of Table V. The resulting 719 nucleotide Ncol-StuI 
fragment of clone PEH7-9 is ligated into the Ncol-StuI site of BMP7/SP6#2 from which the corresponding 71 9 nucleotide 

40 fragment is removed. The resulting clone Is designated BMP7mix/SP6. 

Direct DNA sequence analysis of BMP7mix/SP6 confirmed identity of the 3' region to the nucleotide sequence 
from #1082 to #1402 of Table V, however the 5' region contained one nucleotide mis incorporation. 

Amplification of the nucleotide sequence (#97 to #1402 of Table V) utilizing PEH7-9 as a template is r-epeated as 
described above. The resulting amplified DNA product of this procedure is digested with the restriction endonucleases 

4S Sail and PstI. This digestion results in the excision of a 747 nucleotide fragment comprising nucleotide #97 to #833 of 
Table V plus the additional sequences of the 5' priming oligonucleotide used to create the Sail restriction endonuclease 
recognition site described earlier. This 747 Sail -PstI fragment is subcloned into a Sall-PstI digested pSP65 vector 
resulting in 5'BMP7/SP65. DNA sequence analysis demonstrates that the insert of the 5'BMP7/SP65#1 comprises a 
sequence identical to nucleotide #97 to #362 of Table V. 

so The clones BMP7mix/SP6 and 5'BMP7/SP65 are digested with the restriction endonucleases Sail and Ncol. The 

resulting 3' Ncol-Sall fragment of BMP7mix/SP6 comprising nucleotides #363 to #1402 of Table V and 5' Sall-Ncol 
fragment of 5'BMP7/SP65 comprising nucleotides #97 to #362 of Table V are ligated together at the Ncol restriction 
sites to produce a 1317 nucleotide fragment comprising nucleotides #97'to #1402 of Table V plus the additional se- 
quences derived from the 5' and 3' oligonucleotide primers which allows the creation of Sail restriction sites at both 

ss ends of this fragment. This 1317 nucleotide Sail fragment is ligated into the Sail site of the pMT2 derivative pMT2Cla- 
2. This clone is designated BMP7/pMT2. 

The insert of BMP7/pMT2 is excised by digestion with the restriction endonuclease Sail. The resulting 1317 nu- 
cleotide Sail fragment is subcloned into the Sail restriction site of the vector pSP64. This ctone is designated 



33 



EP 0 429 570 B1 



BMP7/SP64#2d. The insert of BMP7/SP64#2d is excised by digestion with Sail and the resulting Sail fragment com- 
prising nucleotides #97 to #1402 of Table V is subcloned into the Xhol restriction endonuclease site of the pMT2 
derivative pMT21 described above. 

5 Example VII 

Transient COS Cell Expression 

To obtain transient expression of BMP-5, BMP-6, and BMP-7 proteins one of the vectors containing the cDNA for 
10 BMP-6, BMP-6 or BMP-7. BMP5mix/pMT21#2, BMP6/pMT2l#2, or BMP7/pMT21 respectively, are transfected into 
COS-1 cells using the electroporation method. Other suitable transfectlon methods include DEAE-dextran, and lipo- 
fection. Approximately 48 hours later, cells are analysed for expression of both intracellular and secreted BMP-5, BMP- 

6 or BMP-7 protein by metabolic labelling with [^^S] methionine and polyacrylamlde gel electrophoresis. Intracellular 
BMP is analyzed in cells which are treated with tunicamycin, an inhibitor of N-linked glycosylation. In tunicamycin- 

is treated cells, the nonglycosytated primary translation product migrates as a homogeneous band ot predictable size 
and is often easier to discern in polyacrylamide gels than the glycosylated form of the protein. In each case, intracelluar 
protein in tunicamycin-treated cells is compared to a duplicate plate of transfected, but untreated COS-1 cells. 

A. BMP-5 COS Expression 

20 

The results demonstrate that intracellular forms of BMP-5 of approximately 52 Kd and 67 Kd are made by COS 
cells. The 52 Kd protein is the size predicted by the primary sequence of the the BMP^ cDNA clone. Following treatment 
of the cells with tunicamycin, only the 62 Kd form of BMP-5 is made, suggesting that the 57 Kd protein is a glycosylated 
derivative of the 52 Kd primary translation product. The 57 Kd protein is secreted into the conditioned medium and is 
2S apparently not efficiently processed by COS-1 cells into the pro and mature peptides. 

B. BMP-6 COS Expression 

Intracellular BMP-6 exists as a doublet of approximately 61 Kdand 65 Kd in untreated COS-1 cells. In the presence 
30 of tunicamycin, only the 61 Kd protein is observed, indicating that the 66 Kd protein is the glycosylated derivative of 
the 61 Kd primary translation product. This is similar to the molecular weight predicted by the cDNA clone for BMP-6. 
In the absence of tunicamycin, the predominant protein secreted from COS-1 cells is the 65 Kd glycosylated, unproc- 
essed clipped form ot BMP-6. There are also peptides of 46 Kd and 20 Kd present at lower abundance than the 65 Kd 
that likely represent the processed pro and mature peptides, respectively. 

35 

C. BMP-7 COS Expression 

Intracellular BMP-7 protein in tunicamycin-treated COS-1 cells is detected as a doublet of 44 Kd and 46 Kd. In the 
absence of tunicamycin, proteins of 46 Kd and perhaps 48 Kd are synthesized. These likely represent glycosylated 
40 derivatives of the BMP-7 primary translation products. The 48 Kd protein is the major BMP species secreted from COS- 
1 cells, again suggesting inefficient cleavage of BMP-7 at the propeptide dibasic cleavage site. 

Example VIII 

4S CHO Cell Expression 

DHFR deficient CHO cells (DUKX Bll) are transfected by electroporation with one of the BMP-5. BMP-6 or BMP- 

7 expression vectors described above, and selected for expression of DHFR by growth in nucleoside-free media. Other 
methods of transfectlon, including but not limited toCaP04 precipitation, protoplast fusion, microinjection, and lipofec- 

50 Won, may also be employed. In order to obtain higher levels of expression more expediently, cells may be selected in 
nucleoside-free media supplemented with5 nM, 20nMor 100 nM MTX. Since the DHFR selectable marker is physically 
linked to the BMP cDNA as the second gene of a bictstronic coding region, cells which express DHFR should also 
express the BMP encoded within the upstream cistron. Either single clones, or pools of combined clones, are expanded 
and analyzed for expression of BMP protein. Cells are selected in stepwise increasing concentrations of MTX (6 nM, 

55 20 nM, 100 nM, 600 nM, 2 uM, 10 uM, and 100 uM) In order to obtain cell lines which contain multiple copies ot the 
expression vector DNA by virtue of gene amplification, and hence secrete large amounts of BMP protein. 

Using standard techniques cell lines are screened for expression of BMP RNA, protein or activity, and high ex- 
pressing cell lines are cloned or recloned at the appropriate level of selection to obtain a more homogeneous population 



34 



EP 0 429 570 B1 



of cells. The resultant cell line is then further characterized for BMP DNA sequences, and expression of BMP RNA 
and protein. Suitable cell lines can then be used for producing recombinant BMP protein. 

A. CHO Expression of BMP-5 

5 

The BMP-5 vector BMP5mix/pMT21 #2 described above is transf ected into CHO cells by electroporation, and cells 
are selected for expression of DHFR. Clonal cell lines are obtained from individual colonies selected stepwise for 
resistence to MTX, and analyzed for secretion of BMP-5 proteins. In some cases cell lines may be maintained as pools 
and cloned at later stages of MTX selection. 

10 As described in Example V B. the cDNA for BMP-5 encodes for a protein of approx innately 52 Kd. Following process- 

ing within the cell that includes, but may not be limited to, propeptide cleavage, glycosylation, and dimer or multimer 
formation, multiple BMP-5 peptides are produced. There are at least 4 candidate peptides for processed forms of the 
BMP-5 protein discernable following SDS PAGE under reducing conditions; a 65 Kd peptide, a 35 Kd peptide, and a 
doublet of approximately 22 Kd molecular weight. Other less abundant BMP-5 peptides may also be present. By com- 

is parison to the processing of other related BMP molecules and the related protein TGF-beta, the 65 Kd protein likely 
represents unprocessed BMP-5, the 35 Kd species represents the propeptide, and the 22 Kd doublet represents the 
mature peptide. 

Material from a BMP-5 cell line is analyzed in a 2-dimensional gel system. In the first dimension, proteins are 
elect rophoresed under nonreducing conditions. The material is then reduced, and electrophoresed in a second poly- 

20 acrylamide gel. Proteins that form disulfide-bonded dimers or multimers will run below a diagonal across the second 
reduced gel. Results from analysis of BMP-5 protein indicates that a significant amount of the mature BMP-5 peptides 
can form homodimers of approximately 30-35 Kd that reduce to the 22 Kd doublet observed In one dimensional reduced 
gels. A fraction of the mature peptides are apparently in a disulfide-bonded complex with the pro peptide. The amount 
of this complex is minor relative to the mature homodimer. In addition, some of the unprocessed protein can apparantly 

2S form homodimers or homomultimers. 

B. CHO Expression of SMP-6 

The BMP-6 expression vector BMP6/pMT21 described above is transfered into CHO cells and selected for stable 
30 transformants via DHFR expression in a manner as described above in part A with relation to BMP-5. The mature 
active species of BMP-6 is contemplated to comprise amino acid #382 - #513 of Table IV. It is contemplated that 
secreted BMP-6 protein will be processed in a manner similar to that described above for BMP-5, other related BMP 
molecules and analogous to the processing of the related protein TGF-p [Gentry, et al.; Dernyck, et al., Supra. 1. 

35 C. CHO Expression of BMP-7 

The BMP-7 expression vector BMP7/pMT21 described above is transf ected into CHO cells and selected for stable 
transformants via DHFR expression in a manner as described above in relation to BMP-5. The mature active species 
of BMP-7 Is contemplated to comprise amino acid #300-#431 of Table V. It is contemplated that secreted BMP-7 protein 
<o will processed in a manner similar to that described above for BMP-5, other related BMP molecules and analogous to 
the processing of the related protein TGF-p [Gentry, et al.; Dernyck, et al., Supra.1 . 

EXAMPLE IX 

45 Biological Activitv of Expressed BMP Proteins 

To measure the biological activity of the expressed BMP-5, BMP-6 and BMP-7 proteins obtained in Example VII 
and VIII above, the BMP proteins are recovered from the culture media and purified by isolating the BMP proteins from 
other proteinaceous materials with which they are co-produced, as well as from other contaminants. The proteins may 
50 be partially purified on a Heparin Sepharose column and further purified using standard purification techniques known 
to those skilled in the art. 

For instance, post transfection conditioned medium supernatant collected from the cultures is concentrated ap- 
proximately 10 fold by ultrafiltration on a YM 10 membrane and then dlaly2edagainst 20mMTris, 0.15 M NaCI, pH 7.4 
(starting buffer). This material is then applied to a Heparin Sepharose column in starting buffer. Unbound proteins are 
55 removed by a wash of starting buffer, and bound proteins, including proteins of the invention, are desorbed by a wash 
of 20 mM Tris, 2.0 M NaCI, pH 7.4. The proteins bound by the Heparin column are concentrated approximately 10-fold 
on, for example, a Centricon 10 and the salt reduced by diafiltration with, for example, 0.1% trifluoroacetic acid. The 
appropriate amount of the resultant solution is mixed with 20 mg of rat matrix and then assayed for in vivo bone and/ 



35 



EP 0 429 570 B1 



or cartilage formation activity by the Rosen-modified Sampath - Reddi assay. A mock transfection supernatant frac- 
tionation is used as a control. 

Further purification may be achieved by preparative NaDodS04/PAGE [:aemmli, Nature 227 :660-685 (1970)], for 
instance, approximately 300 |ig of protein is applied to a 1.5-mm-thlck 12.5% gel: recovery is be estimated by adding 
L-[^S]methionine-labeled BMP protein purified over heparin-Sepharose as described above. Protein may be visualized 
by copper staining of an adjacent lane [Lee, et al.. Anal. Biochem . 166:308-31 2 (1 987)]. Appropriate bands are excised 
and extracted in 0.1% NaDodSO4/20 mM Tris, pH 8.0. The supernatant may be acidified with 10% CFsCCXDH to pH 
3 and the proteins are desalted on 5.0 x 0.46 cm Vydac C4 column (The Separations Group, Hesperia, CA) developed 
with a gradient of 0.1% CF3COOH to 90% aceton it rile/0.1% CF3COOH. 

The implants containing rat matrix to which specific amounts of human BMP-5, BMP-6 or BMP-7 proteins of the 
Invention have been added are removed from rats after approximately seven days and processed for histological 
evaluation. Representative sections from each implant are stained for the presence of new bone mineral with von 
Kossa and acid fuschin, and for the presence of cartilage-specific matrix formation using toluldine blue. The types of 
cells present within the section, as welt as the extent to which these cells display phenotype are evaluated and scored 
as described In Example III. 

Levels of activity may also be tested for host cell extracts. Purification is accomplished in a similar manner as 
described above except that 6 M urea is Included in all the buffers. 

The foregoing descriptions detail presently preferred embodiments of the present invention. Numerous modifica- 
tions and variations in practice thereof are expected to occur to those skilled in the art upon consideration of these 
descriptions. Those modifications and variations are believed to be encompassed within the claims appended hereto. 



Claims 



Claims for the following Contracting States : AT, BE, CH, DE, DK, FR, GB, IT, LI, LU, NL, SE 

1 . A DN A sequence encoding a BMP protein having the ability to induce the formation of cartilage and/or bone, said 
DNA sequence being selected from the group consisting of: 

(a) a DNA sequence encoding BMP-5, 

(i) comprising the nucleotide positions #699 to #2060 of Table III; 

(ii) comprising the nucleotide positions #1665 to #2060 of Table III; 

(iii) comprising sequences which hybridise to the sequence of (i) under stringent hybridisation conditions 
and encode a protein having the biological properties of BMP-5; 

(iv) comprising sequences which are degenerate or allelic with respect to a sequence of any one of sections 
(i) to (iii); or 

(v) having the amino acid sequence with the amino acids #323 to #454 of Table III; 

(b) a DNA sequence encoding BMP-6, 

(i) comprising nucleotide positions #160 to #1698 of Table IV; 

(ii) comprising nucleotide positions #1303 to #1698 of Table IV, 

(iii) comprising sequences which hybridise to the sequence of (i) under stringent hybridisation conditions 
and encode a protein having the biological properties of BMP-6; 

(iv) comprising sequences which are degenerate or allelic with respect to a sequence of any one of sections 
(i) to (iii); or 

(V) having the amino acid sequence with the amino acids #382 to #513 of Table IV; and 

(c) a DNA sequence encoding BMP-7, 

(i) comprising nucleotide positions #994 to #1389 of Table V; 

(ii) comprising sequences which hybridise to the sequence of (i) under stringent hybridisation conditions, 
encode an amino acid sequence with the N-terminal position corresponding to the amino acid position 
encoded by the codon starting with nucleotide position #994 and encode a protein having the biological 
properties of BMP-7; 

(iii) comprising sequences which are degenerate or allelic with respect to a sequeru:e of any one of sections 



36 



EP 0 429 570 B1 

(i) to (iii); or 

(iv) having the amino acid sequence with the amino acids #300 to #431 of Table V. 

2. A vector comprising a DNA sequence of claim 1 in operative association with an expression control sequence 
therefor. 

3. A host cell transformed with the vector of claim 2. 

4. The host cell according to claim 3, which is a mammalian cell. 

5. The host cell according to claim 4, which is a CHO cell. 

6. A protein exhibiting properties of BMP-5, BMP-6 or BMP-7, which is encoded by a DNA sequence of claim 1 . 

7. A protein exhibiting properties of BMP-5, BMP-6 or BMP-7, which is obtainable by the steps of: 

(a) culturing in a suitable culture medium a host cell of any one of claims 3 to 5, and 

(b) recovering, isolating and purifying said protein from said culture medium. 

8. The protein of claim 6 or 7. further characterised by the ability to demonstrate the induction of cartilage and/or 
bone formation. 

9. A method for producing a BMP protein, said method comprising the steps of: 

(a) culturing in a suitable culture medium the transformed host cell of claims 4 to 6; and 

(b) recovering, isolating and purifying said protein from said culture. 

10. A protein exhibiting properties of BMP-7, which is obtainable by the steps of: 

(a) culturing in a suitable culture medium a CHO cell transformed with a DNA sequence encoding amino acids 
#1 to #431 of Table V or with a DNA sequence comprising nucleotides #97 to #1 389 of Table V; and 

(b) recovering, isolating and purifying said BMP-7 protein from said culture medium. 

11. A method for producing a BMP-7 protein, said method comprising the steps of: 

(a) culturing in a suitable culture medium a CHO cell transformed with a DNA sequence encoding amino acids 
#1 to #431 of Table V or with a DNA sequence comprising nucleotides #97 to #1389 of Table V; and 

(b) recovering, isolating and purifying said BMP-7 protein from said culture. 

12. A pharmaceutical composition comprising a protein of any one of claims 6 to 8 or 10 In admixture with a pharma- 
ceutical ly acceptable vehicle. 

13. The composition of claim 12, further comprising a pharmaceutically acceptable matrix. 

14. The composition of claim 13, wherein said matrix comprises hydroxyapatite, collagen, polylactic acid ortricalcium 
phosphate. 

15. Use of a protein as defined In any one of claims 6 to 8 or 10 for the preparation of a pharmaceutical composition 
for the treatment of a patient In need of cartilage and/or bone formation. 

16. Use of a protein as defined In any one of claims 6 to 8 or 10 for the preparation of a pharmaceutical composition 
for wound hisaling and tissue repair. 

17. A DNA sequence comprising nucleotide #1 through #2153 as shown In Table III. 



37 



EP 0 429 570 B1 

18. A DNA sequence comprising nucleotide #1 through #2923 as shown in Table IV. 

19. A DNA sequence comprising nucleotide #1 through 1448 as shown in Table V. 

5 20. A DNA sequence comprising the BMP-7 DNA sequence of ATCC deposit 68020. 



Claims for the following Contracting State : ES 

10 1. A method for preparing a DNA sequence encoding a BMP protein having the ability to induce the formation of 
cartilage and/or bone, said DNA sequence being selected from the group consisting of: 

(a) a DNA sequence encoding BMP-5, 

'5 (i) comprising the nucleotide positions #699 to #2060 of Table III; 

(ii) comprising the nucleotide positions #1665 to #2060 of Table III; 

(iii) comprising sequences which hybridise to the sequence of (i) under stringent hybridisation conditions 
and encode a protein having the biological properties of BMP-5; 

(iv) comprising sequences which are degenerate or allelic with respect to a sequence of any one of sections 

(i) to (iii); or 

(v) having the amino acid sequence with the amino acids #323 to #454 of Table III; 

(b) a DNA sequence encoding BMP-6, 

2S (i) comprising nucleotide positions #160 to #1698 of Table IV; 

(ii) comprising nucleotide positions #1303 to #1698 of Table IV 

(iii) comprising sequences which hybridise to the sequence of (i) under stringent hybridisation conditions 
and encode a protein having the biological properties of BMP-6; 

(iv) comprising sequences which are degenerate or allelic with respect to a sequence of any one of sections 
30 (i) to (ill); or 

(v) having the amino acid sequence with the amino acids #382 to #513 of Table IV; and 

(c) a DNA sequence encoding BMP-7, 

35 {]) comprising nucleotide positions #994 to #1389 of Table V; 

(ii) comprising sequences which hybridise to the sequence of (i) under stringent hybridisation conditions, 
encode an amino acid sequence with the N-terminal position corresponding to the amino acid position 
encoded by the codon starting with nucleotide position #994 and encode a protein having the biologicat 
properties of BMP-7; 

40 (iii) comprising sequences which are degenerate or allelic with respect to a sequence of any one of sections 

(i) to (Iii); or 

(iv) having the amino acid sequence with the amino acids #300 to #431 of Table V 
said method comprising the following steps: 

45 

(a) construction of a cDNA library containing the target cDNA; 

(b) screening of the cDNA library with a suitable probe, which is a fragment of the DNA encoding a bovine 
BMP-5,BMP-6 or BMP-7 protein; and (c) isolating clones containing DNA encoding a BMP-5, BMP-6 or BMP- 
7 protein. 

so 

2. A method for the preparation of an expression vector comprising the insertion of a DNA sequence of claim 1 in 
operative association with an expression control sequence. 

3. A host cell transformed with the vector of claim 2. 

55 

4. The host cell according to claim 3, which Is a mammalian cell. 

5. The host cell according to claim 4, which is a OHO cell. 



38 



EP 0 429 570 B1 

6. A method for producing a BMP protein, said method comprising the steps of: 

(a) culturing in a suitable culture medium the transformed host cell of claims 3 to 5; and 
5 (b) recovering, isolating and purifying said protein from said culture. 

7. The method of claim 6, wherein said protein is further characterised by the ability to demonstrate the induction of 
cartilage and/or bone formation. 

10 8. A method for producing a BMP-7 protein, said method comprising the steps of: 

(a) culturing In a suitable culture medium a CHO cell transformed with a DNA sequence encoding amino acids 
#1 to #431 of Table V or with a DNA sequence comprising nucleotides #97 to #1 389 of Table V; and 

'5 (b) recovering, isolating and purifying said BMP-7 protein from said culture. 

9. A method for the preparation of a pharmaceutical composition comprising combining a protein produced according 
to the method of any one of claims 6 to 8 with a pharmaceutically acceptable vehicle. 

20 10. The method of claim 9, wherein said composition further comprises a pharmaceutically acceptable matrix. 

11. The method of claim 10, wherein said matrix comprises hydroxyapatite, collagen, polylactic acid or tricalcium 
phosphate. 

25 12. The method of any one of claims 9 to 1 1 wherein said pharmaceutical composition is for the treatment of a patient 
in need of cartilage and/or bone formation. 

1 3. The method of any of claims 9 to 11 wherein said pharmaceutical composition is for wound healing and tissue repair 

30 14. A method for the preparation of a DNA sequence comprising nucleotide #1 through #2153 as shown in Table III, 
said method comprising the following steps: 

(a) construction of a cDNA library containing the target cDNA; 

(b) screening of the cDNA library with a suitable probe, which is a fragment of the DNA encoding a bovine 
35 BMP-5 protein; and (c) isolating clones containing DNA encoding a BMP-5 protein. 

15. A method for the preparation of a DNA sequence comprising nucleotide #1 through #2923 as shown in Table IV, 
said method comprising the following steps: 

40 (a) construction of a cDNA library containing the target cDNA; 

(b) screening of the cDNA library with a suitable probe, which is a fragment of the DNA encoding a bovine 
BMP-6 protein; and (c) isolating clones containing DNA encoding a BMP-6 protein. 

16. A method for the preparation of a DNA sequence comprising nucleotide #1 through 1448 as shown in Table V, 
45 said method comprising the following steps: 

(a) construction of a cDNA library containing the target cDNA; 

(b) screening of the cDNA library with a suitable probe, which is a fragment of the DNA encoding a bovine 
BMP-7 protein; and (c) isolating clones containing DNA encoding a BMP-7 protein. 

50 

17. The method of claim 16, wherein the BMP-7 DNA sequence is contained in the clone ATCC deposit 68020. 



39 



EP 0 429 570 B1 



Patentanspruche 



PatentansprOche fur folgende Vertragsstaaten : AT, BE, CH, DE, DK, FR, GB, IT, LI, LU, NL, SE 

5 

1. DNA-Sequenz, die ein BMP-Prolein codiert, das die Fahigkeit besitzt, Knorpelund/oder Knochenbildung zu indu- 
zieren, wobei die DNA-Sequenz 

(a) eine DNA-Sequenz, die BMP-5 codiert. und die 

10 

(i) die Nucleotidpositionen #699 bis #2060 in Tabelle III umfa3t; 

(ii) die Nucleotidpositionen #1665 bis #2060 in Tabelle III umfaBt; 

(iii) Sequenzen umfaBt, die mit der Sequenz nach (i) unter stringenten Hybridisierungsbedlngungen hy- 
bridisieren und ein Protein codleren, das die biologischen Eigenschaften von BMP-5 besitzt; 

^5 (iv) degenerierte Sequenzen oder Allele einer Sequenz nach (i) bis (iii) umfaBt; Oder 

(v) BMP-5 codiert, das die Aminosauresequenz von Position #323 bis #454 in Tabelle III besitzt; 

(b) eine DNA-Sequenz, die BMP-6 codiert, und die 

20 (i) die Nucleotidpositionen #160 bis #1698 in Tabelle IV umfaBt; 

(ii) die Nucleotidpositionen #1303 bis #1698 in Tabelle IV umfaBt; 

(iii) Sequenzen umfaBt, die mit der Sequenz nach (i) unter stringenten Hybridisierungsbedingungen hy- 
bridisieren und ein Protein codteren, das die biologischen Eigenschaften von BMP-6 besitzt; 

(iv) degenerierte Sequenzen Oder Allele einer Sequenz nach (i) bis (iii) umfaBt; oder 

2^ (v) BMP-6 codiert, das die Aminosauresequenz von Position #382 bis #513 in Tabelle IV besitzt; oder 

(c) eine DNA-Sequenz, die BMP-7 codiert, und die 

(t) die Nucleotidpositionen #994 bis #1389 in Tabelle V umfaBt; 
30 (ii) Sequenzen umfaBt, die mit der Sequenz nach (i) unter stringenten Hybridisierungsbedingungen hy- 

bridisieren, die eine Aminosauresequenz codieren, deren N-Terminus der Aminosaure entspricht, die das 
Codon mit der Nucleotidposrtion #994 beginnend codiert, und die ein Protein codieren, das die biologi- 
schen Eigenschaften von BMP-7 besitzt; 

(iii) degenerierte Sequenzen oder Allele einer Sequenz nach (i) bis (iii) umfaBt; oder 
35 (iv) BMP-7 codiert, das die Aminosauresequenz von Position #300 bis #431 in Tabelle V besitzt, 

ist. 

2. Vektor, der eine DNA-Sequenz nach Anspruch 1 in f unktioneller Verkn upf ung mit einer Expressionskontrollsequenz 
40 umfaBt. 

3. Wirtszelle, die mit dem Vektor nach Anspruch 2 transformiert ist. 

4. Wirtszelle nach Anspruch 3, die eine Saugerzelle ist. 

45 

5. Wirtszelle nach Anspruch 4, die eine CHO-Zelle ist. 

6. Protein, das Eigenschaften von BMP-5, BMP-6 oder BMP-7 aufweist und das von einer DNA-Sequenz nach An- 
spruch 1 codiert wird. 

so 

7. Protein, das Eigenschaften von BMP-5, BMP-6 oder BMP-7 aufweist und durch folgende Schritte erhaltlich ist: 

(a) Zuchtung einer Wirtszelle nach einem der Anspruche 3 bis 5 in einem geeigneten Kulturmedium, und 

(b) Gewinnung, Isolierung und Reinigung des Proteins aus dem Kulturmedium. 

55 

8. Protein nach Anspruch 6 oder 7, weiter gekennzeichnet durch die Fahigkeit, die Induktion von Knorpel- und/oder 
Knochenbildung zu bewirken. 



40 



EP 0 429 570 B1 



9. Verfahren zur Herstellung eines BMP-Proteins, das folgende Schrilte umfafJt: 

(a) Zuchtung der transformierten Wirtszelle nach Anspruch 4 bis 6 in einem geeigneten Kulturmedium, und 

(b) Gewinnung, Isolierung und Reinigung des Proteins aus dem Kulturmedium. 

10. Protein, das Eigenschaften von BMP-7 aulweist und durch tolgende Schritte erhaltlich ist: 

(a) Zuchtung einer CHO-Zelle in einem geeigneten Kulturmediuna, die mit einer DNA-Sequenz transtormiert 
ist, die die Aminosauren #1 bis #431 in Tabelle V codiert, Oder mit einer DNA-Sequenz, die die Nucleotide 
#97 bis #1389 in Tabelle V um!a3t, und 

(b) Gewinnung, Isolierung und Reinigung des BMP-7-Proteins aus dem Kulturmedium. 

11. Verfahren zur Herstellung eines BMP-7-Proteins, das folgende Schritte umfa(3t: 

(a) Zuchtung einer CHO-Zelle in einem geeigneten Kulturmedium, die mit einer DNA-Sequenz transtormiert 
ist, die die Aminosauren #1 bis #431 in Tabelle V codiert, oder mit einer DNA-Squenz, die die Nucleotide #97 
bis #1389 in Tabelle V umfaftt, und 

(b) Gewinnung, Isolierung und Reinigung des BMP-7-Proteins aus dem Kulturmedium. 

12. Arzneimittel, das ein Protein nach einem der Anspruche 6 bis 8 oder 10 in einem Gemisch mit einem pharmazeu- 
tisch vertraglichen Trager umfa3t. 

13. Arzneimittel nach Anspruch 12, das weiter eine pharmazeutisch vertragliche Matrix umfaGt. 

14. Arzneimittel nach Anspruch 13, wobei die Matrix Hydroxyapatit, Kollagen, PolymilchsaureoderTricalciumphosphat 
umfaBt. 

15. Verwendung eines Proteins gema3 der Definition in einem der Anspruche 6 bis 8 oder 10 fur die Herstellung eines 
Arzneimittels zur Behandlung eines Patienten. der Knorpel- und/oder Knochenbildung benotigt. 

16. Verwendung eines Proteins gema3 der Definition in einem der Anspruche 6 bis 8 oder 1 0 fur die Herstellung eines 
Arzneimittels zur Wundheilung oder Wiederherstellung von Gewebe. 

17. DNA-Sequenz, die die Nucleotide #1 bis #2153 wie in Tabelle III gezeigt umfafJt. 

18. DNA-Sequenz, die die Nucleotide #1 bis #2923 wie in Tabelle IV gezeigt umfalBt. 

19. DNA-Sequenz, die die Nucleotide #1 bis #1448 wie in Tabelle V gezeigt umfa3t. 

20. DNA-Sequenz, die die BMP-7-DNA-Sequenz der ATCC-Hinterlegungsnummer 68020 umfa!5t. 



Patentanspruche fur folgenden Vertragsstaat : ES 

1. Verfahren zur Herstellung einer DNA-Sequenz, die ein BMP-Protein codiert, das die Fahigkeit besitzt, Knorpel- 
und/oder Knochenbildung zu induzieren, wobei die DNA-Sequenz 

(a) eine DNA-Sequenz, die BMP-5 codiert, und die 

(i) die Nucleotidpositionen #699 bis #2060 in Tabelle III umfaBt; 

(ii) die Nucleotidpositionen #1665 bis #2060 in Tabelle III umfaBt; 

(iii) Sequenzen umfaBt, die mit der Sequenz nach (i) unter stringenten Hybrtdisierungsbedingungen hy- 
bridisieren und ein Protein codieren, das die biologischen Eigenschaften von BMP-5 besitzt; 

(iv) degenerierte Sequenzen oder Allele einer Sequenz nach (i) bis (iii) umfaOt; oder 

(v) BMP-5 codiert, das die Aminosauresequenz von Position #323 bis #454 in Tabelle III besitzt; 

(b) eine DNA-Sequenz, die BMP-6 codiert, und die 



41 



EP 0 429 570 B1 



(i) die Nucleottdpositionen #160 bis #1698 in Tabelle IV umfaBt; 

(ii) die Nucleotidpositionen #1303 bis #1698 in Tabelle IV umfaGt; 

(iii) Sequenzen unnfa3t, die mit der Sequenz nach (i) unter stringenten Hybridisterungsbedingungen hy- 
bridisieren und ein Protein codieren, das die biologischen Eigenschatten von BMP-6 besltzt; 

(iv) degenerierte Sequenzen oder Allele etner Sequenz nach (I) bis (iii) umfaBt; oder 

(V) BMP-6 codiert, das die Aminosauresequenz von Position #382 bis #51 3 in Tabelle IV besltzt; oder 

(c) eine DNA-Sequenz, die BMP-7 codiert, und die 

(i) die Nucleotidpositionen #994 bis #1389 in Tabelle V umfa3t; 

(ii) Sequenzen umfaBt, die mit der Sequenz nach (i) unter stringenten Hybridisierungsbedingungen hy- 
bridisieren, die eine Aminosauresequenz codieren, deren N-Terminus der Aminosaure entspricht, die das 
Codon mit der Nucleotidposition #994 beginnend codiert, und die ein Protein codieren, das die biologi- 
schen Eigenschatten von BMP-7 besitzt; 

(iii) degenerierte Sequenzen oder Allele einer Sequenz nach (i) bis (iii) umfaOt; oder 

(iv) BMP-7 codiert. das die Aminosauresequenz von Position #300 bis #431 in Tabelle V besitzt, 

ist und das Verfahren folgende Schritte umfaOt: 

(a) Konstruktion einer cDNA-Bank, die die gesuchte cDNA enthalt; 

(b) Absuchen der cDNA-Bank mit einer geeigneten Sonde, die ein Fragment der DNA ist, die ein BMP-5-, 
BMP-6- Oder BMP-7-Protein vom Rind codiert; und 

(c) Isolierung von Clonen, die DNA enthalten, die ein BMP-5-, BMP-6- oder BMP-7-Protein codiert. 

2. Verfahren zur Herstellung eines Expressionsvektors, umfassend die Insertion einer DNA-Sequenz nach Anspruch 
1 in tunktioneller Verknupfung mit einer Expressionskontrollsequenz. 

3. Wirtszelle, die mit dem Vektor nach Anspruch 2 transformiert ist. 

4. Wirtszelle nach Anspruch 3, die eine Saugerzelle ist. 

5. Wirtszelle nach Anspruch 4, die eine CHO-Zelle ist. 

6. Verfahren zur Herstellung eines BMP-Proteins, wobei das Verfahren folgende Schritte umfaBt: 

(a) Zuchtung der trahsformierten Wirtszelle nach einem der Anspruche 3 bis 5 in einem geeigneten Kulturme- 
dlum, und 

(b) Gewinnung, Isolierung und Reinigung des Proteins aus dem Kulturmedium. 

7. Verfahren nach Anspruch 6, wobei das Protein welter gekennzeichnet ist durch die Fahigkeit, die Induktion von 
Knorpel- und/oder Knochenbildung zu bewirken. 

8. Verfahren zur Herstellung eines BMP-7-Proteins, das folgende Schritte umfaBt: 

(a) Zuchtung einer CHO-Zelle in einem geeigneten Kulturmedium, die mit einer DNA-Sequenz transformiert 
ist, die die Aminosauren #1 bis #431 in Tabelle V codiert, oder mit einer DNA-Sequenz, die die Nucleotide 
#97 bis #1389 in Tabelle V umfaBt, und 

(b) Gewinnung, Isolierung und Reinigung des BMP-7-Proteins aus dem Kulturmedium. 

9. Verfahren zur Herstellung eines Arzneimittels, das das Mischen eines Proteins, hergestellt gemaB dem Verfahren 
nach einem der Anspruche 6 bis 8, mit einem pharmazeutisch vertraglichen Trager umfaBt. 

10. Verfahren nach Anspruch 9, wobei das Arzneimittel welter eine pharmazeutisch vertragliche Matrix umfaBt. 

11. Verfahren nach Anspruch 10, wobei die Matrix Hydroxyapatit, Kollagen; Polymilchsaure oder Tricalciumphosphat 
umfaBt. 

12. Verfahren nach einem der Anspruche 9 bis 11, wobei das Arzneimittel zur Behandlung eines Patienten ist, der 



42 



EP 0 429 570 B1 



Knorpel- und/oder Knochenbitdung benotigt. 

13. Verfahren nach einem der Anspruche 9 bis 11, wobei das Arzneimittel zur Wundheilung Oder Wiederherstellung 
von Gewebe ist. 

5 

14. Verfahren zur Herstellung einer DNA-Sequenz. die die Nucleotide #1 bis #2153 wie in Tabetle It) gezeigt umfaBt, 
wobei das Verfahren die fotgenden Schritte umfaQt: 

(a) Konstruktion einer cDNA-Bank. die die gesuchte cDNA enthatt; 
10 (b) Absuchen der cDNA-Bank mit einer geeigneten Sonde, die ein Fragment der DNA ist, die ein BMP-5-Pro- 

tein vom Rind codiert; und 

(c) Isollerung von Clonen, die DNA enthalten, die ein BMP-5-Protein codiert. 

15. Verfahren zur Herstellung einer DNA-Sequenz, die die Nucleotide #1 bis #2923 wie in Tabelle IV gezeigt unnfaQt, 
15 wobei das Verfahren die folgenden Schritte unnfafBt: 

(a) Konstruktion einer cDNA-Bank, die die gesuchte cDNA enthatt; 

(b) Absuchen dercDNA-Bank mit einer geeigneten Sonde, die ein Fragment der DNA ist, die ein BMP-6-Pro- 
tein vom Rind codiert; und 

^0 (c) Isolierung von Clonen, die DNA enthalten, die ein BMP-6-Protein codiert. 

16. Verfahren zur Herstellung einer DNA-Sequenz, die die Nucleotide #1 bis #1448 wie in Tabelle V gezeigt umfaQt, 
wobei das Verfahren die folgenden Schritte umfaBt: 

^5 (a) Konstruktion einer cDNA-Bank, die die gesuchte cDNA enthalt; 

(b) Absuchen der cDNA-Bank mit einer geeigneten Sonde, die ein Fragment der DNA ist, die ein BMP-7-Pro- 
tein vom Rind codiert; und 

(c) Isolierung von Clonen, die DNA enthalten, die ein BMP-7-Protein codiert. 

30 17. Verfahren nach Anspruch 16, wobei die BMP-7-DNA-Sequenz in dem Clon mit der ATCC-Hinterlegungsnummer 
68020 enthalten ist. 



Revendicatione 

35 

Revendications pour les Etats contractants suivants : AT, BE, OH, DE, DK, FR, GB, IT, LI, LU, NL, SE 

1. Sequence d'ADN codant une proteine BMP ayant la capacity d'induire ia formation de cartilage et/ou d'os, cette 
40 sequence d'ADN etant choisie parmi le groupe comprenant : 

(a) une s6quence d'ADN codant BMP-5, 

(i) comprenant les positions nucleotidiques #699 ^ #2060 du tableau III, 
4^ (ii) comprenant les positions nucleotidiques #1665 a #2060 du tableau III, 

(iii) comprenant des sequences qui s'hybrident ^ la sequence de (i) dans des conditions d'hybridation 
rigoureuses et qui codent une prot6ine ayant les propri6t6s biologiques de BMP-5, 

(iv) comprenant des sequences qui sont d^g^n^r^es ou alleles par rapport k une sequence de Tune quel- 
conque des sections (i) ^ (iii), ou 

50 (v) comportant la sequence d'acides amines avec les acides amines #323 h #454 du tableau III, 

(b) une s6quence d'ADN codant BMP-6, 

(i) comprenant des positions nucl6otidiques #160 k #1698 du tableau IV 
55 (ii) comprenant des positions nucl6otidiques #1 303 k #1698 du tableau IV, 

(iii) comprenant des sequences qui s'hybrident k la s6quence de (i) dans des conditions d'hybridation 
rigoureuses et qui codent une prot6ine ayant les propri6t6s biologiques de BMP-6, 

(iv) comprenant des sequences qui sont d6gen6r6es ou alleles par rapport k une sequence de Tunequel- 



43 



EP 0 429 570 B1 



conque des sections (i) ^ (iii), ou 

(v) comportant la sequence d'acides amines avec les acides amines #382 ^ #51 3 du tableau IV, et 
(c) une s6quence d'ADN ccwjant BMP-7, 

(i) comprenapt des positions nucleotidiques #994 a #1389 du tableau V 

(ii) comprenant des sequences qui s'hybrident k la sequence de (i) dans des conditions d'hybridatlon 
rlgoureuses, codent une sequence d'acides amines avec la position N-terminale correspondant k la po- 
sition d'acide amin6 cod6e par le codon initiant avec la position nucl6otidique #994 et codent une prot6ine 
ayant les propri6t6s biologiques de BMP-7. 

(iii) comprenant des sequences qui sont d^gdn^r^es ou alleles par rapport k une sequence de Tune quel- 
conque des sections (i) k (iii), ou 

(iv) connportant la sequence d'acides amines avec les acides amines #300 k #431 du tableau V 

2. Vecteur comprenant une sequence d'ADN de la revendication 1 en association fonctionnelle avec une sequence 
de controle d'expression de celle-ci. 

3. Cellule hote transformee par le vecteur de la revendication 2. 

4. Cellule hote suivant la revendication 3, qui est une cellule de mammitere. 

5. Cellule h6te suivant la revendication 4 qui est une cellule CHO. 

6. Proteine montrant des propri6t6s de BMP-5, BMP-6 ou BMP-7, qui est codee par une sequence d'ADN suivant la 
revendication 1 . 

7. Prot6ine montrant des propri6t6s de BMP-5, BMP-6 ou BMP-7, qui peut 6tre obtenue par les 6tapes ; 

(a) de culture dans un milieu de culture appropri6 d'une cellule hote suivant I'une quelconque des revendica- 
tions 3 ^ 5, et 

(b) de recuperation, d'isolement et de purification de cette prot6ine a partir de ce milieu de culture. 

8. Proteine suivant I'une des revendications 6 et 7, caract6risee en outre par la capacity de d6montrer induction de 
formation de cartilage et/ou d'os. 

9. Proced6 de production de prot6ine BMP, ce proc6d6 comprenant les 6tapes : 

(a) de culture dans yn milieu de culture approprl6 de la cellule hote transform6e suivant I'une des revendica- 
tions 4^6, et 

(b) de r6cup6rati6n, d'isolement et de purification de cette prot6ine a partir de cette culture. 

10. Prot6ine montrant des propri6t6s de BMP-7, qui peut 6tre obtenue par les 6tapes : 

(a) de culture dans un milieu de culture appropri^ d'une cellule CHO transformee par une sequence d'ADN 
codant des acides amines #1 a #431 du tableau V ou par une sequence d'ADN comprenant des nucleotides 
#97 k #1 389 du tableau V, et 

(b) de recuperation, d'isolement et de purification de ladite proteine BMP-7 k partir de ce milieu de culture. 

11. Proc6d6 de production d'une proteine BMP-7, ce proc6de comprenant les 6tapes : 

(a) de culture dans un milieu de culture approprie d'une cellule CHO transformee par une sequence d'ADN 
codant des acides amines #1 k #431 du tableau V ou par une sequence d'ADN comprenant des nucleotides 
#97 a #1 389 du tableau V, et 

(b) de recuperation, d'isolement et de purification de cette proteine BMP-7 a partir de cette culture. 

12. Composition pharmaceutique comprenant une proteine suivant I'une quelconque des revendications 6 ^ 8 ou 10 
en melange avec un support pharmaceutiquement acceptable. 



44 



EP 0 429 570 B1 



13. Composition suivant ta revendication 12, comprenant en outre une matrice pharmaceutiquement acceptable. 

14. Composition suivant la revendication 13, caract6rjs6e en ce que ladite matrice comprend de I'hydroxyapatite, du 
collagdne, de I'acide polylactlque ou du phosphate tricalcique. 

15. Utilisation d'une proteine suivant Tune quelconque des revendications 6 a 8 ou 10 pour la preparation d'une com- 
position pharmaceutique destin6e au traitement d'un patient ayant besoin de formation de cartilage et/ou d'os. 

16. Utilisation d'une prot6ine suivant Tune quelconque des revendications 6 ^ 8 ou 10 pour la pr6paration d'une com- 
position pharmaceutique destin^e k la cicatrisation d'une blessure et ci la reparation d'un tissu. 

17. Sequence d'ADN comprenant des nucleotides #1 ^ #2153 comme illustr6 dans le tableau III. 

18. sequence d'ADN comprenant des nucleotides #1 ^ #2923 comme illustre dans le tableau IV 

19. sequence d'ADN comprenant des nucleotides #1 a #1448, comme illustre dans le tableau V. 

20. sequence d'ADN comprenant la sequence d'ADN de BMP-7 du depot ATCC 68020. 



Revendications pour I'Etat contractant suivant : ES 

1. Procede de preparation d'une sequence d'ADN codant une proteine BMP ayant la capacite d'induire la formation 
de cartilage et/ou d'os, cette sequence d'ADN etant choisie parmi le groupe comprenant : 

(a) une sequence d'ADN codant BMP-5, 

(i) comprenant les positions nucieotidiques #699 a #2060 du tableau III, 
(It) comprenant les positions nucieotidiques #1665 a #2060 du tableau III, 

(iii) comprenant des sequences qui s'hybrident ^ la sequence de (i) dans des conditions d'hybridation 
rigou reuses et qui codant une proteine ayant les proprietes biologiques de BMP-5, 
(Iv) comprenant des sequences qui sont degenerees ou alleles par rapport ^ une sequence de I'une quel- 
conque des sections (I) a (ili), ou 

(v) comportant la sequence d'acides amines avec les acides amines #323 a #454 du tableau III, 

(b) une sequence d'ADN codant BMP-6, 

(I) comprenant des positions nucieotidiques #160 a #1698 du tableau IV, 
(li) comprenant des positions nucieotidiques #1303 a #1698. du tableau IV, 

(iii) comprenant des sequences qui s'hybrident a la sequence de (i) dans des conditions d'hybridation 
rigoureuses et qui codent une proteine ayant les proprietes biologiques de BMP-6, 
(Iv) comprenant des sequences qui sont degener6es ou alleles par rapport ^ une sequence de I'une quel- 
conque des sections (i) a (iii), ou 

(v) comportant la sequence d'acides amines avec les acides amines #382 a #61 3 du tableau IV, et 

(c) une sequence d'ADN codant BMP-7, 

(i) comprenant des positions nucieotidiques #994 a #1389 du tableau V, 

(il) comprenant des sequences qui s'hybrident h la sequence de (i) dans des conditions d'hybridation 
rigoureuses, codent une sequence d'acides amines avec la position N-terminale correspondant a la po- 
sition d'actde amine codee par le codon initiant avec la position nucieotidique #994 et codent une proteine 
ayant les proprietes biologiques de BMP-7, 

(Iii) comprenant des sequences qui sont d6generees ou alleles par rapport a une sequence de I'une quel- 
conque des sections (i) k (ili), ou 

(Iv) comportant la sequence d'acides amines avec les acides amines #300 a #431 du tableau V 
ce procede comprenant les etapes suivantes : 



45 



EP 0 429 570 B1 



(a) de construction d'une biblioth^que d'ADNc contenant TADNc cible, 

(b) de passage au crible de la bibliothfeque d'ADNc par une sonde appropri6e, qui est un fragment de I'ADN 
codant une prot6ine BMP-5, BMP-6 ou BMP-7 bovine, et 

(c) d'isolement des clones contenant de I'ADN codant une prot6ine BMP-5, BMP-6 ou BMP-7. 

5 

2. Proc6d6 de preparation d'un vecteur d'expression comprenant I'insertion d'une sequence d'ADN suivant la reven- 
dication 1 en association fonctionnelle avec une s6quence de contrdle d'expression. 

3. Cellule hfite transform6e par le vecteur suivant la revendicatlon 2. 

70 

4. Cellule hote suivant la revendicatlon 3, qui est une cellule de mammifere. 

5. Cellule hote suivant la revendicatlon 4, qui est une cellule CHO. 

'5 6. Proc6d6 de production de proteine BMP, ce proc6d6 comprenant les 6tapes 

(a) de culture dans un milieu de culture appropri6 de la cellule h6te transform6e suivant I'une des revendlca- 
tions 3 a 5, et 

(b) de r6cup6ration, d'isolement et de purification de cette prot6ine ^ partir de cette culture. 

20 

7. Procedd suivant la revendicatlon 6, dans lequel la prot6ine est en outre caract6ris6e par la capacity de d6montrer 
I'induction de formation de cartilage et/ou d'os. 

8. Proced6 de production d'une prot6ine BMP-7, ce proc6de comprenant les 6tapes : 

25 

(a) de culture dans un milieu de culture approprie d'une cellule CHO transform6e par une sequence d'ADN 
codant des acides amines # 1 ^ # 431 du Tableau V ou par une sequence d'ADN comprenant des nucleotides 
# 97 ^ # 1 389 du Tableau V, et 

(b) de r6cup6ration. d'isolement et de purification de cette proteine BMP-7 a partir de cette culture. 

30 

9. Proc6d6 de preparation d'une composition pharmaceutique comprenant une combinaison d'une prot6ine produite 
conform6ment au proc6d6 suivant I'une quelconque des revendications 6^8 avec un support pliarmaceutiquement 
acceptable. 



35 10. Proc6d6 suivant la revendicatlon 9, caract6ris6 en ce que la composition comprend en outre une matrice phar- 
maceutiquement acceptable. 



11. Proced6 suivant la revendicatlon 10, caracterise en ce que la matrice comprend de I'hydroxyapatite, du collagene, 
de I'acide polylactique ou du phosphate tricalcique. 

40 

1 2. Precede suivant I'une quelconque des revendications 9^11, caracterise en ce que la composition pharmaceutique 
est destinee au traitement d'un patient ayant besoin de formation de cartilage et/ou d'os. 



13. Precede suivant I'une quelconque des revendications 9 a II, caracterise en ce que la composition pharmaceutique 
45 est destinee a la cicatrisation d'une blessure et k la reparation d'un tissu. 

14. Proc6de de preparation d'une sequence d'ADN comprenant des nucleotides #1 k #2153 comme illustre dans le 
Tableau III, ce procede comprenant les etapes suivantes : 

50 (a) de construction d'une bibliothfeque d'ADNc contenant I'ADNc cible, 

(b) de passage au crible de la btbliotheque d'ADNc par une sonde appropriee, qui est un fragment de I'ADNc 
codant une proteine BMP-5 bovine, et 

(c) d'isolement de clones contenant de I'ADN codant une proteine BMP-5. 

55 15. Procede de preparation d'une sequence d'ADN comprenant des nucleotides #1 a #2923 comme illustre dans le 
Tableau IV, ce procede comprenant les etapes suivantes : 



(a) de construction d'une bibliothfeque d'ADNc contenant I'ADNc cible. 



46 



EP 0 429 570 B1 



(b) de passage au crible de la bibliotheque d'ADNc par une sonde appropri6e, qui est un fragment de I'ADN 
codant une prot6ine BMP-6 bovine, et 

(c) d'isolement de clones contenant de I'ADN codant une prot6ine BMP-6. 

16. Proc6de de preparation d'une sequence d'ADN comprenant des nucleotides #1 a #1448. comma illustr6 dans le 
Tableau V. ce proc6d6 comprenant las 6tapes suivantes : 

(a) de construction d'une bibliotheque d'ADNc contenant I'ADNc cible, 

(b) de passage au crible de la bibliotheque d'ADNc par une sonde appropri6e, qui est un fragment de TADN 
codant une proteine BMP-7 bovine, et 

(c) d'isolement de clones contenant de I'ADN codant une prot6ine BMP-7. 

17. Procede suivant la revendication 16, caract6ris6 en ce que la sequence d'ADN de BMP-7 est contenue dans le 
d6p6t ATCC 68020 de clone. 



47 



This Page is Inserted by IFW Indexing and Scanning 
Operations and is not part of the Official Record 

BEST AVAILABLE IMAGES 

Defective images within this document are accurate representations of the original 
documents submitted by the appHcant. 

Defects in the images include but are not limited to the items checked: 

□ BLACK BORDERS 

□ IMAGE CUT OFF AT TOP, BOTTOM OR SIDES 
FADED TEXT OR DRAWING 

[^BLURRED OR ILLEGIBLE TEXT OR DRAWING 

□ SKEWED/SLANTED IMAGES 

□ COLOR OR BLACK AND WHITE PHOTOGRAPHS 

□ GRAY SCALE DOCUMENTS 

□ LINES OR MARKS ON ORIGINAL DOCUMENT 

□ REFERENCE(S) OR EXHIBIT(S) SUBMITTED ARE POOR QUALITY 

□ OTHER: . 

IMAGES ARE BEST AVAILABLE COPY. 
As rescanning these documents will not correct the image 
problems checked, please do not report these problems to 
the IFW Image Problem Mailbox.