Skip to main content

Full text of "USPTO Patents Application 09804625"

See other formats


J 



® 



Europaisches Patentamt 
European Patent Office 
Office europ€en des brevets 



© Publication number: 



0 409 472 A1 



© 



EUROPEAN PATENT APPLICATION 



© Application number: 90307568.7 
© Date of filing: 11.07.90 



© int. CIA C12N 15/12, C12P 21/02, 
C12P 21/08, A61K 37/02, 
C12N 15/16, C12N 15/62 



© Priority: 19.07.89 US 382805 


® Applicant: CHIRON CORPORATION 


4560 Horton Street 


@ Date of publication of application: 


Emeryville California 94608(US) 


23.01.91 Bulletin 91/04 


@ Inventor: Keifer, Michael C. 




® Designated Contracting States: 


401 Wright Court 


AT BE CH DE DK ES FR GB GR IT LI LU NL SE 


Clayton, California 9451 7( US) 




Inventor: Masiarz, Frank R. 




148 Marvlew Way 




San Francisco, California 941 31 (US) 




Inventor: Barr, Philip J, 




67 Bay Forest Drive 




Oakland, California 94611 (US) 




0 Representative: Hartley, David et al 




Withers & Rogers 4 Dyer's Buildings 




Holbornorn 




London, EC1N 2JT(GB) 



m 

CO 
H 

i 

f— 

m 

o 
O 

TP 
-< 



© Bone morphogenetic protein. 

© The purification and cloning of bone morphogenetic protein are disclosed, as well as production of BMP and 
its analogs thereof by recombinant ONA techniques. Pharmaceutical compositions comprising BMP and the use 
of such compositions are also disclosed. 



CM 

e 
o 

LU 



Xerox Copy Centre 



EP 0 409 472 A1 



BONE MORPHOGENETIC PROTEIN 



This invention relates to a bone morphogenetic protein (BMP) which initiates cartilage and bone growth. 
The full length coding sequence for BMP, a polypeptide, is provided. The BMP is provided by isolation 
from bone sources and by synthesis using recombinant DNA techniques. 

5 

BACKGROUND OF THE INVENTION 

It is known that deminerali2ed bone matrix induces new bone formation when implanted in the soft 
tissue by a process generally designated as matrix induced bone formation (see Urist, M.R., Science , 150 : 

w 893-899 (1965)). There have been numerous efforts to extract and identify the active material (or materials) 
which induces this process, and it has been generally referred to in the literature as bone morphogenetic 
protein(s) (BMP). It is uncertain whether BMP is a single material or a mixture of materials, and there does 
not appear to be agreement among the investigators as to which material, if any, is the bone morphogenetic 
protein. As discussed herein, the term BMP is used to describe the protein having the amino acid sequence 

is shown in FIG. 3 (bovine BMP) or FIG. 5 (human BMP), without the signal peptide. 

The therapeutic use of BMP offers considerable advantages over use of traditional bone graft materials. 
While not intended to be limited by any theory one hypothesis assumes that BMP initiates the differenti- 
ation of tissue cells into osteoblasts (cells that manufacture bone). During a process that replicates normal 
human fetal development, BMP-induced osteoblasts form cartilage which, over a period of several weeks 

20 yields solid bone. Thus BMP may be useful for replacing bone that has been destroyed by disease or 
accident, for use in treatment of scoliosis victims, for treatment of mal-or mis-formed bone, for use in 
healing of a fracture, dental reconstruction, hip replacement, bone remodeling, and control of osteoporosis. 

It is thus an object of the present invention to produce a functional cartilage and bone growth factor or a 
component thereof, which is a protein identified by its entire amino acid sequence, which has BMP activity. 

25 It is another object of the present invention to produce this biologically active BMP protein by 
recombinant DNA technology. 



SUMMARY OF THE INVENTION 

30 

The present invention provides a class of mature native mammalian proteins termed herein as "bone 
morphogenetic protein" or "BMP", exemplified by the native human and bovine sequences described 
herein. Generally, this class of proteins induce bone growth in vivo or in vitro . The human and/or bovine 
sequences are representative of the class, and can be used to identify and isolate other mammalian BMP 

35 proteins, which will be at least partially or substantially homologous in nucleotide and amino acid 
sequences. Those of skill in the art will be able to readily identify other mammalian BMP's based on 
sequence homology to the human and bovine proteins disclosed herein, as well as biological activity. It is 
recognized that there may be allelic variations in BHP within a species, and such allelic variants are also 
within the scope of the class of proteins provided by the present invention. 

40 The present invention further provides polypeptides which are analogs of BMP, such as BMP muteins, 
fusion proteins comprising BMP or BMP domains, and BMP fragments. Preferred analogs have BMP 
activity. A BMP mutein is a protein substantially homologous to a native BMP sequence ( e . g ., a 
minimum of about 75%, 85%, 90% or 95% homologous) wherein at least one amino acid is different The 
term fusion protein includes a protein comprising a complete BMP sequence or a domain, and a 

45 heterologous N- or C-terminal sequence (such as a signal sequence or sequence which protects the protein 
from degradation). A BMP fragment or domain is an amino acid sequence of sufficient length from a protein 
such that it is identifiable as having been derived from such BMP protein. The origin of a particular peptide 
can be, determined, for example by comparing its sequence to those in public databases. 

The present invention provides in another embodiment BMP having amino acid sequence shown in 

so FIGS. 3 and 5 (which also show the signal peptide). The present invention also provides methods of 
preparing the BMP by recombinant DNA techniques. 

In yet another embodiment, the present invention provides the DNA sequence encoding BMP or 
analogs thereof, which may be used to construct vectors for expression in host systems by recombinant 
DNA techniques. 

In still another embodiment, the present invention provides therapeutic compositions comprising BMP 



2 



EP 0 409 472 A1 



and, optionally, other osteoinductive associated factors such as matrix Gla protein (MGP) and bone 
calcification factor (BCF) and methods for forming cartilage and bone in vertebrates by introducing in vivo at 
the desired site an effective bone initiating amount of BMP. The identity of BMP was first reported by Price. 
Urist and Otawara in Biochem. Biophys, Res. Comm . 117:765-771 (1983). The identity of BCF is disclosed 
5 in commonly assigned copending Serial No. 360,826, filed June 2 t 1989. 



BRIEF DESCRIPTION OF THE DRAWINGS 

10 FIG. 1 shows the amino acid sequences of eight peptides from tryptic digestion of bovine BMP; 

FIG. 2 shows DNA and amino acid sequences of two exon-containing regions of the bovine BMP gene; 
FIG. 3 shows the nucleotide sequence of bovine BMP cDNA and the deduced amino acid sequence of 
the precursor polypeptide; 

FIGS. 4a through 4c show the sequences of the exon-containing regions of the human BMP gene, 
is FIG. 5 shows the nucleotide sequence of human BMP and the deduced amino acid sequence of the 
precursor polypeptide. 

DETAILED DESCRIPTION OF THE INVENTION 

20 The BMP according to the present invention may be obtained, free of other osteoinductive associated 
factors, directly from bone sources, by preparative peptide synthesis using chemical methods (such as the 
Merrifield synthesis method) or by recombinant DNA technology. 

As more particularly described in Example 1, BMP may be obtained from partially purified human, 
bovine, or other vertebrate bone extracts, by preparative gel electrophoresis and electroelution of the 

25 protein. 

BMP nucleic acid sequences may be obtained by recombinant DNA methods, such as by screening 
reverse transcripts of mRNA, or by screening genomic libraries from any cell. The DNA may also be 
obtained by synthesizing the DNA using commonly available techniques and DNA synthesizing apparatus. 
Synthesis may be advantageous because unique restriction sites may be introduced at the time of 

30 preparing the DNA, thereby facilitating the use of the gene in vectors containing restriction sites not 
otherwise present in the native source. Furthermore, any desired site modification in the DNA may be 
introduced by synthesis, without the need to further modify the DNA by mutagenesis. 

In general, DNA encoding the BMP may be obtained from human, bovine or other sources by 
constructing a cDNA library from mRNA isolated from vertebrate tissue; and screening with labeled DNA 

35 probes encoding portions of the human or bovine chains in order to detect clones in the cDNA library that 
contain homologous sequences; or by polymerase chain reaction (PCR) amplification of the cDNA (from 
mRNA) and subcloning and screening with labeled DNA probes; and then analyzing the clones by 
restriction enzyme analysis and nucleic acid sequencing so as to identify full-length clones and, if full-length 
clones are not present in the library, recovering appropriate fragments from the various clones and ligating 

40 them at restriction sites common to the clones to assemble a clone encoding a full-length molecule. 
Particularly preferred DNA probes are set forth in the accompanying examples. Any sequences missing 
from the 5 end of the BMP cDNA may be obtained by the 3' extension of the synthetic oligonucleotides 
complementary to BMP sequences using mRNA as a template, (so-called primer extension), or homologous 
sequences may be supplied from known cDNAs derived from human or bovine sequences as shown in FIG. 

45 3 or FIG. 5. 

The practice of the present invention will employ, unless otherwise indicated, conventional molecular 
biology, microbiology, and recombinant DNA techniques within the skill of the art. Such techniques are 
explained fully in the literature. See e . g ., Maniatis, Fritsch & Sambrook, "Molecular Cloning: A Laboratory 
Manual" (1982); "DNA Cloning: A Practical Approach," Volumes I and II (D.N. Clover ed. 1985); 
50 "Oligonucleotide Synthesis" (M.J. Gait ed. 1984); "Nucleic Acid Hybridization" (S.D. Names & S.J. Higgins 
eds. 1985); "Transcription And Translation" (B.D. Hames & S.J. Higgins eds. 1984); "Animal Cell Culture" 
(R.I. Freshney ed. 1986); "Immobilized Cells And Enzymes" (IRL Press, 1986); B. Perbal. "A Practical 
Guide To Molecular Cloning" (1984). 

In describing the present invention, the following terminology will be used in accordance with the 
55 definitions set out below. 

The term "osteoinductive associated factors" includes factors known in the art which are present in 
mammalian bone or other mammalian tissue and tend to co-purify with BMP or BMP activity. Such factors 
include, but are not limited to, proteins which have been isolated from bone having reported relative 



3 



EP 0 409 472 A1 



molecular weights by migration on a SDS-PAGE of 34KD, 24KD, 18.5KD, 17.5KD, 16.5KD, 14KD (as cited in 
the U.S. Patent No. 4,761,471), and 6KD (reported by Price, P.A., et al ., from Prot NatL Acad. Sci. , 73 , 
pp. 1447-1451, 3976). All observed molecular weights are reported herein as relative molecular weighfby 
migration on SDS-PAGE gel. 
5 A "replicon" is any genetic element (e.g., plasmid, chromosome, virus) that functions as an 
autonomous unit of DNA replication in vivo ; i 7e ., capable of replication under its own control. 

A "vector" is a replicon, such as"piasmidrphage or cosmid, to which another DNA segment may be 
attached so as to bring about the replication of the attached segment. 

A "DNA molecule" refers to the polymeric form of deoxyribonucleotides (adenine, guanine, thymine, or 
to cytosine) in its either single stranded form, or a double-stranded helix. This term refers only to the primary 
and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this 
term includes double-stranded DNA found, inter alia , in linear DNA molecules (e.g., restriction 
fragments), viruses, plasmids, and chromosomes. IrTdiscussing the structure of particular double-stranded 
DNA molecules, sequences may be described herein according to the normal convention of giving only the 
75 sequence in the 5 to 3' direction along the nontranscribed strand of DNA ( i . e ., the strand having a 
sequence homologous to the mRNA). 

A DNA "coding sequence" is a double-stranded DNA sequence which is transcribed and translated into 
a polypeptide in vivo when placed under the control of appropriate regulatory sequences. The boundaries of 
the coding sequence are determined by a start codon at the 5 (amino) terminus and a translation stop 
20 codon at the 3 (carboxy) terminus. A coding sequence can include, but is not limited to, procaryotic 
sequences, cDNA from eucaryotic mRNA, genomic DNA sequences from eucaryotic (e.g., mammalian) 
DNA, and even synthetic DNA sequences. A polyadenylation signal and transcription teFmination sequence 
will usually be located 3' to the coding sequence. 

Transcriptional and translational control sequences are DNA regulatory sequences, such as promoters, 
25 enhancers, polyadenylation signals, terminators, and the like, that provide for the expression of a coding 
sequence in a host cell. 

A "promoter sequence" is a DNA repulatory region capable of binding RNA polymerase in a cell and 
initiating transcription of a downstream (3 direction) coding sequence. For purposes of defining the present 
invention, the promoter sequence is bounded at its 3 terminus by the transcription initiation site and 

30 extends upstream (5 direction) to include the minimum number of bases or elements necessary to initiate 
transcription at levels detectable above background. Within the promoter sequence will be found a 
transcription initiation site (conveniently defined by mapping with nuclease S1), as well as protein binding 
domains (consensus sequences) responsible for the binding of RNA polymerase. Eucaryotic promoters will 
often, but not always, contain "TATA" boxes and "CAT" boxes. Procaryotic promoters contain Shine- 

35 Dalgarno sequences in addition to the -10 and -35 consensus sequences. 

A coding sequence is "under the control" of transcriptional and translational control sequences in a cell 
when RNA polymerase transcribes the coding sequence into mRNA, which is then translated into the 
protein encoded by the coding sequence. 

A "signal sequence" can be included before the coding sequence. This sequence encodes a signal 

40 peptide, N- terminal to the polypeptide, that communicates to the host cell to direct the polypeptide to the 
cell surface or secrete the polypeptide into the media, and this signal peptide is clipped off by the host cell 
before the protein leaves the cell. Signal sequences can be found associated with a variety of proteins 
native to prokaryotes and eukaryotes. For instance, alpha-factor, a native yeast protein, is secreted from 
yeast, and its signal sequence can be attached to heterologous proteins to be secreted into the media (See 

45 U.S. Patent 4,546,082, EPO 0 116 201, publication date 12 January 1983; U.S. Patent Application Ser. No. 
522.909, filed 12 August 1983). Further, the alpha-factor and its analogs have been found to secrete 
heterologous proteins from a variety of yeast, such as Saccharomyces and Kluyveromyces, (EPO 
88312306.9 filed 23 December 1988; U.S. Patent Application Ser. No. 339,682, filed 30 December 1987, 
and EPO Pub. No. 0 301 669, publication date 1 February 1989). 

so A cell has been "transformed" by exogenous or heterologous ON A when such DNA has been 
introduced inside the cell. The transforming DNA may or may not be integrated (covalently linked) into 
chromosomal DNA making up the genome of the cell. In prokaryotes, yeast, and mammalian cells for 
example, the transforming DNA may be maintained on an episomal element such as a plasmid. With 
respect to eukaryotic cells, a stably transformed cell is one in which the transforming DNA has become 

55 integrated into a chromosome so that it is inherited by daughter cells through chromosome replication. This 
stability is demonstrated by the ability of the eukaryotic cell to establish cell lines or clones comprised of a 
population of daughter cells containing the transforming DNA. A "clone" is a population of ceils derived 
from a single cell or common ancestor by mitosis. A "ceil line" is a clone of a primary cell that is capable 



4 



EP 0 409 472 A1 



of stable growth in vitro for many generations. 

Two DNA sequences are "substantially homologous" when at least about 85% (preferably at least 
about 90%, and most preferably at least about 95%) of the nucleotides match over the defined length of the 
DNA sequences. Sequences that are substantially homologous can be identified in a Southern hybridization 

5 experiment under, for example, stringent conditions as defined for that particular system. Defining appro- 
priate hybridization conditions is within the skill of the art. See, e.g., Maniatis et al supra ; DNA Cloning, 
Vols. I & II, supra ; Nucleic Acid Hybridization, supra . 

A "heterologous" region of the DNA construct is an identifiable segment of DNA within a larger DNA 
molecule that is not found in association with the larger molecule in nature. Thus, when the heterologous 

io region encodes a mammalian gene, the gene will usually be flanked by DNA that does not flank the 
mammalian genomic DNA in the genome of the source organism. Another example of a heterologous 
coding sequence is a construct where the coding sequence itself is not found in nature < e . g ., a cDNA 
where the genomic coding sequence contains introns, or synthetic sequences having codons different than 
the native gene). Allelic variations or naturally-occurring mutational events do not give rise to a heterologous 

7S region of DNA as defined herein. 

A composition comprising "A" (where "A" is a single protein, DNA molecule, vector, etc.) is substan- 
tially free of "B" (where "B" comprises one or more contaminating proteins, DNA molecules, vectors, etc.) 
when at least about 75% by weight of the proteins, DNA, vectors (depending on the category of species to 
which A and B belong) in the composition is "A w . Preferably, "A" comprises at least about 90% by weight 

20 of the A + B species in the composition, most preferably at least about 99% by weight. It is also preferred 
that a composition, which is substantially free of contamination, contain only a single molecular weight 
species having the activity or characteristic of the species of interest. 

An "antibody" is any immunoglobulin, including antibodies and fragments thereof, that binds a specific 
epitope. The term encompasses, inter alia, polyclonal, monoclonal, and chimeric antibodies. 

25 For more about chimeric antibodies see U.S. Patents Nos., 4,816,397 and 4,816,567. 

The intron-free DNA provided by the present invention is novel, since it is believed that the naturally- 
occurring human and bovine genes contain introns. Hence, the term "intron-free" excludes the DNA 
sequences which naturally occur in the chromosomes of human or bovine cells. The present invention, also 
encompasses the intron-free cDNA sequences derivable from the DNA sequences disclosed herein. 

30 As more particularly described in the following examples, human and bovine cDNA libraries were 
initially probed for sequences encoding BMP sequences using labeled oligodeoxynucleotides whose 
sequences were based on a partial amino acid sequence determined from analysis of purified protein 
samples derived from bone described herein. However, it is realized that once being provided with intron- 
free DNA encoding human and bovine BMP and their leader sequences as described herein, one of 

35 ordinary skill in the art would recognize that other precisely hybridizing probes may be prepared from the 
described sequences in order to readily obtain the remainder of the desired human or bovine gene. 

Vectors are used to simplify manipulation of the DNA which encodes the BMP polypeptide, either for 
preparation of large quantities of DNA for further processing (cloning vectors) or for expression of the BMP 
polypeptide (expression vectors). Vectors comprise plasmids, viruses (including phage), and integratable 

40 DNA fragments, i.e., fragments that are integratable into the host genome by recombination. Cloning vectors 
need not contain expression control sequences. However, control sequences in an expression vector 
include transcriptional and translational control sequences such as a transcriptional promoter, an optional 
operator sequence to control transcription, a sequence encoding suitable ribosome binding sites (for 
prokaryotic expression), and sequences which control termination of transcript ion and translation. The 

45 expression vector should preferably include a selection gene to facilitate the stable expression of BMP 
and/or to identify transformants. However, the selection gene for maintaining expression can be supplied by 
a separate vector in cotransformation systems using eukaryotic host cells. 

Suitable vectors generally will contain replicon (origins of replication, for use in non-integrative vectors) 
and control sequences which are derived from species compatible with the intended expression host. By 

so the term "replicable" vector as used herein, it is intended to encompass vectors containing such replicons 
as well as vectors which are replicated by integration into the host genome. Transformed host cells are cells 
which have been transformed or transfected with vectors containing BMP encoding ONA. The expressed 
BMP will be deposited intracellular^ or secreted into either the periplasmic space or the culture super- 
natant, depending upon the host cell selected and the presence of suitable processing signals in the 

55 expressed peptide, e.g. homologous or heterologous signal sequences. 

Suitable host cells are prokaryotes or eukaryotic cells. Prokaryotes include <3ram negative or Gram 
positive organisms, for example E . coli or bacilli. Eukaryotic cells include yeast or higher eukaryotic cells 
such as established cell lines of mammalian origin. 



5 



EP 0 409 472 A1 



Expression vectors for host cells ordinarily include an origin of replication, a promoter located upstream 
from the BMP coding sequence, together with a ribosome binding site, a polyadenylation site, and a 
transcriptional termination sequence. Those of ordinary skill will appreciate that certain of these sequences 
are not required for expression in certain hosts. An expression vector for use with microbes need only 
s contain an origin of replication recognized by the host, a promoter which will function in the host and a 
selection gene. 

An expression vector is constructed according to the present invention so that the BMP coding 
sequence is located in the vector with the appropriate regulatory sequences, the positioning and orientation 
of the coding sequence with respect to the control sequences being such that the coding sequence is 

70 transcribed and translated under the "control" of the control sequences (i.e., RNA polymerase which 
binds -to the DNA molecule at the control sequences transcribes the coding sequence). The control 
sequences may be ligated to the coding sequence prior to insertion into a vector, such as the cloning 
vectors described above. Alternatively, the coding sequence can be cloned directly into an expression 
vector which already contains the control sequences and an appropriate restriction site. For expression of 

75 BMP in prokaryotes and yeast, the control sequences will necessarily be heterologous to the coding 
sequence. If the host cell is a prokaryote, it is also necessary that the coding sequence be free of introns ( 
e.g., cDNA). If the selected host cell is a mammalian cell, the control sequences can be heterologous or 
homologous to the BMP coding sequence, and the coding sequence can either be genomic DNA containing 
introns or cDNA. Either genomic or cDNA coding sequences can be expressed in yeast. 

20 Expression vectors must contain a promoter which is recognized by the host organism. Promoters 
commonly known and available which are used in recombinant DNA construction include the /3-lactamase 
(penicillinase) and lactose promoter systems, a tryptophan (trp) promoter system and the tac promoter. 
While these are commonly used, other known microbial promoters are suitable. 

In addition to prokaryotes, eukaryotic cells such as yeast are transformed with BMP encoding vectors. 

25 Saccharomyces cerevisiae , or common baker's yeast, is the most commonly used among lower eukaryotic 
host microorganisms. However, a number of other species are commonly available and useful herein. Yeast 
vectors generally will contain an origin of replication from the 2 micron yeast plasmid or an autonomously 
replicating sequence (ARS), a promoter, DNA encoding BMP, sequences for polyadenylation and transcript 
ion termination, and a selection gene. 

30 Suitable promoter sequences in yeast vectors include the promoters for the glycolytic enzymes such as 
enolase, 3-phosphoglycerate kinase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate 
decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate 
kinase, triosephosphate isomerase, phosphoglucose isomerase, and glucokinase. 

Other yeast promoters, which have the additional advantage of transcription controlled by growth 

35 conditions are the promoter regions for alcohol dehydrogenase 1 or 2, isocytochrome C, acid phosphatase, 
as well as enzymes responsible for maltose and galactose utilization, 

Higher eukaryotic cell cultures may be used, whether from vertebrate or invertebrate cells, including 
insects, and the procedures of propagation thereof are known. See, for example, Tissue Culture , Academic 
Press, Kruse and Patterson, editors (1973). 

40 Suitable host cells for expressing BMP in higher eukaryotes include: monkey kidney CVI line trans- 
formed by SV40 (COS-7, ATCC CRL 1651); baby hamster kidney cells (BHK, ATCC CRL 10); Chinese 
hamster ovary-ceils-DHFR (described by Urlaub and Chasin, PNAS (USA) 77 : 4216 (1980)); mouse Sertoli 
cells (TM4, Mather, J.P., BioL Reprod. 23 : 243-251 (1980)); monkey kid"ney cells (CVI ATCC CCL 70); 
African green monkey kidney cells (VERO-76, ATCC CRL-1587); human cervical carcinoma cells (HELA, 

45 ATCC CCL 2); canine kidney cells (MDCK, ATCC CCL 34); buffalo rat liver celis <BRL 3A, ATCC CRL 
1442); human lung cells (W138, ATCC CCL 75); human liver cells (Hep ^2, HB 8065); mouse mammary 
tumor (MMT 060652, ATCC CCL 51); rat hepatoma cells (HTC, M1 , 54, Baumann. M., et al ., J. Cell Biol. 85 
: 1-8 (1980)) and TRI cells (Mather, J.P., et al ., Annals N.Y. Acad. ScL 383 : 44-88 (1 982))! Corm^nlylused 
promoters are derived from polyoma, adenovirus 2, and simian virus 40 (SV40). It will be appreciated that 

so when expressed in mammalian tissue, the recombinant BMP may have higher molecular weight due to 
glycosylation. It is therefore intended that partially or completely glycosylated forms of BMP having 
molecular weights greater than 19KD are within the scope of this invention as well as its unglycosylated 
forms. 

A number of procaryotic expression vectors are known in the art. See, e . g U.S. Patent Nos. 
55 4,440,859; 4,436,815; 4,431,740; 4,431,739; 4,428,941; 4,425,437; 4,418,149; 4,411,994; 4,366,246; 
4,342,832; see also U.K. Pub. Nos. GB 2,121,054; <3B 2,008,123; CB 2,007,675; and European Pub. No. 
103,395. Preferred procaryotic expression systems are in E . coli . 

Other preferred expression vectors are those for usein eucaryotic systems. An exemplary eucaryotic 

6 



EP 0 409 472 A1 



expression system is that employing vaccinia virus, which is well-known in the art. See. e.g.. Macket et al 
. (1984) J. Virol . 49 :857; "DNA Cloning," Vol. II, pp. 191-211, supra ; PCT Pub. No. WO 86/07593. Yeast 
expression vectors are known in the art. See, e.g., U.S. Patent Nos. 4,446.235; 4,443,539; 4,430,428; see 
also European Pub. Nos. 103,409; 100,561; 96,491. Another preferred expression system is vector pHS1, 

5 which transforms Chinese hamster ovary cells. See PCT Pub. No. WO 87/02062. Mammalian tissue may be 
cotransformed with DNA encoding a selectable marker such as dihydrofolate reductase (DHFR) or 
thymidine kinase and DNA encoding BMP. 

If wild type DHFR gene is employed, it is preferable to select a host cell which is deficient in DHFR, 
thus permitting the use of the DHFR coding sequence as marker for successful transfection in hgt" 

10 medium, which lacks hypoxanthine, glycine, and thymidine. An appropriate host cell in this case is the 
Chinese hamster ovary (CHO) cell line deficient in DHFR activity, prepared and propagated as described by 
Urlaub and Chasin, 1980, Proc. Nat. Acad. Sci . (USA) 77 : 4216. Expression vectors derived from 
baculovirus for use in insect ceils are knownTand available in the art. See Lucklow and Summers, 
Biotechnology , 6 , p. 47-55. 

rs Depending on the expression system and host selected, BMP is produced by growing host cells 
transformed by an exogenous or heterologous DNA construct, such as an expression vector described 
above under conditions whereby the BMP protein is expressed. The BMP is then isolated from the host 
cells and purified. If the expression system secretes BMP into growth media, the protein can be purified 
directly from cell-free media. If the BMP protein is not secreted, it is isolated from cell lysates. The 

20 selection of the appropriate growth conditions and recovery methods are within the skill of the art. 

The recombinantly made BMP is recovered from transformed cells in accordance with known proce- 
dures. Preferably, an expression vector will be used which provides for secretion of BMP from the 
transformed cells; thus the cells may be separated by centrifugation. The BMP typically is purified by 
general protein purification techniques, including, but not limited to, size exclusion, ion-exchange 

25 chromatography, HPLC, and the like. 

Once a coding sequence for BMP has been prepared or isolated, it can be cloned into any suitable 
vector and thereby maintained in a composition of celts which is substantially free of cells that do not 
contain a BMP coding sisquence (e.g., free of other library clones). Numerous cloning vectors are known 
to those of skill in the art. Example's oT recombinant DNA vectors for cloning and host cells which they can 

30 transform include the various bacteriophage lambda vectors ( E . coli ), pBR322 ( E . coli ), pACYC177 ( E . 
coli ), pKT230 (gram-negative bacteria), pGV1106 (gram-negative bacteria), pLAFRI (gram-negative bac- 
teria), pME290 (non-E . coli gram-negative bacteria), pHV14 ( E . coli and Bacillus subtilis). pBD9 (Bacillus), 
PIJ61 (Streptomyces), pDC6 (Streptomyces), actinophage, <*>C31 (Streptomyces), Ylp5 <Saccharomyces), 
YCp19 (Saccharomyces), and bovine papilloma virus (mammalian cells). See generally , DNA Cloning: Vols. 

35 I & II, supra ; T. Maniatis et al ., supra ; B. Perbal, supra . 

Alternatively the BMP may be made by conventional peptide synthesis, for instance, by using the 
principles of the Merrifield synthesis and using commercial automatic apparatus designed to employ the 
methods of the Merrifield synthesis. Peptides prepared using conventional peptide synthesis may be 
purified using conventional affinity chromatography, gel filtration and/or RP-HPLC. 

40 Figure 3 shows the nucleotide sequence of bovine BMP cDNA and the deduced amino acid sequence 
or the precursor polypeptide. The putative signal peptidase cleavage site is noted (i). The cDNA sequence 
was obtained from a 830 bp Bgl II insert of bovine BMP cDNA clone #1, which was isolated from a calf liver 
cDNA library, as described below. 

Figure 5 shows the nucleotide sequence of human BMP cDNA and the deduced amino acid sequence 

45 of the precursor polypeptide. The putative signal peptidase cleavage site is noted (I). The cDNA sequence 
was obtained from a 600bp BamHI/Hindlll insert of human BMP cDNA clone A6, which was isolated from a 
BMP/PCR human kidney cDNA library, as described below. 

It is further intended from the nucleotides sequences in Figures 3 and 5 that BMP analogs are within 
the scope of the present invention. Analogs, such as fragments, may be produced, for example, by pepsin 

so digestion of BMP. Other analogs, such as muteins, can be produced by standard site-directed mutagenesis 
of BMP coding sequences. Analogs exhibiting "BMP activity" may be identified by the in vivo and/or in vitro 
assays, preferably the cartilage inducing assay, Methods of Enzymology , 146 , pp 294-312. (1987). 

An example of a BMP analog are the yeast cleavage products produced in vivo from the full-length 
bovine or human expression product. The processing of the bovine expression product results in tvo 

55 roughly 16KD polypeptides, described in Example 9 below, and one or both of these analogs are referred to 
herein as the "16KD yeast cleavage analog." 

As mentioned above, a DNA sequence encoding BMP can be prepared synthetically rather than cloned. 
The DNA sequence can be designed with the appropriate codons for the BMP amino acid sequence. In 



7 



EP 0 409 472 A1 



general, one will select preferred codons for the intended host if the sequence will be used for expression. 

The complete sequence is assembled from overlapping oligonucleotides prepared by standard methods 

and assembled into a complete coding sequence. See .e.g., Edge (1981) Nature 292 :756; Nambair, et al 

. (1984) Science 223 :1299; Jay et al . (1984) J. Biol. Chem . 259 :6311. 
5 Synthetic DNA sequences allow convenient construction of genes which will express BMP analogs or 

"muteins". Alternatively, DNA encoding muteins can be made by site-directed mutagenesis of native BMP 

genes or cDNAs, and muteins can be made directly using conventional polypeptide synthesis. 

Site-directed mutagenesis is conducted using a primer synthetic oligonucleotide complementary to a 

single stranded phage DNA to be mutagenized except for limited mismatching, representing the desired 
io mutation. Briefly, the synthetic oligonucleotide is used as a primer to direct synthesis of a strand 

complementary to the phage, and the resulting double-stranded DNA is transformed into a phage- 

supporting host bacterium. Cultures of the transformed bacteria are plated in top agar, permitting plaque 

formation from single cells which harbor the phage. 

Theoretically, 50% of the new plaques will contain the phage having, as a single strand, the mutated 
75 form; 50% will have the original sequence. The resulting plaques are hybridized with kinased synthetic 

primer at a temperature which permits hybridization of an exact match, but at which the mismatches with 

the original strand are sufficient to prevent hybridization. Plaques which hybridize with the probe are then 

picked, cultured, and the DNA recovered. 

A general method for site-specific incorporation of unnatural amino acids into proteins is described in 
20 Christopher J. Noren, Spencer J. Anthony-Cahill, Michael C. Griffith, Peter C, Schultz, (April 1989), Science, 

Vol 244, pp 182-188. This method may be used to create analogs with unnatural amino acids. 

Preparations of BMP and its analogs may be assayed in vivo according to the method described by 

Urist, et a I., Methods in Enzymology (D. Barnes and D. A. Sirbaska, eds.), vol. 146, pp. 294-312, Academic 

Press,~N7Y. (1987), and in vitro by the method of Sato and Urist, Clin. Orthop ., 183:180-187 (1984) as 
25 modified by Kawamura and Urist, Dev. Biol ., 130:435-442 (1988), all of which are incorporated by reference 

herein. 

Substantially pure BMP, higher molecular glycosylated forms thereof, or active fragments thereof, or the 
nontoxic salts thereof, combined with a pharmaceutically acceptable carrier to form a pharmaceutical 
composition, may be administered to mammals, including humans, either intravenously, subcutaneously, 

30 percutaneously, intramuscularly or orally. 

Such proteins are often administered in the form of pharmaceutically acceptable nontoxic salts, such as 
acid addition salts or metal complexes, e.g., with zinc, iron or the like (which are considered as salts for 
purposes of this application). Illustrative of such acid addition salts are hydrochloride, hydrobromide, 
sulphate, phosphate, maleate, acetate, citrate, benzoate, succinate, malate, ascorbate, tartrate and the like. 

35 If the active ingredient is to be administered in tablet form, the tablet may contain a binder, such as 
tragacanth, corn starch or gelatin; a disintegrating agent, such as alginic acid; and a lubricant, such as 
magnesium stearate. If administration in liquid form is desired, sweetening and/or flavoring may be used, 
and intravenous administration in isotonic saline, phosphate buffer solutions or the like may be affected. 
Pharmaceutical compositions viii usually contain an effective amount of BMP in conjunction with a 

40 conventional, pharmaceutically acceptable carrier. The dosage will vary depending upon the specific 
purpose for which the protein is being administered, and dosage levels in the range of about 0.1 ug to 
about 100 milligrams per Kg. of body weight may be used. 

The present invention further contemplates the combination of BCF, particularly human or bovine, with 
BMP as a therapeutic composition for initiating bone formation both in vitro and in vivo. 

45 Implants of recombinant BMP, alone or when mixed with one or more osteoinductive associated factors 
may be used to initiate cartilage and bone growth. The implants can be time-release composition 
encapsulated, for instance, in liposomes or other time-release membranes, natural or synthetic, which are 
absorbable by the host subject. The BMP may be either human, bovine or any other mammalian form, or 
mixtures thereof. To initiate bone growth, may be mixed with any combination of one or more other 

so proteins, particularly, with one or more other proteins derived from bone. Such mixtures may initiate 
cartilage formation, followed by bone growth. Implants of may be used to induce cartilage and bone growth 
in the quadriceps compartment. 

The purification protocols, described in detail below, allow for the first time the purification of native 
BMP in sufficient quantity and at a high enough purity to permit accurate amino acid sequencing. The 

56 amino acid sequences derived from the purified BMP allow for the design of probes to aid in the isolation of 
native BMP nucleic acid sequence, or the design of synthetic nucleic acid sequences encoding the amino 
acid sequence of BMP, as well as allowing both diagnostic and therapeutic antibodies to BMP and its 
analogs to be produced for the first time. BMP DNA genes or fragments may also be utilized in a diagnostic 



8 



EP 0 409 472 A1 



test for identifying subjects having defective BMP-genes. 

Specific anti-sera or monoclonal antibodies (described below) can be made to a synthetic BMP peptide 
having the sequence or fragments of the sequence of amino acid residues, such as those shown in Figures 
3 or 5. Examples are the tryptic fragments shown in FiG. 1 f and antibodies thereto can be used to 

s immunoprecipitate any BMP present in a selected tissue, cell extract, or body fluid. Purified BMP from this 
source can then be sequenced and used as a basis for designing specific probes as described above. 
Antibodies to other regions that diverge from known BMP can also be used. Also useful as antigens are 
purified native or recombinant BMP. 

Native, recombinant or synthetic BMP peptides (full length or subunits) can be used to produce both 

70 polyclonal and monoclonal antibodies. If polyclonal antibodies are desired, purified BMP peptide is used to 
immunize a selected mammal (e.g., mouse, rabbit, goat, horse, etc.) and serum from the immunized 
animal later collected and treated according to known procedures. Compositions containing polyclonal 
antibodies to a variety of antigens in addition to BMP can be made substantially free of antibodies which 
are not anti-BMP by immunoaffinity chromatography. 

75 Monoclonal anti-BMP antibodies can also be readily produced by one skilled in the art from the 
disclosure herein. The general methodology for making monoclonal antibodies by hybridomas is well 
known. Immortal, antibody-producing cell lines can also be created by techniques other than fusion, such as 
direct transformation of B lymphocytes with oncogenic DNA, or transfection with Epstein-Barr virus. See, e . 
g ., M. Schreier et at .. "Hybridoma Techniques" (1980); Hammerling et al ., "Monoclonal Antibodies And T- 

20 cell Hybridomas" (1981); Kennett et al "Monoclonal Antibodies" (1980); see also U.S. Patent Nos. 
4,341,761; 4.399,121; 4,427,783; 4,444,887; 4,451,570; 4,466,917; 4.472.500; 4,491,632; 4,493,890. 

Panels of monoclonai antibodies produced against BMP peptides can be screened for various 
properties; i.e., isotype, epitope, affinity, etc. Of particular interest are monoclonal antibodies that 
neutralize the activity of BMP. Such monoclonals can be readily identified in BMP activity assays. High 

25 affinity antibodies are also useful in immunoaffinity purification of native or recombinant BMP. 

Antibodies to BMP (both polyclonal and monoclonal) forms described herein may be used to inhibit or . 
to reverse various clinical indications of bone disease such as osteoporosis, osteoarthritis, etc. One 
therapeutic approach would be to treat the patient with an effective dose of anti-BMP antibodies through a 
conventional intravenous route. BMP antagonists or agonists, such as BMP muteins, could also be used in 

30 place of antibodies. These anti-BMP compositions may also be useful in dectecting or inhibiting various 
forms of tumors, since some tumors are known to be induced by growth factors. 

The determination of the appropriate treatment regimen (i.e., dosage, frequency of administration, 
systemic vs. local, etc.) is within the skill of the art. For administration, the antibodies will be formulated in a 
unit dosage injectable form (solution, suspension, emulsion, etc.) in association with a pharmaceutical^ 

35 acceptable parenteral vehicle. Such vehicles are usually nontoxic and nontherapeutic. Examples of such 
vehicles are water, saline, Ringer's solution, dextrose solution, and Hank's solution. Nonaqueous vehicles 
such as fixed oils and ethyl oleate may also be used. A preferred vehicle is 5% (w/w) human albumin in 
saline. The vehicle may contain minor amounts of additives, such as substances that enhance isotonicity 
and chemical stability, e.g., buffers and preservatives. The antibody is typically formulated in such 

40 vehicles at concentrations of about 1 ng/ml to 1 0 mg/ml. 

Anti-BMP antibodies will also be useful in diagnostic applications. The present invention contemplates a 
method, particularly a diagnostic method, in which a sample from a human (or other mammal) is provided, 
and the amount of BMP is quantitatively measured in an assay. For example, employing anti-BMP 
antibodies in a quantitative immunoassay could be used to detect -genetic deficiency in BMP. Antibody 

45 specific for BMP could be formulated into any conventional immunoassay format; e . g ., homogeneous or 
heterogeneous, radioimmunoassay or ELISA. The various formats are well known to those skilled in the art. 
See, e.g., "Immunoassay" A Practical Guide" (D.W. Chan and M.T. Perlstein eds. 1987) the disclosure of 
whichls incorporated herein by reference. 

In general, production of recombinant BMP -can provide compositions of that polypeptide substantially 

so free of contaminating proteins. The ability to obtain high levels of purity is a result of recombinant 
expression systems which can produce BMP in substantial quantities vis-a-vis in vivo sources. Thus, by 
applying conventional techniques to recombinant cultures, BMP compositions can be produced that are 
substantially more pure than the compositions available from bone sources. 

Purified BMP will be particularly useful as a tool in the design and screening of cartilage or bone growth 

55 inhibitors. First, milligram amounts of the material are obtainable according to the present invention. 
Milligram amounts are capable of crystallization to permit three dimensional studies using X-ray diffraction 
and computer analysis. This may permit deduction concerning the shape of the molecule, thus defining 
proper shapes for substances usable as inhibitors of the activity normally exhibited by BMP. Generally, 



9 



EP 0 409 472 A1 



antagonists have been peptides whose interactions with an a polypeptide, the activity of which is inhibited, 
are stabilized by modification of the "residues" participating in the peptide bond so as to enhance the 
ability of the peptide to interact specifically with the enzyme, receptor, or co-factor, such as osteoinductive 
associated factors in the case of BMP. Thus the peptide bond joins specifically chosen carboxylic acids and 

s amines (not necessarily amino acids). These peptides are configured in a three dimensional array so as to 
complement the contours of the intended target. A similar lock and key spatial arrangement may result from 
molecules designed complementary to the surface contours of the BMP of the invention. It is understood 
that "surface" includes convolutions which may face inward, and specifically includes the active site. 
Furthermore, "complementary" is understood to mean that, in addition to spatial conformations which "fit", 

w interactions between the protein and the molecule which matches its surface contours are attractive and 
positive. These interactions may be hydrogen bonding, ionic or hydrophobic affinity. 

Accordingly, the invention contemplates peptide antagonists and agonists (2-15 amino acids) to BMP 
which are characterized by three dimensional contours complementary to the three dimensional contours on 
the surface of recombinant BMP. By peptide in this context is meant that the antagonist or agonist contains 

is carboxylic acid amide bonds. The carboxylic acid and amine participants need not be a-amino acids. 

Second, even without the assistance of a three dimensional structure determination, purified BMP of the 
invention is useful as a reagent in screening BMP inhibitors in vitro as an ad hoc approach to evaluation. 
Impure BMP preparations currently available yield confusing~data due to Impurities. For example, con- 
taminants which turn out to be themselves inhibitors, activators, or substrates for BMP may Interfere with 

20 the evaluation. Thus, a substantial improvement in current screening techniques for BMP agonists and 
antagonists would be effected by the availability of the purified BMP protein. 

It will be understood that this description and disclosure of the invention is intended to cover all 
changes and modifications of the invention which are within the spirit and scope of the invention. It is within 
the knowledge of the art to insert, delete or substitute amino acids within the amino acid sequence of a 

26 BMP without substantially affecting the calcification and bone growth inducing activity of the molecule. 
Thus, the invention includes such deletions, additions or substitutions. Furthermore, it is recognized that one 
skilled in the art' could recombinantly produce such modified proteins. 

The following examples are provided by way of illustration but are not intended to limit the invention in 
any way. 

30 

EXAMPLE 1 



35 

Purification of BMP From Bone 



The BMP proteins of interest, partially purified from human (17KD) and bovine (19KD) sources as 

40 described by Urist, et ai ., Proc. Nat. Acad. Sci. USA , 81 , 371-375 (1984), were further purified to 
homogeneity by prep¥ra¥ve gel electrophoresis "and electroelution (M.N. Hunkapiller, E. Lujan, F. Ostrander 
and LE. Hood, Methods in Enzymology , $H : 227-236 (1983)). This purification showed that the initial 
partially purified samples contained, in addition to the 19KD BMP, other mammalian proteins at 34KD, 
22KD, 14KD and 6KD. After precipitation with acetone (W. H. Konigsberg and L. Henderson, Methods in 

45 Enzymology , 91 : 254-259 (1983)) and quantitation by amino acid analysis 4B.A. Bidlingmeyer, S.A. Cohen 
and T.L. TarvihT Journal of Chromatography , 336 : 93-104 (1984)), the material was reduced under 
denaturing conditions with 2-mercaptoethanol ancTcysteine residues were derivatized with 4-vinyl-pyridine 
(M. Friedman, L.C. Kruli and J.F. Cavins, Journal of Biological Chemistry , 245 : 3868-3871 (1970)). After 
exhaustive dialysis to remove the denaturant, protein recovery was assessed~by a repetition of amino acid 

so analysis. The proteins were digested with TPCK-trypsin in the presence of 2M urea to generate unblocked 
peptide fragments suitable for sequence analysis (C. Allen, Sequencing of Proteins and Peptides , pages 
51-62 (1981), Elsevier/North Holland Publishing Company, Amsterdam, Holland). Products of the digestion 
were resolved by reverse-phase high performance liquid chromatography using gradients of acetonitrile or 
acetonitrile/isopropanol in aqueous trifluoroacetic acid (J.E. Shively, Methods of Protein Microcharac- 

55 terization , pages 41-87 (1986), Humana Press, Clifton, New Jersey). Peptide fractions were subjected to 
automated Edman degradation using an Applied Biosystems 470A protein sequencer (M.N. Hunkapiller, 
R.M. Hewick, NJ. Oreyer and LE. Hood, Methods in Enzymology , Bl_ : 399-413 (1983)). The phenyl- 
thiohydantoin amino acid derivatives were identified by chromatography~on an Applied Biosystems 120A 



10 



EP 0 409 472 A1 



PTH analyzer (M.W. Hunkapiller, Applied Biosystems , User Bulletin Number 14 (1985), Applied 
Biosystems, Foster City, California). 



EXAMPLE 2 



RNA Isolation and Probe Synthesis 

70 ' 



Cell culture. 

is 293, an embryonic human kidney cell line obtained from the American Type Culture Collection (ATCC 
No. CRL 1573) was cultured in Dulbecco's modified Eagle's medium containing 10% fetal calf serum, 100 
U/ml penicillin and 100 ug/ml streptomycin at 37* C in 5% C0 2 . 



20 RNA isolation. 

RNA was isolated from calf liver (obtained from JR Scientific, Woodland, CA) by the guanidinium 
thiocyanate/CsCi method (Maniatis, T. Fritsch, E.F. and Sambrook, J. (1982) Molecular Cloning: A Labora- 
tory Manual (Cold Spring Harbor Lab., Cold. Spring Harbor. NY) and Freeman, G.J., Ciayberger, C ; , 
25 DeKruyff, R. t Rosenblum, D.S. and Cantor, H. (1983) Proc. NatL Acad. ScL: USA 80 : 4094-4098). Poly(A)* 
RNA was purified by a single fractionation over oligo(dT)-cellulose (Maniatis, T. Fritsch, E.F. and Sambrook, 
J. (1982) Molecular Cloning: a Laboratory Manual (Cold Spring Harbor Lab., Cold Spring Harbor, NY)). 



30 Oligonucleotide synthesis. 

Oligonucleotide adapters, primers and probes were synthesized by the phosphoramidite method with an 
Applied Biosystems (Foster City, CA) model 380A synthesizer, purified by polyacrylamide gel elec- 
trophoresis and desalted on a Waters SEP-PAK (Cib) cartridge. 

35 

(a) Adapters. 

A 14-mer oligonucleotide (5' CCTGTAGATCTCCG 3') and a 18-mer oligonucleotide (5' AATTCG- 
40 GAGATCTACAGG 3') were synthesized and used as the EcoRI adapters for the cDNA library constructed 
in lambda ZAP!!. The 14-mer was phosphorylated (Maniatis, T. Fritsch, E.F. and Sambrook, J. (1982) 
Molecular Cloning: a Laboratory Manual (Cold Spring Harbor Lab., Cold Spring Harbor, NY)) and subse- 
quently heated to 95 *C for 15 min. to inactivate polynucleotide kinase, prior to annealing with the 18-mer. 
These asymmetrically phosphorylated adapters also -contain an interna! Bglll restriction enzyme site. 

45 

(b) PCR primers. 

Two 47-mer oligonucleotides were synthesized for PCR amplification of the complete coding region of 
so human BMP cDNA from kidney cell line 293 mRNA and subsequent cloning into lambda 2APII. The 5 
sense primer (5' TCCGGACTCGAGGAATTC AAACAATCATGATTTCCAGAATGGAGAAG 3) and 3' an- 
tisense primer (5' GACTCGAGGAATTCGTCGACACCTCAAGGCCGTTACTCAAA GTCAGT 3 ) are based on 
the sequence of the human gene exons 1 and 7, respectively. Both primers have 5 extensions (adapters) 
that contain several restriction enzyme sites. 
55 Two additional sets of PCR primers/adapters were synthesized for amplifying bovine and human BMP 
cDNA clones (encoding only the mature protein) and subsequent cloning into pAB125, a plasmkJ containing 
the yeast a-factor leader sequence. The 5' sense primer (42-mer) for the human BMP cONA (5 
ACTACTGGT CTAGATAAAAGATTCCCAGTGTACGACTACGAT 3') and the 5' sense primer (41-mer) for 



11 



EP 0 409 472 A1 



the bovine BMP cDNA (5 GGAACCCTCTCTAGATAAAAGATTCCCGGTGTATGACTATG 3) contain an Xbal 
site to facilitate ligation of the PCR amplified cDNA to the a-factor leader sequence. The 3' antisense primer 
(37-mer) for the human BMP cDNA (5 TCTTACCTGTCGACTATTACTCAAAGTCAGTATTTAT 3') and the 
3' antisense primer (41-mer) for the bovine BMP cDNA (5 AATGGCCGTCGACTATCACTCAAAGCCAGGG- 
5 TTTACTCTTG 2) contain a Sail site directly after the stop codon. 



(c) Probes. 

10 Oligonucleotide probes, based on the tryptic peptide sequences of bovine BMP, were synthesized for 
screening the bovine genomic library (Probes A-D) and are shown in Figure 1. The actual probes are 
complementary to the sequences shown. The sequences of four additional BMP tryptic peptides were 
determined (E-H) and are also shown in Fig. 1. With some codons, two nucleotides were included at 
degenerate positions to increase the probability of a correct guess. At serine residues, two separate 

75 oligonucleotides for each probe (differing only at the serine codon) had to be synthesized due to the 
sunique nature of the serine codon degeneracy. 

Two partially overlapping 50-mer oligonucleotides, based on the bovine BMP exon 3 sequence, were 
synthesized for screening the calf liver cDNA library (Probe I) and are shown in Fig. 2a (underlined). Four 
oligonucleotide probes were synthesized to identify exons 1, 5, 6, and 7 of the human BMP gene (see 

20 Table 1). Probe BMP103 (5 CCAGTGGTTCATTCCAAGGA CAAATATCACCAAC ATCTTCATCG CCATCT- 
TCTCCAT 3') is a 57-mer complementary to bovine BMP exon 1 coding sequences. Probe BMP104 (5 
TCACTCAAAGCCAGGGTTTACTCTTGCTCTGGGCC ACGGGTTCGAGTACCTTCTATT 3) is also a 57-mer 
complementary to bovine BMP exon^ 7 coding sequences. BMP 116 {5 GAGACCAAATA- 
GATAATTGTTTCTCCATTTATGAGATCC 3) is a 39-mer complementary to human BMP exon 5 coding 

25 sequences. BMP 117 (5 CAAGTGACCGATCATAAAA TTGTTCACTTATGGACTCGTCTGAAATGAGA 3') is 
a 51-mer complementary to human BMP exon 6 coding sequences. A 26-mer oligonucleotide (b TACTCC- 
CTCTGGAAGGCACATGTAGC 3') complementary to human BMP exon 3 coding sequences (Probe J) was 
synthesized for screening the human BMP/PCR cDNA library. 

30 

EXAMPLE 3 



35 Construction and Screening of cDNA Libraries. 



Construction of the cDNA libraries. 

40 (a) Calf liver cDNA library. First strand cDNA was synthesized from calf liver poly(A)* RNA using 
conditions similar to Okayama and Berg [Okayama, H. and Berg, P. Molec. and Cell Biol . 3 :4094-4098 
(1983)]. About 5 ug of poly(A)* RNA in 20 ill 5 mM Tris-hydrochloride (pH 7.5Twasheited to 65* C for 3 
min., then quick cooled on wet ice and immediately adjusted (at room temperature) to contain 50 mM Tris- 
hydrochloride (pH 8.3 at 42" C), 8 mM MgCI 2 30 mM KCI, 10 mM dithiothreitol, 2 mM each of dATP, dGTP. 

45 dTTP and [a- 32 P]dCTP(~300cpm/pmol), 60 U RNasin, and 2.5 ug of oligo (dT) 12 -i8 (total volume 40 ml). 
The reaction was initiated by the addition of 50-60 U of cloned moloney murine leukemia virus reverse 
transcriptase and continued for 60 min. at 42* C. The second cDNA strand was synthesized by the method 
of Gubler and Hoffman [Gubler, U. and Hoffman, B.J. Gene 25 :263-269 (1983)] as modified by Aruffo and 
Seed [Aruffo, A. and Seed, B. Proc. Natl. Acad. Sci.: USA 74 :8573-8577 (1987)]. The ds cDNA was then 

50 ligated to asymmetrically (hemi) phosphorylated EcoRI adapters (see oligonucleotide synthesis) as de- 
scribed by Aruffo and Seed, supra t phosphorylated with T* polynucleotide kinase (Maniatis, et al supra )» 
adjusted to 0.5 M NaCI, 25 mM EDTA and heated at 75 *C for 15 min. to inactivate the polynucleotide 
kinase. The ds cDNA was separated from unligated adapters by chromatography on Biogel A-15 m and 
recovered by ethanol precipitation. eDNA was ligated to EcoRI-cut lambda ZAPII (Stratagene) with T«. DNA 

55 ligase (New England Biolabs) as described by supplier, but included 15% polyethylene glycol (PEG) 8000 
(Sigma), a modification described by Pheiffer and Zimmerman {Pheiffer, B.H. and Zimmerman, S.B. Nucl. 
Acids. Res. V[ :7853-7871 (1983)]. The ligated DNA was recovered by centrifugation (12,000 xg), washed 
with chloroform, dried, resuspended in 4 ul water and incubated with an in vitro packaging extract 



12 



EP 0 409 472 A1 



(Stratagene) according to supplier. Recombinant phage was propagated in E . coli XLI-Blue (Stratagene). 

(b) BMP primed-PCR amplified (BMP/PCR) human kidney cDNA library. The PCR reactions were 
performed as described by the suppliers of the PCR kit (Perkin/Elmer/Cetus). Two synthetic 47-mer 
oligonucleotide primers whose sequences were derived from exon 1 (sense primer) and 7 (antisense 
primer) of the human BMP gene and contained restriction site adapters suitable for cloning were used at a 
final concentration of 1 uM each. The PCR primers flank the complete coding region of hBMP mRNA. The 
template cDNA was synthesized from 2.5 ug of embryonic human kidney cell line 293 poly(A)* RNA. The 
conditions of cDNA synthesis were identical to the above (Part A) except that the reaction volume was 20 
Ul. The cDNA was fractionated on Biogel A-15m t also as above, recovered by ethanol precipitation and 
resuspended in 100 ul of sterile water. 1-10 ul of cDNA template were used for each PCR reaction. 40 
cycles of PCR were performed in a Perkin/Elmer/Cetus DNA thermal cycler. Each cycle consisted of a 
94° C, 1 min. denaturation step, a 55 "C, 2 min. annealing step and a 72 *C, 3 min. extension step. The 
extension step in cycle 40 was 15 min. instead of 3 min. Samples were extracted once with phenol/ 
chloroform/IAA (1:1:0.04) once with chloroform/IAA (24:1), recovered by ethanol precipitation, digested with 
EcoRI and fractionated by electrophoresis on a 7% acrylamide, 1x TBE gel. DNA migrating between 400- 
800 b.p. was excised from the gel, purified by passage over an Elutip-d column, ligated to Eco-RI cut 
lambda ZAPII, packaged and propagated as above (Part A). 



20 Screening of the libraries. 

(a) Bovine genomic library. Approximately 10 6 recombinant phage from a bovine genomic library 
(Clontech) were plated (20,000 phage/137 mm dia plate) in E . coli LE392. and grown for 5-6 hours at 
37" C. The phage were transferred onto nitorcellulose filters (Millipore, HATF1 37) processed according to 

25 Benton and Davis (8) and screened with probe A (Fig. 1). The probes were end-labeled with T 4 
polynucleotide kinase and ( fi32 -P) ATP (1) to a specific activity of 1-2 x 10 8 cmp/ug. The filters were 
prehybridized for 1-2 h at 37 # C in 5x SSC (1x SSC = 0.15 M sodium chloride/0. 015 M sodium citrate, pH 
7), 5x Denhardt's solution <1x Denhardt's solution = 0.02% polyvinylpyrrolidone/0.02% Ficoll/0.02% bovine 
serum albumin), 10% dextran sulfate. 50 mM sodium phosphate pH 6.8, 1 mM sodium pyrophosphate, 

30 0.1% NaDodSO* and 50 ug/ml denatured salmon sperm DNA. Labeled probe was added to a concentration 
of 10 B cpm/ml and hybridization was continued overnight at 37 - C with gentle shaking. The filters were 
washed in 2xSSC. 0.1% NaDodSO* at 55 # C, and exposed to Kodak XAR-2 film with a DuPont Lightning 
Plus intensifying screen overnight at -80 *C. After development, the probe was removed from the filters by 
washing in O.lxSSC, 0.1% NaDodSO* at 65* C. One set of filters was then hybridized with probe B (Fig. 1) 

35 and washed and exposed as above. Areas of plaques giving signals with probes A and B were picked, 
replated, transferred onto nitrocellulose in quadruplicate, amplified according to Woo (21) and screened with 
probes A-D (Fig. 1) (one probe per filter). Filters were washed and exposed to film as above. A plaque 
giving signals with three (A-C) of the four probes was purified by an additional round of plating and 
screening. 

40 (b) Calf liver cDNA library. Approximately 192,000 recombinant phage were plated (16,000 phage/137 
mm dia plate) in E . coli XLI-Blue, processed as above and screened with E . coli probe i (Fig. 2a). The 
probe was labeled~with~DNA polymerase I (Klenow fragment) and (a 32 -P)-d CTP (9) to a specific activity of 
2 x 10 s cpm/ug. The filters were screened as above (a) but with the following changes. (1) The 
hybridization solution contained 40% formamide and (2) the filters were washed in 2xSSC, 0.1% NaDodSCU 

45 at65*C. 

(c) Human genomic library. Approximately 10* recombinant phage from a human genomic library 
(Stratagene) were plated (50,000 phage/plate) in E . coli LE392, processed and screened with the 780 bp 
Bglll insert of bBMP cDNA#1 (Fig. 3). The probe was labeled (9) and the filters were hybridized as above 
(see calf liver cDNA library). The filters were washed in 2xSSC, 0.1% NabodSO* at 60 "C. Positive plaques 

so were purified by replating and rescreening. 

(d) (BMP/PCR) human kidney cDNA library. Approximately 1000 recombinant phage were plated (500 
mm dia plate) in E . coli XL1 Blue, processed, hybridized with probe J (Fig. 4b, underlined) and washed as 
in (a). Positive plaqueTwere purified by replating and rescreening. 

55 

EXAMPLE 4 



13 



EP 0 409 472 A1 

Plasmid and Phage DNA Isolation, Subcloning, Sequencing and Analysis 



Plasmid DNA was isolated by the alkaline lysis method (Maniatis, et al ., supra ) and lambda DNA was 
5 isolated by a phage miniprep procedure described by Jones and Rawls. [Jones, K.W. and Rawls. J.M 
Genetics 120 :733-742 (1 988)]. 

Bluescript SK(-) plasmids containing BMP cDNA were released from lambda ZAP by the M13 
rescue/excision protocol described by the supplier (Stratagene). BMP gene fragments were released from 
the EMBL3 lambda vector by sail or other appropriate restriction enzyme digestions (see Fig. 2 and Table 
w 1). BMP cDNA inserts were excised from the Bluescript SK(-) vector by a Bglll (bBMP cDNA) or a 
BamHl/Hindlll (hBMP cDNA) digestion. The DNA fragments were purified by polyacryiamide or agarose gel 
electrophoresis (Maniatis, et al ., supra ) and passage over an Elutip-d column (Schleicher and Schuell) and 
were then subcloned into pUC 19 or M13 sequencing vectors [Yamisch-Perron, C. Vieira, J. and Messing, 
J., Gene 33 :103-119 (1985)]. DNA sequencing was performed by the dideoxy chain termination method 
76 (Sanger, Nicklen, S. and Coulson, A.R., Proc. Natl. Acad. Sci. USA 74 :5463-67 (1977)] using M13 
primers as well as specific internal primers. Ambiguous regions were resolved using 7-deaza-2- 
deoxyguanidine-triphosphate [Barr, P.J., Thayer, R.M., Laybourn, P., Najarian, R.C., Seeia, F., and Tolan, D., 
Biotechniques 4 :428-32 (1986)] and sequenase (U.S. Biochemicals). 

20 

Northern blot analysis. 

Poly(A)* RNA was fractionated on a 1.4% agarose gel in the presence of formaldehyde (Lehrach, H., 
Diamond, D., Wozney, J.M. and Boedtker, H„ Biochemistry 16 :4743-51 (1977)] and directly transferred to 
26 nitrocellulose according to Thomas (Thomas, P., Proc. Natl. Acad. Sci. USA 7 7:5201-5 (1980)]. 

Filters were hybridized with probe I or bBMP cDNA #1 and washed as" previously described above in 
screening of the libraries, section B. 



30 Southern blot analysis. 

Genomic blots: 10 ug of human, bovine and mouse genomic DNA (Clontech) was digested with EcoRI, 
fractionated on a 0.7% agarose gel and transferred to nitrocellulose (Maniatis, et al ., supra ). Hybridization 
and washing were identical to those described under "Northern blot analysis. M ~Cione and PGR blots: DNA 
35 from genomic clones, cDNA clones or PCR reactions were digested with various restriction enzymes, 
fractionated on 1% agarose gels and transferred to nitrocellulose (Maniatis, et al ., supra ). 



EXAMPLE 5 

40 



Expression of Bovine and Human BMPs in Yeast 

46 

The PCR primers described in detail above were used to generate DNA sequences with Xba-1 and Sal- 
1 restriction sites for direct in-frame cloning into pAB125, a vector containing the a-factor leader (described 
in EPO Pub. No. 0 116 201, published 22 August 1984) sequence fused to the ADH2/GAPDH promoter 
(described in a copending U.S. Patent Application Ser. No. 760,197, filed 29 July 1985). The resulting 

50 promoter/leader/gene cassettes were excised with BamH1 and Sal-1 and cloned into the yeast expression 
vector PBS24.1 . The plasmid PBS24.1 is a derivative a pBS24 which is described in copending U.S. Patent 
Application Ser. No. 138,894, filed 24 December 1987. The BamHI-Sall vector fragment of pBS24 was 
ligated to a 65 base pair human basic FGF BamHI-Sall fragment to create pBS24.1 . This 65 base pair 
fragment will be replaced by the BamHI-Sall promoter/leader/BMP cassettes which are ligated into pBS24.1 

55 The resulting plasmids pBS24bBMP and pBS24hBMP were used to transform yeast strain AB110 with 
genotype Mata, ura3-52, leu2-04 or both leu2-3 and Ieu2-112, pep4-3, his4-580, cir', under leucine 
selection media, such as the synthetic complete media without leucine in Methods in Yeast Genetics f Cold 
Spring Harbor Laboratories, 1986, F. Sherman, G.R. Fink and J.B. Hicks. For induction of expression, cells 



14 



EP 0 409 472 A1 



were grown for 48h the uracil deficient media below: 20 g Casamino Acids 

5 g Ammonium Sulfate 

1 g Potassium Phosphate 

0.5g Magnesium Sulfate 
5 0.1 g Sodium Chloride 

0.1 g Calcium Chloride 

0.04ml Trace Elements Mixture 

41 1 2% Sodium Molybdate 

0.01 5g Vitamin Mix 
to 0.03 g Pantothenate 

0.03 g inositol 

70 ml 50% Glucose 

q.s. to a 900ml and pH to 6.0 

q.s to 1000 ml 



Trace Elements Mixture 

5 g Boric Acid 
20 0.4g Cupric Sulfate 

1 g Potassium Iodide 

2 g Ferric-Chloride 

4 g Manganese Sulfate 

2 g Sodium Molybdate 
25 4 g Zinc Sulfate 

q.s. to 1000ml and sterilize by filtration. 

Vitamin Mix 

30 3 g Myo-lnositol 

3 g Thiamine 
3 g Pyridoxine 

3 g Calcium Pantothenate 
0.2g Biotin 
as 2 g p-Aminobenzoic Acid 

2 g Riboflavin 
0.2g Folic acid 

3 g Niacin 

Yeast cells were removed from the culture media by centrifugation and the proteins in the supernatants 
40 analyzed after precipitation with 10% trichloroacetic acid/deoxycholate (0.4 mg/ml). The pel lets were 
washed with acetone and loaded onto 15% SDS-polyacrylamide gels together with appropriate controls. 
Proteins were visualized by Coomassie blue staining. A samples of S. cerevisiae strain AB110 containing 
pBS24.lbBMP or pBS24.1hBMP were deposited with the ATCC on 1 June 1989 under Accession Nos. 
20949 and 20950. 



EXAMPLE 6 



50 

Recombinant Bovine BMP Purification 



Medium was removed from yeast cells by centrifugation, and concentrated approximately ten fold. The 
55 pH was adjusted to 4.5 and the concentrate diluted to a conductivity below 5 mS/cm. This was applied to 
Fast Flow S ion-exchange resin (Pharmacia) pre-equilibrated with 50 mM sodium acetate, 1 mM EDTA, 1 
rnM PMSF (pH 4.5). The column was washed with one volume of the above buffer and eluted using a 0-1 M 
sodium chloride gradient in the above buffer. The 19KD and 16KD proteins eluted at a conductivity of 5^25 



15 



EP 0 409 472 A1 



mS/cm t as confirmed by SDS-PACE. The fractions containing predominantly the 19KD protein were pooled, 
adjusted to pH 7.5 and 4.5 M with respect to urea, concentrated, and applied to an S-100 sizing column in 
4M urea, 100 mM Tris/HCI, 1 mM EDTA, 1 mM PMSF (pH 7.5). Fractions containing 19KD and 16KD 
proteins were identified by SDS-PACE, pooled separately, concentrated and dialyzed against water, prior to 
5 lyophtlization. 



EXAMPLE 7 

10 

ASSAY FOR BMP ACTIVITY 



75 Samples of purified recombinant BMP were added to CMRL-1066 (GIBCO) culture medium containing 
fetal rat midbelly triceps brachii muscle fragments. Connective tissue outgrowths were cultured on a 
substratum of BMP-free matrix from the diaphyses of long bones of adult male Sprague-Dawley rats. This 
assay is detailed more fully by Kawamura and Urist, Developmental Biology, 130 , 435-442 (1982). The 
inductive activity is measured by [ 3 H]thymidine incorporation into DNA, [ 35 S]suifate incorporation into 

20 glycosaminoglycans and confirmation of chondrogenesis (cartilage formation) by histology. Recombinant 
BMP was tested at concentrations of 200 ng/ml to. 5 g/mi in the 2 ml culture system. The same level of 
positive results was observed with recombinant BMP as was previously noted with native BMP at equivalent 
concentrations. Higher pH]thymidine and p 5 S]sulfate incorporation and new cartilage and chondrocytes 
were observed in the recombinant BMP induced cultures. No cartilage or chondrocytes were seen in control 

25 cultures without recombinant BMP. 



EXAMPLE 8 

30 

Isolation and Analysis of the BMP gene and cDNA 



35 

I. The Bovine BMP gene. 

Probes A and B (Fig. 1) were used to isolate 1 strongly and 7 weakly hybridizing clones from 10 6 
recombinants of a bovine genomic library. The one strongly hybridizing clone (29-bg-3) was subjected to a 

40 second round of screening with probes A-D (Fig. 1). Three of the probes (A-C) hybridized to 29-bg-3. 
Southern blot analysis of purified 29-bg-3 DNA localized probes A and B to a 1.9kb EcoRI fragment and 
probe C to a 1.2kb EcoRI-Sall fragment. Both fragments were sequenced and shown to contain regions, in 
the top reading frame, encoding their respective tryptic peptides. (Fig. 2; boxed amino acids). Interestingly, 
tryptic peptide D was also present but was split between two exons, thus explaining the lack of hybridization 

45 with probe D. Intron-Exon boundaries conform to the GT-AG rule and are denoted by vertical lines. 
Additional bovine BMP exons were not isolated. Attempts were directed at isolating a bovine BMP cDNA 
clone using as a probe exon sequences derived from the bovine BMP gene. 



so II. The Bovine BMP cDNA 

Northern blot analysis of poly(A) + RNA from several bovine tissues using probe I revealed calf liver as a 
good source of bovine BMP mRNA (data not shown). Probe I was then used to isolate putative bovine BMP 
cDNA clones from a calf liver cDNA library. Two clones (#1 and #7) were sequenced, and shown to contain 
55 identical overlapping sequences as well as the expected encoded tryptic peptides (A-D) <Fig. 3). The 
additional BMP tryptic peptides (E-H, Fig. 1) were also found encoded in the bovine BMP cDNA. 



16 



EP 0 409 472 A1 



III. The Human BMP gene 

Northern blot analysis of poly(A)* RNA from several human tissues and cell lines, including liver, kidney 
and osteosarcoma, (using bovine BMP cDNA #1 as a probe) failed to detect human BMP. However, a 

5 Southern blot, performed under identical hybridization and wash conditions detected human BMP gene 
fragments (data not shown). 

Based on the Northern and Southern results, the following strategy was adopted to (1) clone and 
sequence the human BMP gene, then (2) identify a tissue source of human BMP mRNA by PCR 
amplification (using human BMP based primers: BMP/PCR cDNA) and Southern blot analysis of the 

70 products 3) clone and isolate the PCR generated human BMP cDNA. 

Bovine BMP cDNA #1 was used as a probe to isolate 7 strongly and 5 weakly hybridizing clones from 
10 6 recombinants of a human genomic library. Southern blot analysis of purified DNA from 11 of the 12 
clones identified two hybridizing Hindlll fragments (1.7 kb and 2.0 kb) common to bee clones HC4, 5 and 9. 
The 1.7 kb and 2.0 kb Hindlll fragments from HG9 were sequenced and shown to have a 63.4% and 62.2% 

75 amino acid homology to the bovine BMP exons shown on Figure 2A and 2B respectively. Table 1 
summarizes these results as well as the Southern blot results for the remaining human BMP exons. The 
sequence of the exon-containing region of each subclone is shown in Figure 4a-c. The 5 end of exon 1 
(Cap site) and the Z end of exon 7 (poly(A)* addition site) are unknown. The intron/exon boundaries follow 
the GT-AG rule and are denoted by vertical lines. The DNA was translated in all three reading frames. The 

20 middle and top frames contain the correct amino acids for exons 1-6 and exon 7, respectively (boxed). 



IV. The Human BMP cDNA 

25 Kidney (cell line, 293) was identified as a source of hBMP mRNA by PCR amplification and Southern 
blot analysis. 10 3 recombinants of a cDNA library made from the hBMP/PCR cDNA, were screened with 
probe J (human exon 3 probe) and 12 putative hBMP cDNA clones were isolated. Agarose gel elec- 
trophoresis following a BamHl/Hindlll digestion of the clones showed that each clone contained either a 
700bp or a 600bp cDNA insert. DNA sequencing revealed that the 700bp species was te expected full 

30 length human BMP cDNA (Fig. 5) while the 600bp species was a truncated human BMP cDNA, missing 
exon 2 (not shown). This shorter cDNA species most likely represents an aberrantly spliced, non-functional 
mRNA since a translational frameshift occurs at the newly formed exon 1/exon 3 junction resulting in a 
premature termination codon. 

35 

EXAMPLE 9 



40 Analysis of Human and Bovine BMPs Expressed in Yeast 



hBMP is expressed in yeast as a mixture of three approximately 17KD proteins, whereas bBMP is 
expressed as a mixture of 3 species with molecular weights of 19KD and a 16KD doublet. The size 

45 heterogeneity is most probably a result of processing of each BMP by yeast encoded enzyme(s) during 
secretion. Amino-terminal amino acid sequencing of the bBMP mixture gave a single amino terminus (Phe), 
indicating that the processing occurs in the carboxyl region of the protein, yielding the 16KD yeast cleavage 
analogs. Several paired basic amino acid residues in this region are likely candidates as proteolysis sites 
during secretion. This observation, together with the fact that each BMP cDNA encodes a putative protein 

so product of molecular weight greater than 20kD, also underscores the possibility that BMP, in vivo , is the 
product of proteolytic processing from a larger precursor. 



55 



17 



EP 0 409 472 A1 



TABLE 1 



5 


A Summary of the Southern Blot Results Identifying 
Human BMP Exon-Containing DNA from Genomic 
Clones. 




Exon 


Restriction 


Genomic 


Probe 4 






Fragment 1 


Clone 2 




IV 




Size 


Enzyme 








<kb) 










1 


0.6 


Pstl 


Hg43 


BMP 103 




2 


0.6 


Pstl 


Hg43 


hBMP cDNA 




3 


1.7 


Hind ill 


HG9 


bBMP cDNA 


15 


4 


2.0 


Hind ill 


HG9 


bBMP cDNA 




5 


0.4 


Bgl II 


HG5 


BMP 116 




6 


3.0 


Bgl II 


HG5 3 


BMP 117 




7 


1.1 


Bgl II 


HG5 


BMP 104 



1 Exon-containing DNA restriction fragment. 

2 Genomic clone from which restriction fragment was derived. 

3 Exon 1 and 2 DNA's were obtained from a 7 kb Sal I fragment of HG 4 
subcloned into pUC 1 9. Both exons were found on the same Pst I fragment, 
but identified with different probes. Exon 6 was obtained from a 1 5kb Sal I 
insert of H 5 subcloned into pUC19. 

* Probe used to identify exon-containing DNA restriction fragment. Probes 
are described in "Oligonucleotide Synthesis" section of Materials and 
Methods. Hybridization and washing conditions are described under 
Example 3 in the "Screening of the libraries (c) human genomic library" 
section of the examples. 



35 Claims 

1 . A composition comprising mammalian bone morphogenetic protein (BMP) and analogs thereof substan- 
tially free of other osteoinductive associated factors. 

2. A composition according to claim 1, wherein said mammalian bone morphogenetic protein is human 
40 BMP. 

3. A composition according to claim 1, wherein said mammalian bone morphogenetic protein is bovine 
BMP. 

4. A composition according to claim 1 or 2, wherein the polypeptide comprises an amino acid sequence 
aai-aai82 as shown in Fig. 5 or a fragment thereof. 

45 5. A composition according to claim 1 or 3, wherein the polypeptide comprises an amino acid sequence 
aai-aaiso as shown in Fig. 3 or a fragment thereof. 

6. A composition according to claim 5, wherein said polypeptide comprises of a 16KD yeast cleavage 
analog. 

7. An intron-free DNA sequence or its complement encoding a polypeptide comprising an amino acid 
so sequence of mammalian BMP and analogs thereof. 

.8. An DNA sequence according to claim 7, wherein said DNA encodes human BMP. 

9. A DNA sequence according to claim 7, wherein said DNA encodes bovine BMP. 

10. A DNA sequence according to claim 7, wherein said polypeptide comprises the mammalian BMP signal 
sequence. 

55 11. A DNA sequence according to claim 7, wherein said polypeptide does not comprise the mammalian 
BMP signal sequence. 

12. A DNA sequence according to claim 7, wherein said polypeptide further comprises an N-terminal yeast 
alpha-factor signal sequence that provides for secretion in a yeast host. 



18 



EP 0 409 472 A1 



13. A replicon comprising a DNA sequence according to claim 8. 

14. A vector comprising a DNA sequence according to claim 8. 

15. A cell comprising a replicon according to claim 13. 

16. A cell comprising a vector according to claim 14. 

5 17. A method of producing recombinant mammalian BMP or an analog thereof comprising: 

(a) providing a population of cells comprising a heterologous DNA sequence, wherein said DNA 
sequence comprises (i) transcriptional and translational control sequences functional in said cells, and (ii) 
a coding sequence under the control of said transcriptional and translational sequences that encodes a 
polypeptide comprises mammalian BMP and analogs thereof; and 

70 (b) growing said population of cells under conditions whereby said polypeptide is expressed. 

18. The method of claim 17, wherein said polypeptide is human BMP. 

19. The method of claim 17, wherein said polypeptide is bovine BMP. 

20. The method claim 17, wherein said population of cells are microorganisms. 

21. The method of claim 17, wherein said population of cells are yeast. 
75 22. The method of claim 17, wherein said population of cells are E. coli . 

23. The method of claim 18, wherein said polypeptide comprises a signal sequence at the N-terminus of 
said polypeptide, and said polypeptide is secreted from the said cells. 

24. The method of claim 23, wherein said cells are yeast cell and said signal sequence is a yeast alpha- 
factor signal sequence. 

20 25. A method for inducing bone growth comprising the step of contacting bone tissue with an effective 
amount of a composition of mammalian BMP or an active analog thereof. 
26. A monoclonal antibody to a mammalian bone morphogenetic protein or analog thereof. 



19 



EP 0 409 472 A1 



PEPTIDE A 

VAL ASN ALA LEU ASP CLU ASP SER LEU THR MET ASP LEU CLU PHE ARC 
PROBE A 

3' CTC AAT CCC CTC CAT CAC CAC TCC CTC ACC ATC CAC CTC CAC TTC CC 3 
f T T T 

5' CTC AAT CCC CTC CAT CAC CAC ACC CTC ACC ATC CAC CTC CAC TTC CC 3' 
f T T T 

PEPTIDE B 

CLU SER CLU ALA ASP PRO ALA THR CYS ASP PHE CLN ARC 

PROBE B 

5' CAC TCC CAC CCT CAC CCT CCC ACC TCC CAC TTC CAA CC 3' 

T T T C 

5' CAC ACC CAC CCT CAC CCT CCC ACC TCC CAC TTC CAA CC 3' 

T T f C 

PEPTIDE C 

MET SER ALA CLU CLN VAL CLN ASN VAL TRP VAL ARC 
PROBE C 

5* ATC TCT CCT CAA CAA CTC CAA AAC CTC TCC CTC CC 
G G C T 



5' ATC ACT CCT CAA CAA CTC CAA AAC CTC TCC CTC CC 
C C C T 

PEPTIDE D 

GLY TYR HIS VAL PRO VAL ALA VAL CYS ARC 
PROBE D 

5' CCC TAC CAC CTC CCT CTC CCT CTC TCC AC 3' 
f f T C 

ADDITIONAL TRYPTIC PEPTIDES 

PEPTIDE E 

CLY CLU PRO LEU TYR CLU PRO SER AGR 
PEPTIDE F 

CLU ALA LEU SER ALA SER VAL ALA LYS 
PEPTIDE G 

VAL ASN SER CLU SER LEU SER PRO TY1 
PEPTIDE H 

ASN SER TYR LEU LEU CLY LEU THR PRO ASP ARC 



3' 
3' 



20 



EP 0 409 472 A1 



Two Bovnw. &M ? e*ot\% 



ArgProI^uProI^uValPhel^uLy ffialAsnMaLeuAs^ 
ThrProLeuAlaProCysPheSerGluG lyGlaAxgProGlyArgGlyGlnLeuAspHis 
AsnAlaProCysProLeuPhePheOP Ai jSerThrProTrpThrArgThrAlaOP Pro 

• AACGCCCCTTGCCCCTTGTTTTTCTGAAG ZTC^CGnrcTtt*rn\nzzriGCT&ACC\ 

• TTGCGGGG AACGGGGAACAAAAAGACTTC EAGTTGCGGGACCTGCTCCTGTCGAACTCGT 

. I - T^tde p 

A.^pT^ufil uPheArcrft J eGlnGluThrThrCysArgArg GluSerGluAlaAspProAla 
GlyLeuArgValGlnAspSerArgAspAspValGlnGluGlylleOP GlyArgPrcArg 
TrpThrAM SerSerClyPheLysArgArgArgAlaGlyGlyAsnLeuArgGlDThrPro 

ACCTGAArcTCAAfiTCCTAAGTTCTCTGCTC^ 

ThrCvsAspPheGlnArafelyTvrHisVa^ 
HisLeuOP l^uPrcsGluGlyLeuProArgdiyGluCysGlyAlaLysAlaThrSerLeu 
ProProValThrScrArgGlyAlaThrThrTripOP ValTrpGlyLysGlyHisGlnPro 
CCACC7GTGACTTCCAGAGGGGC7ACCACGTQGTGAGTGTGGGGCAAAGGCCACGAGCCT * * 
GGTGGACACTGAAGGTCTCCCCGATGGTGCAQCACTCACACCCCGTTOCCGGTGGTCGGA * « 



ns. 2A 



rova LAI aval Cy sAr'a SerThrValAr c^etSer 
GluI^uThrlleSerProPheProJttaA!^^ 
GlyAlaHisHisPhcSerPheSerSiProTrpProPheAlaGluAlaProCysGlyCys 
GGAGCTCACCATTTCTCCTTTTCCA<aCCCGTGGCCGTTTGCAGAAGCACCGTGCGGATGT 
CCTCGAGTGGTAAAGAGGAAAAGGTCGGGCACCGGCAAACGTCTTCGTGGCACGCCTACA 

MaGluGlnValGlnteDValTrpValArg^ ^ 
CysOP ThrtlyAlaGluArgValdiySerteuProLeuValLeuGlnLeutepValGla 
I^uLeuAsnArgCysArgThrCysGlyPheAlaAlaThrtlyPrc^ 
CTGCTGAACAGGTGCAGAACGTGTGGGTTCGCTGCCACTGGTCCTCCAGCTCTGGGTCCA 
GACGACTTGTCCACGTCTTGCACACCCAAGCGACGG7GACCAGGAGGTCGAGACCCAGGT 

SerSerGluGli^alCysThrGlyAlaCysTlvrGlyValHlsArgTyrAlaProRisPro 
GlaGlnOP Arg<ayM«tHl*GlyGlyLauHlsArgCysAlaGlnValQr«ThrProSer 
AlaAlaValLysAzigTyrAlaArgGlyl^iiAlaGI&VaiCyaThrGlyMetU 
GCAGCAGTGAAGAGpTATGCACGGGGGCTTGCAOUW » • 

CGTCGTCACTTCTdCATACGTGCCCCCGAACGTGTCCA^ t • 



21 



EP 0 409 472 A1 



1 TGATAAACAGCTGCTTTCAGGACAACTGGTCAGCCCCAAAGGCACACAGACAATCTCCCT 
ACTATTTGTCGACGAA^GTCCTGTTGACCAGTCGGGGTTTCCGTGTGTCTGTTAGAGGGA 

MetGluLysMetAlaMetLysMetLeuVal 
61 ATCTCTGGO^CGGAAATTGTTCTTCCCATAATGGAGAAGATGGCGATGAAGATGTTGGTG 
TAGAGACCGTGCCTTTAACAAGAAGGGTATTACCTCTTCTACCGCTACTTCTACAACCAC 

IlePheValLeuGlyMetAsnHisTrpThrCysThrGlyPheProValTyrAspTyrAsp 
1 21 ATATTTGTCCTTGGAATGAACCACTGGACTTGTACAGGTTTCCCGGTGTATGACTATGAC 
TATAAACAGGAACCTTACTTGGTGACCTGAACATGTCCAAAGGGCCACATACTGATACTG 

ProAlaSerLeuLysGluAlaLeuSerAlaSerValAlaLysValAsnSex<;inSerLeu 
181 CCGGCTTCCCTGAAGGAGGCTCTCAGCGCCTCTGTGGCAAAAGTGAATTCCCAGTCACTG 
GGCCGAAGGGACTTCCTCCGAGAGTCGCGGAGACACCGTTTTCACTTAAGGGTCAGTGAC 

SerProTyrLeuPheArgAlaPheArgSerSerValLysArgValAsnAlaLeuAspGlu 
24 1 AGCCCSTATCTGTTTCGGGCGTTTAGAAGCTCAGTTAAAAGAGTCAACGCCCTGGACGAG 
TCGGGGATAGACAAAGGCCGCAAATCTTCGAGTGAATTTTCTCAGTTGCGGGACCTGCTC 

AspSerLeuThrMetAspLeuGluPheArglleGlnGluThrThrCysArgArgGluSer 
301 GACAGCTTGACCATGGACTTAGAGTTCAGGATTCAAGAGACGACGTGCAGGAGGGAATCT 
CTGTCGAACTGGTACCTGAATCTCAAGTCCTAAGTTCTCTGCTGCACGTCCTCCCTTAGA 

GluMaAspProAlaThrCysAspPheGlnArgGlyTyrHisValProValAlaValCys 
361 GAGGCAGACCCCGCCACCTCTGACTTCCAGAGGGGCTACCACGTGCCCGTGGCCGTTTGC 
CTCCGTCTGGGGCGGTGGACACTGAAGGTCTCCCCGATGGTGCACGGGCACCGGCAAACG 

ArgSerThrValArgMetSerAlaGluGlnValGlnAsnValTrpValArgCysHisTrp 
421 AGAAGCACCGTGCGGATGTCTGCTGAACAGGTGCAGAACGTGTGGGTTCGCTGCCACTGG 
TCTTCGTGGCACGCCTACAGACGACTTGTCCACGTCTTGCACACCCAAGCGACGGTGACC 

SerSerSerSerGlySerSerSerSerGluGluMetPhePheGlyAsplleLeuGlySer 
481 TCCTCCAGCTCTGGGTCCAGCAGCAGTGAAGAGATGTTTTTTGGGGATATC 

AGGAGGTCGAGACCCAGGTCGTCGTCACTTCTCTACAAAAAACCCCTATAGAACCCTAGG 

SerThrSerArgAsnSerTyrLeuLeuGlyLeuThrProAspArgSerArgGlyGluPro 
54 1 TCTACATCAAGAAACAGTTACCTGCTTGGCCTCACTCCTGACAGATCCAGAGGTGAACCA 
AGATGTAGTTCTTTGTCAATGGACGAACCGGAGTGAGGACTC 

I^uTyrGluProSerArgGluMetArgArgAsnP^ 
601 CTTTATGAACCATCACGTGAGATGAGAAGAAACTTTCCTC 

GAAATACTTGGTAGTGCACTCTACTCTTCTTTGAAAGGAGAACCTTTATCTTCCATGAGC 

\f 

AsnProTrpProArgAlaArgValAsnProGlyPheGluOP 
661 AACCCG TGGCCCAG AGCAAGAGTAAACCCTGGCTTTGAGTGACAGCCTTAAGCAAAATGC 
TTGGGCACCGGGTCTCGTTCTCATTTGGGACCGAAA^ 

721 ACTGGAAGGAATAGAAGTTCCAATGAAGAAAGATACCTTATGAATTGTGTAA 

TGACCTTCCTTATCTTCAAGGTTACTTCTTTCTATGGAATACTTAACACATTAAAAGAAA 

7 81 TGATCAATTGCAGTCCCTAATAAATGGCTTACTTTTCC 
ACTAGTTAACGTCAGGGATTATTTACCGAATGAAAAGG 



Fiy* 3 



22 



EP 0 409 472 A1 



LeuArgLysAsnCysHisPrc<»lnThrHisArgGluThrLeuSerValSerArgLeu61n 
SerAM GluGluLeuSerSerPrcAsnThrAM ArgAspThrLeuCysLeuSerlleThr 
I^uLeuGlyArgThrVallleProLysHisIleGluArgHisSerLeuSerLeuAspTyr 
CTCTTAGGAAGAACTGTCATCCCCAAACACATAGAGAGACACTCTCTGTCTCTCGATTAC 
GAGAATCCTTCTTGACAGTAGGGGTTTGTGTATCTCTCTGTGAGAGACAGAGAGCTAATG 

SerOP PheProGluTrpAr gAroOP Ar gQP OP OP ArgTv rOP LauCvsLeuLeu — 
IleMetlleSgrAraMgtGl uLvsMetThrMetMetMetLvsIleLeuIlftMetPheAla fcXOn 
AsnHisAspPheGlnAsnGlyGluAspAspAspAspAspGluAspiieAspTyrValCys i 
AATCATGATTTCC\G. 5 ATGGAGAAGATGACGATGATGATGAAGATATTGATTATGTTTGC I 
TTAGTACTAAAGGTCTTACCTCTTCTACTGCTACTACTACTTCIATAACTAATACAAACG 

Tj*iifi1iiOP ThrThr^vLeuAlaG^ptalAra^ aLeu 
I^uGlvMetAsnTvrTrpSerCysSerO IyLysVaiPheThrAsnLeuAlaThrCysSer 
SerTrpAsnGl uLeuLeuValLeuLeuArgOC GlylleHisGlnProGlyHisLeuLeu 
TCTTGGAATGAACTACTGGTCTTGCTCAGGTAAGGTATTCACCAACCTGGCCACCTGCTC 
AGAACCTTACTTGATGACCAGAACGAGTG^TTCCATAAGTGGTTGGACC^TGGACGAG 

AspHisAlaGluProCysTrpArgLeuCysLeuValSerLeuCysProMetCysLeuArg 
GlySefCysArgAla^etl^uAlaProValSerCysLeuThrValProHisValLeuAla 
TrpIleMetGlnSerHisAlaGlyAlaCysValLeuSerHisCysAlaProCysAlaCys 
TGGATCATGCAGAGCCATGCTGGCGCCTGTGTCTTGTCTCACTGTGCCCCATGTGCTTGC 
ACCTAGTACGTCTCGGTACGACCGCGGACACAGAACAGAGTGACACGGGGTACACGAACG 

ValGli JyalSerGlnCvsThrThrThrlleHisProProOC GlvMetProSerValPr o 
CysProGjlyPhePr oValT y rAspTvrAspProSerSerLeuArqAspAlaLeuSerAla £ 
ValScrArgPheProSerValJLrgl^uArgSerlleLeulAuLysGlyCysProGlnCys t X0r\ 
GTG7CCAGGTTTCCCAGTGTACGACTACGATCCATCCTCCTTAAGGGATGCCCTCAGTGC -n 
CACAGGTCpAAAGGGTCAGATGCTGAlX3CTAGGTAGGAGGAATTCCCTACGGGAGTCAOT ^ X, 

LeuTrpQC LvsOP IleProSerHisOP ValArglleCvsPheGlyHisSerGluAla 
S erValValLvsValAsnSerGInSe r LeuSerProTyr2>u Ph eArgAIaPhftArgSer 
l^uCysGlyLysSerGluPheProValTh^ 

CTCTGTGGTAAAAGTGAATTCCCAGTCACTGAGTCCGTATCTGTTTCGGGCATTCAGAAG 
GAGACACCATTTTCAC7TAAGGGTCAGTGACTCAGGCATAGACAAAGCCCGTAAGTCTTC 

HisOC LvsGli iOC ValGlnAsnGluIlePheS«rThrProProSerAsnAlaValCy» 
SerLeuLysArgV alSerAlaLysOP AsnLeuLeuTyrSerSerPheGlnCysCysLeu 
l^uiieLysLys&rLysCysLysMetLysSerSerl^uLeuLexiLeiiProMetLexiSer 
CTCATTAAA^GAGTAAGTGCAAAATGAAATCTTCTCTACTCCICCTTCCAATGCTGTCT 
GAGTAATTTTTCraTTCACGTTTTA^ 



1 



4cL 



23 



EP 0 409 472 A1 




AM HisHisLysLeuGlnLysCysIleAspHisThrLeuLysLeuTyrPheCysGluOly 
IleAlaSerOC ThrSerCluMetHisOP SerHisSerGluThrLeuPheLeuOP Ax? 
ATAGCATCATAAAC77CAGAAATGCATTGATCACACTCTGAAACTTTATTTTTGTGAAG G 
TATCGTAGTATTTGAAGTCTTTACGTAACTAGTGTGAGACTTTGAAATAAAAACACTTC C 



OP GlyProArgOP GluGlnLeuGlyHisGluPheArgValGlnHisProGlyAspTyr 
LeuArgSerAM Me tAr gThrThrTrpSerOP IlcAM SerSerAlaSerGlyArgLeu 
TTGAGGTCCTAGATGAGAACAACTTGGTCATGAATTTAGAGTTGM3CATCCGGGAGACTA 
AACTCCAGGATCTACTCTTGTTGAACCAGTACTTAAATCTCAAGTCGTAGGCCCTCTGAT 

^sAroLvsAspSftrGlvGluAspProAl aThr<^sAlaPhgGlnArQAspTvrTyrVal 
MetGlnGluGlyPheTrpArgArgSerArgTyrMetCysLeuProGluGlyLeuLeuCys 
HisMaGlyArgllel^uGluLysIleProLeuHisValProSerArgGlyThrThrMet 
CATGCAGGAAGGATTCTGGAGAAGATCCCGCTACATGTGCCTTCCAGAGGGACTACTATG 
GTACGTCCTTCCTAAGACCTCTTCTAGGGCGATGTACACGGAAGGTCTCCCTGATGATAC 

^alSertlyArgArgProIlcPrcCluMetAsnLysArgLysScrLeuThrSerSerMet 
GfLyLysTrpGluGluThrHisPrcArgAscGluGlnLysGluGluProHisPhcPheHis 
TrpOC ValGlyGlyAspProScrGlnLysOP ThrLysGlyArgAlaSerLeuLeuPro 
TGG TAAG TGGGAGG AG ACCCATCCCAGAAATGAACAAAAGGAAGAGCCTCACTTCTTCCA 
ACCATTCACCCTCCTCTGGGTAGGGTCTTTACTTGTTTTCCTTCTCGGAGTGAAGAAGGT 



Al&GluGluAroThrHisProPhgValPhfcSerS ^ 
SerOP AroGluAsnSerProI^uCvsLeuPheGl niSerThrMaValCysAraserTnf " 
Glnl^uLysArgGluLeuThrProl^xiSerPheProV^IHisSerCysLeuGixiLysHis 
CAGCTGAAGAGAGAACTCACCCCTTTGTCTTTTCCACTCCACAGCTGTTTGCAGAAGCAC 
GTCGACTTCTCTCTTGAGTGGGGAAACAGAAAAGGT»GGTGTCGACAAACGTCITCGTG 



OP AraTvrT^uProggrArQCvsArQAraC^sMet^uAlaAlaAlaGlYProProPro 
v^n^fiVals^rAlaGlnGlnValGlnAlaValHisAlaArgCVsSerTrpSerSerSer 
ArgGluGlylieCysPrcAlaGlyAlaGlyGlyAlaCysSerLcuGlxiLauValLeuLcu 
CGTGAAGGTATCTGCCCAGCAGGTGCAGGCGGTGCATGCTCGCTGCAGCTGGTCCTCCTC 
GCACTTCCATAGACGGGTCGTCCACGTCCGCCACGTACGAGCGACGTCGACCAGGAGGAG 

AroLeu SerLeu ThrAl aAl aLysAr^ TyrAspTrpGlyLeu 
ThrSc rGl uSerTvrSer SerGl uGliy alOP LeuGlyPro 
HisValOP ValLeuGlnGlnArgArgri.yMetThrGlyAlaLeu 
CACGTCTGAGTCTTACAGCAGC6AAGAQ3TATGACTGGGGCCTTG 




GTGCAGACTCAGAATGTCGTCGi 




TACTGACCCCGGAAC 



24 



EP 0 409 472 A1 



PhePheLeuSerCysAlaAspThrSerOP PygT^nAfinPhftPh^TLpp p^T^twny 
PheLeuSerPheMetCysOP HlBlleLeuMetProGluPhcLeuAM I MetllePhedlv 
PheSerPhePheHisValLeuThrHisProAspAlaOP XleSerLeuA spAspPheTrp 
TTTTCTTTCTTTCATGTGCTGACACATCCTGA7GCCT6AATTTCTTTAG feTGATTTTTGG 
AAAAGAAAGAAAGTACACGACTGTGTAGGACTACGGACTTAAAGAAATC TACTAAAAACC 



^ThrCvgTrpAfipTrtuIIcton<ny<U^ AapProGly 
^DMetl^^lvSerHisLvsTrpArQAsnAsnTvTLftiiPheG LyLysLeuArgProArg 

ValLysThrPro 
TAAGTTAAGACCCCG 



GlyHisValGlyIle5ftrOC MetGluLysGlnLeuSerlleTx pOC 
GGACATGTTGGGATCTCATAAATGGAGAAACAATTATCTATTTG 3 



CCTGTACAACCCTAGAG TATTTACCTCTTTGTTAATAG ATAAAC IATTCAATTCTGGGGC 



GluGluSerCysLeuMetllelleThrValLeuGI 
ArgGlyVall^iiSerTyrAspTyri^^sValThrG 
GluArgSerLeuValLeuOP 
GAGAGG AGTCTTGTCTTATGATTATTACTG TGTTACAG 



b ra^SyrPheGlpThrSeyProQC 
GavLeuIleSerAspGlu5ftrTl5 



CTCTCCTCAGAACAGAATACTAATAATGACACAATGTC HAGAGTAAAGTCTGCTCAGGTA 



SerGluGlpPheTvrAspArgSerLeuG LyLysOP 



LysOP ThrlleLeuOP 
AAG TGAACAATTTT 



SerValThrTr >OC 



sPheArgArgValHi* 
ITCTCATTTCAGACGAGTCCAT 



Ya^ST^snPht^gtll ^lvHlsI^up alS^ 

sOP PheLeuSerCysCysAlaThrArg 
VallleSerPheLeuLeuCysHisGln 



ATGATCGG TCACTTG 5TAAGTGATTTCTTTCCTGCTGTGCCACCAG 
TTCACTTGTTAAAATACTAGCCAGTGAAC IATTCACTAAAGAAAGGACGACACGGTGGTC 



SexOP CysAspOP GlnSerLeuCysPheProPheLeuSerLeuG avIleMetArqArq 

IleLeuMetOP LeuThxGluProMetLeuProPheSerllePhcAr 1 - 1 1 A ' — - 

AspLeuAspValThrAapArgAlaTyrAlaSerLeuPheTyrLeuAM 

GATCTTGATGTl^CTGACAGAGCCTATGCTTCCCTTTTCTATCTTTAC 

CTAGAACTACACTG ACTGTCTCGGATACGAAGGGAAAAGATAGAAATiCTAG TACTCTT 



Val^uProProGlvAsnArqArcrPv rProAsnHisArqHisArQAlaArqlleAsn^ 

GlylleAlaSexTrpLysGlnLysValProLysProProAlaGlnSerLysAsiiLysTyr 
GlyTyrCyst«uI^uGluThrGluGlyT^ Ha 

GGGTATTGCCWXrTGGAAACAGAAGGTACCOUUCtt 
CCCATAACGGAGGACCTTTCTCTTTC^ 

.ASfiEhfiSluQC. ArgProOP GlyLysLysMetGlnValHlsThrSezValPheArgAsn 
OP LeuOP Val Thr AlaLeuArgOC GluAsnAlaGlyAlaHisLysCysIleAM Lys 
I^uTto^uSerAsnGlyl^uGluValArgLys 
CTGACTTTGAGTAACGGCCTTGAGGTAAGAAAATGCAGGTGCACAC^ 
GACTGAAACTCATTGCCGGAACTCCATTCTTITACGTCCA 



7 



Ore 



25 



EP 0 409 472 A1 



MetlleSerArgMetGluLysMetThrMetMetMetLysIleLeuIleMetPhe 
1 ACAATCATGATTTCCAGAATGGAGAAGATGACGATGATGATGAAGATATTGATTATGTTT 
TGTTAGTACTAAAGGTCTTACCTCTTCTACTGCTACTACTACTTCTATAACTAATACAAA 

-I 1*1 

Al aLeuGl yMetAsnTyrTrpSerCy sSerGlyPhePr oValTyrAspTyr AspProSer 
61 GCTCTTGGAATGAACTACIGGTCTTGCTCAGGTTTCCCAGTGTACGACTACGATCCATCC 
CGAGAACCTTACTTGATGACCAGAACGAGTCCAAAGGGTCACATGCTGATGCTAGGTAGG 

SerLeuArgAspAlaLeuSerAlaSerValValLysValAsoSerGlnSerLeuSerPro 
121 TCCTTAAGGGATGCCCTCAGTGCCTCTGTGGTAAAAGTGAATTCCCAGTCACTGAGTCCG 
AGGAATTCCCTACGGGAGTCACGGAGACACCATTTTCACTTAAGGGTCAGTGACTCAGGC 

TyrLeuPheArgAlaPheArgSerSerLeuLysArgValGluValLeuAspGlvLAsnAsn 
181 TATCTGTTTCGGGCATTCAGAAGCTCATTAAAAAGAGTTGAGGTCCTAGATGAG AACAAC 
ATAGAGAAAGCCCGTAAGTCTTCGAGTAATTTTTCTCAACTCCAGGATCTACTCTTGTTG 

LeuValMetAsnLeuGl\iPheSerIleArgGluThrThrCysArgLysAspSerGlyGlu 
24 1 TTGGTCATGAATTTAGAGTTCAGCATCCGGGAGACAACATGCAGGAAGGATTCTGGAGAA 
AACCAGTACTTAAATCTCAAGTCGTAGGCCCTCTGTTGTACGTCCTTCCTAAGACCTCTT 

AspPxoAl aThrCy sAlaPheGlnArgAspTyrTyrValSerThrAlaValCy sArgSer 
301 GATCCCGCTACATGTGCCTTCCAGAGGGACTACTATGTGTCCACAGCTGTTTGCAGAAGC 
CTAGGGCGATGTACACGGAAGGTCTCCCTGATGATACACAGGTGTCGACAAACGTCTTCG 

ThrValLysValSerAlaGlnGlnValGlnGlyValHisAlaArgCysSerTrpScrSer 
361 ACCGTGAAGGTATCTGCCCAGCAGGTGCAGGGCGTGCATGCTCGCTGCAGCTGGTCCTCC 
3GGCACTTCCATAGACGGGTCGTCCACGTCCCGCACGTACGAGCGACGTCGACCAGGAGG 

SerThrSerGluSerTyrSerSerGluGluMetllcPheGlyAspMetLeuGlySerHls 
421 TCCACGTCTGAGTCTTACAGCAGCGAAGAG ATGATTTTTGGGGACATGTTGGGATCTCAT 
AGGTGCAGACTCAGAATGTCGTCGCTTCTCTACTAAAAACCCCTCTACAACCCTAGAGTA 

LysTrpArgAsnAsnTyrLeuPheGlyLeuIleSerAspGluSerlleSerGluGlnPhe 
481 AAATGGAGAAACAATTATCTATTTGGTCTCATTTCAGACGAGTCCATAAGTGAACAATTT 

tttacctctttgttaatagataaaccagagtaaagtctgctcaggtattcacttgttaaa 

TyrAspArgSerLeuGlylleMetArgArgValLeuProProGlyAsnArgArgTyxPro 

541 tatgatcggtcacttgggatcatgagaagggtattgcctcctggaaacagaaggtaccca 
atactagccagtgaaccctagtactcttcccataacggaggacctttgtcttccatgggt 

AsnHisArgHisAxgAlaArglleAsnThrAspPheGluOC 

601 aaccaccggcacagagcaagaataaatactgactttgagtaacggccttgaggt 

TTGGTGGCCGTGTCTCGTTCTTATTTATGACTGAAACTCATTGCOGGAACTCCA 



26 



J 



European 
Patent Office 



EUROPEAN SEARCH 
REPORT 



Application Number 
EP 90 30 7568 



DOCUMENTS CONSIDERED TO BE RELEVANT 



Category 



Citation of document with indication, where appropriate, 
of relevant passages 



Relevant 
to claim 



CLASSIFICATION OF THE 
APPLICATION (Int. CI.S) 



X 



X,A 



P.X 



P,X 



CHEMICAL ABSTRACTS, vol. 111. no. 9. 28 August 1989 
Columbus. Ohio, USA BURNETT, P. R. et al: "combination 
histochemical and autoradiographic method for analysis of 
enzymatic and proliferative responses to immunoreactive 
osteoinducer" page 403; ref. no. 74303H 

* abstract " 

WO-A-8 800 205 (GENETIC INSTITUTE.INC.) 

* the whole document * * page 51 , line 26 - page 54, line 4 * 



WO-A-8 910 409 (GENETICS INSTITUTE.INC) 
* the whole document * 



CALCIFIED TISSUE international .supppl 2 vol. 46, April 
1990, NEW YORK Inc page A46 SAMPATH T.K. and al: 
"Human osteogenic proteins:expression of biologically ac- 
tive molecules in E. COLI" 

* abstract * 

PROCEEDINGS OF THE NATIONAL ACADEMY OF SCI- 
ENCES OF USA. vol. 85, December 1988, WASHINGTON 
US pages 9484 - 9488; WANG E. A. and al: "purification and 
characterization of other distinct bone-inducing factors" 

* the whole document * 

Methods in ENZYMOLOGY vol. 146, 1987, NEW YORK, US. 
pages 294 - 312; URIST M. R: and al: "Preparation and 
bioassay of bone morphogenetic protein and polypeptides 
fragments" 

* the whole document * 



The present search report has been drawn up for all claims 



26 



C 12 N 15/12 
C 12 P 21/02 
C 12 P 21/08 
A 61 K 37/02 
C 12 N 15/16 
C 12 N 15/62 



1-3,7-10, 
13-19,23. 
25,20-22 

1-3.7-10, 
13-19,23, 
25 

1-2,7-8, 
13-18,20, 



1.3,25 



TECHNICAL FIELDS 
SEARCHED (Int. CI.8) 



C12N 
A 61 K 
C12P 
C07K 



1-3,25 



Place of search 



The Hague 



Date of completion of search 

09 November 90 



Examiner 
L€ CORNEC N.D.R. 



CATEGORY OF CITED DOCUMENTS 
X : particularly relevant if taken alone 
Y : particularly relevant if combined with another 

document of the same catagory 
A : technological background 
O: non-written disclosure 
P: intermediate document 
T: theory or principle underlying the Invention 



E : earlier patent document, but published on, or after 

the filing date 
D ; document cited In the application 
L : document cited for other reasons 

& : member of the same patent family, corresponding 
document 



J 



European 
Patent Office 



EUROPEAN SEARCH 
REPORT 



Page 2 
Application Number 

EP 90 30 7568 



DOCUMENTS CONSIDERED TO BE RELEVANT 



Category 



Citation of document with indication, where appropriate, 
of relevant passages 



Relevant 
to claim 



CLASSIFICATION OF THE 
APPLICATION <lnt. C\J5) 



EP-A-0 148 155 (THE DOW CHEMICAL COMPANY) 
* the whole document ' 



1-3.25,26 



TECHNICAL FIELDS 
SEARCHED Ont. CI.5) 



The present search report has been drawn up for all claims 



Place of search 
The Hague 



Date of completion of search 
09 November 90 



Examiner 
LE CORNEC N.O.FL 



CATEGORY OF CITED DOCUMENTS 
X : particularly relevant if taken alone 
Y ; particularly relevant If combined with another 

document of the same category 
A: technological background 
0: non-written disclosure 
P: intermediate document 
T : theory or principle underlying the invention 



E : earlier patent document, but published on. or after 

the fifing date 
D : document cited in the application 
L : document cited for other reasons 

& : member of the same patent family, corresponding 
document 



This Page is Inserted by IFW Indexing and Scanning 
Operations and is not part of the Official Record 

BEST AVAILABLE IMAGES 

Defective images within this document are accurate representations of the original 
documents submitted by the applicant. 

Defects in the images include but are not limited to the items checked: 

□ BLACK BORDERS 

□ IMAGE CUT OFF AT TOP, BOTTOM OR SIDES 
□f FADED TEXT OR DRAWING 

\jf BLURRED OR ILLEGIBLE TEXT OR DRAWING 

□ SKEWED/SLANTED IMAGES 

□ COLOR OR BLACK AND WHITE PHOTOGRAPHS 

□ GRAY SCALE DOCUMENTS 

□ LINES OR MARKS ON ORIGINAL DOCUMENT 

□ REFERENCE(S) OR EXHIBIT(S) SUBMITTED ARE POOR QUALITY 

□ OTHER: 

IMAGES ARE BEST AVAILABLE COPY. 
As rescanning these documents will not correct the image 
problems checked, please do not report these problems to 
the IFW Image Problem Mailbox.