Skip to main content

Full text of "USPTO Patents Application 09804625"

See other formats


(19) 



Europaisches Patentamt 
European Patent Office 
Office europeen dee brevets 



(12) 



(11) EP 0 313 578 B1 

EUROPEAN PATENT SPECIFICATION 



(45) Date of publication and mention 
of the grant of the patent: 
28.08.1996 Bulletin 1996/35 

(21) Application number: 87905023.5 

(22) Date of filing: 30.06.1987 



(51) inter* C07K 14/51, C12N 15/12, 
A61K38/18 

(86) International application number: 
PCT/US87/01537 

(87) International publication number: 

WO 88/00205 (14.01.1988 Gazette 1988/02) 



(54) NOVEL OSTEOINDUCTIVE COMPOSITIONS 

OSTEOINDUKTIVE MITTEL 

NOUVELLES COMPOSITIONS OSTEOINDUCTIVES 



(84) Designated Contracting States: 

AT BE CH DE FR GB IT LI LU NL SE 

(30) Priority: 01.07.1986 US 880776 

17.12.1986 US 943332 

20.03.1987 US 28285 
26.03.1987 US 31346 

(43) Date of publication of application: 
03.05.1989 Bulletin 1989/18 

(60) Divisional application: 95111771.2 

(73) Proprietor: GENETICS INSTITUTE, INC. 
Cambridge, Massachusetts 02140 (US) 

(72) Inventors: 

• WANG, Elizabeth, A. 
Carlisle, MA 01741 (US) 

• WOZNEY, John, M. 
Hudson, MA 01749 (US) 

• ROSEN, Vicki, A. 
Boston, MA 02116 (US) 



00 

00 
h- 
IO 

CO 
CO 

o 

CL 
iD 



(74) Representative: VOSSIUS & PARTNER 
Postf ach 86 07 67 
81634 Munch en (DE) 



(56) References cited: 
EP-A- 0121 976 
EP-A- 0148 155 
WO-A-85/04173 
US-A- 4 563 350 



EP-A- 0128 041 
EP-A- 0 212 474 
US-A- 4 455 256 
US-A- 4 619 989 



• PROCEEDINGS OF THE NATL. ACADEMY OF 
SCIENCES USA, vol. 81, January 1984, 
Washington, DC (US); URIST, pp. 371-375 

• SCIENCE, vol. 220, 13 May 1983, Washington, DC 
(US); URIST, pp. 680-686 

• PROCEEDINGS OF THE NATL. ACADEMY OF 
SCIENCES USA, vol. 80, November 1983, 
Washington, DC (US); SAMPATH et at., pp. 
6591-6595 

• PROCEEDINGS OF THE NATL. ACADEMY OF 
SCIENCES USA, vol. 78, November 1981, 
Washington, DC (US); SUGGS et al., pp. 
6613-6617 



Note: Within nine months from the publication of the mention of the grant of the European patent, any person may give 
notice to the European Patent Office of opposition to the European patent granted. Notice of opposition shall be filed in 
a written reasoned statement. It shall not be deemed to have been filed until the opposition fee has been paid. (Art. 
99(1 ) European Patent Convention). 



Printed by Jouve, 76001 PARIS (FR) 



EP 0 313 578 B1 



Description 

The present invention relates to novel proteins : processes for obtaining them and genes encoding them. These 
proteins are capable of inducing cartilage and bone formation. 

5 

Background 

Bone is a highly specialized tissue characterized by an extensive matrix structure formed of fibrous bundles of the 
protein collagen, and proteoglycans, noncollagenous proteins, lipids and acidic proteins. The processes of bone for- 
io mation and renewal/repair of bone tissue, which occur continuously throughout life, are performed by specialized cells. 
Normal embryonic long bone development is preceded by formation of a cartilage model. Bone growth is presumably 
mediated by "osteoblasts" (bone-forming cells), while remodeling of bone is apparently accomplished by the joint ac- 
tivities of bone-resorbing cells, called "osteoclasts" and osteoblasts. A variety of osteogenic, cartilage-inducing and 
bone inducing factors have been described. See, e.g. European patent applications 148,155 and 169,016 for discus- 
es sions thereof. 

Brief Description of the Invention 

The present invention provides novel proteins in purified form and genes encoding them. Specifically, two of the 
20 novel proteins are designated BMP-2 Class I (or BMP-2), and BMP-2 Class II (or BMP-4) wherein BMP is bone mor- 
phogeny protein. These proteins are characterized by peptide sequences the same as or substantially homologous 
to amino acid sequences illustrated in Tables II, III and IV below. They are capable of inducing bone formation at a 
predetermined site. These bone inductive factors are further characterized by biochemical and biological characteristics 
including activity at a concentration of 10 to 1000ng/gram of bone in an jn vivo rat bone formation assay described 
25 below. Proteins of this invention may be encoded by the DNA sequences depicted in the Tables or by sequences 
capable of hybridizing thereto and coding for polypeptides with bone growth factor biological properties or other vari- 
ously modified sequences demonstrating such properties. 

One of the proteins of the invention is designated BMP-2 Class I (or BMP-2). It is characterized by at least a portion 
of a peptide sequence the same or substantially the same as that of amino acid #1 through amino acid #396 of Table 
30 in which represents the cDNA hBMP-2 Class I. This peptide sequence is encoded by the same or substantially the 
same DNA sequence, as depicted in nucleotide #356 through nucleotide #1543 of Table III. The human peptide se- 
quence identified in Table III is 396 amino acids in length. hBMP-2 or related bone inductive proteins may also be 
characterized by at least a portion of this peptide sequence. hBMP-2 Class I is further characterized by the ability to 
induce bone formation. 

3S The homologous bovine bone inductive protein of the invention designated bBMP-2 Class I (or bBMP-2), has a 

DNA sequence identified in Table II below which represents the genomic sequence. This bovine DNA sequence has 
a prospective 129 amino acid coding sequence followed by approximately 205 nucleotides (a presumptive 3' non- 
coding sequence). bBMP-2, Class I is further characterized by the ability to induce bone formation. A further bone 
inductive protein composition of the invention is designated BMP-2 Class II or BMP-4. The human protein hBMP-2 

40 Class II (or h BMP-4) is characterized by at least a portion of the same or substantially the same peptide sequence 
between amido acid #1 through amino acid #408 of Table IV which represents the cDNA of hBMP-2 Class II. This 
peptide sequence is encoded by at least a portion of the same or substantially the same DNA sequence as depicted 
in nucleotide #403 through nucleotide #1626 of Table IV. This factor is further characterized by the ability to induce 
bone formation. 

45 Another aspect of the invention provides pharmaceutical compositions containing a therapeutically effective 

amount of one or more bone growth factor polypeptides according to the invention in a pharmaceutical^ acceptable 
vehicle. These compositions may further include other therapeutically useful agents. They may also include an appro- 
priate matrix for delivering the proteins to the site of the bone defect and for providing a structure for bone growth. 
These compositions may be employed in methods for treating a number of bone defects and periodontal disease. 

so These methods, according to the invention, entail administering to a patient needing such bone formation an effective 
amount of at least one of the novel proteins BMP-2 Class I and BMP-2 Class-ll as described herein. 

Still a further aspect of the invention are DNA sequences coding on expression for a human or bovine polypeptide 
having the ability to induce bone formation. Such sequences include the sequence of nucleotides in a 5' to 3' direction 
illustrated in Tables II, III and IV. Alternatively, a DNA sequence which hybridizes under stringent conditions with the 

ss DNA sequences of Tables II, III and IV or a DNA sequence which hybridizes under non-stringent conditions with the 
illustrated DNA sequences and which codes on expression for a protein having at least one bone growth factor biological 
property are included in the present invention. Finally, allelic or other variations of the sequences of Tables II, III and 
IV, whether such nucleotide changes result in changes in the peptide sequence or not, are also included in the present 



2 



EP 0 313 578 B1 



invention. 

Still a further aspect of the invention is a vector containing a DNA sequence as described above in operative 
association with an expression control sequence. Such vector may be employed in a novel process for producing a 
bone growth factor polypeptide in which a cell line transformed with a DNA sequence encoding expression of a bone 
s growth factor polypeptide in operative association with an expression control sequence therefor, is cultured. This 
claimed process may employ a number of known cells as host cells for expression of the polypeptide. Presently pre- 
ferred cell lines are mammalian cell lines and bacterial cells. 

Other aspects and advantages of the present invention will be apparent upon consideration of the following detailed 
description and preferred embodiments thereof. 

w 

Detailed Description of the Invention 

The proteins of the present invention are characterized by amino acid sequences or portions thereof the same as 
or substantially homologous to the sequences shown in Tables II, III and IV. These proteins are also characterized by 

is the ability to induce bone formation. 

The bone growth factors provided herein also include factors encoded by the sequences similar to those of Tables 
II, III and IV, but into which modifications are naturally provided (e.g. allelic variations in the nucleotide sequence which 
may result in amino acid changes in the polypeptide) or deliberately engineered. For example, synthetic polypeptides 
may wholly or partially duplicate continuous sequences of the amino acid residues of Tables II, III and IV These se- 

20 quences, by virtue of sharing primary, secondary, or tertiary structural and conformational characteristics with bone 
growth factor polypeptides of Tables II, III and IV may possess bone growth factor biological properties in common 
therewith. Thus, they may be employed as biologically active substitutes for naturallyoccurring bone growth factor 
polypeptides in therapeutic processes. 

Other specific mutations of the sequences of the bone growth factors described herein involve modifications of 

2S one or both of the glycosylation sites. The absence of glycosylation or only partial glycosylation results from amino 
acid substitution or deletion at one or both of the asparagine-linked glycosylation recognition sites present in the se- 
quences of the bone growth factors shown in Tables II, III and IV The asparagine-linked glycosylation recognition sites 
comprise tripeptide sequences which are specifically recognized by appropriate cellular glycosylation enzymes. These 
tripeptide sequences are either asparagine-X-threonine or asparagine-X-serine, where X is usually any amino acid. A 

30 variety of amino acid substitutions or deletions at one or both of the first or third amino acid positions of a glycosylation 
recognition site (and/or amino acid deletion at the second postion) results in non-glycosylation at the modified tripeptide 
sequence. 

The present invention also encompasses the novel DNA sequences, free of association with DNA sequences 
encoding other proteinaceous materials, and coding on expression for bone growth factors. These DNA sequences 

35 include those depicted in Tables II, III and IV in a 5' to 3' direction and those sequences which hybridize under stringent 
hybridization conditions [see, T Maniatis et al, Molecular Cloning (A Laboratory Manual) , Cold Spring Harbor Laboratory 
(1982), pages 387 to 389] to the DNA sequences of Tables II, III and IV 

DNA sequences which hybridize to the sequences of Tables II, III and IV under relaxed hybridization conditions 
and which code on expression for bone growth factors having bone growth factor biological properties also encode 

40 bone growth factors of the invention. For example, a DNA sequence which shares regions of significant homology, e. 
g., sites of glycosylation or disulfide linkages, with the sequences of Tables II, ill arid IV and encodes a bone growth 
factor having one or more bone growth factor biological properties clearly encodes a member of this novel family of 
growth factors, even if such a DNA sequence would not stringently hybridize to the sequence of Tables II, III and IV 
Similarly, DNA sequences which code for bone growth factor polypeptides coded for by the sequences of Tables 

45 II, III and IV, but which differ in codon sequence due to the degeneracies of the genetic code or allelic variations 
(naturally-occurring base changes in the species population which may or may not result in an amino acid change) 
also encode the novel growth factors described herein. Variations in the DNA sequences of Tables II, III and IV which 
are caused by point mutations or by induced modifications to enhance the activity, haff-life or production of the polypep- 
tides encoded thereby are also encompassed in the invention. 

so Another aspect of the present invention provides a novel method for producing the novel osteoinductive factors. 

The method of the present invention involves culturing a suitable cell or cell line, which has been transformed with a 
DNA sequence coding on expression for a novel bone growth factor polypeptide of the invention, under the control of 
known regulatory sequences.. Suitable cells or cell lines may be mammalian cells, such as Chinese hamster ovary 
(CHo) cells: The selection of suitable mammalian host cells and methods for transformation, culture, amplification, 

55 screening and product production and purification are known in the art. See, e.g.,<3ething and Sambrook, Nature , 293 : 
620-625 (1981) : or alternatively, Kaufman et al, Mol. Cell. Biol., 5(7): 1750-1 759 (1985) or Howley et al, U.S. Patent 
4,419,446. Another suitable mammalian cell line, which is described in the accompanying examples, is the monkey 
COS-1 cell line. A similarly useful mammalian cell line is the CV-1 cell line. 



3 



EP 0 313 578 B1 



Bacterial cells are suitable hosts. For example, the various strains of E. colj (e.g., HB101 , MC1061 ) are well-known 
as host cells in the field of biotechnology. Various strains of B. subtilis , Pseudomonas , other bacilli and the like may 
also be employed in this method. 

Many strains of yeast cells known to those skilled in the art are also available as host cells for expression of the 
s polypeptides of the present invention. Additionally, where desired, insect cells may be utilized as host'cells in the method 
of the present invention. See, e.g. Miller et al, Genetic Engineering , 8:277-298 (Plenum Press 1986) and references 
cited therein. 

Another aspect of the present invention provides vectors for use in the method of expression of these novel oste- 
oinductive polypeptides. Preferably the vectors contain the full novel DNA sequences described above which code for 

10 the novel factors of the invention. Additionally the vectors also contain appropriate expression control sequences per- 
mitting expression of the bone inductive protein sequences. Alternatively, vectors incorporating modified sequences 
as described above are also embodiments of the present invention and useful in the production of the bone inductive 
proteins. The vectors may be employed in the method of transforming cell lines and contain selected regulatory se- 
quences in operative association with the DNA coding sequences of the invention which are capable of directing the 

15 replication and expression thereof in selected host cells. Useful regulatory sequences for such vectors are known to 
one of skill in the art and may be selected depending upon the selected host cells. Such selection is routine and does 
not form part of the present invention: 

A protein of the present invention, which induces bone growth in circumstances where bone is not normally formed, 
has application in the healing of bone fractures. An osteogenic preparation employing one or more of the proteins of 

20 the invention may have prophylactic use in closed as well as open fracture reduction and also in the improved fixation 
of artificial joints. De novo bone formation induced by an osteogenic agent contributes to the repair of congenital, 
trauma induced, or oncologic resection induced craniofacial defects, and also is useful in cosmetic plastic surgery. An 
osteogenic factor of the invention may be valuable in the treatment of periodontal disease, and in other tooth repair 
processes'. Such agents may provide an environment to attract bone-forming cells, stimulate growth of bone-forming 

2S cells or induce differentiation of progenitors of bone-forming cells. Of course, the proteins of the invention may have 
other therapeutic uses. 

A further aspect of the invention is a therapeutic method and composition for repairing fractures and other conditions 
related to bone defects or periodontal diseases. Such a composition comprises a therapeutically effective amount of 
at least one of the bone inductive factor proteins of the invention. The bone inductive factors according to the present 

30 invention may be present in a therapeutic compositon in admixture with a pharmaceutically acceptable vehicle or matrix. 
Further therapeutic methods and compositions of the invention comprise a therapeutic amount of a bone inductive 
factor of the invention with a therapeutic amount of at least one of the other bone inductive factors of the invention. 
Additionally, the proteins according to the present invention or a combination of the proteins of the present invention 
may be co-administered with one or more different osteoinductive factors with which they may interact. Further, the 

55 bone inductive proteins may be combined with other agents beneficial to the treatment of the bone defect in question. 
Such agents include, but are not limited to various growth factors. The preparation of such physiologically acceptable 
protein compositions, having due regard to pH, isotonicity, stability and the like, is within the skill of the art. 

In particular, BMP-2 Class I may be used individually in a pharmaceutical composition. BMP-2 Class I may also 
be used in combination with one or more of. the other proteins of the invention. BMP-2 Class I may be combined with 

40 BMP-2 Class II. It may also be combined with BMP-3. Further BMP-2 Class I may be combined with BMP-2 Class II 
and BMP-3. 

BMP-2 Class II may be used individually in pharmaceutical composition. In addition, it may be used in combination 
with other proteins as identified above. Further it may be used in combination with BMP-3. 

The therapeutic method includes locally administering the composition as an implant or device. When administered, 

45 the therapeutic composition for use in this invention is, of course, in a pyrogen-free, physiologically acceptable form. 
Further, the composition may desirably be encapsulated or injected in a viscous form for delivery to the site of bone 
damage. Preferably, the bone growth inductive factor composition would include a matrix capable of delivering the 
bone inductive factor to the site of bone damage, providing a structure for the developing bone and cartilage and 
optimally capable of being resorbed into the body Such matrices may be formed of other materials presently in use 

so for other implanted medical applications. 

The choice of material is based on, for example, biocompatibility biodegradability, mechanical properties, cosmetic 
appearance and interface properties. Similarly, the application of the osteoinductive factors will define the appropriate 
formulation. Potential matrices for the osteoinductive, factors may be biodegradable and chemically defined, such as, 
but not limited to calcium sulfate, tricalciumphosphate, hydroxyapatite, polylactic acid, polyanhydrides; biodegradable 

55 and biologically well defined, such as bone or dermal collagen, other pure proteins or extracellular matrix components; 
nonbiodegradable and chemically defined, such as sintered hydroxyapatite, bioglass, aluminates : or other ceramics; 
or combinations of any of the above mentioned types of material, such as polylactic acid and hydroxyapatite or collagen 
and tricalciumphosphate. The bioceramics might also be altered in composition, such as in calcium-aluminate-phos- 



4 



EP 0 313 578 B1 

phate and processing to alter for example, pore size, particle size, particle shape, and biodegradability. 

The dosage regimen will be determined by the attending physician considering various factors which modify the 
action of such a growth factor, e.g. amount of bone weight desired to be formed, the site of bone damage, the condition 
of the damaged bone, the patient's age, sex, and diet, the severity of any infection, time of administration and other 
5 clinical factors. The dosage may vary with the type of matrix used in the reconstitution and the composition of BMP's. 
The addition of other known growth factors i such as IGF 1 (insulin like growth factor 1), to the final composition, may 
also effect the dosage. Generally, the dosage regimen should be in the range of approximately 10 to 10 6 nanograms 
of protein per gram of bone weight desired. Progress can be monitored by periodic assessment of bone growth and/ 
or repair, e.g. x-rays. Such therapeutic compositions are also presently valuable for veterinary applications due to the 
io lack of species specificity in bone inductive factors. Particularly domestic animals and thoroughbred horses in addition 
to humans are desired patients for such treatment with the bone inductive factors of the present invention. 

The following examples illustrate practice of the present invention in recovering and characterizing the bovine 
proteins and employing them to recover the human proteins, obtaining the human proteins and in expressing the 
proteins via recombinant techniques. 

75 

EXAMPLE I 

Isolation of Bovine Bone Inductive Factor 

20 Ground bovine bone powder (20-1 20 mesh, Helitrex) is prepared according to the procedures of M. R. Urist et al. , 

Proc. Natl Acad. Sci USA, 70:3511 (1973) with elimination of some extraction steps as identified below. Ten kgs of the 
ground powder is demineralized in succesive changes of 0.6N HCI at 4°C over a 48 hour period with vigorous stirring. 
The resulting suspension is extracted for 16 hours at 4°C with 50 liters of 2M CaCI 2 and 10mM ethylenediamine- 
tetraacetic acid [EDTA] : and followed by extraction for 4 hours in 50 liters of 0.5M EDTA. The residue is washed three 

25 times with distilled water before its resuspension in 20 liters of 4M guanidine hydrochloride [GuCI], 20mM Tris (pH 7.4), 
1 mM N-ethylmaleimide, ImM iodoacetamide, 1mM phenylmethylsulfonyl fluoride as described in Clin. Orthop. Rel. 
Res. , 1*71: 213 (1982). After 16 to 20 hours the supernatant is removed and replaced with another 10 liters of GuCI 
buffer. The residue is extracted for another 24 hours. 

The crude GuCI extracts are combined, concentrated approximately 20 times on a Pellicon apparatus with a 1 0,000 

30 molecular weight cut-off membrane, and then dialyzed in 50mM Tris, 0.1 M NaCI, 6M urea (pH7.2), the starting buffer 
for the first column. After extensive dialysis the protein is loaded on a 4 liter DEAE cellulose column and the unbound 
fractions are collected. 

The unbound fractions are concentrated and dialyzed against 50mM NaAc, 50mM NaCI (pH 4.6) in 6M urea. The 
unbound fractions are applied to a carboxymethyl cellulose column. Protein not bound to the column is removed by 

35 extensive washing with starting buffer, and the bone inductive factor containing material desorbed from the column by 
50mM NaAc, 0.25mM NaCI, 6M urea (pH 4.6). The protein from this step efution is concentrated 20- to 40- fold, then 
diluted 5 times with 80mM KP0 4 , 6M urea (pH6.0). The pH of the solution is adjusted to6.0 with 500mM K 2 HP0 4 . The 
sample is applied to an hydroxy lapatite column (LKB) equilibrated in 80mM KP0 4 , 6M urea (pH6.0) and all unbound 
protein is removed by washing the column with the same buffer. Bone inductive factor activity is eluted with 100mM 

40 KP0 4 (pH7.4) and 6M urea. 

The protein is concentrated approximately 10 times, and solid NaCI added to a final concentration of 0.15M. This 
material is applied to a heparin - Sepharose column equilibrated in 50mM KP0 4 , 150mM NaCI, 6M urea (pH7.4). After 
extensive washing of the column with starting buffer, a protein with bone inductive factor activity is eluted by 50mM 
KP0 4 , 700mM NaCI, 6M urea (pH7.4). This fraction is concentrated to a minimum volume, and 0.4ml aliquots are 

4$ applied to Superose 6 and Superose 12 columns connected in series, equilibrated with 4M GuCI, 20mM Tris (pH7.2) 
and the columns developed at a flow rate of 0.25ml/min. The protein demonstrating bone inductive factor activity has 
a relative migration corresponding to approximately 30,000 dalton protein. 

The above fractions are pooled, dialyzed against 50mM NaAc, 6M urea (pH4;6), and applied to a Pharmacia 
MonoS HR column. The column is developed with a gradient to 1.0M NaCI, 50mM NaAc, '6M urea (pH4.6). Active 

so fractions are pooled and brought to pH3.0 with 10% trifluoroacetic acid (TFA). The material is applied to a 0.46 x 25cm 
Vydac C4 column in 0.1% TFA and the column developed with a gradient to 90% acetonitrile, 0.1% TFA (31 .5% ace- 
tonitrile, 0.1% TFA to 49.5% acetonitrile, 0.1% TFA in 60 minutes at Iml per minute). Active material is eluted at ap- 
proximately 40-44% acetonitrile. Aliquots of the appropriate fractions are iodinated by one of the following methods: 
P. J. McConahey etal, Int. Arch. Allergy , 29:185-189 (1966); A. E. Bolton et al, Biochem J . t 133:529 (1973); and D. F. 

ss Bowen-Pope, J. Biol. Chem ., 237:5161 (1 982). The iodinated proteins present in these fractions are analyzed by SOS 
gel electrophoresis and urea Triton X 100 isoelectric focusing. At this stage, the bone inductive factor is estimated to 
be approximately 10-50% pure. 



5 



EP 0 313 578 B1 



EXAMPLE II 

Characterization of Bovine Bone Inductive Factor 
5 A. Molecular Weight 

Approximately 20ug protein trom Example I is lyophilized and redissolved in 1 X SDS sample buffer. After 15 minutes 
of heating at 37°C, the sample is applied to a 15% SDS polyacrylamide gel and then electrophoresed with cooling. 
The molecular weight is determined relative to prestained molecular weight standards (Bethesda Research Labs). 

ip Immediately after completion, the gel lane containing bone inductive factor is sliced into 0.3cm pieces. Each piece is 
mashed and 1 .4ml of 0.1% SDS is added. The samples are shaken gently overnight at room temperature to elute the 
protein. Each gel slice is desalted to prevent interference in the biological assay. The supernatant from each sample 
is acidified to pH 3.0 with 10% TFA S filtered through a 0.45 micron membrane and loaded on a 0.46cm x 5cm C4 \fydac 
column developed with a gradient of 0.1% TFA to 0.1% TFA, 90% CH 3 CN. The appropriate bone inductive factor - 

is containing fractions are pooled and reconstituted with 20mg rat matrix. In this gel system, the majority of bone inductive 
factor fractions have the mobility of a protein having a molecular weight of approximately 28,000 - 30,000 daltons. 

B. Isoelectric Focusing 

20 The isoelectric point of bone inductive factor activity is determined in a denaturing isoelectric focusing system. The 

Triton X100 urea gel system (Hoeffer Scientific) is modified as follows: 1) 40% of the ampholytes used are Servalyte 
3/10; 60% are Servalyte 7-9. 2) The catholyte used is 40mM NaOH. Approximately 20ug of protein from Example I is 
lyophilized, dissolved in sample buffer and applied to the isoelectrofocusing gel. The gel is run at 20 watts, 10°C for 
approximately 3 hours. At completion the lane containing bone inductive factor is sliced into 0.5 cm slices. Each piece 

25 is mashed in 1.0ml 6M urea, 5mM Tris (pH 7.8) and the samples agitated at room temperature. The samples are 
acidified, filtered, desalted and assayed as described above. The major portion of activity as determined in the assay 
described in Example III migrates in a manner consistent with a pi of 8.8 - 9.2. 

C. Subunit Characterization 

30 

The subunit composition of bone inductive factor is also determined. Pure bone inductive factor is isolated from a 
preparative 15% SDS gel as described above. A portion of the sample is then reduced with 5mM DTT in sample buffer 
and re-electrophoresed on a 15% SDS gel. The approximately 30kd protein yields two major bands at approximately 
20kd and 18kd, as well as a minor band at 30kd. The broadness of the two bands indicates heterogeneity caused most 
35 probably by glycosylation, other post translational modification, proteolytic degradation or carbamyiation. 

EXAMPLE III 

Biological Activity of Bone Inductive Factor 

40 

A rat bone formation assay according to the general procedure of Sampath and Reddi, Proc. Natl. Acad. Sci. LI- 
SA , 80:6591 -6595 (1 983) is used to evaluate the osteogenic activity of the bovine bone inductive factor of the present 
invention obtained in Example I. This assay can also be used to evaluate bone inductive factors of other species. The 
ethanol precipitation step is replaced by dialyzing the fraction to be assayed against water. The solution or suspension 

45 is then redissolved in a volatile solvent, e.g. 0.1 - 0.2 % TFA, and the resulting solution added to 20mg of rat matrix. 
This material is frozen and lyophilized and the resulting powder enclosed in #5 gelatin capsules. The capsules are 
implanted subcutaneously in the abdominal thoracic area of 21 - 49 day old male long Evans rats. The implants are 
removed after 7 - 14days. Half of each implant is used for alkaline phosphatase analysis [See, A. H. Reddi etal., Proc. 
Natl.Acad.Sci. , 69:1601 (1972)] and half is fixed and processed for histological analysis. Routinely, 1(am glycolmeth- 

50 acrylate sections are stained with Von Kossa and acid fuchsin to detect new bone mineral. Alkaline phosphatase, an 
enzyme produced by chondroblasts and osteoblasts in the process of matrix formation, is also measured. New cartilage 
and bone formation often correlates with alkaline phosphatase levels. Table I below illustrates the dose response of 
the rat matrix samples including a control not treated with bone inductive factor. 

ss 



6 



EP 0 313 578 B1 



TABLE 1 



5 



Protein* Implanted u.g 


Cartilage 


Alk. Phos.u/I 


7.5 


2 


Not done 


2.5 


3 


445.7 


0.83 


3 


77.4 


0.28 


0 


32.5 


0.00 


0 


31.0 



*A1 this stage the bone inductive factor is approximately 10-15% pure. 



The bone or cartilage formed is physically confined to the space occupied by the matrix. Samples are also analyzed 
by SDS gel electrophoresis and isoelectric focusing as described above, lollowed by autoradiography. Analysis reveals 
a correlation of activity with protein bands at 28 - 30kd and a pi 9.0. An extinction coefficient of 1 OD/mg-cm is used 
as an estimate for protein and approximating the purity of bone inductive factor in a particular fraction. In the in vivo 
rat bone formation assays on dilutions as described above, the protein is active in vivo at 10 to 200ng protein/gram 
bone to probably greater than 1u.g protein/gram bone. 



20 



30 



35 



EXAMPLE IV 

Bovine Bone Inductive Factor Protein Composition 



The protein composition of Example MA of molecular weight 28 - 30kd is reduced as described in Example IIC and 
digested with trypsin. Eight tryptic fragments are isolated by standard procedures having the following amino acid 
2$ sequences: 



Fragment 


1: 


A 


A 


F 


L 


G 


D 


I 


A 


L 


D 


E 


E D L 


Fragment 


2 : 


A 


F. 


Q 


V 


Q 


Q 


A 


A 


D 


L 






Fragment 


3: 


N 


Y 


Q 


D 


H 


V 


V 


E 


G 








Fragment 


4: 


S 


T 


P 


A 


Q 


T> 


V 


S 


R 








Fragment 


5: 


N 


Q 


E 


A 


L 


R 














Fragment 


6: 


L 


S 


E 


P 


D 


P 


s 


H 


T 


L 


E 


E 


Fragment 


7: 


F 


D 


A 


Y 


Y 
















Fragment 


8: 


L 


K 


P 


S 


N 


7 


A 


T 


I 


Q 


S 


I V E 



A less highly purified preparation of protein from bovine bone is prepared according to a purification scheme similar 
40 to that described in Example I. The purification basically varies from that previously described by omission of the DE- 
52 column, the CM cellulose column and the mono s column, as well as a reversal in the order of the hydroxy lapatite 
and heparin sepharose columns. Briefly, the concentrated crude 4 M extract is brought to 85% final concentration of 
ethanol at 4 degrees. The mixture is then centrifuged : and the precipitate redissolved in 50 mM Tris, 0.15 M NaCI, 6.0 
M urea. This material is then fractionated on Heparin Sepharose as described. The Heparin bound material is fraction- 
45 ated on hydroxyapatite as described. The active fractions are pooled, concentrated, and fractionated on a high reso- 
lution gel filtration (TSK 30000 in 6 M guanidinium chloride, 50 mM Tris, pH 7.2). The active fractions are pooled, 
dialyzed against 0. 1% TFA : and then fractionated on a C4 Vydac reverse phase column as described. The preparation 
is reduced and electrophoresed on an acrylamide gel. The protein corresponding to the 1 8K band is eluted and digested 
with trypsin. Tryptic fragments are isolated having the following amino acid sequences: 

so 





Fragment 


9: 


s 


L 


K 


P 


is 


N 


H 


A" 


T 


I 


Q S ? V 




Fragment 


10: 


s 


F 


D 


A 


Y 


Y 


C 


S 




A 






Fragment 


11: 


V 


Y 


P 


N 


M 


T 


V 


E 


S 


C 


A 


ss 


Fragment 


12: 


V 


D 


F 


A 


D 


I 


7 


W 









Tryptic Fragments 7 and 8 are noted to be substantially the same as Fragments 10 and 9, respectively 



7 



EP 0 313 578 B1 



A. bBMF-2 

Two probes consisting of pools of oligonucleotides are designed on the basis of the amino acid sequence of Frag- 
ment 3 and synthesized on an automated DNA synthesizer as described above. 

s 

Probe 41:ACNACCAT [A/G] T C [T/C] T G [A/G] A T 
Probe $2 : C A [A/G] G A [T/C] ATGGTNGTNGA 

These probes are radioactivety labeled and employed to screen the bovine genomic library constructed as follows: 
io Bovine liver DNA is partially digested with the restriction endonuclease enzyme Sau 3A and sedimented through a 
sucrose gradient. Size fractionated DNA in the range of 15-30kb is then ligated to the lambda J1 BamH1 arms vector 
[Frischauf et al, J. Mol. Biol. , 170:827-842 (1983) Mullins et al., Nature 308: 856-858 (1984)]. The library is plated at 
8000 recombinants per plate. Duplicate nitrocellulose replicas of the plaques are made and amplified according to a 
modification of the procedure of Woo et al, Proc. Natl. Acad. Sci. USA , 75:3688-91 (1978). 
is The radioactively labelled 17-mer Probe #1 is hybridized to the set of filters according. to the following method: 

The probe is kinased and hybridized to the other set of filters in 3M tetramethylammonium chloride (TMAC) , 0.1M 
sodium phosphate pH6.5, 1 mM EDTA, 5X Denhardts, 0.6% SDS, 1 0Oug/ml salmon sperm DNA at 48 degrees C, and 
washed in 3M TMAC, 50mM Tris pH8.0 at 50 degrees C. These conditions minimize the detection of mismatches to 
the probe pool [see, Wood et al, Proc. Natl. Acad. Sci, U.S.A. . 82:1585-1588 (1985)]. 400,000 recombinants are 
20 screened by this procedure. One duplicate positive is plaque purified and the DNA is isolated from a plate lysate of 
the recombinant bacteriophage designated lambda bP-21 . Bacteriophage bP-21 was deposited with the ATCC under 
accession number ATCC 40310 on March 6, 1987. The bP-21 clone encodes the bovine growth factor designated 
bBMP-2. 

The oligonucleotide hybridizing region of this bBMP-2 clone is localized to an approximately 1 .2 kb Sac I restriction 
25 fragment which is subcloned into Ml 3 and sequenced by standard techniques. The partial DNA sequence and derived 
amino acid sequence of this Sac I fragment and the contiguous Hind Ill-Sac I restriction fragment of bP-21 are shown 
below in Table II. The bBMP-2 peptide sequence from this clone is 129 amino acids in length and is encoded by the 
DNA sequence from nucleotide #1 through nucleotide #387. The amino acid sequence corresponding to the tryptic 
fragment isolated from the bovine bone 28 to 30kd material is underlined in Table II. The underlined portion of the 
30 sequence corresponds to tryptic Fragment 3 above from which the oligonucleotide probes for bBMP-2 are designed. 
The predicted amino acid sequence indicates that tryptic Fragment 3 is preceded by a basic residue (K) as expected 
considering the specificity of trypsin. The arginine residue encoded by the CGT triplet is presumed to be the carboxy- 
terminus of the protein based on the presence of a stop codon (TAG) adjacent to it. 

35 



40 



45 



SO 



55 



8 



EP 0 313 578 B1 



10 



15 



20 



25 



30 



35 



TABLE II 

(1) 15 30 45 

GGC CAC GAT GGG AAA GGA CAC CCT CTC CAC AGA AGA GAA AAG CGG 
GHDGXGHPLHHR.SXR 

60 . 75 90 

CAA GCA AAA CAC AAA CAG CGG AAA CGC CTC AAG TCC AGC TGT AAG 
QAKHXQRKRLKSSCK 

105 120 135 

aga cac cct tta tat gtg gac ttc agt gat gtg ggg tgg aat gac 
rhply'vdfs.dvgwhd 

150 165 180 

TGG ATC GTT GCA CCG CCG GGG TAT CAT GCC TTT TAC TGC CAT GGG 
WIVAPPG YH A F Y C H G 

195 -210 225 

GAG TGC CCT TTT CCC CTG GCC GAT CAC CTT AAC TCC ACG AAT CAT 
ECPFPLAD H L N S T N H 

240 255 270 

GCC ATT CTC CAA ACT CTG : GTC AaC TCA GTT AAC TCT AAG ATT CCC 
AIVQTLVNSV KSKIP 

38-5 300 315 

AAG GCA TGC TGT GTC CCA ACA GAG CTC AGC GCC ATC TCC ATG CTG 
KACCVPTELSA. ISML 

330 345 360 

TAC CTT GAT GAG AAT GAG AAG GTG GTA TTA AAG AAC TAT CAG GAC 
Y L D E N E K V V L K N Y O D 

375 (129) 397 407 

ATG GTT GTC GAG GGT TGT GGG TGT CGT TAG CAC AG CA AAATAAAATA 
M V V E G C G C R 

417 427 437 447 457 

TAAATATATA TATATATATA TTAGAAAAAC AGCAAAAAAA TCAAGTTGAC 

467 477 487 497 507 

ACTTTAATAT TTCCCAATGA AGACTTTATT TATGGAATGG AATGGAGAAA 

517 527 537 547 557 

AAGAAAAACA CAGCTATTTT GAAAACTATA TTTATATCTA CCGAAAAGAA 



40 



567 577 587 

GTTGGGAAAA CAAATATTTT AATCAGAGAA TTATT 



45 



EXAMPLE V 



Human Bone Inductive Factors 



A. hBMP-2: Class I and II 



so The Hindlll-Sacl bovine genomic bBMP-2 fragment described in Example IV A. is subcloned into an M1 3 vector. 

A 32 p-labeled single -stranded DNA probe is made from a template preparation of this subclone. This probe is used to 
screen polyadenylated RNAs from various cell and tissue sources. 

Polyadenylated RNAs from various cell and tissue sources are elect rophoresed on formaldehyde-agarose gels 
and transferred to nitrocellulose by the method of Toole et al., supra . The probe is then hybridized to the nitrocellulose 

55 blot in 50% formamide, 5 X SSC, 0.1% SDS, 40 mM sodium phosphate pH6.5, 100 ng/ml denatured salmon sperm 
DNA : and 5 mM vanadyl ribonucleosides at 42° C overnight and washed at 65° C in 0.2 XSSC, 0.1% SDS. Following 
autoradiography, a hybridizing band corresponding to an mRNA species of approximately 3.8 kb is detected in the lane 
containing RNA from the human cell line U-2 OS. The Hindlll-Sacl fragment is labeled with 32 P by nick translation and 



9 



EP 0 313 578 B1 



used to screen the nitrocellulose filter replicas ol a U-2 OS cDNA library by hybridization in standard hybridization 
buffer at 65° overnight followed by washing in 1 X SSC, 0.1% SDS at 65°. 

This library was constructed by synthesizing cDNA from U-2 OS polyadenylated RNA and cloning into lambda 
gt10 by established techniques (Toole et aL supra ). Twelve duplicate positive clones are picked and replated for sec- 

5 ondaries. Duplicate nitrocellulose replicas are made of the secondary plates and both sets hybridized to the bovine 
genomic probe as the primary screening was performed. One set of filters is then washed in 1 X SSC, 0.1% SDS; the 
other in 0.1 X SSC, 0.1% SDS at 65°. 

Two classes of hBMP-2 cDNA clones are evident based on strong (4 recombinants) or weak (7 recombinants) 
hybridization signals under the more stringent washing conditions (0.1 X SSC, 0.1% SDS). All 11 recombinant bacle- 

io riophages are plaque purified, small scale DNA preparations made from plate lysates of each, and the inserts subcloned 
into pSP65 and into Ml 3 for sequence analysis. Sequence analysis of the strongly hybridizing clones designated 
hBHP-2 Class I (also known as BMP-2) indicates that they have extensive sequence homology with the sequence 
given in Table II. These clones are therefore cDNA encoding the human equivalent of the protein encoded by the 
bBMP-2 gene whose partial sequence is given in Table II. Sequence analysis of the weakly hybridizing recombinants 

is designated hBMP-2 Class II (also known as BMP-4) indicates that they are also quite homologous with the sequence 
given in Table II at the 3' end of their coding regions, but less so in the more 5' regions. Thus they encode a human 
protein of similar, though not identical, structure to that above. 

Full length hBMP-2 Class I cDNA clones are obtained in the following manner. The 1 .5 kb insert of one of the Class 
II subclones (11-10-1) is isolated and radioactively labeled by nick-translation. One set of the nitrocellulose replicas of 

20 the U-2 OS cDNA library screened above (50 filters, corresponding to 1 ,000,000 recombinant bacteriophage) is rehy- 
bridized with this probe under stringent conditions (hybridization at 65° in standard hybridization buffer; washing at 65° 
in 0.2 X SSC, 0.1% SDS). All recombinants which hybridize to the bovine genomic probe which do not hybridize to the 
Class II probe are picked and plaque purified (10 recombinants). Plate stocks are made and small scale bacteriophage 
DNA preparations made. After subcloning into M1 3, sequence analysis indicates that 4 of these represent clones which 

25 overlap the original Class I clone. One of these, lambda U20S-39, contains an approximately 1.5 kb insert and was 
deposited with the ATCC on June 1 6 t 1 987 under accession number 40345. The partial DNA sequence (compiled from 
lambda U20S-39 and several other hBMP-2 Class I cDNA recombinants) and derived amino acid sequence are shown 
below in Table III. Lambda U20S-39 is expected to contain all of the nucleotide sequence necessary to encode the 
entire human counterpart of the protein BMP-2 Class I encoded by the bovine gene segment whose partial sequence 

30 is presented in Table II. This human cDNA hBMP-2 Class I contains an open reading frame of 1188 bp, encoding a 
protein of 396 amino acids. This protein of 396 amino acids has a molecular weight of 45kd based on this amino acid 
sequence. It is contemplated that this sequence represents the primary translation product. The protein is preceded 
by a 5' untranslated region of 342 bp with stop codons in all frames. The 1 3 bp region preceding this 5* untranslated 
region represents a linker used in the cDNA cloning procedure. 

35 



40 



45 



50 



55 



10 



EP 0 313 578 B1 



TABLE III 



10 20 30 4 0 50 60 70 

GTOSACTCIA GAGTCIUICT CAGCACITGG CTQOGGkCTT CITGAACITG CAGGGAGAAT AACTTGOGCA 

io 80 90 100 110 120 130 140 

ccccacittg ogcoggigcc tttcooocag oggagccigc ticgccatct cogagcocca oogococtcc 

150 160 170 180 190 200 210 

15 ACTCCTCCGC CTIGCCOGAC AOGAGAOGC TGTICCCAGC GIGAAAAGAG AGACIGOGOG GCOGGCACOC 

220 230 240 250 260 270 280 

GGGAGAAGGA GGAGGCAAAG AAAAGGAAOG GACATTOGGT OdTGOGCCA GGTOCTTTGA OCAGAGTTIT 

20 

29-0 300 31-0 320 330 340 350 

TCCATGIGGA CGCTCITTCA ATGGACGTCT COCOGOGIGC TICITAGAOG GACTCOGGTC TCCTAAAGCT 

25 (1) 370 385 400 

OGAOC ATG GIG GOC GGG AOC OGC TGT CTT CIA GOG TIG CTC CTT CCC CAG GTC 
MET Val Ala Gly Ihr Arg Cys leu Leu Ala Leu Leu Leu Pro Gin Val 



30 



35 



415 430 445 

CTC CIG GGC GGC GOG GCT GGC CTC GIT COG GAG CIG GGC OGC AGG AAG TIC GOG 
Leu leu Gly Gly Ala Ala Gly Leu Val Pro Glu Leu Gly Arg Arg Lys Phe Ala 

460 475 490 505 

GOG GOG TOG TCG GGC OGC CCC TCA TOC CAG CCC TCP GAC GAG GTC CIG AGC GAG 
Ala Ala Ser Ser Gly Arg Pro Ser Ser Gin Pro Ser Asp Glu Val Leu Ser Glu 

520 535 550 565 

TTC GAG TIG OGG CIG CTC AGC ATC TTC GGC CIG AAA CAG AGA CCC AGC CCC AGC 
.Hie Glu Leu Arg Leu Leu Ser MET Rie Gly Leu Lys Gin Arg Pro Uir Pro Ser 

40 580 595 610 

AGG GAC GCC GIG GIG CCC CCC TAC AIG CCA GAC CIG TAT GGC AGG CAC TOG GGT 
Arg Asp Ala Val Val Pro Pro Tyr MET Leu Asp Leu Tyr Arg Arg His Ser Gly 

625 640 655 670 

4S CAG COG GGC TCA CCC GCC CCA GAC CAC GGG TIG GAG AGG GCA GCC AGC OGA GCC 
Gin Pro Gly Ser Pro Ala Pro Asp His Arg Leu Glu Arg Ala Ala Ser Arg Ala 

685 700 715 

AAC ACT GTG CGC AGC TTC CAC CAT GAA GAA TCT TIG GAA GAA CIA CCA GAA AGG 
50 Asn Ihr Val Arg Ser Phe His His Glu Glu Ser Leu Glu Glu Leu Pro Glu Hir 



55 



11 



EP 0 313 578 B1 





730 








745 


760 






775 








nol 




AAA ALA 


AUU 


QQG AGA 


TTC TIC TIT AAT 


TEA 


ACT TCI ATC 


CCC 


AOG 


GAG 




Ser 


Gly 


Lys Thr 


Ohr 


Arg Arg 


Phe Rie Phe Asn 


Leu 


Ser Ser He 


Pro 


Thr 


Glu 


5 






790 






805 




820 






835 






TIT 


ATC ACC 


TCA 


GCA GAG 


CTT CAG GIT TIC 


GGA 


GAA CAG ATC 


CAA 


GAT 


GCT 




Glu 


Hie 


lie ihr 


Ser 


Ala Glu 


leu Gin Val Phe 


Aru 


Glu Gin MET 


Gin 


Asp 


Ala 










850 




865 




880 








10 


TEA 




AAL, AAT 


AGC 


ACT TIC 


CAT CAC CGA ATT 


AAT 


ATT TAT GAA 


ATC 


ATA 


AAA 




leu 


Gly 


Asn Asn 


Ser 


Ser Phe 


His His Arg He 


Asn 


He IVr Glu 


He 


He 


lys 




OCT 


895 






910 




925 






940 






GCA 


ACA GOC 


AAC 


TOG AAA 


TIC CCC GIG ACC 


ACT 


CTT TIG GAC 


ACC 


AGG 


TTC 


15 


Pro 


Ala 


Thr Ala 


Asn 


Ser lys 


Hie Pro Val Ihr 


Ser 


Leu Leu Asp 


Thr 


Aig 


Toil 




GTC 




955 






970 




985 










AAT 


CAG AAT 


GCA 


AGC AGG 


TGG GAA ACT TIT 


GAT 


GTC ACC CCC 


GCT 


GTC 


ATC 




Val 


Asn 


Gin Asn 


Ala 


Ser Arg 


Trp Glu Ser Phe 


Asp 


Val Ihr Pro 


Ala 


Val 


MET 


20 


1000 




1015 


1030 




1045 








CGG TCG 


ACT GCA 


CAG GGA CAC 


GOC AAC CAT GGA 


TIC 


GTC GIG GAA GTC 


GCC 


CAC 



Arg Trp Ihr Ala Gin Gly His Ala Asn His Gly Phe Val Val Glu Val Ala His 

1060 1075 1090 HQS 

TIG GAG GAG AAA CAA. GCT GIC TOC AAG AGA CAT GIT AGG ATA AGC AGG TCT TIG 
■ Leu Glu Glu lys Gin Gly Val Ser Lys Arg His Val* Arg He Ser"Arg r Sef Leu' 

H20 1135 1150 

CAC CAA GAT GAA CAC AGC TGG TCA CAG ATA AGG CCA TTC CTA CTA ACT TTT GGC 
His Gin Asp Glu His Ser Trp Ser Gin He Arg Pro Leu Leu Val Ihr Fhe Gly 

H65 H80 H95 1210 

CAT GAT GGA AAA GGG CAT OCT CTC CAC AAA AGA GAA AAA OCT CAA GOC AAA CAC 
His Asp Gly Lys Gly His Pro Leu His lys Arg Glu Lys Arg Gin Ala lys His 

1225 1240 1255 

AAA CAG OGG AAA OGC CIT AAG TOC AGC TCT AAG AGA CAC OCT TTC TAC GTC GAC 
Lys Gin Arg Lys Arg Leu lys Ser Ser Cys Lys Arg His Pro Leu iyr Val Asp 

40 1270 1285 1300 1315 

•TIC ACT GAC GIG GGG TCG AAT GAC TCG ATT GTC GCT CCC OCG GGG TAT CAC GCC 
Fhe Ser Asp Val Gly Trp Asn Asp Trp He Val Ala Pro Pro Gly iyr His Ala 



25 



30 



35 



45 



50 



1330 1345 1360 1375 

TIT TAC TCC CAC GGA GAA TCC OCT TIT OCT CTC GCT GAT CAT CPS AAC TCC ACT 
Hie Tyr Cys His Gly Glu Cys Pro Hie Pro Leu Ala Asp His Leu Asn Ser Ihr 

1390 1405 1420 

AAT CAT GOC ATT GTT CAG AOG TTC GIC AAC TCT GCT AAC TCT AAG ATT CCT AAG 
Asn His Ala He Val Gin Ihr Leu Val Asn Ser Val Asn Ser Lys He Pro Lys 



55 



12 



EP 0 313 578 B1 



1435 1450 . 1465 1480 

GCA TGC TCT GTC COG ACA GAA CTC AGT GCT ATC TOG ATG CIG TkC CTT GAC GAG 
Ala cys cys Val Pro Thr Glu Leu Ser Ala lie Ser MET Leu Oyr Leu Asp Glu 

1495 1510 1525 

AAT GAA AAG GIT CTA TTA AAG AAC TAT CAG GAC AIG GOT GIG GAG GGT TCI GGG 
Asn Glu Lys Val Val Leu Lys Asn Tyr Gin Asp MET Val Val Glu Gly Cys Gly 

1540(396) 1553 1563 1573 1583 159 3 1603 

TCP CGC TACTACAGCA AAATIAAA3A CA3AAATATA TAIAIAIATA TATA1TTTAG AAAAAAGAAA 
cys Arg 



AAAA 



Full-length hBMP-2Class II human cDNA clones are obtained in the following manner. The 200 bp EcoRI-SacI 
fragment from the 5' end of the Class II recombinant 11-10-1 is isolated from its plasmid subclone, labeled by nick- 
translation, and hybridized to a set of duplicate nitrocellulose replicas ol the U-2 OS cDNA library (25 filters/set; rep- 
resenting 500,000 recombinants). Hybridization and washing are performed under stringent conditions as described 
above. 16 duplicate positives are picked and replated for secondaries. Nitrocellulose filter replicas of the secondary 
plates are made and hybridized to an oligonucleotide which was synthesized to correspond to the sequence of 11-10-1 
and is of the following sequence: 

CGGGCGCTCAGGATACTCAAGACCAGTGCTG 

Hybridization is in standard hybridization buffer at 50°C with washing at 50° in 1 X SSC, 0.1% SDS. 14 recombinant 
bacteriophages which hybridize to this oligonucleotide are plaque purified. Plate stocks are made and small scale 
bacteriophage DNA preparations made. After subcloning 3 of these into M13, sequence analysis indicates that they 
represent clones which overlap the original Class II clone. One of these, lambda U20S-3, was deposited with the ATCC 
under accession number 40342 on June 1 6, 1 987. U20S-3 contains an insert of approximately 1 .8 kb. The partial DNA 
sequence and derived amino acid sequence of U20S-3 are shown below in Table IV. This clone is expected to contain 
all of the nucleotide sequence necessary to encode the entire human BMP-2 Class II protein. This cDNA contains an 
open reading frame of 1224 bp, encoding a protein of 408 amino acids, preceded by a 5* untranslated region of 394 
bp with stop codons in all frames, and contains a 3' untranslated region of 308 bp following the in-frame stop codon. 
The 8 bp region preceding the 5' untranslated region represents a linker used in the cDNA cloning procedure. This 
protein of 408 amino acids has molecular weight of 47kd and is contemplated to represent the primary translation 
product. 



13 



EP 0 313 578 B1 



TABLE IV 

10 20 30 40 50 60 70 

CTCIAGAGGG CAGAGGAGGA GGGAGGGAGG GAAGGAGOGC GGAGCCOGGC COGGAAGCTA GGTCAGIGTG 

80 90 100 110 120 130 140 

GCATOOGAGC TGAGGGAOGC GAGCCTGAGA OGCOGCTCCT GCTOOGGCTC AGTATCTAGC TIGTCTOOCC 

150 160 170 180 190 200 210 

GATGGGAITC OOGTOCAAGC TATCTOGAGC CTGCAGOGCC ACAGTOOOOG GCCCTOGOOC AGGTTCACIG 

220 230 240 250 260 270 280 

CAAOOGITCA GAGGTOCOCA GGAGCIGCTG CTCGOGAGOC CGCIACIGCA GGGACCTATC GAGCCATTCC 

290 300 310 320 330 340 350 

CTAGIGOCAT CXXEAGCAAC GCACTGCTGC AGCTTCOCIG AGCCITKXA GCAAGITTCT TCAAGATTGG 

360 370 580 390 400 (1) 

CIGTCAAGAA TCATCGACTG TTATIATATC CCTICTTITC TGTCAAGACA CC ATG ATT OCT 

MET. He Pro 

417 432 447 462 

GCT AAC OGA ATS CIG ATG GTC GIT TTA TTA TGC CAA GTC CIG CXh GGA GGC GOG 
Gly Asn Arg MET Leu MET Val Val Leu Leu Cys Gin Val Leu Leu Gly Gly Ala 

477 492 507 

AGC CAT GCT ACT TIG ATA OCT GAG AOS GGG AAG AAA AAA GTC GOC GAG AIT CAG 
Ser His Ala Ser Leu lie Pro Glu Tfcr Gly Lys Lys Lys Val Ala Glu He Gin 

35 522 537 552 567 

GGC CAC GOG GGA GGA OGC OGC TCA GGG CAG AGC CAT GAG CTC CIG GGG GAC TIC 
Gly His Ala Gly Gly Arg Arg Ser Gly Gin Ser His Glu Leu Leu Arg Asp Phe 

582 597 612 627 

40 GAG GOG ACA CTT CIG CAG ATG TIT GGG CIG OGC OGC OGC COG CAG OCT AGC AAG 

-Glu Ala Thr Leu leu Gin MET Rie Gly Leu Arg Arg Arg Pro Gin Pro Ser lys 

642 657 672 

AGT GOC GTC ATT COG GAC TAC ATC OGG GAT CTT TAG OGG CTT CAG TCP GGG GAG 
45 Ser Ala Val He Pro Asp Tyr MET Arg Asp Leu Tyr Arg Leu Gin Ser Gly Glu 

687 702 717 732 

GAG GAG GAA GAG CAG ATC CAQ AGC ACT GCT CTT GAG TAT CCT GAG GGC GOG GOC 
Glu Glu Glu Glu Gin He His Ser Uir Gly Leu Glu Tyr Pro Glu Arg Pro Ala 

so 



10 



15 



20 



25 



30 



55 



14 



EP 0 313 578 B1 



747 762 777 

AGC OGG GCC AAC AOC GIG AGG AGC TIC CAC CAC GAA GAA CAT CIG GAG AAC ATC 
Ser Arg Ala Asn Thr Val Arg Ser Phe His His Glu Glu His Leu Glu Asn He 

792 807 822 837 

OCA GGG ACC AGT GAA AAC TCI GCT TIT OCT TIC CTC TIT AAC CTC AGC AGC ATC 

Pro Gly Thr Ser Glu Asn Ser Ala Hie Arg Hie Leu Hie Asn Leu Ser Ser lie 

852 867 882 897 

OCT GAG AAC GAG GTS ATC TCC TCT GCA GAG CTT OGG CTC TIC OGG GAG CAG GTS 
Pro Glu Asn Glu Val lie Ser Ser Ala Glu Leu Arg Leu Hie Arg Glu Gin Val 

912 927 942 

GAC CAG GGC OCT GAT TOG GAA AGG GGC TIC CAC OGT ATA AAC ATT TAT GAG GIT 
Asp Gin Gly Pro Asp Trp Glu Arg Gly Hie His Arg He Asn lie Tyr Glu Val 

957 972 987 1002 

ATC AAG COC CCA GCA GAA GTC GTC OCT GGG CAC CTC ATC ACA OGA CTA CTC GAC 
MET lys Pro Pro Ala Glu Val Val Pro Gly His Leu lie Thr Arg Leu Leu Asp 

1017 1032 1047 

AOG AGA CTC GTC CAC CAC AAT GTC ACA OGG TCG GAA ACT TIT GAT GTC AGC OCT 
. 111?:. Arg leu Val His. His Am Val ^to. Arg^.Tcp. Gly t# Bir-Phe .Asp Val Ser 4*p. 

106 2 1077 1092 1107 

GOG GTC CTT OGC TCG AOC OGG GAG . AAG.,_CAG .CCA AAC TAT GGG CTA . GOC. ATT GAG - 

Ala Val leu Arg Trp Thr Arg Glu Lys Gin Pro Asn Tyr Gly" Leu Ala ' lie Glu 

H22 H37 1152 1167 

GIG ACT CAC CTC CAT CAG ACT OGG AOC CAC CAG GGC CAG CAT GTC AGG ATT' AGC 
Val Thr His Leu His Gin Thr Arg Thr His Glu Gly Gin His Val Arg lie Ser 

1182 1197 1212 

OGA TOG TTA OCT CAA GGG AGT GGG AAT TCG GCC CAG CTC OGG COC CTC CIG GIC 
Arg Ser leu Pro Gin Gly Ser Gly Asn Trp Ala Gin Leu Arg Pro Leu Leu Val 

!227 1242 1257 1272 

ACC TIT GGC CAT GAT GGC GGG GGC CAT GCC TTC AOC OGA OGC OGG AGG GOC AAG 
Thr Hie Gly His Asp Gly Arg Gly His Ala Leu Thr Arg Arg Arg Arg Ala lys 

1287 1302 1317 

OGT AGC CCT AAG CAT CAC TCA CAG OGG GCC AGG AAG AAG AAT AAG AAC TCC GGG 
Arg Ser Pro lys His His Ser Gin Arg Ala Arg Lys Lys Asn Lys Asn Cys Arg 

1332 1347 1362 1377 

OGC CAC TCG CTC TAT GTC GAC TIC AGC GAT GIG GGC TCG AAT GAC TCG ATT GIG 

Arg His Ser Leu lyr Val Asp Hie Ser Asp Val Gly Trp Asn Asp Trp lie Val 

1392 1407 1422 1437 

GCC OCA CCA GGC TAC CAG GCC TIC TAC TCC CAT GGG GAC TCC CCC TIT CCA CTC 
Ala Pro Pro Gly Tyr Gin Ala Rie Tyr Cys His Gly Asp Cys Pro Phe Pro Leu 



15 



EP 0 313 578 B1 



1452 1467 1482 

GCT GAC CAC CTC AAC TCA ACC AAC CAT GCC AIT GTG CAG AOC CTG GTC AAT TCP 
Ala Asp His Leu Asn Ser Thr Asm His Ala lie Val Gin Thr Leu Val Asn Ser 

1497 1512 1527 1542 

GTC AAT TCC ACT ATC CCC AAA GCC TCT TCT GIG CCC ACT GAA CTG ACT GCC ATC 
Val Asn Ser Ser lie Pro Lys Ala Cys Cys Val Pro Thr Glu Leu Ser Ala lie 

1557 1572 1587 

TCC ATC CIG TAC CTG GAT GAG TAT GAT AAG GTG GTA CTG AAA AAT TAT CAG GAG 
Ser MET Leu Tyr Leu Asp Glu iyr Asp lys Val Val Leu Lys Asn iyr Gin Glu 

1602 1617 (408) 1636 1646 1656 

ATG GEA CTA GAG GGA TCT GGG TCC OGC TGAGATCAGG CACTCCTTCA GGATAGACAG 
MET Val Val Glu Gly Cys Gly Cys Arg 

1666 1676 1686 1696 1706 1716 1726 

ATATACACAC CACACACACA CACCACAIAC ACCACACACA CACGTTCOCA TCCACTCACC CACACACTAC 



1736 1746 1756 1766 1776 . 1786 1796 

ACAGACIGCT TCCITATAGC T3GACTTTTA TTTAAAAAAA AAAAAAAAAA AATGGAAAAA ATOCCTAAAC 



25 1806 1816 1826 .... 1836 1846 1856 1866 

, ATTCAfXTIG ACXT[T?OTT^ .TG&CIJTACG' T©3^ATCIT TTGACCATAT .TGATCATKTA TITIGACAAA 



187 6 1886 1896 1906 1916 1926 1S36 

ATATATTTAT AACIAOGEAT TAAAAGAAAA AAATAAAATG AGTCATTA3T TTAAAAAAAA AAAAAAAACT 



1946 

CTAGAGTPOGA OGGAATTC 

35 

The sequences of BMP-2 Class I and II as shown in Tables II, III IV and have significant homology to the beta (B) 
and beta (A) subunits of the inhibins. The inhibins are a family of hormones which are presently being investigated for 
use in contraception. See, A. J. Mason et al, Nature , 318:659-663 (1985). To a lesser extent they are also homologous 
to Mullerian inhibiting substance (MIS), a testicular glycoprotein that causes regression of the Mullerian duct during 
40 development of the male embryo and transforming growth factor-beta (TGF-b) which can inhibit or stimulate growth 
of cells or cause them to differentiate. Furthermore, the sequence of Table IV encoding hBMP-2 Class II has significant 
homology to the Drosophila decapentaplegic (DPP-C) locus transcript. See, J. Massague, Cell, 49:437-438 (1987); R. 
W. Padgett etal, Nature, 325:81-84 (1987); R.L. Cate et al, CeH45: 685-698 (1986). It is considered possible therefore 
that BMP-2 Class II is the human homolog of the protein made from this transcript form this developmental mutant locus. 

45 

EXAMPLE VI 

Expression of Bone Inductive Factors, 

in order to produce bovine, human or other mammalian bone inductive factors, the DNA encoding it is transferred 
into an appropriate expression vector and introduced into mammalian cells by conventional genetic engineering tech- 
niques. 

One skilled in the art can construct mammalian expression vectors by employing the sequence of Tables II, III 
AND IV or other modified sequences and known vectors, such as pCD [Okayama et al., Mol. Cell Biol. , 2:161-170 
55 (1 982)] and pJL3, pJL4 [Gough et al., EMBO J., 4:645-653 (1 985)]. The transformation of these vectors into appropriate 
host cells can result in expression of osteoinductive factors. One skilled in the art could manipulate the sequences of 
Tables II, III and IV by eliminating or replacing the mammalian regulatory sequences flanking the coding sequence with 
bacterial sequences to create bacterial vectors for intracellular or extracellular expression by bacterial cells. For ex- 



16 



i 



EP 0 313 578 B1 



ample, the coding sequences could be further manipulated (e.g. ligated to other known linkers or modified by deleting 
non-coding sequences there-from or altering nucleotides therein by other known techniques). The modified bone in- 
ductive factor coding sequence could then be inserted into a known bacterial vector using procedures such as described 
in T. Taniguchi et aL, Proc. Natl Acad. Sci. USA , 77:5230-5233 (1 980). This exemplary bacterial vector could then be 

5 transformed into bacterial host cells and bone inductive factor expressed thereby. For a strategy for producing extra- 
cellular expression of bone inductive factor in bacterial cells., see, e.g. European patent application EPA 177,343. 

Similar manipulations can be performed for the construction of an insect vector [see, e.g. procedures described 
in published European patent application 155,476] for expression in insect cells. A yeast vector could also be con- 
structed employing yeast regulatory sequences for intracellular or extracellular expression of the factors of the present 

io invention by yeast cells. [See, e.g., procedures described in published PCT application W086/00639 and European 
patent application EPA 123,289]. 

A method for producing high levels of an osteoinductive factor of the invention from mammalian cells involves the 
construction of cells containing multiple copies of the heterologous bone inductive factor gene. The heterologous gene 
can be linked to an amplifiable marker, e.g. the dihydrofolate reductase (DHFR) gene tor which cells containing in- 

15 creased gene copies can be selected tor propagation in increasing concentrations of methotrexate (MTX) according 
to the procedures of Kaufman and Sharp, J. Mol. Biol. , 159:601-629 (1982). This approach can be employed with a 
number of different cell types. 

For example, a plasmid containing a DNA sequence for a bone inductive factor of the invention in operative as- 
sociation with other plasmid sequences enabling expression thereof and the DHFR expression plasmid pAdA26SV(A) 

20 3 [Kaufman and Sharp, Mol. Cell. Biol. , 2:1304 (1982)] can be co-introduced into DHFR-deficient CHO cells, DUKX- 
Bll, by calcium phosphate coprecipitation and transfection. DHFR expressing transformants are selected for growth in 
alpha media with dialyzed fetal calf serum, and subsequently selected for amplification by growth in increasing con- 
centrations of MTX (sequential steps in 0.02, 0.2, 1 .0 and 5uM MTX) as described in Kaufman et al., Mol Cell Biol. , 5: 
1750 (1983). Transformants are cloned, and biologically active bone inductive factor expression is monitored by rat 

2S bone formation assay. Bone inductive factor expression should increase with increasing levels of MTX resistance. 
Similar procedures can be followed to produce other bone inductive factors. 

Alternatively, the human gene is expressed directly, as described above. Active bone inductive factor may be 
produced in bacteria or yeast cells. However the presently preferred expression system for biologically active recom- 
binant human bone inductive factor is stably transformed CHO cells. 

30 As one specific example, to produce the human bone inductive factor (hBMP-1 ) of Example V, the insert of U20S- 

1 is released from the vector arms by digestion with Sal I and subcloned into the mammalian expression vector pMT2CX 
digested with Xho I. Plasmid DNA from this subclone is transfected into COS cells by the DEAE<textran procedure 
[Sompayrac and Danna PNAS 78:7575-7578 (1981); Luthman and Magnusson, Nucl.Acids Res . 11: 1295-1308 
(1983)]. Serum-free 24 hr. conditioned medium is collected from the cells starting 40-70 hr. post-transfection. 

35 The mammalian expression vector pMT2 Cla-Xho (pMT2 CX) is a derivative of p91023 (b) (Wong et al., Science 

228:810-815, 1985) differing from the latter in that it contains the ampicillin resistance gene in place of the tetracycline 
resistance gene and further contains a Xhol site for insertion of cDNA clones. The functional elements of pMT2 Cla- 
Xho have been described (Kaufman, R.J., 1985, Proc. Natl. Acad. Sci. USA 82:689-693) and include the adenovirus 
VA genes, the SV40 origin of replication including the 72 bp enhancer, the adenovirus major late promoter including a 

40 5' splice site and the majority of the adenovirus tripartite leader sequence present on adenovirus late mRNAs, a 3' 
splice acceptor site, a DHFR insert, the SV40 early polyadenylation site (SV40), and pBR322 sequences needed for 
propagation in E. coli . 

Plasmid pMT2 Cla-Xho is obtained by EcoRI digestion of pMT2-VWF, which has been deposited with the American 
Type Culture Collection (ATCC), Rockville,.MD (USA) under accession number ATCC67122. EcoRI digestion excises 

4$ the cDNA insert present in pMT2-VWF, yielding pMT2 in linear form which can be ligated and used to transform E. coli 
HB 101 or DH-5 to ampicillin resistance. Plasmid pMT2 DNA can be prepared by conventional methods. pMT2CX is 
then constructed by digesting pMT2 with Eco RV and Xbal, treating the digested DNA with Klenow fragment of DNA 
polymerase I, and ligating Cla linkers (NEBiolabs, CATCGATG). This removes bases 2266 to 2421 starting from the 
Hind III site near the SV40 origin of replication and enhancer sequences of pMT2. Plasmid DNA is then digested with 

so EcoRI , blunted as above, and ligated to an EcoRI adapter, 

5' PO4 -AATTCCTCGAGAGCT 3' 

55 3 ' GGAG CTCTCGA 5 1 

digested with Xhol, and ligated, yielding pMT2 Cla-Xho, which may then be used to transform E. coM to ampicillin 
resistance. Plasmid pMT2 Cla-Xho DNA may be prepared by conventional methods. 



17 



i 



EP 0 313 578 B1 



10 



15 



20 



25 



30 



35 



Example VII 

Biological Activity of Expressed Bone Inductive Factor 
A. BMP-1 

To measure the biological activity of the expressed bone inductive factor. (hBMP-1 ) obtained in Example VI above. 
The factor is partially purified on a Heparin Sepharose column. 4 ml of transfection supernatant from one 100 mm dish 
is concentrated approximately 10 fold by ultrafiltration on a YM 10 membrane and then dialyzed against 20mM Tris, 
0.15 M NaCI, pH 7.4 (starting buffer). This material is then applied to a 1.1 ml Heparin Sepharose column in starting 
buffer. Unbound proteins are removed by an 8 ml wash of starting buffer, and bound proteins, including BMP-1, are 
desorbed by a 3-4 ml wash of 20 mM Tris, 2.0 M NaCI, pH 7.4. 

The proteins bound by the Heparin column are concentrated approximately 10-fold on a Centricon 10 and the salt 
reduced by diafiltration with 0.1% trifluoroacetic acid. The appropriate amount of this solution is mixed with 20 mg of 
rat matrix and then assayed for in vivo bone and cartilage formation as previously described in Example III. A mock 
transfection supernatant fractionation is used as a control. 

The implants containing rat matrix to which specific amounts of human BMP-1 have been added are removed from 
rats after seven days and processed for histological evaluation. Representative sections from each implant are stained 
for the presence of new bone mineral with von Kossa and acid fuschin, and for the presence of cartilage-specific matrix 
formation using toluidine blue. The types of cells present within the section, as well as the extent to which these cells 
display phenotype are evaluated. 

Addition of human BMP-1 to the matrix material resulted in formation of cartilage-like nodules at 7 days post 
implantation. The chondroblast-type cells were recognizable by shape and expression of metachromatic matrix. The 
amount of activity observed for human BMP-1 was dependent upon the amount of human BMP-1 protein added to the 
matrix. Table IX illustrates the dose-response relationship of human BMP-1 protein to the amount of bone induction 
observed. 

Table IX 



IMPLANT NUMBER 


AMOUNT USED (equivalent of ml transfection media) 


HISTOLOGICAL SCORE 


876-134-1 


10 BMP-1 


C+2 


876-134-2 


3 BMP-1 


C+1 


876-134-3 


1 BMP-1 


C+/- 


876-134-4 


10 MOCK 


C- 


876-134-5 


3 MOCK 


C- 


876-134-6 


1 MOCK 


C- 



40 



45 



Cartilage (c) activity was scored on a scale from 0(-) to 5. 

Similar levels of activity are seen in the Heparin Sepharose fractionated COS cell extracts. Partial purification is 
accomplished in a similar manner as described above except that 6 M urea is included in all the buffers. Further, in a 
rat bone formation assay as described above, BMP-2 has similarly demonstrated chondrogenic activity. 

The procedures described above may be employed to isolate other bone inductive factors of interest by utilizing 
the bovine bone inductive factors and/or human bone inductive factors as a probe source. Such other bone inductive 
factors may find similar utility in, inter alia, fracture repair. 

The foregoing descriptions detail presently preferred embodiments of the present invention. Numerous modifica- 
tions and variations in practice thereof are expected to occur to those skilled in the art upon consideration of these 
descriptions. Those modifications and variations are believed to be encompassed within the claims appended hereto. 



so 



Claims 



55 



Claims for the following Contracting States: BE, CH, DE, FR, GB, IT, LI, LU, NL, SE 

1. A gene encoding human BMP-2 comprising the following DNA sequence: 



18 



EP 0 313 578 B1 



!0 20 30 40 50 60 70 

GTOGACTCIA GAGTCTCTGT CAGCACITCG CTGGGGACTT CTTCAACTIG CAGGGAGAAT AAdTCCGCA 

80 90 100 110 120 130 140 

ccccAcnrc ogooggigoc tttcocccag oggagocigc ttogocatct cogagococa COGCOOCTCC 

iSO 160 170 180 190 200 210 

ACTCCTOGGC CTTCCCCGAC ACTGAGAOGC TCTTCCCAGC GTCAAAAGAG AGACTCOGOG GOCGGCACCC 

220 2 30 240 250 260 270 280 

GGGAGAAGGA GGAGGCAAAG AAAAGGAACG GACAITOGCT CCITCGGCCA GGTCCTITCA CCAGAGITTT 

. -, 4 - 29.0- ■•.:--3 QQ.,... 310^- - -•■ 320 ■ *330'< ' 340 ^ • • • -350- : 

TCCATCTCGA CGCTCITTCA ATGGAOGTCT CTCOGOGTCC TTCTTAGAOG GACTCOGGTC TCCIAAAGGT 

W 370 385 400 

OGAOC ATC GTC GGC GGG AOC OGC TCT CIT CIA GOG TTG CTG CTT COC CAG GTC 
MET Val Ala Gly Thr Arg Cys Leu Leu Ala Leu Leu Leu Pro Gin Val 

415 430 445 

CTC CTG GGC GGC GOG GCT GGC CTC GTT OOG GAG CPG GGC OGC AGG AAG TTC GOG 
I*u Leu Gly Gly Ala Ala Gly Leu Val Pro Glu Leu Gly Arg Arg Lys Fhe Ala 

460 475 490 505 

GOG GOG TOG TOG GGC OGC OOC TCA TCC CAG CCC TCT GAC GAG GTC CTG AGC GAG 

Ala Ala Ser Ser Gly Arg Pro Ser Ser Gin Pro Ser Asp Glu Val Leu Ser Glu 

520 535 550 565 

TTC GAG TTG GGG CTC CTC AGC ATG TTC GGC CTG AAA CAG AGA CCC ACC CCC AGC 
Phe Glu Leu Arg Leu Leu Ser MET Rie Gly Leu Lys Gin Arg Pro Thr Pro Ser 

580 595 610 

AGG GAC GCC CTG GIG OOC OOC TAC ATC CTA GAC CTG TAT OGC AGG CAC TOG GCT 
Arg Asp Ala Val Val Pro Pro Tyr MET Leu Asp Leu iyr Arg Arg His Ser Gly 

625 640 655 670 

CAG COG GGC TCA COC GCC OCA GAC CAC OGG TTC GAG AGG GCA GCC AGC GGA COC 
Gin Pro Gly Ser Pro Ala Pro Asp His Arg Leu Glu Arg Ala Ala Ser Arg Ala 

685 700 715 

AAC ACT GTC OGC AGC TTC CAC CAT GAA GAA TCT TTG GAA GAA CTA CCA GAA AOS 
Asn Thr Val Arg Ser Fhe His His Glu Glu Ser Leu Glu Glu Leu Pro Glu Thr 



19 



EP 0 313 578 B1 



22 745 760 775 

ACT GGG AAA ACA AOC OGG AGA TTC TTC TTT AAT TTA AGT TCT ATC OCC AOG GAG 

Ser Gly Lys Thr Thr Arg Arg Phe Fhe Hie Asn Leu Ser Ser lie Pro Thr Glu 

790 805 820 " " ' ~ 835 

GAG TIT ATC AOC TCA GCA GAG CTT CAG GTT TTC OGA GAA CAG ATG CAA GAT GCT 
Glu Phe lie Thr Ser Ala Glu Leu Gin Val Phe Arg Glu Gin MET Gin Asp Ala 

rrm* 850 865 880 

TIA GGA AAC AAT AGC AGT TTC CAT CAC CGA ATT AAT ATT TAT GAA ATC ATA AAA 
Leu Gly Asn Asn Ser Ser Fhe His His Arg lie Asn lie Tyr Glu lie lie Lys 

895 910 925 940 

OCT GCA ACA GCC AAC TOG AAA TTC OCC GTG AOC AGT CTT TTG GAC AOC AGG TTG 
Pro Ala Thr Ala Asn Ser Lys Phe Pro Val Thr Ser Leu Leu Asp Thr Arg Leu 

955 970 985 

GTG AAT CAG AAT GCA AGC AGG TGG GAA AGT TTT GAT GTC AOC OCC GCT GTG ATG 
Val Asn Gin Asn Ala Ser Arg Trp Glu Ser Phe Asp Val Thr Pro Ala Val MET 

1000 1015 1030 1045 

^ ^ Ma Gll | Gly His Ala Asn His Gly Phe Val Val Glu Val Ala His 

1060 1075 1090 H05 

TTG GAG GAG AAA CAA GGT GTC TCC AAG AGA CAT GTT AGG ATA AGC AGG TCT TTG 
Leu Glu Glu Lys Gin Gly Val Ser Lys Arg His VaT Arg lie Ser Arg "Ser Leu 

U20 1135 H50 

5^ 5^ ^G ATA AGG CCA TTG CTA GTA ACT TTT GGC 

His Gin Asp Glu His Ser Trp Ser Gin He Arg Pro Leu Leu Val Thr Fhe Gly 

1165 ll 80 1195 1210 

CAT GAT GGA AAA GGG CAT OCT CTC CAC AAA AGA GAA AAA CGT CAA GCC AAA CAC 
His Asp Gly Lys Gly His Fro Leu His Lys Arg Glu Lys Arg Gin Ala Lys His 

1225 1240 1255 

AAA CAG OGG AAA CGC CTT AAG TOC AGC TGT AAG AGA CAC OCT TTG TAC GTG GAC 
Lys Gin Arg Lys Arg Leu Lys Ser Ser Cys Lys Arg His Pro Leu Tyr Val Asp 

H!° 1285 1300 1315 

■TTC AGT GAC GTG GGG TGG AAT GAC TGG ATT GTG GCT CCC COS GGG TAT CAC GCC 

Fhe Ser Asp Val Gly Trp Asn Asp Trp lie Val Ala Fro Pro Gly Tyr His Ala 

1330 1345 1360 1375 

TIT TAC TGC CAC GGA GAA TGC OCT TTT OCT CTG GCT GAT CAT CTG AAC TCC ACT 
Phe Tyr Cys His Gly Glu Cys Fro Phe Pro Leu Ala Asp His Leu Asn Ser Thr 

1390 1405 1420 

AAT CAT GCC ATT GTT CAG ACG TTG GTC AAC TCT GTT AAC TCT AAG ATT OCT AAG 
Asn His Ala He Val Gin Thr Leu Val Asn Ser Val Asn Ser Lys He Fro Lys 



20 



EP 0 313 578 B1 



1435 1450 . 1465 1480 

GCA TCC TCT GTC COG ACA GAA CDC ACT GCT AIC TOG ATC CTG TAC CTT GAC GAG 
Ala cys Cys Val Pro Ihr Glu Leu Ser Ala lie Ser MET Leu Tyr Leu Asp Glu 

1495 1510 1525 

AAT GAA AAG GTT GTA TTh AAG AAC TAT CAG GAC AIG GIT GTC GAG GCT TGT GGG 
Asn Glu Lys Val Val Leu Lys Asn lyr Gin Asp MET Val Val Glu Gly Cys Gly 

1540(396) 1553 1563 1573 1583 1593 1603 

1CT OGC TAG1ACAGCA AAATTAAAXA CATAAA3MA TATATAIAIA TATATTTTAG AAAAAAGAAA 

cys Arg 



AAAA 

A gene encoding human BMP-2 having the amino acid sequence given in claim 1 . 

A gene encoding a protein exhibiting properties of human BMP-2 and comprising a DNA sequence: 

(a) which differs from a DNA sequence of claim 1 in codon sequence due to the degeneracy of the genetic code; 

(b) which hybridises with a DNA sequence of claim 1 or section (a), above; or 

(c) represents a fragment, allelic or other variation of a DNA sequence of claim 1 , whether said variation results 
in changes in the peptide sequence or not. 

The DNA sequence of claim 3, which is a genomic DNA sequence. 

The DNA sequence of claim 3, which is a cDNA sequence. 

A gene encoding bovine BMP-2 comprising the following DNA sequence: 



21 



EP 0 313 578 B1 



(1) 15 30 45 

GGC CAC GAT GGG AAA GGA CAC CCT CTC CAC AGA AGA GAA AAG CGG 
GHDGKGHPLHRR EKR 

60 75 90 

CAA GCA AAA CAC AAA CAG CGG AAA CGC CTC AAG TCC AGC TGT AAG 
QAKHKQRKRLKSSCK 

105 120 135 

AGA CAC CCT TTA TAT GTG GAC TTC AGT GAT GTG GGG TGG AAT GAC 
RHPLYVDFSDVGWND 

150 165 180 

TGG ATC GTT GCA CCG CCG GGG TAT CAT GCC TTT TAC TGC CAT GGG 
W IVAPPGYH AFYCHG 

195 210 225 

GAG TGC CCT TTT CCC CTG GCC GAT CAC CTT AAC TCC ACG AAT CAT 
ECPF PLAD HLNSTNH 

240 255 270 

GCC ATT CTC CAA ACT "CTG : GTC AAC TCA GTT AAC TCI?" AAG ATT CCC 
AIVQTLV NSVNSKIP 

•. -v. 2ss r ; ' : '" : ""3bo' :lr "iis 

AAG GCA TGC TGT GTC CCA ACA GAG CTC AGC GCC ATC TCC ATG CTG 
KACCVP T ELS AISML 

330 345 360 

TAC CTT GAT GAG AAT GAG AAG GTG GTA TTA AAG AAC TAT CAG GAC 
Y L D E N E K V V L K N Y O P 

375 ' (129) 397 407 

ATG GTT GTC GAG GGT TGT GGG TGT CGT TAGCACAGCA AAATAAAATA 
M V V E G C G C R 

417 427 437 447 457 

TAAATATATA TATATATATA TTAGAAAAAC AGCAAAAAAA TCAAGTTGAC 

467 477 487 497 507 

ACTTTAATAT TTCCCAATGA AGACTTTATT TATGGAATGG AATGGAGAAA 

517 527 537 547 557 

AAGAAAAACA CAGCTATTTT GAAAACTATA TTTATATCTA CCGAAAAGAA 

567 577 587 

GTTGGGAAAA CAAATATTTT AATCAGAGAA TTATT 



A gene encoding bovine BMP-2 containing the amino acid sequence of claim 6. 

A gene encoding a protein exhibiting properties of bovine BMP-2 and comprising DNA sequences: 

(a) which differ from a DNA sequence of claim 7 in codon sequence due to the degeneracy of the genetic code; 

(b) which hybridise with a DNA sequence of claim 7 or section (a) t above; or 

(c) represent fragments, allelic or other variations of a DNA sequence of claim 7, whether said variations result 
in changes in the peptide sequence or not. 



22 



EP 0 313 578 B1 



9. The DNA sequence of claim 8, which is a genomic DNA sequence. 

10. The DNA sequence of claim 8, which is a cDNA sequence. 

5 11. A gene encoding human BMP-4 comprising the following DNA sequence: 

10 20 30 40 50 * 60 70 

CTCTAGAGGG CAGAGGAGGA GGGAGGGAGG GAAGGAGOGC GGAGO00GGC COGGMGCIA GGEXSAGTGTC 

10 

80 90 100 110 120 130 140 

GCATOOGAGC TCAGGGAOGC GAGCCTGAGA OGOOGCTCCT GCTOOGGCTG ACHaTCEAGC TTGTCICCCC 

150 160 170 180 190 200 210 

GATGGGAITC OOCTCCAAGC TATCTOGAGC CTGCAGOGOC ACAGTCC003 GOOCIOGOOC AGGTTCAC1G 

220 230 240 250 260 270 280 

20 CAAOOCTTCA GAGCTCOOCA GGAGCIGCIG CTGGOSAGOC OGCTACIGCA GGGAOCEATC GAGCCATTCC 

290 300 310 320 330 340 350 

CTAGTCCCAT OCX£?&CAAC GCACIGCTGC AGCTTCCCIG AGOCTCTOCA GCAAGTTTCT TCAAGATTCG 



75 



25 



30 



35 



40 



45 



SO 



55 



" 360 370 : ' f : 380 ' 390 "400 (lj 

CICTCAAGAA TCATOGACTG TEATTAIATC CCTTCTTTTC TGICAAGACA OC MG ATT OCT 

MET. lie Pro 



23 



EP 0 313 578 B1 



10 



15 



20 



25 



30 



35 



40 



45 



50 



55 



417 432 447 462 

GGT AAC GGA ATG CTG ATG GIC GIT TEA TEA TCC CAA GTC CIG CEA GGA GGC GOG 
Gly Asn Arg MET Leu MET Val Val Leu Leu Cys Gin Val Leu Leu Gly Gly Ala 

477 492 507 

AGC CAT GCT -AST TIG ATA (XT GAG AOS GGG AAG AAA AAA GIC GOC GAG ATT CAG 
Ser His Ala Ser Leu lie Pro Glu Thr Gly Lys Lys Lys Val Ala Glu lie Gin 

522 537 552 567 

GGC CAC GOG GGA GGA OGC OGC TCA GGG CAG AGC CAT GAG CTC CTG OGG GAC TIC 

Gly His Ala Gly Gly Arg Arg Ser Gly Gin Ser His Glu Leu Leu Arg Asp Phe 

582 597 612 627 

GAG GOG ACA CTT CIG CAG ATG TIT GGG GIG OGC OGC OGC GOG CAG OCT AGC AAG 
Glu Ala Thr Leu Leu Gin MET Hie Gly Leu Arg Arg Arg Pro Gin Pro Ser lys 

642 657 672 

ACT GCC GTC ATT O0G GAC TAC" ATC OGG GAT CTT TAC OGG CTT CAG TCT GGG GAG 
Ser Ala Val He Pro Asp Tyr MET Arg Asp Leu Tyr Arg Leu Gin Ser Gly Glu 

687 702 717 732 

GAG GAG GAA GAG CAG ATC CAC AGC ACT GGT CTT GAG TAT CCT GAG GGC OGG GOC 
Glu Glu Glu Glu Gin He His Ser Thr Gly leu Glu Tyr Pro Glu Arg Pro Ala 

747 762 " 777 

AGC GGG GOC AAC AOC GIG AGG AGC TIC CAC CAC GAA GAA CAT CIG GAG AAC ATC 
Ser Azg Ala Asn Ihr Val Arg Ser Hie His His Glu Glu His -Leu -Glu Asn He 

792 807 822 837 

OCA GGG AOC ACT GAA AAC TCT GCT TIT OCT TIC CTC TIT AAC CIC AGC AGC ATC 

Pro Gly Thr Ser Glu Asn Ser Ala Hie Arg Hie Leu Hie Asn Leu Ser Ser He 

852 867 882 897 

OCT GAG AAC GAG GIG ATC TOC TCT GCA GAG CTT OGG CIC TIC OGG GAG CAG GIG 
Pro Glu Asn Glu Val He Ser Ser Ala Glu Leu Arg Leu Hie Arg Glu Gin Val 

912 927 942 

GAC CAG GGC OCT GAT TOG GAA AGG GGC TIC CAC OCT ATA AAC ATT TAT GAG GIT 
Asp Gin Gly Pro Asp Trp Glu Arg Gly Hie His Arg lie Asn He Tyr Glu Val 

957 972 987 1002 

ATG AAG O0C OCA GCA GAA GIG GTG OCT GGG CAC CTC ATC ACA GGA CEA CTG GAC 
MET Lys Pro Pro Ala Glu Val Val Pro Gly His Leu He Thr Arg Leu Leu Asp 

1017 1032 1047 

AOG AGA CTG GTC CAC CAC AAT GTC ACA GGG TGG GAA ACT TIT GAT GIG AGC OCT 
Thr; Arg leu Val His. His Asn.Val Thr. Arg ,Trp Glu Thr Hie Asp Val Ser..Prp. 

1062 1077 1092 1107 

GOG GIC CTT OGC TOG AOC GGG GAG . AAG .CAG CCA AAC TAT GGG CTA GCC ATT GAG . 

Ala Val Leu Arg Trp Thr Arg Glu Lys Gin Pro Asn iyr*Gly Leu Ala lie Glu 

"22 1137 H52 1167 

GTG ACT CAC CIC CAT CAG ACT GGG AOC CAC CAG GGC CAG CAT GTC AGG ATT AGC 
Val Thr His Leu His Gin Thr Arg Thr His Gin Gly Gin His Val Arg lie Ser 



24 



EP 0 313 578 B1 



10 



is 



1182 1197 1212 

O^TOGTIACCTCAAGGGAGTC^AATTCGCXr 

Arg Ser leu Pro Gin Gly Ser Gly Asn Trp Ala Gin Leu Arg Pro Leu Leu Val 

1227 1242 1257 1272 

AOC TIT GGC CAT GAT GGC OGG GGC CAT GCC TIG ACC CGA OGC OGG AGG GCC AAG 
Hu: Hie Gly His Asp Gly Arg Gly His Ala Leu T!rr Arg Arg Arg Arg Ala Lys 

1287 1302 1317 

OCT AGC CCT AAG CAT CAC TCA CAG OGG GCC AGG AAG AAG AAT AAG AAC TGC OGG 
Arg Ser Pro Lys His His Ser Gin Arg Ala Arg Lys Lys Asn Lys Asn cys Arg 

1332 1347 1362 1377 

OGC CAC TOG CTC TAT GTC GAC TIC AGC GAT GTG GGC TCG AAT GAC TGG ATT GIG 
Arg His Ser Leu Tyr Val Asp Hie Ser Asp Val Gly Trp Asn Asp Trp lie Val 

13 92 1407 1422 1437 

GCC CCA OCA GGC TAC CAG GCC TTC TAC TCC CAT GGG GAC TGC CCC TIT CCA CTC 
20 Ala Pro Pro Glv TVr Gin Ala Hie TVr Cvs His Glv Aso Cvs Pro Fhe Pro Leu 

1452 1467 1482 

GCT GAC CAC CTC AAC TCA ACC AAC CAT GOC ATT GTC CAG AOC CTC GTC AAT TCT 
Ala Asp His Leu Asn Ser Uir Asn His Ala lie Val Gin Thr Leu Val Asn Ser 

25 . 1497 1512 1527 " 1542 

GTC AAT TCC ACT ATC OOC AAA GOC TCT TCT GTC COC ACT GAA CIG ACT GOC ATC 
Val Asn Ser Ser He Pro lys Ala Cys Cys Val Pro Thr Glu Leu Ser Ala He 

1557 1572 1587 

TOC ATC CTC TAC CTC GAT GAG TAT GAT AAG GTC GTA CTC AAA AAT TAT CAG GAG 
Ser MET Leu Tyr Leu Asp Glu Tyr Asp lys Val Val Leu Lys Asn Tyr Gin Glu 

1602 1617 (408) 1636 1646 1656 

ATC GTA GTA GAG GGA TCT GGG TCC OGC TCAGATCAGG CAGTOCTTCA GGATAGACAG 
3S MET Val Val Glu Gly Cys Gly Cys Arg 

1666 1676 1686 1696 1706 1716 1726 

AIATACACAC CACACACACA CACCACATAC AOCACACACA CAOGTTCOCA TCCACICACC CACACACTAC 



30 



40 



SO 



ss 



1736 1746 1756 1766 1776 1786 1796 

ACAGACTCCT TOCITATAGC TCGACITTEA TTTAAAAAAA AAAAAAAAAA AATGGAAAAA A3XXXTAAAC 



1806 1816 1826 1836 1846 1856 1866 

45 AITCACCITC ACXTTTATTEA TC^CTJTACG TCCAAATCIT TTCACCATAT TCATCATATA TTTTCACAAA 

187 6 1886 1896 1906 1916 1926 1936 

AIATAITEAT AACTAGGTAT TAAAAGAAAA AAAIAAAATC AGTCATEATT TEAAAAAAAA AAAAAAAACT 



1946 

CTAGAGTOGA OGGAATTC 



12. A gene encoding human BMP-4 having the amino acid sequence given in claim 11 . 

13. A gene encoding a protein exhibiting properties of BMP-4 and comprising a DNA sequence: 



25 



EP 0 313 578 B1 



(a) which differs from a DNA sequence of claim 11 in codon sequence due to the degeneracy of the genetic 
code; 

(b) which hybridises with a DNA sequence of claim 11 or section (a), above; or 

(c) represents a fragment, allelic or other variation of a DNA sequence of claim 11, whether said variation 
results in changes in the peptide sequence or not. 

14. The DNA sequence of claim 13, which is a genomic DNA sequence. 

15. The DNA sequence of claim 1 3, which is a cDNA sequence. 

16. A vector containing the gene or DNA sequence of any one of claims 1 to 15 in operative association with an 
expression control sequence. 

17. A cell transformed with a vector of claim 16. 

18. The cell of claim 17 which is a mammalian cell, a bacterial cell, an insect cell or a yeast cell. 

19. The cell of claim 18 which is a CHO cell. 

20 20. A protein exhibiting properties of BMP-2 which is encoded by a gene or DNA sequence of any one of claims 1 to 10. 

21. A protein exhibiting properties of BMP-2, which is obtainable by the steps of cutturing in a suitable culture medium 
a cell transformed with an expression vector comprising a gene or a DNA sequence of any one of claims 1 to 10, 
and recovering said protein from said culture medium. 



w 



15 



25 



22. A protein exhibiting properties of BMP-4 which is encoded by a gene or DNA sequence of any one of claims 11 to 15. 



23. A protein exhibiting properties of BMP-4, which is obtainable by the steps of cutturing in a suitable culture medium 
a cell transformed with an expression vector comprising a gene or a DNA sequence of any one of claims 11 to 15, 

50 and recovering said protein from said culture medium. 

24. A process for producing the protein of claims 21 or 23, comprising the steps of culturing in a suitable culture medium 
the cell of claim 17 and isolating said protein from said culture medium. 

35 25. A pharmaceutical composition comprising the proteins of any one of claims 20 to 23, individually or in combination 
and a pharmaceutical^ acceptable vehicle. 

26. The pharmaceutical composition of claim 25, further comprising a matrix capable of delivering the composition to 
the site o1 the bone or cartilage defect and providing a structure for inducing bone or cartilage formation. 

40 

27. The pharmaceutical composition of claim 26, wherein said matrix comprises hydroxyapatite, collagen, polylactic 
acid or tricalcium phosphate. 

28. Use of a protein of any one of claims 20 to 23, individually or in combination, for the preparation of a pharmaceutical 
45 composition for inducing bone or cartilage formation. 

Claims for the following Contracting State : AT 

50 1. A process for the preparation of a gene encoding human BMP-2 comprising the following DNA sequence: 



55 



26 



EP 0 313 578 B1 



10 20 30 40 50 60 70 

GTCGACICIA GAGTCTCTGT CAGCACITGG CIGGGGACCT CTTGAACTIG CAGGGAGAAT AACITCCGCA 



80 90 100 110 120 130 140 

COOCACTITG OGOOQGIGCC TITGCCCCAG OGGAGOCTCC TTOGOCATCT OOGAGCOOCA COGOOOCTCC 



ISO 160 170 180 190 200 210 

ACTOCTOGGC CITGOCCGAC ACTGAGAOGC TGITOOCAGC GIGAAAAGAG AGACIGOGOG GOOGGCACOC 



220 230 240 250 260 270 280 

GGGAGAAGGA GGAGGCAAAG AAAAGGAAOG GACA1TCGGT CCITGOGCCA GGTOCTTIGA CCAGAGITIT 



290 3 00 -310 320 -330 340 -350 

TCCATCTCGA OGCTCTTTCA ATCGAOCHCT OCCOGOGTCC TTCTXAGAOG GACIGOGGTC TCCTAAAGGT 



(1) 370 385 400 

OGAOC ATG GIG GOC GGG AOC OGC TCT CTT OA GOG TIG CIG CIT OOC CAG GTC 
MET Val Ala Gly Thr Arg Cys Leu Leu Ala Leu Leu Leu Pro Gin Val 

445 

OGC AGG AAG TIC GOG 
Arg Arg Lys Fhe Ala 

505 

GAG GTC CIG AGO GAG 
Glu Val Leu Ser Glu 

565 

AGA CCC AOC COC AGO 
Arg Pro Ihr Pro Ser 

610 

OGC AGG CAC TOG C-GT 
Arg Arg His Ser Gly 

670 

GCA GOC AGC CGA GCC 
Ala Ala Ser Arg Ala 

715 

GAA CTA CCA -GAA AOG 
Glu Leu Pro Glu Ihr 



415 430 
CIC CIG GGC GGC GOG GOT GGC CTC GIT COG GAG CIG GGC 
Leu Leu Gly Gly Ala Ala Gly Leu Val Pro Glu Leu Gly 

460 475 490 

GOG GOG TOG TOG GGC OGC CCC TCA TOC CAG OOC TCT GAC 
Ala Ala Ser Ser Gly Arg Pro Ser Ser Gin Pro Ser Asp 

520 535 550 

TTC GAG TIG OGG CIG CTC AGC ATG TIC GGC CIG AAA CAG 
.Fhe Glu Leu Arg Leu Leu Ser MET Fhe Gly Leu Lys Gin 

580 595 
AGG GAC GOC GIG GTG OOC OOC TAC ATG CIA GAC CIG TAT 
Arg Asp Ala Val Val Pro Pro Tyr MET Leu Asp Leu Tyr 

625 640 655 

CAG COG GGC TCA CCC GOC CCA GAC CAC OGG TIG GAG AGG 
Gin Pro Gly Ser Pro Ala Pro Asp His Arg Leu Glu Arg 

685 700 
AAC ACT GIG OGC AGC TTC CAC CAT GAA GAA TCT TIG GAA 
Asn Ihr Val Arg Ser Fhe His His Glu Glu Ser Leu Glu 



27 



EP 0 313 578 B1 



730 745 760 775 

ACT GGG AAA ACA AOC CGG AGA TTC TTC TTT AAT TTA AGT TCT ATC CCC AOS GAG 

ser Gly Lys Tnr Thr Arg Arg Fhe Phe Phe Asn Leu Ser Ser He Pro Thr Glu 

790 805 820 835 

^^^^^^^ OT ^ OT ^^GAACAGATCCAAGATGCr 
Glu Phe lie Ser Ala Glu Leu Gin Val Phe Arg Glu Gin MET Gin Asp Ala 

850 865 880 

^^^f^^^^^^^^^^^^^AIAAAA 
Leu Gly Asn Asn Ser Ser Phe His His Arg lie Asn lie Tyr Glu lie lie Lys 

895 910 9 25 940 

^^^^^^^^^^^^OTTTCGACACCAGGITC 
ProAlaThrMaAsnSerIysI^eProVallhrSerLeul£uAspC^ArgLeu 

955 970 985 

^^5^^^^^^^^ m< ^^ACCO0CCCTGTCATC 
val Asn Gin Asn Ala Ser Arg Trp Glu Ser Phe Asp Val Tiir Pro Ala Val MET 

1000 1015 1030 1045 

^^ACTGC\CAGGGA<^CGOCAACC^GGATICGTCGTCGAAGrcGCCCAC 
Arg Trp Thr Ala Gin Gly His Ala Asn His Gly Phe Val Val Glu Val Ala His 

1060 1075 1090 1205 

TIG GAG GAG AAA CAA GGT GTC TCC AAG AGA CAT GTT AGG ATA AGC AGG TCT TTC 
Leu Glu Glu lys =Gln Gly Val Ser Lys Arg His VaTArg He Ser Arg ber u*xi 

H20 H35 H5o 

CAC C?yS TI13 GTA ACT TTT GGC 

His Gin Asp Glu His Ser Trp Ser Gin He Arg Pro Leu Leu Val Thr Phe Gly 

1165 H80 1195 1210 

His Asp Gly Lys Gly His Pro Leu His Lys Arg Glu Lys Arg Gin Ala Lys His 

1225 1240 1255 

^2^^^^ OT ^^^^^AGACACCCTTrcTRCGTGGAC 
Lys Gin Arg Lys Arg Leu Lys Ser Ser Cys Lys Arg His Pro Leu Tyr Val Asp 

1270 1285 1300 1315 

TTC AGT GAC GTG GGG TGG AAT GAC TGG ATT GTG GCT CCC CCG GGG TAT CAC GCC 

Pae Ser Asp Val Gly Trp Asn Asp Trp He Val Ala Pro Pro Gly Tyr His Ala 

nrrm „, 1330 1345 "60 1375 

TTT TAC TGC CAC GGA GAA TGC CCT TTT CCT CTG GCT GAT CAT CTG AAC TCC ACT 
Pne Tyr Cys His Gly Glu Cys Fro Phe Pro Leu Ala Asp His Leu Asn Ser Thr 

1390 1405 1420 

AAT CAT GCC ATT GTT CAG AGG TTG GTC AAC TCT GTT AAC TCT AAG ATT CCT AAG 
Asn His Ala lie Val Gin Tnr Leu Val Asn Ser Val Asn Ser Lys He Pro Lys 



28 



EP 0 313 578 B1 



1435 1450 . 1465 1480 

GCA TGC TGT GIC COG ACA GAA CTC ACT GCT ATC TOG ATC CIG TAC CTT GAC GAG 
5 Ala Cys Cys Val Pro Thr Glu Leu Ser Ala lie Sex MET Leu iyr Leu Asp Glu 

1495 1510 1525 

AAT GAA AAG CTT GTA TTA AAG AAC TAT CAG GAC ATC GIT GIG GAG GCT TGT GGG 
Asn Glu Lys Val Val leu lys Asn iyr Gin Asp MET Val Val Glu Gly Cys Gly 

10 1540(396) 1553 1563 1573 1583 159 3 1603 

TGT OGC TAGTACAGCA AAATIAAAIA CATAAATAIA TAIAIAIATA TA3MTTTAG AAAAAAGAAA 

cys Arg 

16 AAAA , 

wherein said process comprises the following steps: 

a) screening of a gene library constructed from U-2 OS derived DNA or cDNA with a labelled bBMP-2 fragment 
20 by hybridization, 

b) isolating positive clones, and 

c) isolating the DNA-inserts from said clones. 

2. The process according to claim 1 , wherein the gene encodes human BMP-2 having the amino acid sequence 
25 given in claim 1 , 

3. A process for the preparation of a gene encoding a protein exhibiting properties of human BMP-2 and comprising 
a DNA sequence: 

30 a) which differs from a DNA sequence of claim 1 in codon sequence due to the degeneracy of the genetic code; 

b) which hybridizes with a DNA sequence of claim 1 or section (a), above; or 

c) represents a fragment, allelic or other variation of a DNA sequence of claim 1 , whether said variation results 
in changes in the peptide sequence or not, 

35 wherein said process comprises standard techniques of molecular biology. 

4. The process according to claim 3, wherein the DNA sequence is a genomic DNA sequence. 

5. The process according to claim 3, wherein the DNA sequence is a cDNA sequence. 

40 

6. A process for the preparation of a gene encoding bovine BMP-2 comprising the following DNA sequence: 



45 



50 



$5 



29 



EP 0 313 578 B1 



(1) 15 30 45 

GGC CAC GAT GGG AAA GGA CAC CCT CTC CAC AGA AGA GAA AAG CGG 
GHDGKGHPLHRREK R 

60 75 90 

CAA GCA AAA CAC AAA CAG CGG AAA CGC CTC AAG TCC AGC TGT AAG 
QAKHKQRKRLKSSCK 

105 120 135 

AGA CAC CCT TTA TAT GTG GAC TTC AGT GAT GTG GGG TGG AAT GAC 
RHPLYVDFSDV-GWND 

150 165 180 

TGG ATC GTT GCA CCG CCG GGG TAT CAT GCC TTT TAC TGC CAT GGG 
WIVAPPGYH AFYCH G 

195 .210 225 

GAG TGC CCT TTT CCC CTG GCC GAT CAC CTT AAC TCC ACG AAT CAT 
E C P F P L A D H L N S T N H 

. 240 ( 255 270 

GCC ATT'' CTC' CAA ACT CTG^TC'AAfe' TCA GTT AAC TCT AAG ATT CCC 
AIVQTLV NSVNSKI P 

38-5 3 00* 315 

AAG GCA TGC TGT GTC CCA AC A GAG CTC AGC GCC ATC TCC ATG CTG 
K ACC VP TELSAIS ML 

330 345 ■ - 360 

TAC CTT GAT GAG AAT GAG AAG GTG GTA TTA AAG AAC TAT CAG GAC 
YLD ENEKVVLK N Y O D 

375 * * (129) 397 407 

ATG GTT GTC GAG GGT TGT GGG TGT CGT TAGCACAGCA AAATAAAATA 
M V V E G C G C R 

417 427 437 447 457 

TAAATATATA TATATATATA TTAGAAAAAC AGCAAAAAAA TCAAGTTGAC 

467 477 487 497 507 

ACTTTAATAT TTCCCAATGA AGACTTTATT TATGGAATGG AATGGAGAAA 

517 527 537 547 557 

AAGAAAAACA CAGCTATTTT GAAAACTATA TTTATATCTA CCGAAAAGAA 



567 577 587 

GTTGGGAAAA CAAATATTTT AATCAGAGAA TTATT, 

wherein said process comprises the following steps: 



a) screening a gene library constructed from bovine liver DNA or cDNA with a labelled probe designed on the 
basis of the amino acid sequence of a fragment of bBMP-2, 

b) isolating positive clones, and 

c) isolating the DNA-inserts from said clones. 

7. The process according to claim 6, wherein the gene encodes bovine BMP-2 having the amino acid sequence of 
claim 6. 



30 



EP 0 313 578 B1 

A process for the preparation of a gene encoding a protein exhibiting properties of bovine BMP-2 and comprising 
DNA sequences: 

a) which differ from a DNA sequence of claim 7 in codon sequence due to the degeneracy of the genetic code; 

b) which hybridize with a DNA sequence of claim 7 or section a), above; or 

c) represent fragments, allelic or other variations of a DNA sequence of claim 7, whether said variations result 
in changes in the peptide sequence or not, 

wherein said process comprises standard techniques of molecular biology. 

The process according to claim 8, wherein the DNA sequence is a genomic DNA sequence. 

0. The process according to claim 8, wherein the DNA sequence is a cDNA sequence. 

1. A process for the preparation of a gene encoding human BMP-4 comprising the following DNA sequence: 



31 



EP 0 313 578 B1 



10 20 30 40 50 60 70 

CTCIAGAGGG CAGA3GAGGA GGGAGGGAGG GAAGGAGCGC GGAGCOOGGC OOGGAAGC1A. GGTCAGIGIG 



80 90 100 110 120 130 140 

GCATOGGAGC TGAGGGACGC GAGCCIGAGA CGOQ3CTSCT GCTCOGGCTG AGOMCEAGC TO3TCTOOOC 



70 



*5 



20 



150 160 170 180 190 200 210 

GATGGGATTC CCGICCAAGC TATCTCGAGC CIGCAGCGCC ACAGTCCCOG GCOCIOGOOC AGGTICACIG 



220 230 240 250 260 270 280 

CAAOOCTICA GAGCTCOOCA GGAGCTGCTG CTGGOGAGCC OXTACTGCA GGGAOCTATG GAGOCATTCC 



290 300 310 320 330 340 350 

GTAGIGCCAT CCOGAGCAAC GCACTGCIGC AGCTTOOCTG AGCCTITCCA GCAAGTCTCT TCAAGA3TCG 



360 370 380 390 400 (1) 

CTGTCAAGAA TCATOGACTC CXTICTTITC TGTCAAGACA CC ATG AIT CCT 

.MET. He Pro.. 



25 



30 



35 



40 



45 



417 432 447 462 

GCT AAC CGA A1G CTG ATG GTC GIT TEA TEA TCC CAA GTC CTG CCA GGA GGC GOG 
Gly Asn Arg MET Leu MET Val Val Leu leu Cys Gin Val leu Leu Gly Gly Ala 

477 492 507 

AGC CAT GCT ACT TIG ATA OCT GAG AOG GGG AAG AAA AAA GTC GOC GAG ATT CAG 
Ser His Ala Ser Ibu lie Pro Glu Thr Gly lys lys Lys Val Ala Glu lie Gin 

522 537 552 567 

GGC CAC GOG GGA GGA OGC OGC TCA GGG CAG AGC CAT GAG CIC CTG OGG GAC TTC 

Gly His Ala Gly Gly Arg Arg Ser Gly Gin Ser His Glu Leu Leu Arg Asp Rie 

582 597 612 627 

GAG GOG ACA CTT CTG CAG ATG TIT GGG CIG OGC OGC OGC COG CAG OCT AGC AAG 
<SLu Ala Hit Leu Leu Gin MET Fhe Gly Leu Arg Arg Arg Pro Gin Pro Ser lys 

642 657 672 

ACT GOC GTC ATT OOG GAC TAC ATG OGG GAT CTT TAC OGG CTT CAG TCT GGG <SAG 
Ser Ala Val lie Pro Asp Tyr MET Arg Asp Leu Tyr Arg Leu Gin Ser Gly Glu 

687 702 717 732 

GAG GAG GAA GAG CAG ATC CAC AGC ACT GCT CTT GAG TAT OCT GAG OGC COG GOC 
Glu Glu Glu Glu Gin lie His Ser Thr Gly Leu Glu Tyr Pro Glu Arg Pro Ala 



so 



55 



32 



EP 0 313 578 B1 



747 762 777 

AGC COG GCC AAC AOC GIG AGG AGC TTC CAC CAC GAA GAA CAT CIG GAG AAC ATC 
Ser Arg Ala Asn Hir Val Arg Ser Fhe His His Glu Glu His -Leu -Glu Asn He 

792 807 822 837 

OCA GGG AOC AGT GAA AAC TCT GCT TTT OGT TIC CTC TTT AAC CTC AGC AGC ATC 

Pro Gly Uir Ser Glu Asn Ser Ala Rie Arg Fhe Leu Ftie Asn Lbu Ser Ser lie 

852 867 882 897 

CCT GAG AAC GAG GIG ATC TOC TCT GCA GAG CTT OGG CTC TTC OGG GAG CAG GIG 
Pro Glu Asn Glu Val He Ser Ser Ala Glu Leu Arg Lbu Hie Arg Glu Gin Val 

912 927 942 

GAC CAG GGC CCT GAT TOG GAA AGG GGC TTC CAC OGT ATA AAC ATT TAT GAG GIT 
Asp Gin Gly Pro Asp Trp Glu Arg Gly Hie His Arg He Asn lie Tyr Glu Val 

957 972 987 1002 

ATC AAG COC OCA GCA GAA GIG GIG OCT GGG CAC CTC ATC ACA OGA CIA CTC GAC 
MET Lys Pro Pro Ala Glu Val Val Pro Gly His Leu He Uir Arg Leu Leu Asp 

1017 1032 1047 

AOG AGA CIG* GTC CAC CAC AAT GIG ACA CGG TCG GAA ACT TIT GAT GIG AGC OCT 
"ttr Arg Leu Val His His Asn Val Thr Arg # Trp Glu .3hr-Phe Asp Val Ser Pro 

1062 1077 1092 1107 

GOG GTC CTT CGC TOG ACC OGG GAG. AAG .CAG CCA AAC TAT GGG CIA GOC. ATT . GAG- 

Ala Val leu Arg Trp Thr Arg Glu Lys Gin Pro Asn Tyr Gly* Leu Ala lie Glu 

1122 1137 1152 1167 

GIG ACT CAC CTC CAT CAG ACT OGG AOC CAC CAG GGC CAG CAT GTC AGG ATT "AGC 
Val Dir His Leu His Gin Ihr Arg Thr His Gin Gly Gin His Val Arg lie Ser 



H82 1197 1212 

OGA TOG TTA OCT CAA GGG AGT GGG AAT TGG GCC CAG CTC OGG COC CTC CTC GTC 
Arg Ser Leu Pro Gin Gly Ser Gly Asn Trp Ala Gin Leu Arg Pro Leu Leu Val 

1227 1242 1257 1272 

AOC TIT GGC CAT GAT GGC OGG GGC CAT GCC TIG ACC OGA OGC OGG AGG GOC AAG 
Ihr Itae Gly His Asp Gly Arg Gly His Ala Lea Thr Arg Arg Arg Arg Ala lys 

1287 1302 1317 

•OCT AGC CCT AAG CAT CAC TCA CAG OGG GOC AGG AAG AAG AAT AAG AAC TGC OGG 
Arg Ser Pro Lys His His Ser Gin Arg Ala Arg Lys lys Asn Lys Asn Cys Arg 

1332 1347 1362 1377 

OGC CAC TOG CTC TAT GIG GAC TTC AGC GAT GIG GGC TCG AAT GAC TCG ATT GIG 

Arg His Ser Lbu lyr Val Asp Hie Ser Asp Val Gly Trp Asn Asp Trp He Val 

1392 1407 1422 1437 

GOC CCA OCA GGC TAC CAG GOC TTC TAC TCC CAT GGG GAC TGC GCC TTT OCA CIG 
Ala Pro Pro Gly TVr Gin Ala Fhe Tvr Cvs -His Glv Aso Cvs Pro Fhe Pro Leu 

1452 1467 1482 

GCT GAC CAC CTC AAC TCA ACC AAC CAT GOC ATT GIG CAG AOC CTG-GIC AAT TCT 
Ala Asp His Leu Asn Ser Thr Asn His Ala He Val Gin Uhr Leu Val Asn Ser 



33 



EP 0 313 578 B1 



1497 1512 1527 1542 

CTC AAT TCC ACT ATC COC AAA GOC TCT TCT GTC OOC ACT GAA CTC ACT GOC ATC 
Val Asn Ser Ser lie Pro Lys Ala Cys Cys Val Pro Thr Glu l£U Ser Ala lie 

1557 1572 1587 

TCC ATC CTC TAC CTC GAT GAG TAT GAT AAG GIG GTA CIG AAA AAT TAT CAG GAG 
Ser MET leu iyr Leu Asp Glu iyr Asp lys Val Val Leu Lys Asn Tyr Gin Glu 

1602 1617 (408) 1636 1646 1656 

ATC GEA GTA GAG GGA TCT GGG TCC CGC TCAGATCAGG CAGTOCITCA GGAIAGACAG 
MET Val Val Glu Gly Cys Gly Cys Arg 

1666 1676 1686 1696 1706 1716 1726 

ATATACACAC CACACACACA CACCACATAC AOCACACACA CACGITOCCA TOCACICACC CAGAGACCAC 

1736 1746 1756 1766 . 1776. . 1786 . 1796 

AO^GACIGCT TCCTEATATSC TCGACTTTTA TTEAAAAAAA AAAAAAAAAA AATCGAAAAA ATOXTAAAC 



1806 1816 1826 1836 1846 1856 1866 

ATTCAOCTTG AOCTIATTTA TCACITTAOG .TCCAAATCTT TTCACCATAT .TCATCATAIA TTTTCACAAA 



1876 1886 1896 1906 1916 1926 1936 

ATATATTEAT AACTAOGTAT TAAAAGAAAA AAATAAAATC AGTCATIA1T TTAAAAAAAA AAAAAAAACT 



1946 

CTAGACTOGA OGGAAITC , 

wherein said process comprises the following steps: 

a) screening of a gene library constructed from U-2 OS derived DNA or cDNA with a labelled bBMP-2 fragment 
by hybridization, 

b) isolating positive clones, and 

c) isolating the DNA-inserts from said clones. 

12. The process according to claim 11, wherein the gene encodes human BMP-4 having the amino acid sequence 
given in claim 11 . 

13. A process for the preparation of a gene encoding a protein exhibiting properties of BMP-4 and comprising a DNA 
sequence: 

a) which differs from a DNA sequence of claim 1 1 in codon sequence due to the degeneracy of the genetic code; 

b) which hybridizes with DNA sequence of claim 11 or section a), above; or 

c) represents a fragment, allelic or other variation of a DNA sequence of claim 11 , whether said variation results 
in changes in the peptide sequence or not : 

wherein said process comprises standard techniques of molecular biology. 

14. The process according to claim 13, wherein the DNA sequence is a genomic DNA sequence. 

15. The process according to claim 13, wherein the DNA sequence is a cDNA sequence. 

16. A vector containing the gene or DNA sequence prepared according to any one of claims 1 to 15 in operative 
association with an expression control sequence. 



34 



EP 0 313 578 B1 



17. A cell transformed with a vector of claim 16. 

18. The cell of claim 17 which is a mammalian cell, a bacterial cell, an insect cell or a yeast cell. 

19. The cell of claim 18 which is a CHO cell. 

20. A process for the preparation of a protein exhibiting properties of BMP-2, wherein said process comprises the 
steps of culturing in a suitable culture medium a cell transformed with an expression vector comprising a gene or 
a DNA sequence prepared according to any one of claims 1 to 10, and recovering said protein from said culture 
medium. 

21. A process for the preparation of a protein exhibiting properties of BMP-4, wherein said process comprises the 
steps of culturing in a suitable culture medium a cell transformed with an expression vector comprising a gene or 
a DNA sequence prepared according to any one of claims 11 to 15, and recovering said protein from said culture 
medium. 

22. A process for producing a protein exhibiting properties of BMP-2 or BMP-4, comprising the steps of culturing in a 
suitable culture medium the cell of claim 17 and isolating said protein from said culture medium. 

23. A process for the preparation of a pharmaceutical composition comprising combining the proteins prepared ac- 
cording to any one of claims 20 to 22, individually or in combination with a pharmaceutically acceptable vehicle. 

24. The process according to claim 23, wherein said pharmaceutical composition further comprises a matrix capable 
of delivering the composition to the site of the bone or cartilage defect and providing a structure for inducing bone 
or cartilage formation. 

25. The process according to claim 24, wherein said matrix comprises hydroxy apatite, collagen, poly lactic acid or 
tricalcium phosphate. 

26. Use of a protein prepared according to any one of claims 20 to 22, individually or in combination, for the preparation 
of a pharmaceutical composition for inducing bone or cartilage formation. 

Patentanspruche 



Patentanspruchefur folgende Vertragsstaaten : BE, CH, DE, FR, GB, IT, LI, LU, NL, SE 

1. Menschliches BMP-2 codierendes Gen, umfassend die nachfolgende DNA-Sequenz: 



35 



EP 0 313 578 B1 



10 


20 


30 


40 


50 


GTCGACTCTA 


GAGTGTGTGT 


CAGCACTTGG 


CTGGGGACTT 


CTTGAACTTG 


60 


70 


80 


90 


100 


CAGGGAGAAT 


AACTTGCGCA 


CCCCACTTTG 


CGCCGGTGCC 


TTTGCCCCAG 


110 


120 


130 


140 


150 


CGGAGCCTGC 


TTCGCCATCT 


CCGAGCCCCA 


CCGCCCCTCC 


ACTCCTCGGC 


160 


170 


180 


190 


200 


CTTGCCCGAC 


ACTGAGACGC 


TGTTCCCAGC 


GTGAAAAGAG 


AGACTGCGCG 


210 


220 


230 


240 


250 


GCCGGCACCC 


GGGAGAAGGA 


GGAGGCAAAG 


AAAAGGAACG 


GACATTCGGT 


260 


270 


280 


290 


300 


CCTTGCGCCA 


GGTCCTTTGA 


CCAGAGTTTT 


TCCATGTGGA 


CGCTCTTTCA 


310 


320 


330 


340 


350 


ATGGACGTGT 


CCCCGCGTGC 


TTCTTAGACG 


GACTGCGGTC 


TCCTAAAGGT 



(1) 370 385 400 

OGAOC ATG GIG GOC GGG AOC OGC TGT CTT CTh GOG TIG CEG CTT OOC CAG GTC 
MET Val Ala Gly Car Arg Cys Leu Leu Ala Leu Leu Leu Pro Gin Val 

415 430 445 

CTC C1G GGC GGC GOG GOT GGC CIC GIT COG GAG CIG GGC OGC AGG AAG TIC GOG 
leu Leu Gly Gly Ala Ala Gly Leu Val Pro Glu Leu Gly Arg Arg Lys Fhe Ala 

460 475 490 505 

GOG GOG TOG TOG GGC OGC COC TCA TOC CAG OOC TCT GAC GAG GTC CIG AGO GAG 

Ala Ala Ser Ser Gly Arg Pro Ser Ser Gin Pro Ser Asp Glu Val Leu Ser Glu 

520 535 550 565 

7IC-GAG TIG OGG CIG CIC AGC AIG TIC GGC CIG AAA CAG AGA CCC AOC CCC AGC 
.?he Glu Leu Arg Leu Leu Ser MET Rie Gly Leu Lys Gin Arg Pro Ihr Pro Ser 

580 595 £10 

AGG GAC GOC GIG GIG COC OOC ZkC ATG CIA GAC CIG TAT GGC AGG CAC TOG GGT 
Arg Asp Ala Val Val Pro Pro Tyr MET Leu Asp Leu Tyr Arg Arg His Ser Gly 



36 



EP 0 313 578 B1 



625 640 655 670 

CAG COG GGC TCA COC GOC CCA GAC CAC OGG TIG GAG AGG GCA GOC AGC GGA GCC 
Gin Pro Gly Ser Pro Ala Pro Asp His Arg Leu Glu Arg Ala Ala Ser Arg Ala 

685 700 715 

AAC ACT GIG OGC AGC TIC CAC CAT GAA GAA TCT TIG GAA GAA CTA CCA GAA AOG 
Asn Thr Val Arg Ser Phe His His Glu Glu Ser Leu Glu Glu Leu Pro Glu Thr 

730 745 760 775 

AGT GGG AAA ACA ACC Q3G AGA TIC TTC TIT AAT TEA ACT TCT ATC COC AOS GAG 

Ser Gly Lys Thr Thr Arg Arg Phe Phe Phe Asn Leu Ser Ser lie Pro Thr Glu 

790 805 820 835 

GAG TIT ATC ACC TCA GCA GAG CTT CAG GIT TTC OGA GAA CAG ATG CAA GAT GCT 
Glu Phe lie Thr Ser Ala Glu Leu Gin Val Phe Arg Glu Gin MET Gin Asp Ala 

850 865 880 

TEA GGA AAC AAT AGC AGT TIC CAT CAC OGA ATT AAT ATT TAT GAA ATC ATA AAA 
Leu Gly Asn Asn Ser Ser Phe His His Arg He Asn lie Tyr Glu lie lie lys 

895 910 925 940 

OCT GCA ACA GCC AAC TOG AAA TTC COC GIG ACC AGT CTT TIG GAC ACC AGG TIG 
Pro Ala Thr Ala Asn Ser lys Phe Pro Val Thr Ser Leu Leu Asp Thr Arg Leu 

955 970 985 

GIG AAT CAG AAT GCA AGC AGG TGG GAA ACT TIT GAT Git ACC COC GCT GIG ATC 
Val Asn Gin Asn Ala Ser Arg Trp Glu Ser Phe Asp Val Thr Fro Ala Val MET 

1000 1015 1030 1045 

OGG TGG ACT GCA CAG GGA CAC GOC AAC CAT GGA TIC GIG GIG GAA GIG GOC CAC 

Arg Trp Thr Ala Gin Gly His Ala Asn His Gly Phe Val Val Glu Val. Ala. .Bis . 

1060 1075 1090 11*05 

TIG GAG GAG AAA CAA GCT GIC TOC AAG AGA CAT GIT AGG ATA AGC AGG TCT TTG- 
Leu Glu Glu lys Gin Gly Val Ser Lys Arg His VaT Arg lie Ser Arg r Sef Lai' 

1120 1135 1150 

CAC CAA GAT GAA CAC AGC TGG TCA CAG ATA AGG OCA TIG CPA GTA ACT TIT GGC 
His Gin Asp Glu His Ser Trp Ser Gin lie Arg Pro Leu Leu Val Bur Phe Gly 

1165 1180 1195 1210 

CAT GAT GGA AAA GGG CAT OCT CTC CAC AAA AGA GAA AAA OCT CAA GOC AAA CAC 
His Asp Gly Lys Gly His Pro Lea His lys Arg Glu Lys Arg Gin Ala lys His 

1225 1240 1255 

AAA CAG GGG AAA OGC CTT AAG TOC AGC TCT AAG AGA CAC OCT TIG TAC GIG GAC 
Lys Gin Arg lys Arg Leu lys Ser Ser Cys Lys Arg His Pro Leu Tyr Val Asp 

1270 1285 1300 1315 

TTC AGT GAC GIG GGG TGG AAT GAC 1GG ATT GIG GCT GCC COG GGG TAT CAC GOC 

Phe Ser Asp Val Gly T*p Asn Asp Trp He Val Ala Pro Pro Gly Tyr His Ala 



37 



EP 0 313 578 B1 



1330 13<5 1360 1375 

TTT TAC TCC CAC GGA GAA TGC OCT TIT CCT CTG GCT GAT CAT CTG AAC TCC ACT 
— e TNt Cys Kis Gly Glu Cys Pro Fhe Pro Jjeu Ala As? His Leu Asn Ser Thr 

1390 1405 1420 

AAT CAT GCC ATT GIT CAG AOS TTG GIC AAC TCT GTT AAC TCT AAG ATT OCT AAG 
Asn Kis Ala He Val Gin Thr Leu Val Asn Ser Val Asn Ser Lys He Pro Lys 



1435 1450 . 1465 1480 

GCA TCC TCT GTC COG ACA GAA CIC ACT GCT ATC TCG AIG CTG TAC CTT GAC GAG 
Ala cys cys Val Pro Thr Glu Leu Ser Ala lie Ser MET I^u Tyr Leu Asp Glu 

1495 1510 1525 

AAT GAA AAG GIT GTA TEA AAG AAC TAT CAG GAC AIG GIT GIG GAG GGT TGI GGG 
Asn Glu Lys Val Val Leu lys Asn Tyr Gin Asp MET Val Val Glu Gly Cys Gly 

1540(396) 1553 1563 1573 1583 159 3 1603 

TGT OGC 1?>CTACAGCA AAATTAAATA CATAAAIATA TATATATA0A TMAITTTAG AAAAAAGAAA 

cys Arg 



AAAA 



2. Gen, das menschiiches BMP-2 codiert, das die in Anspruch 1 angegebene Aminosauresequenz aufweist 

3. Gen, das ein Protein codiert, das Eigenschaften von menschlichem BMP-2 zeigt, und eine DNA-Sequenz umfafM, 
die: 

(a) sich in der Codonsequenz infolge der Degeneriertheit des genetischen Codes von einer DNA-Sequenz 
nach Anspruch 1 unterscheidet; 

(b) mit einer DNA-Sequenz nach Anspruch 1 oder nach vorstehendem Absatz (a) hybridisiert; oder 

(c) ein Fragment, eine allelische oder eine andere variation einer DNA-Sequenz nach Anspruch 1 darstellt, 
unabhangig davon, ob die Variation zu Anderungen in der Peptidsequenz fuhrt oder nicht. 

4. DNA-Sequenz nach Anspruch 3, dadurch gekennzeichnet, daft sie eine genomische DNA-Sequenz ist. 

5. DNA-Sequenz nach Anspruch 3, dadurch gekennzeichnet, daG sie eine cDNA-Sequenz ist. 

6. Rinder-BMP-2 codierendes Gen, umfassend die nachtolgende DNA-Sequenz: 



38 



EP 0 313 578 B1 



15 



25 



30 



35 



45 



SO 



(1) 15 30 45 

GGC CAC GAT GGG AAA GGA CAC CCT CTC CAC AGA AGA GAA AAG CGG 
G H D G X G H ? L K R R 2 X R 

60 75 90 

CAA GCA AAA CAC AAA CAG CGG AAA CGC CTC AAG TCC AGC TGT AAG 
QAXHKQRKRLKS SCX 

105 120 135 

AGA CAC CCT TTA TAT GTG GAC TTC AGT GAT GTG GGG TGG AAT GAC 
RHP L Y V D F S D V G W N D 

150 165 180 

TGG ATC GTT GCA CCG CCG GGG TAT CAT GCC .TTT TAC TGC CAT GGG 
WIVAPPGYH AFY CHG 



195 -210 225 

GAG TGC CCT TTT CCC CTG GCC GAT CAC CTT AAC TCC ACG AAT CAT 
20 EC P FP LADH LN S T N H 

240 255. . 270 

GCC' - ATT* CTC* CSV ACT "CTG ; GTC ' "AAC* ' TC A GTT A-AC TCT'AAG ATT CCC 
A I V Q T L V N S V N S X I P 



.\.. v . v v ... . . 3&5r . • v* : ; - 300 - 315 

AAG GCA TGC TGT GTC CCA ACA GAG CTC AGC GCC ATC TCC ATG CTG 
XACCVPT2LSA ISML 

330 345 360 
TAC CTT GAT GAG AAT GAG AAG GTG GTA TTA AAG AAC TAT CAG GAC 
Y LDZNZXVVLX N Y 0 2 

375 - (129) 397 407 

ATG GTT GTC GAG GGT TGT GGG TGT CGT T AGC AC AGC A AAATAAAATA 
M V V E G C G C R 



40 417 427 . 437 447 457 

TAAATATATA TATATATATA TTAGAAAAAC AGCAAAAAAA TCAAGTTGAC 

467 477 437 457 507 

ACTTTAATAT TTCCCAATGA AGACTTTATT TATGGAATGG AATGGAGAAA 



527 537 547 557 



567 577 587 

GTTGGGAAAA CAAATATTTT -AATC AC-AG AA T7ATT , 



7. Gen, das Rinder-BMP-2 codiert, das die Aminosauresequenz von Anspruch 6 ehthalt. 

ss 8. Gen, das ein Protein codiert, das Eigenschaften von Rinder-BMP-2 zeigt, und DNA-Sequenzen umfaGt, die: 

(a) sich in der Codonsequenz intolge der Degeneriertheit des genetischen Codes von einer DNA-Sequenz 
nach Anspruch 7 unterscheiden; 



39 



EP 0 313 578 B1 

(b) mit einer DNA-Sequenz nach Anspruch 7 oder nach vorstehendem Absatz (a) hybridisieren; oder 

(c) Fragmente, allelische oder andere Variationen einer DNA-Sequenz nach Anspruch 7 darstellen, unabhan- 
gig davon, ob die Variationen zu Anderungen in der Peptidsequenz fuhren oder nicht. 

5 

9. DNA-Sequenz nach Anspruch 8, dadurch gekennzeichnet, daG sie eine genomische DNA-Sequenz ist. 

10. DNA-Sequenz nach Anspruch 8, dadurch gekennzeichnet, daB sie eine cDNA-Sequenz ist. 
io 11. Menschliches BMP-4 codierendes Gen, umfassend die nachfolgende DNA-Sequenz: 

10 20 30 40 50 

CTCTAGAGGG CAGAGGAGGA GGGAGGGAGG GAAGGAGCGC GGAGCCCGGC 

15 



20 



25 



30 



35 



40 



45 



50 



55 



40 



EP 0 313 578 B1 



60 


70 


80 


90 


100 


CCGGAAGCTA 


GGTGAGTGTG 


GCATCCGAGC 


TGAGGGACGC 


GAGCCTGAGA 


110 


120 


130 


140 


150 


CGCCGCTGCT 


GCTCCGGCTG 


AGTATCTAGC 


TTGTCTCCCC 


GATGGGATTC 


160 


170 


180 


190 


200 


CCGTCCAAGC 


TATCTCGAGC 


CTGCAGCGCC 


ACAGTCCCCG 


GCCCTCGCCC 


210 


220 


230 


240 


251 


AGGTTCACTG 


CAACCGTTCA 


GAGGTCCCCA 


GGAGCTGCTG 


CTGGCGAGCC 


260 


270 


280 


290 


300 


CGCTACTGCA 


GGGACCTATG 


GAGCCATTCC 


GTAGTGCCAT 


CCCGAGCAAC 


310 


320 


330 


340 


350 


GCACTGCTGC 


AGCTTCCCTG 


AGCCTTTCCA 


GCAAGTTTGT 


TCAAGATTGG 


360 


370 


380 


390 


400 


CTGTCAAGAA 


TCATGGACTG 


TTATTATATG 


CCTTGTTTTC 


TGTCAAGACA 



(1) 

CC ATG ATT CCT 
MET lie Pro 



417 432 447 462 

GGT AAC C3A ATG CTG ATG CTC GIT TTA TTA TGC CAA GTC CIG CIA GGA GGC GOG 
Gly Asn Arg MET Leu MET Val Val Lea Leu Cys Gin Val lea Leu Gly Gly Ala 

477 492 507 

AGC CAT GCT ACT TTG ATA OCT GAG AOG GGG AAG AAA AAA GTC GCC GAG AIT CAG 
Ser His Ala Ser Leu lie Pro Glu f Uir Gly Lys Lys Lys Val Ala Glu lie Gin 

522 537 552 567 

GGC CAC GOG GGA GGA GGC OGC TCA GGG CAG AGC GAT GAG CTC CTC OGG GAC TIC 

Gly His Ala Gly Gly Arg Arg Ser Gly Gin Ser His Glu Leu leu Arg Asp Fhe 

582 597 612 627 

GAG GOG ACA CIT CTG CAG ATG TTT GGG COG OGC GGC GGC COG CAG OCT AGC AAG 
Glu Ala Thr Leu Leu Gin MET Hie Gly Leu Arg Arg Arg Pro Gin Pro Ser lys 

642 657 672 

ACT GCC GTC ATT COG GAC TAC ATG GGG GAT CTT TAC GGG CTT CAG TCT GGG GAG 
Ser Ala Val He Pro Asp Tyr MET Arg Asp Leu Tyr Arg Leu Gin Ser -Gly Glu 

667 702 717 732 

GAG GAG GAA GAG CAG ATC CAC AGC ACT GGT CTT GAG TAT OCT GAG CGC CCS GCC 
Glu Glu Glu Glu Gin He His Ser Thr Gly Lau Glu Tyr Pro Glu Arg Pro Ala 

747 762 777 

AGC C3G GCC AAC AOC GIG AGG AGC TIC CAC CAC GAA GAA CAT CIG GAG AAC ATC 
Ser Arg Ala Asn Car Val Arg Ser Phe His His Glu Glu Kis-Leu-Glu Asn lie 



41 



EP 0 313 578 B1 



792 807 822 837 

OCA GGG ACC ACT GAA AAC TCI GCT TIT OCT TIC CIC TIT AAC CIC AGC AGC ATC 

Pro Gly &r Ser Glu Asn Ser Ala Ifce Arg ae Leu Rie Asn Leu Ser Ser lie 

852 867 882 897 

OCT GAG AAC GAG GIG ATC TCC TCT GCA GAG CIT CGG CIC TIC CGG GAG CAG GIG 
at> Glu Asn Glu Val lie Ser Ser Ala Glu Lau Arg leu Efae Arg Glu Gin Val 

912 927 942 

GAC CAG GGC CCT GAT TCG GAA AGG GGC TIC CAC OCT ATA AAC ATT TAT GAG GIT 
Asp Gin Gly Pro Asp Trp Glu Arg Gly Rie His Arg lie Asn lie Tyr Glu Val 

957 972 987 1002 

ATG AAG CCC CCA GCA GAA GIG GIG OCT GGG CAC CIC ATC ACA CGA CIA CIG GAC 
MET Lys Pro Pro Ala Glu Val Val Pro Gly Kis Leu lie Bar Arg Leu Leu Asp 

1017 1032 1047 

AOG AGA CIG' GIC CAC CAC AAT GIG ACA CGG TOG GAA ACT TIT GAT GIG AGC OCT 
Ihr Arg Leu Val His His Asn Val Ear Arg, Trp. Glu Eir-Ehe Asp Val Ser .Pro . 

1062 1077 1CS2 1107 

GOG GIC CIT CGC TGG ACC CGG GAG. AAG .CAG CCA AAC TAT GGG CIA GOC. AIT GAG. 

Ala Val Leu Arg Trp Brr Arg Glu Lys Gin Pro Asn Tyr Gly Leu Ala lie Glu 

H22 1137 1152 1167 

GIG ACT CAC CIC CAT CAG ACT 03G ACC CAC CAG GGC CAG CAT GTC AGG ATT* AGC 
Val Uir His leu His Gin ar Arg Bir His Gin Gly Gin His Val Arg lie Ser 

1182 1197 1212 

OGA TOG TEA OCT CAA GGG ACT GGG AAT TCG GOC CAG CIC C5G COC CIC CIG GTC 
Arg Ser Lai Pro Gin Gly Ser Gly Asn Trp Ala Gin Leu Arg Pro Leu Leu Val 

1227 1242 1257 1272 

ACC TIT GGC CAT GAT GGC CGG GGC CAT GCC TIG AOC CGA OGC GGG AGG GOC AAG 
Bxr Fhe Gly His Asp Gly Arg Gly His Ala Leu Ihr Arg Arg Arg Arg Ala lys 

1287 1302 1317 

CCT AGC CCT AAG CAT CAC TCA CAG CGG GOC AGG AAG AAG AAT AAG AAC TCC OGG 
Arg Ser Pro lys His His Ser Gin Arg Ala Arg Lys Lys Asn Lys Asn Cys Arg 

1332 1347 1362 1377 

OGC CAC TOG CIC TAT CIG GAC TIC AGC GAT GIG GGC TCG AAT GAC TCG ATT GIG 

Arg His Ser Leu iyr Val Asp Rie Ser Asp Val Gly Trp Asn Asp Trp He Val 

1392 1407 1422 1437 

GCC CCA CCA GGC TAC CAG GOC TIC TAC TCC CAT GGG GAC TCC CCC TIT CCA CIG 
Ala Pro Pro Glv Tvr Gin Ala Rie TVr Cvs Kis Glv Asd Cvs Pro Rie Pro Leu 

1452 1467 1482 

GCT GAC CAC CTC AAC TCA ACC AAC CAT GCC ATT GTG CAG AOC CIG CTC AAT TCT 
Ala Asp His Leu Asn Ser Tfcr Asn Kis Ala He Val Cin Bar leu Val Asn Ser 



42 



EP 0 313 578 B1 



1497 1512 1527 1542 

GTC AAT TCC ACT KTC CCC AAA GCC TCT TOT GIG OOC ACT GAA CIG ACT GCC ATC 
Val Asn Ser Ser lie Pro Lys Ala cys cys Val Pro Thr Glu Leu Ser Ala lie 

1S57 1572 1587 

TCC ATC C1G TAC CIG GAT GAG TAT GAT AAG GIG GTA CIG AAA AAT TAT CAG GAG 
Ser MET Leu Tyr Lea Asp Glu Tyr Asp lys Val Val Leu Lys Asn ayr Gin Glu 

1602 1617 (408) 1636 1646 1656 

AIG GTA GXA GAG GGA TGI GGG TCC CSC TGAGATCAGG CAGICCITCA GGATAGACAG 
MET Val Val Glu Gly Cys Gly Cys Arg 



1666 1676 1686 1696 1706 

ATATACACAC CACACACACA CACCACATAC ACCACACACA CACGTTCCCA 

1716 1726 1736 1746 1756 

TCCACTCACC CACACACTAC ACAGACTGCT TCCTTATAGC TGGACTTTTA 

1766 1776 1786 1796 1806 

TTTAAAAAAA AAAAAAAAAA AATGGAAAAA ATCCCTAAAC ATTCACCTTG 

1816 1826 1836 1846 1856 

ACCTTATTTA TGACTTTACG TGCAAATGTT TTGACCATAT TGATCATATA 

1866 1876 1886 1896 1906 

TTTTGACAAA ATATATTTAT AACTACGTAT TAAAAGAAAA AAATAAAATG 

1916 1926 1936 1946 

AGTCATTATT TTAAAAAAAA AAAAAAAACT CTAGAGTCGA CGGAATTC 



12. Gen, das menschliches BMP-4 codiert, das die in Anspruch 11 angegebene Aminosauresequenz aufweist. 

13. Gen, das ein Protein codiert, das Eigenschaften von BMP-4 zeigt, und eine DNA-Sequenz umfaGt, die: 

(a) sich in der Codonsequenz infolge der Degeneriertheit des genetischen Codes von einer DNA-sequenz 
nach Anspruch 11 unterscheidet; 

(b) mit einer DNA-Sequenz nach Anspruch 11 Oder nach vorstehendem Absatz (a) hybridisiert; oder 

(c) ein Fragment, eine allelische oder eine andere variation einer DNA-Sequenz nach Anspruch 11 darstellt, 
unabhangig davon, ob die Variation zu Anderungen in der Pepttdsequenz fuhrt oder nicht. 

14. DNA-Sequenz nach Anspruch 13, dadurch gekennzeichnet, daG sie eine genomische DNA-Sequenz ist. 
16. DNA-Sequenz nach Anspruch 13, dadurch gekennzeichnet, daG sie eine cDNA-Sequenz ist. 

16. Vektor, enthaltend das Gen oder die DNA-Sequenz nach einem der Anspruche 1 bis 15 in einer funktionellen 
Verbindung mit einer Expressions-Kontrollsequenz. 

17. Zelle, dadurch gekennzeichnet, daG sie mit einem Vektor nach Anspruch 16 transformiert ist. 

18. Zelle nach Anspruch 17, dadurch gekennzeichnet, daG sie eine Saugerzelle, eine Bakterienzelle, eine Insekten- 
zelle oder eine Hefezelle ist. 



43 



EP 0 313 578 B1 



19. Zelle nach Anspruch 18, dadurch gekennzeichnet, daB sie eine CHO-Zelle ist. 

20. Protein, das Eigenschaften von BMP-2 aufweist, das durch ein Gen oder eine DNA-Sequenz nach einem der 
Anspruche 1 bis 10 codiert ist. 

21. Protein, das Eigenschaften von BMP-2 aufweist, das erhaltlich ist durch die Schritte 

Zuchten einer mit einem Expressionsvektor transformierten Zelle in einem geeigneten Kulturmedium, wobei 
der Vektor ein Gen oder eine DNA-Sequenz nach einem der Anspruche 1 bis 10 umfaBt, und 

Gewinnen des Proteins aus dem Kulturmedium. 

22. Protein, das Eigenschaften von BMP-4 aufweist, das durch ein Gen oder eine DNA-Sequenz nach einem der 
Anspruche 11 bis 15 codiert ist. 

23. Protein, das Eigenschaften von BMP-4 aulweist, das erhaltlich ist durch die Schritte 

Zuchten einer mit einem Expresionsvektor transformierten Zelle in einem geeigneten Kulturmedium, wobei 
der Vektor ein Gen oder eine DNA-Sequenz nach einem der Anspruche 11 bis 15 umfaBt und 

Isolieren des Proteins aus dem Kulturmedium. 

24. Verfahren zur Herstellung des Proteins nach Anspruch 21 oder 23, umfassend die Schritte 

Zuchten der Zelle nach Anspruch 1 7 in einem geeigneten Kulturmedium und 
Gewinnen des Proteins aus dem Kulturmedium. 

25. Arzneimittel, dadurch gekennzeichnet, daB es, einzeln oder in Kombination, die Proteine nach einem der Anspru- 
che 20 bis 23 und einen pharmakologisch vertraglichen Trager umfaBt. 

26. Arzneimittel nach Anspruch 25, dadurch gekennzeichnet, daB es ferner eine Matrix umfaBt, die fahig ist, das 
Arzneimittel an die Stelle des Knochen- oder Knorpelschadens zu liefern und eine Struktur zur Induktion der Kno- 
chen- oder Knorpelbildung bereitzustellen. 

27. Arzneimittel nach Anspruch 26, dadurch gekennzeichnet daBdie Matrix Hydroxyapatit, Kollagen, Polyessigsaure 
oder Tricalciumphosphat umfaBt. 

28. Verwendung des Proteins nach einem der Anspruche 20 bis 23, einzeln oder in Kombination, zur Herstellung eines 
Arzneimittels zur Induktion der Knochen- oder Knorpelbildung. 



Patentanspruche fur folgenden Vertragsstaat : AT 

1. Verfahren zur Herstellung eines menschliches BMP-2 codierenden Gens, das die nachfolgende DNA-Sequenz 
umfaBt: 



44 



EP 0 313 578 B1 



10 


20 


30 


40 


50 


GTCGACTCTA 


GAGTGTGTGT 


CAGCACTTGG 


CTGGGGACTT 


CTTGAACTTG 


60 


70 




90 


100 


CAGGGAGAAT 


AACTTGCGCA 


CCCCACTTTG 


CGCCGGTGCC 


TTTGCCCCAG 


110 


120 


130 


140 


150 


CGGAGCCTGC 


TTCGCCATCT 


CCGAGCCCCA 


CCGCCCCTCC 


ACTCCTCGGC 


160 


1 70 


iOU 




£ V V 


CTTGCCCGAC 


ACTGAGACGC 


TGTTCCCAGC 


GTGAAAAGAG 


AGACTGCGCG 


0 1 0 

£, JL \J 




o ^ n 




« 9 V 




\9 v» \s nu r\J\\3 Kj4\ 




a a a Aftr; A Arv? 




260 


270 


280 


290 


300 


CCTTGCGCCA 


GGTCCTTTGA 


CCAGAGTTTT 


TCCATGTGGA 


CGCTCTTTCA 


310 


320 


330 


340 


350 


ATGGACGTGT 


CCCCGCGTGC 


TTCTTAGACG 


GACTGCGGTC 


TCCTAAAGGT 



(1) 370 385 400 

OGAOC AIG GIG GOC GGG AOC OGC TGT CTT GOG TIG CIG CXT OOC CAG GIC 

MET Val Ala Gly Uir Axg Cys Leu Leu Ala Leu Leu Leu Pro Gin Val 

415 430 445 

CTC CIG GGC GGC GOG GCT GGC CIC GIT COG GAG CIG GGC OGC AGG AAG TIC GOG 
Leu Leu Gly Gly Ala Ala Gly lizu Val Pro Glu Leu Gly Arg Arg Iys Rift Ala 

460 475 490 505 

<^ GQ5 ICS TCS GGC OK OOC TCa T0C CM OOC TCT <SM GAG GIC CIG AGO GAG 

.Ua Ala Ser Ser Gly Arg Pro Ser Ser Gin Pro Ser Asp Glu Val Leu Ser Glu 

. 520 535 550 565 

TIC GAG TIG OGG CIG CIC AGC AIG TIC GGC CIG AAA CAG AGA COC AOC COC AGC 
rhe Glu Leu Arg l£u Leu Ser MET Rie Gly Leu Lys Gin Arg Pro Tfcr Pro Ser 

580 595 
AGG GAC GOC GIG GIG COC COC ^C AIG CIA GAC CIG TAT CGC 
Arg Asp Ala Val Val Pro Pro Tyr MET Leu Asp Leu Tyr Arg 



610 

AGG CAC TOG -GGT 
Arg His Ser Gly 



45 



EP 0 313 578 B1 



625 640 655 670 

CAG 003 GGC TCA O0C GOC OCA GAC CAC CGG TIG GAG AGG GCA GCC AGC GGA GOC 
GLn Pro Gly Ser Pro Ala Pro Asp His Arg leu Glu Arg Ala Ala Ser Arg Ala 

665 700 715 

AAC ACT GIG OGC AGC TIC CAC CAT GAA GAA TCT TIG GAA GAA CIA CCA GAA AOG 
Asn Ihr Val Arg Ser Phe His His Glu Glu Ser Leu Glu Glu Leu Pro Glu Thr 

730 745 760 775 

ACT GGG AAA ACA AOC OGG AGA TIC TIC TIT AAT TEA ACT TCT ATC OOC AOS GAG 

Ser Gly Lys Thr Car Arg Arg Hie Itae Phe Asn Leu Ser Ser lie Pro Thr Glu 

790 805 820 " 835 

GAG TIT ATC AOC TCA GCA GAG CIT CAG GIT TIC CGA GAA CAG ATC CAA GAT GCT 
Glu She lie ttr Ser Ala Glu Leu Gin Val Phe Arg Glu Gin MET Gin Asp Ala 

850 865 880 

TTA GGA AAC AAT AGC ACT TIC CAT CAC 0GA ATT AAT ATT TAT GAA ATC ATA AAA 
Leu Gly Asn Asn Ser Ser Phe His His Arg lie Asn lie Tyr Glu lie lie lys 

895 910 925 940 

OCT GCA ACA GOC AAC TOG AAA TIC OOC GIG AOC ACT CIT TIG GAC AOC AGG TIG 
Pro Ala Thr Ala Asn Ser lys Rie Pro Val Bur Ser Leu Leu Asp Bur Arg Leu 

955 970 985 

GIG AAT CAG AAT GCA AGC AGG TGG GAA ACT TIT GAT GIC AOC OOC GCT GIG AUG 
Val Asn Gin Asn Ala Ser Arg Trp Glu Ser Phe Asp Val Thr Pro Ala Val MET 

1000 1015 1030 1045 

GGG TGG ACT GCA CAG GGA CAC GOC AAC CAT GGA TIC GIG GIG GAA GIG GCC CAC 

Arg T*p Bur Ala Gin Gly His Ala Asn His Gly Ihe Val Val Glu Val Ala His . 

1060 1075 1090 11*05 

TIG GAG GAG AAA CAA GCT GIC T0C AAG AGA CAT GIT AGG ATA AGC AGG TCT TIG 
leu Glu Glu lys Gin Gly Vial Ser Lys Arg His Val" Arg lie Sef'ArgTSer l£u' 

1120 1135 1150 

CAC CAA GAT GAA CAC AGC TGG TCA CAG AIA AGG CCA TIG CIA CIA ACT TIT GGC 
His Gin Asp Glu His Ser Trp Ser Gin lie Arg Pro Leu Leu Val Bur Bie Gly 

1165 1180 1195 1210 

CAT GAT GGA AAA GGG CAT OCT CIC CAC AAA AGA GAA AAA OCT CAA GOC AAA CAC 
His Asp Gly lys Gly His Pro l£u His Lys Arg Glu lys Arg Gin Ala lys His 

1225 1240 1255 

AAA CAG OGG AAA OGC CIT AAG T0C AGC TCT AAG AGA CAC OCT TIG TAC -GIG GAC 
Lys Gin Arg Lys Arg Leu Lys Ser Ser Cys Lys Arg Kis Pro Leu Tyr Val Asp 

1270 1285 1300 1315 

TTC ACT GAC GTG GGG TGG AAT GAC TGG ATT CTG GCT OOC COG <3GG TAT CAC "GGC 
?he Ser Asp Val Gly Tip Asn Asp Trp lie Val Ala Pro Pro Gly Tyr His Ala 
1330 1345 1360 1375 

TIT TAC TGC CAC GGA GAA TGC OCT TIT CCT CX -GCT -GAT CAT CIG AAC TCC ACT 
?he Tyr Cys His Gly Glu Cys Pro ^e Pro Leu Ala As? His Leu Asn Ser Bx 

1390 1405 1420 

AAT CAT GCC ATT CIT CAG AOG TIG GIC AAC TCT CIT AAC TCT AAG ATT CCT AAG 
Ash His Ala He Val Gin Bar Leu Val Asn ser Val Asn Ser lys He Pro Lys 



46 



EP 0 313 578 B1 



1435 1450 . 1465 1480 

GCA TCC .1CT GIC COG ACA GAA CIC ACT GCT ATC TCS'ATO CTC TAC CTT GAC GAG 
Ala Cys Cys Val Pro Bir Glu Leu Ser Ala lie Ser MET Leu Tyr Lea Asp Glu 

1495 1510 1525 

AAT GAA AAG GIT GIA TTA AAG AAC TAT CAG GAC ATC GIT GIG GAG GGT TGT GOG 
Asn Glu Lys Val Val Leu lys Asn Tyr Glu Asp MET Val Val Glu Gly Cys Gly 

1540 (396) 1553 1563 1573 1583 159 3 1603 

TGT CGC 2MEACAGCA AAAITAAA3R OMAAAIAIA TAIAIAIATA TATAITITAG AAAAAAGAAA 
cys Arg 

AAAA, 

wobei das Verfahren die nachfolgenden Schritte umfaGt: 

(a) Absuchen einer Genbank durch Hybridisieren mit einem markierten bBMP-2-Fragment, wobei die Genbank 
aus einer von U-2 OS abgeleiteten DNA oder cDNA konstruiert war, 

(b) Isolieren positiver Clone und 

(c) Isolieren der DNA-lnsertionen aus diesen Clonen. 

2. Verfahren naeh Anspruch 1. dadurch gekennzeichnet, dafJ das Gen menschliches BMP-2 codiert, das die in An- 
spruch 1 angegebene Aminosauresequenz aufweist. 

3. Verfahren zur Herstellung eines Gens, das ein Protein codiert, das Eigenschaften von menschlichem BMP-2 zeigt, 
und eine DNA-Sequenz umfaGt, die: 

(a) sich in der Codonsequenz infolge der Degeneriertheit des genetischen Codes von einer DNA-Sequenz 
nach Anspruch 1 unterscheidet; 

(b) mit einer DNA-Sequenz nach Anspruch 1 oder nach vorstehendem Absatz (a) hybridisiert; Oder 

(c) ein Fragment, eine allelische oder eine andere Variation einer DNA-Sequenz nach Anspruch 1 darstellt, 
unabhangig davon, ob die Variation zu Anderungen in der Peptidsequenz fuhrt oder nicht, 

wobei das Verfahren Standardtechniken der Molekularbiologie umfaGt. 

4. Verfahren nach Anspruch 3 : dadurch gekennzeichnet, da3 die DNA-Sequenz eine genomische DNA-Sequenz ist. 

5. Verfahren nach Anspruch 3 ; dadurch gekennzeichnet, daG die DNA-Sequenz eine cDNA-Sequenz ist. 

6. Verfahren zur Herstellung eines Rinder-BMP-2 codierenden Gens, umfassend die nachfolgende DNA-Sequenz: 



47 



EP 0 313 578 B1 



(1) 15 20 45 

GGC CAC GAT GGG AAA GGA CAC CCT CTC CAC AGA AGA CAA A-AG CGG 
G H D C X G H ? L H R ^ 2 S 

60 75 90 

CAA GCA AAA CAC AAA CAG CGG AAA CGC CTC AAG TCC AGC TGT AAG 
Q A X H X Q 3 X X L X S S C X - 

105 120 135 

AGA CAC CCT TTA TAT GTG GAC TTC AGT GAT GTG GGG TGG AAT GAC 
R H ? L Y V D ? S D V G W N D 

150 165 180 

TGG ATC GTT GCA CCG CCG GGG TAT CAT GCC TTT TAC TGC CAT GGG 
WIVA? PGYH A F Y C K G 

195 .210 225 

GAG TGC CCT TTT CCC CTG GCC GAT CAC CTT AAC TCC ACG AAT CAT 
Z CP F ? LA D H LN S T N H 

240 255 . - ? 70 

GCC - ATT * CTC* CXAACT : CTG^TC" "AX'fc" 'TCA GTT AAC" TCT \AAG ATT CCC 
A I V Q T L. V N S V >X S X I ? 

' • * ' 3 8-5-T* ' - -"2QQ '" ■ 31*5 

AAG GCA TGC TGT GTC CCA ACA GAG CTC AGC GCC ATC TCC ATG CTG 
X ACCV ? T Z L S A I S M L 

30 330 245 360 

TAC CTT GAT GAG AAT GAG AAG GTG GTA TTA AAG AAC TAT CAG GAC 
Y LDZN ZXVVLX V Y O D 



70 



15 



20 



25 



35 



375 " (129) 297 407 

ATG GTT GTC GAG GGT TGT GGG TGT CGT TAGCACAGCA AAATAAAATA 
v V V Z G CGC?. 



40 417 427 437 447 457 

TAAATATATA TATATATATA TTAGAAAAAC AGCAAAAAAA TCAAGTTGAC 

467 477 487 497 507 

ACTTTAATAT TTCCCAATGA AGACTTTATT TATGGAATGG AATGGAGAAA 

45 

517 527 537 547 557 

AAGAAAAACA CAGCTATTTT GAAAACTATA TTTATATCTA CCGAAAAGAA 

567 577 587 

GTTGGGAAAA CAAATATTTT AATCAGAGAA TTATT 



wobei das Verfahren die nachfolgenden Schritte umfaGt: 

55 (a) Absuchen einer Genbank mit einer markierten auf derGrundlage der Aminosauresequenz eines Fragmen- 

tes von bBMP-2 entworfenen Sonde, wobei die Genbank aus Rinderleber-DNA Oder cDNA konstruiert wurde, 

(b) Isolieren positiver Clone und 



48 



EP 0 313 578 B1 

(c) Isolieren der DNA-lnsertionen aus diesen Clonen. 

7. Verfahren nach Anspruch 6, dadurch gekennzeichnet, daft das Gen Rinder-BMP-2 codiert, das die Aminosaure- 
sequenz von Anspruch 6 aufweist. 

8. Verfahren zur Herstellung eines Genes, das ein Protein codiert, das Eigenschaften von Rinder-BMP-2 zeigt, und 
DNA-Sequenzen umfaBt, die: 

(a) sich in der Codonsequenz infolge der Degeneriertheit des genetischen Codes von einer DNA-Sequenz 
nach Anspruch 7 unterscheiden; 

(b) mrt einer DNA-Sequenz nach Anspruch 7 oder nach vorstehendem Absatz (a) hybridisieren; Oder 

(c) Fragmente, allelische oder andere variationen einer DNA-Sequenz nach Anspruch 7 darstellen, unabhan- 
gig davon, ob die Variationen zu Anderungen in der Peptidsequenz fuhren oder nicht, 

wobei das Verfahren Standardtechniken der Molekularbiologie umfaGt. 

9. Verfahren nach Anspruch 8, dadurch gekennzeichnet, daB die DNA-Sequenz eine genomische DNA-Sequenz ist. 

10. Verfahren nach Anspruch 8, dadurch gekennzeichnet, daG die DNA-Sequenz eine cDNA-Sequenz ist. 

11. Verfahren zur Hersteilung eines menschliches BMP-4 codierenden Genes, das die nachfolgende DNA-Sequenz 
umfaBt: 



10 


20 


30 


40 


50 


CTCTAGAGGG 


CAGAGGAGGA i 


GGGAGGGAGG < 


GAAGGAGCGC 


GGAGCCCGGC 


60 


70 


80 


90 


100 


CCGGAAGCTA 


GGTGAGTGTG 


GCATCCGAGC 


TGAGGGACGC 


GAGCCTGAGA 


110 


120 


130 


140 


150 


CGCCGCTGCT 


GCTCCGGCTG 


AGTATCTAGC 


TTGTCTCCCC 


GATGGGATTC 


160 


170 


180 


190 


200 


CCGTCCAAGC 


TATCTCGAGC 


CTGCAGCGCC 


ACAGTCCCCG 


GCCCTCGGCC 


210 


220 


230 


240 


250 


AGGTTCACTG 


CAACCGTTCA 


GAGGTCCCCA 


GG AG CTGCTG 


CTGGCGAGCC 


260 


270 


280 


290 


300 


CGCTACTGCA 


GGGACCTATG 


GAGCCATTCC 


GTAGTGGCAT 


CCCGAGCAAC 


310 


320 


330 


340 


350 


GCACTGCTGC 


AGCTTCCCTG 


AGCCTTTCCA 


GCAAGTTTGT 


TCAAGATTGG 


360 


370 


380 


390 


400 


CTGTCAAGAA 


TCATGGACTG 


TTATTATATG 


CCTTGTTTTC 


TGTCAAGACA 



49 



EP 0 313 578 B1 



(1) 

CC ATG ATT CCT 
MET He Pro 



417 432 447 462 

GST AAC CGA ATG CIO ATG GTC GIT TTA TTA TGC CAA GTC CTG CXA GGA GGC GCS 
C-ly Asn Arg MET Leu MET Val Val Leu Lsu Cys Gin Val Lsu Leu Gly Gly Ala 

477 492 507 

AGC CAT GCT AGT TIG ATA CCT GAS ACS GGG AAG AAA AAA GTC GCC GAS ATT CAG 
Ser Kis Ala Ser Leu lie Pro Glu Z^r Gly Lys Lys Lys Val Ala Glu lie Gin 

522 537 552 567 

GGC CAC GCS GGA GGA CSC CGC TCA GGG CAG AGC CAT GAG CIC CIG CSG GAC TIC 

Gly Kis Ala Gly Gly Arg Arg Ser Gly Gin Ser His Glu Leu Leu Arg As? She 

582 5S7 612 627 

GAS GCS ACA CTT CIG CAS ATG TTT GGG CIG CGC CGC CGC CCS CAG CCT AGC AAG 
<Glu Ala T^r Leu Leu Gin MET Kie Gly Leu Arg Arg Arg Pro Gin Pro Ser Lys 

642 657 672 

AGT' GCC GTC ATT CCG GAC TAC ATS CSG GAT CTT TAC CGG CTT CAG TCT GGG GAG 
Ser Ala Val He Pro Asp Tyr MET Arg Asp Leu Tyr Arg Leu Glr. Ser Gly Glu 

637 702 "17 732 

GAG GAG GAA GAG CAG ATC CAC AGC ACT GGT CTT GAG TAT CCT GAG CSC CCG GCC 
Glu Glu Glu Glu Gin He His Ser T^r Gly Leu Glu Tyr Pro Glu Arg Fro Ala 

747 762 777 

AGC CSG GCC AAC AOC GIG AGG AGC TTC CAC CAC GAA GAA CAT CIG GAG AAC ATC 
Ser Arg Ala Asn Thr Val Arg Ser Phe Kis Kis Glu Glu Kis .Lsu jGIu Asn He 

792 607 S22 S37 

CCA GGG ACC AGT GAA AAC TCT GCT TTT CGT TTC CTC TTT AAC CIC AGC AGC ATC 

Pro Gly Thr Ser Glu Asn Ser Ala Sfce Arg Phe Leu She Asn Leu Ser Ser He 

652 667 882 S97 

CCT GAG AAC GAG GIG ATC TCC TCT GCA *GAG CTT CGG CTC TTC CGG GAG CAS GIG 
Pro Glu Asn Glu Val He Ser Ser Ala Glu Leu Arg leu Phe Arg Glu Gin Val 

912 927 942 

GAC CAG GGC OCT GAT TGG GAA AGG GGC TIC CAC OCT ATA AAC AIT TAT GAG GIT 
Asp Gin Gly Pro Asp Trp Glu Arg Gly Phe Kis Arg He Asn He Tyr Glu Val 

957 972 937 1002 

ATG AAG CCC CCA GCA -GAA GIG GTS CCT GGG CAC CTC ATC ACA CGA CIA CIG GAC 
MET Lys Pro Pro Ala Glu Val Val Pro Gly His Leu He Thr Arg Lsu Leu Asp 

1017 1032 1047 

ACS AGA CIG GTC CAC CAC AAT GTG ACA 'CSG TGG -GAA ACT TTT'GAT GIG AGC CCT 
Thr Arg Leu Val His His Asn Val Tzz Arg. Trp Glu T*ir- Phe Asp .Val Ser .Pro 

1062 1077 1092 1107 

GCG GTC CTT CSC TGG ACC CSG C-JS.AAG.CAG CCA AAC TAT GGG CIA GCC. ATT GAG . 

Ala Val Leu Arg Trp Thr Arg Glu Lys Gin Pro Asn Tyr Gly Leu Ala lie Glu 



50 



EP 0 313 578 B1 



1122 1137 1152 1167 

GIG ACT CAC CIC CAT CAG ACT CGG ACC CAC CAG GGC CAG CAT GIC AGG ATI* AGC 
Val l^r Kis Leu His Gin Uxr Arg Us: His Gin Gly Gin His Val Arg He Ser 

1132 1197 1212 

CZZ TCG TTA OCT OA GGG AG! GGG AAT TGG GOC CAG CTC CGG CCC CIC CIG GTC 
Arg Ser Leu Pro Gin Gly Ser Gly Asr. Trp Ala Gin leu Arg Pro Lsu Leu Val 

. 1227 1242 1257 1272 

ACC TTT GGC CAT GAT GGC C3G GGC CT GCC TIG ACC CGA CGC CGG AGG GCC AAG 
— Sfca Gly His Asp Gly Arg Gly His Ala Leu Taz Arg Arg Arg Arg Ala Lys 

1287 1302 1317 

CGT AGC CCT AAG CAT CAC TCA CAG CGG GCC AGG AAG AAG AAT AAG AAC TGC GGG 
Arg Ser Pro Lys His His Ser GLn Arg Ala Arg Lys Lys Asn Lys Asn C*s Arg 

1332 1347 1362 1377 

CGC CAC TCG CIC TAT GIG GAC TIC AGC GAT GIG GGC TGG AAT GAC TGG ATT GIG 

Arg His Ser Leu Tyr Val Asp rtie Ser Asp Val Gly Trp Asn Asp Trp lie Val 

1392 - 1407 1422 1437 

GCC CCA CCA GGC TAC CAG GCC TIC TAC TGC CAT GGG GAC TGC CCC TTT CCA CIG 
Ala Pro Pro Gly TVr Gin Ala Phe T/r Cvs His Glv Aso Cvs Pro P^e Pro leu 

1452 K67 1482 

GOT GAC CAC CIC AAC TCA ACC AAC CAT GCC AIT GIG CAG ACC CIG GIC AAT TCT 
Ala Asp His Leu Asn Ser ^-r Asn His Ala He Val Gin T*ir Leu Val Asn Ser 

1497 1512 .. 1527 1542 

GTC AAT TCC ACT ATC CCC AAA GCC TCP TCP GIG CCC ACT GAA CIG ACT GCC ATC 
Val Asn Ser Ser lie Pro lys Ala Cys Cys Val Pro 2fcr Glu Leu Ser Ala lie 

1557 1572 1587 

TCC ATC CIG TAC CIG GAT GAG TAT GAT AAG GTG GTA CIG AAA AAT TAT CAG GAG 
Ser MET Leu Tyr leu Asp Glu Tyr Asp lys Val Val Lsu Lys Asn Tyr Gin Glu 

1602 1617 (406) 1636 164 6 1656 

ATG GTA GTA GAG GGA TGT GGG TGC CGC TGAGATCAGG C^GTCCITGA GGAXAGACAG 
MET Val val Glu Gly Cys Gly cys Arg 



1666 1676 1686 1696 1706 

ATATACACAC CACACACACA CACCACATAC ACCACACACA CAGGTTCCCA 

1716 1726 1736 1746 1756 

TCCACTCACC CACACACTAC ACAGACTGCT TCCTTATAGC TGGACTTTTA 

1766 1776 1786 1796 1806 

TTTAAAAAAA AAAAAAAAAA AATGGAAAAA ATCCCTAAAC ATTCACCTTG 



51 



EP 0 313 578 B1 



10 



15 



1816 1826 1836 1846 1856 

ACCTTATTTA TGACTTTACG TGCAAATGTT TTGACCATAT TGATCATATA 

1866 1876 1886 1896 1906 

TTTTGACAAA ATATATTTAT AACTACGTAT TAAAAGAAAA AAATAAAATG 

1916 1926 1936 1946 

AGTCATTATT TTAAAAAAAA AAAAAAAACT CTAGAGTCGA CGGAATTC 

wobei das Verfahren die nachfolgenden Schritte umfaGt: 

(a) Absuchen einer Genbank durch Hybridisieren mit einem markierten bBMP-2-Fragment, wobei die Genbank 
aus einer von U-2 OS abgeleiteten DNA Oder cDNA konstruiert war, 

(b) Isolieren positiver Clone und 

(c) Isolieren der DNA-lnsertionen aus diesen Clonen. 

20 12. Verfahren nach Anspruch 11, dadurch gekennzeichnet, daG das Gen menschliches BMP-4 codiert, das die in 
Anspruch 1 1 angegebene Aminosauresequenz aufweist. 

13. Verfahren zur Herstellung eines Genes, das ein Protein codiert, das Eigenschaften von BMP-4 zeigt, und eine 
DNA-Sequenz umlaGt, die: 

25 

(a) sich in der Codonsequenz infolge der Degeneriertheit des genetischen Codes von einer DNA-Sequenz 
nach Anspruch 1 1 unterscheidet: 

(b) mit einer DNA-Sequenz nach Anspruch 11 oder vorstehendem Absatz (a) hybridisiert; oder 

(c) ein Fragment, eine allelische oder eine andere Variation einer DNA-Sequenz nach Anspruch 11 darstellt, 
unabhangig davon, ob die Variation zu Anderungen in der Peptidsequenz fuhrt oder nicht, 

wobei das Verfahren Standardtechniken der Molekularbiologie umfaGt. 

14. Verfahren nach Anspruch 1 3, dadurch gekennzeichnet, daG die DNA-Sequenz eine genomische DNA-Sequenz ist. 

15. Verfahren nach Anspruch 13, dadurch gekennzeichnet, daG die DNA-Sequenz eine cDNA-Sequenz ist. 

40 16. Vektor, enthaltend das Gen oder die DNA-Sequenz nach einem der AnsprOche 1 bis 15 in einer funktionellen 
Verbindung mit einer Expressions-Kontrollsequenz. 

17. Zelle, dadurch gekennzeichnet, daG sie mit einem Vektor nach Anspruch 16 transformiert ist. 

45 18. Zelle nach Anspruch 17, dadurch gekennzeichnet, daG sie eine Saugerzelle, eine Bakterienzelle, eine Insekten- 
zelle oder eine Hefezelle ist. 

19. Zelle nach Anspruch 18, dadurch gekennzeichnet, daG sie eine CHO-Zelle ist. 

50 20. Verfahren zur Herstellung eines Proteins, das Eigenschaften von BMP-2 zeigt : umfassend die Schritte 

Zuchten einer mit einem Expressionsvektor transformierten Zelle in einem geeigneten Kulturmedium, wobei 
der Expressionsvektor ein Gen oder eine DNA-Sequenz umfaGt, die nach einem der AnsprOche 1 bis 10 
hergestellt wurden, und 

55 

Gewinnen des Proteins aus dem Kulturmedium. 
21 . Verfahren zur Herstellung eines Proteins, das Eigenschaften von BMP-4 zeigt, umfassend die Schritte 



30 



35 



52 



EP 0 313 578 B1 



10 



30 



35 



Zuchten einer mit einem Expressionsvektor transformierten Zelle in einem geeigneten Kulturmedium, wobei 
der Expressionsvektor ein Gen Oder eine DNA-Sequenz umfaGt, die nach einem der AnsprOche 11 bis 15 
hergestellt wurden, und 

Gewinnen des Proteins aus dem Kutturmedium. 
22. Verfahren zur Herstellung eines Proteins, das Eigenschaften von BMP-2 Oder BMP-4 zeigt, umfassend die Schritte 
Zuchten der Zelle nach Anspruch 17 in einem geeigneten Kulturmedium und 
Isolieren des Proteins aus dem Kulturmedium. 



23. Verfahren zur Herstellung eines Arzneimittels, dadurch gekennzeichnet, daG es ein Kombinieren der nach einem 
der AnsprOche 20 bis 22 hergestellten Proteine, einzeln oder in Kombination, mit einem pharmakologisch vert ra g- 
's lichen Trager umfaGt. 

24. Vertahren nach Anspruch 23, dadurch gekennzeichnet, daG das Arzneimitteltemer eine Matrix umfaGt, die fahig 
ist, das Arzneimittel an die Stelle des Knochen- oder Knorpelschadens zu liefem und eine Struktur zur Induktion 
der Knochen- oder Knorpelbildung bereitzustellen. 

20 

25. Verfahren nach Anspruch 24, dadurch gekennzeichnet, daG die Matrix Hydroxyapatit, Kollagen, Polyessigsaure 
oder Tricalciumphosphat umfaGt. 

26. Verwendung eines Proteins nach einem der AnsprOche 20 bis 22, einzeln oder in Kombination, zur Herstellung 
25 eines Arzneimittels zur Induktion der Knochen- oder Knorpelbildung. 

Revendications 



Revendications pour les Etats contractants suivants : BE, CH, DE, FR, GB, IT, LI, LU, NL, SE 

1. Gene codant pour la BMP-2 humaine comprenant la sequence d'ADN suivante : 



40 



45 



so 



55 



53 



EP 0 313 578 B1 



10 20 30 -40 50 60 70 

GICGACTCIA GAGTCIUIGT CAGCACITGG CTGGGGACXT CITGAACTTC CAGGGAGAAX AACTIGCGCA 



80 90 100 110 120 130 140 

occcaciTit; cgccsgigcc ttigooxag cggagcctgc ttogoc\tct OOSAGOCOCA OQGOOOCDCC 



150 160 170 180 190 200 210 

ACTCCTOGGC CircCCOl^C ACIGAGACGC TZTTCCCZGC CT^AAAAGAG AGACIGCGOG GCOGGCACCC 



220 230 240 250 250 270 1 230 

GGGAGAAGGA GGAGGCAAAG AAAAGGAACG GACATTOGGT CCTTCCGCCA GGTCCITIGA OdAGAGim 



29.0 300- -310 - 320 *330 340 :-350 

TCOJDGTGGA CTOXTTICA AIGGAOGIGT CCCCGOGIGC TIUHSiSACG GACIGCGGIC TOCTAAAGGT 



(1) 370 365 400 

CGACC ATC GIG GCC GGG ACC CSC TGT CTT CTA GCS TIG CIG CTT CCC CAG GIC 
MET Vel Ala Gly Err Arg Cys Leu Leu Ala Leu Leu Leu Pro Gin Val 

415 430 445 

CTC CIG GGC GGC GCG GOT GGC CIC GTT CCG GAG CIG GGC CGC AGG AAG TIC GGG 
Lsu Leu Gly Gly Ala Ala Gly Leu Val Fro Glu Leu Gly Arg Arg Lys Phe Ala 

450 475 490 505 

GCG GCG TCG TOG GGC OGC CGC TCA TCC C^G CCC TCT GAC GAG GTC CIG AGC GAG 

Ala Ala Ser Ser Gly Arg; Pro Ser Ser Gin Pro Ser Asp Glu Val Lsu Ser Glu 

520 535 550 565 

TIC GAG TIG CGG CIG CIC AGC ATC TIC GGC CIG AAA CAG AGA CCC ACC CCC AGC 
e Glu Leu Arg Leu Leu Ser MTT Rie Gly Leu Lys Gin Arg Pro ^jt Pro Ser 

530 595 510 

AGG GAC GOC CIG GIG CCC CCC TAC AZG CLA GAC CIG TAT CGC AGG CAC TCG OCT 
Arg Asp Ada Val Val Pro Pro Tyr >m Leu Asp Lsu Tyr Arg Arg His Ser Gly 

625 640 655 670 

C-G CCG GGC 1CA CCC GCC CCA GAC CAC CGG TIG G-G AGG CCA GCC AGC CGA GCC 
GL" Pro Gly Ser Pro A J. a Pro Asp His Arg Leu Glu Arg AJa A2a Ser Arg A-le 

635 700 715 

AAC ACT GIG CGC AGC TTC CAC C-T GAA GAA TCT TIG GAA "GAA CZA CCA GAA ACS 
Asn Thr Val Arg Ser P*e His His Glu Glu Ser Lsu Glu Glu Lsu Pro Glu Trx 



54 



EP 0 313 578 B1 



10 



15 



20 



25 



30 



35 



40 



45 



SO 



55 



730 745 760 775 

AG! GGG AAA ACA ACC 03G AGA TIC TTC TIT AAT TTA ACT TCP ATC CCC AOG GAG 

Ser Giy Lys Tnr Sir Arg Arg Pfce Hie ?he Asn Leu Ser Ser lie Pro T!ir Glu 

790 805 820 835 

GAG TIT ATC ACC TCA GCA GAG CTT CAG GIT TIC CGA GAA CAG ATO CAA GAT GCT 
Glu Hie lie Uir Ser Ala Glu Leu Gin Val Hie Arg Glu Gin MET Gin Asp Ala 

850 865 880 

TTA GGA AAC AAT AGC ACT TTC CAT CAC CGA ATT AAT ATT TAT GAA ATC ATA AAA 
Leu Gly Asn Asn Ser Ser Hie His His Arg lie Asn lie TVr Glu lie lie Lys 

895 910 925 940 

OCT GCA ACA GCC AAC TOG AAA TTC COC GIG ACC ACT CTT TIG GAC ADC AGG TIG 
Pro Ala Thr Ala Asn Ser lys Rie Pro Val Eir Ser Leu leu Asp Cir Arg Leu 

955 970 985 

GIG AAT CAG AAT GCA AGC AGG TCG GAA ACT TTT GAT GTC ACC CCC GCT GIG AIG 
Val Asn Gin Asn Ala Ser Arg Trp Glu Ser Phe Asp Val Sir Pro Ala Val MET 

1000 1015 1030 1045 

CC-G 1GG ACT GCA CAG GGA CAC GCC AAC CAT GGA TTC GIG GIG GAA GIG GCC CAC 

Arg Trp Uir Ala Gin Gly His Ala Asn His Gly She Val Val Glu Val Ala His 

1060 1075 1090 1205 

TIG GAG GAG AAA. CAA GCT GTC TCC AAG AGA CAT CTT AGG ATA AGC AGG TCT TIG 
" Leu Glu Glu- Lys "Gin Gly Val Ser Lys Arg His Val 'Arg He Ser Arg- Ser jjeu 

1120 1135 . 1150 

CAC CAA GAT GAA CAC AGC TGG TCA CAG ATA AGG CCA TIG CIA CIA ACT TTT GGC 
His Gin Asp Glu His Ser Trp Ser Gin lie Arg Pro Leu Leu Val Thr Hie Gly 

1165 1180 1195 1210 

CAT GAT GGA AAA GGG CAT OCT CIC CAC AAA AGA GAA AAA OCT CAA GCC AAA CAC 
His Asp Gly Lys Gly His Pro Leu His Lys Arg Glu Lys Arg Gin Ala Lys His 

1225 1240 1255 

AAA CAG CGG AAA CGC CTT AAG TCC AGC TCT AAG AGA CAC CCT TIG TAC GIG GAC 
Lys Gin Arg Lys Arg Leu Lys Ser Ser Cys Lys Arg His Pro Leu Tyr Val Asp 

1270 1255 1300 1315 

•TIC AGT GAC GIG GGG TGG AAT GAC TCG ATT -GIG GCT CCC CCG GGG TAT CAC GCC 

Hie Ser Asp Val Gly Trp Asn Asp Trp lie Val Ala Pro Pro Gly Tyr His Ale 

1330 1345 1350 1375 

TIT TAC TCC CAC GGA GAA TCC CCT TIT CCT CIG GCT GAT CAT CTC AAC TCC ACT 
Hie T/r Cys His Gly Glu Cys Pro Hie Pro Leu Ala Asp His Leu Asn Ser Tir 

1390 1405 1420 

AAT CAT GCC ATT GIT CAG AOG TIG GTC AAC TCT GIT AAC TCT AAG ATT CCT AAG 
Asn His Ala lie Val Gin Thr Leu Val Asn Ser Val Asn Ser Lys He Pro Lys 



55 



EP 0 313 578 B1 



1*35 1450 . 1465 1430 

CCk TCC 7GT GIC COG ACA GAA CTC AJSI GCT ATC TCG ATG CTC TAC CTT GAC GAG 
Ala Cys Cys Val Pro Tr<r Glu Leu Ser Ala lie Ser MET Leu Tyr Leu Asp Glu 

1495 1510 1525 

AAT GAA AAG GIT GIA TTA AAG AAC TAT GAG GAC ATC GOT GTG GAG GGT TCT GGG 
Asn Glu Lys Val Val Ibu Iys Asn Tyr Gin Asp MET Val Val Glu Gly cys Gly 

1540(396) 1553 1563 1573 1583 1593 1603 

TGT OGC TAGTACAGCA AAA3TAAA2A CAIAAAXAIEA 1MAIAXAIA TOEA1LT1TAG AAAAAAGAAA 
Cys Arg 



AAAA 

Gene codant pour la BMP-2 humaine conriportant la sequence d'acides amines donnee a la revendication 1 . 

Gene codanl pour une proline montrant des proprietes de la BMP-2 humaine et comprenant une sequence 
d'ADN : 

(a) qui differe d'une sequence d'ADN de la revendication 1 dans la sequence de codons du fait de la dege- 
nerescence du code genetique ; 

(b) qui s'hybride avec une sequence d'ADN de la revendication 1 ou du paragraphe (a) ci-dessus ; ou 

(c) represente un fragment, une variation allelique ou autre d'une sequence d'ADN de la revendication 1 , que 
cette variation resulte de changements dans la sequence peptidique ou non. 

Sequence d'ADN suivant la revendication 3, qui est une sequence d'ADN g6nomique. 

Sequence d'ADN suivant Ea revendication 3 ; qui est une sequence d'ADNc. 

Gene codant pour la BMP-2 bovine comprenant la sequence d'ADN suivante : 



56 



EP 0 313 578 B1 



(1) 15 30 45 

GGC CAC GAT GGG AAA GGA CAC CCT CTC CAC AGA AGA GAA AAG CGG 
G HDGXGK?LHRREXH 

60 75 go 

CAA GCA AAA CAC AAA CAG CGG AAA CGC CTC AAG TCC AGC TGT AAG 
QAKHXQRXRLKSSCX 

105 120 135 

AGA CAC CCT TTA TAT GTG GAC TTC AGT GAT GTG GGG TGG AAT GAC 
RHp LYV DFS DVGWN D 

150 165 180 

TGG ATC GTT GCA CCG CCG GGG TAT CAT GCC TTT TAC TGC CAT GGG 
W I V A P P G Y H A F Y C H G 

195 210 225 

GAG TGC CCT TTT CCC CTG GCC GAT CAC CTT AAC TCC ACG AAT CAT 
~ . C P F P L A D H L N S T N H 

24 0 255 . 270 

GCC • ATT CTC- CXA ' ACT "CTG GTC AAC TCA GTT AAC TCT'AAG ATT CCC 
A IV QTL VNSVN SKIP 

. ' '"' 38-5" " • ' 300 '"" ~ 315 

AAG GCA TGC TGT GTC CCA ACA GAG CTC AGC GCC ATC TCC ATG CTG 
KAC CVP TE LS A1 SML 

330 345 36O 

TAC CTT GAT GAG AAT GAG AAG GTG GTA TTA AAG AAC TAT CAG GAC 
XIjDI: NZKVVL K N Y O D 

375 ' (129) 397 407 

ATG GaT GTC GAG GGT TGT GGG TGT CGT TAGCACAGCA AAATAAAATA 
% 2£ v 5 r, C G C R 

417 427 437 447 457 

TAAATATATA TATATATATA TTAGAAAAAC AGCAAAAAAA TCAAGTTGAC 

^rrv™, 467 477 487 <97 507 

ACTTTAATAT TTCCCAATGA AGACTTTATT TATGGAATGG AATGGAGAAA 

,^, > ,, 517 527 537 547 557 

AAGaAAaACA CAGCTATTTT GAAAACTATA TTTATATCTA CCGAAAAC-AA 

567 577 587 

GTTGGGAAAA CAAATATTTT AATCAGAGAA TTATT 



Gene codant pour la BMP-2 bovine contenant la sequence d'acides amines de la revendication 6. 

Gene codant pour une proteine montrant des proprietes de la 8MP-2 bovine et comprenant des sequences d'ADN : 

(a) qui different d'une sequence d'ADN de la revendication 7 dans la sequence des codons du fait de la de- 
generescence du code genetique ; 



57 



EP 0 31 3 578 B1 



10 



15 



20 



25 



30 



(b) qui s'hybrident avec une sequence d'ADN de la revendication 7 ou du paragraphs (a) ci-dessus ; ou 

(c) represented des fragments, des variations alleliques ou autres d'une sequence d'ADN de la revendication 
7, que ces variations r6suttent de changements dans la sequence peptidique ou non. 

9. Sequence d'ADN suivant la revendication 8, qui est une sequence d'ADN g^nomique. 

10. Sequence d'ADN suivant la revendication 8, qui est une sequence d'ADNc. 

11. Gene codant pour la BMP-4 humaine comprenant la sequence d'ADN suivante : 

10 20 30 40 50 * 60 70 

CTCXnGAGGG tii^GGAGGA GGGAGGGAGG GAAGGAGCSC GGAGOCCCGC CCZG^CCT^ GGIGAGIGIG 

BO 90 100 110 120 130 1<0 

GCAIXXSAGC TSAGGGAOGC GAGOCIGAGA CXXSCIC-CT GCICCGGCIG AGIMCI^GC TIGTCTCXXC 

150 160 170 180 190 200 210 

GATGGMTC CCGIXXAAGC TMCTOSAGC CIGCZGCCCC ACAGTCCCCG GCOCTCGCCC AGSTTCICIG 

220 230 240 250 260 270 280 

C?ACCGCTCrt G?£GTOOCCA GGAGCTCCIG CIGGOSAGCC CSCTACTCCA GG^CCITJG GAGCCMTCC 

290 300 310 320 330 240 350 

GIZuJTGCCXr CCCCZZCZAC GCJlCIGCT3C AGCTTOCrTG AGCCUTICCV GC^GTTTGT TC?-AGAITCG 

360' 370 " ' 380 "390 ' 400 (1) 

CTGTCaAGAA TCrtlGSrtCTG TiAi ' IA IMG CLTJJxlTl C TCTCAAGACA CC CCT 

.JET .He Pro 



35 



40 



45 



50 



55 



58 



EP 0 313 578 B1 



■ -117 432 447 462 

GGT AAC OGA AIG CIG AIG GTC GIT TTA TLA TCC CAA GIC CIG CTA GGA GGC GCG 
Gly Asn Arg MET Leu MET Val Val Leu leu Cys Gin Val Leu Leu Gly Gly Ala 

477 492 507 

AGC CAT GCT ACT TTC ATA OCT GAG ACS GGG AAG AAA AAA GTC GCC GAG ATT CAG 
Ser His Ala Ser Leu He Pro Glu Es: Gly Lys Lys Lys Val Ala Glu He Gin 

522 537 552 567 

GGC CAC GCG GGA GGA CCC QGC TCA GGG CAG AGC CAT GAG CTC CIG GGG GAC TTC 

Gly Kis Ala Gly Gly Arg Arg Ser Gly Gin Ser His Glu Leu leu Arg Asp Rie 

582 597 612 €27 

GAG GOG ACA CTT CIG CAG ATG TIT GGG CIG CSC OGC CCC COG CAG OCT AGC AAG 
-Glu Ala Ifcr Leu Leu Gin MET Ihe Gly leu Arg Arg Arg Pro Gin Pro Ser Lys 

642 657 672 

ACT GCC GTC AIT COS GAC TAC AIG 05G GAT CTT TAG OGG CTT CAG TCP GGG GAG 
Ser Ala Val lie Pro Asp Tyr MET Arg As? leu Tyr Arg Leu Gin Ser Gly Glu 

€87 702 717 732 

GAG GAG GAA GAG CAG ATC CAC AGC ACT CGI CTT GAG TAT CCT GAG CGC OCG GCC 
Glu Glu Glu Glu Gin He His Ser Ihr Gly Leu Glu Tyr Pro Glu Arg Pro Ala 

747 762 777 

AGC CGG GCC AAC ACC GIG AGG AGC TTC CAC CAC GAA GAA CAT CIG GAG AAC ATC 
Ser Arg Ala Asn Urr Val Arg Ser Rie His His Glu Glu Kis -leu -Glu Asn He 

792 807 822 837 

CCA GGG ACC ACT GAA AAC TCT GCT TIT CGT TTC CTC TIT AAC CTC AGC AGC ATC 

Pro Gly Thr Ser Glu Asn Ser Ala Fhe Arg rhe Leu Fhe Asn Leu Ser Ser He 

852 867 882 897 

CCT GAG AAC GAG GIG ATC TCC TCT GCA GAG CTT CGG CTC TIC CGG GAG CAG GIG 
Pro Glu Asn Glu Val He Ser Ser Ala Glu Leu Arg Leu Rie Arg Glu Gin Val 

912 927 942 

GAC CAG GGC OCT GAT TGG GAA AGG GGC TIC CAC CCT ATA AAC AIT TAT GAG GIT 
Asp Gin Gly Pro Asp Trp Glu Arg Gly She His Arg He Asn He iyr Glu Val 

957 972 937 1002 

AIG AAG CCC CCA GCA GAA GIG -GIG CCT GGG CAC CTC ATC ACA CGA CIA CIG -GAC 
MTT Lys Pro Pro Ala Glu Val Val Pro Gly His Leu He TSir Arg Leu leu Asp 

1017 1032 1047 

ACG AGA CIG GTC CnC CAC AAT GIG ACA CC-G 1GG GAA ACT TTT <L-T GIG AJI-C CCT 
Thr Arg Leu Val His His Asn Val Thr Arg^Trp. Glu Thr Phe Asp Val Ser .Pro. 

1062 1077 10S2 1107 

GCG GTC CTT CGC TCG ACC CGG GAG AAG CAG CCA AAC TAT GGG CTA GCC . ATT GAG - 

Ala Val Leu Arg Trp ?Sr Arg Glu Lys GLn Pro Asn Tyr Gly Leu Ala lie -Glu 

H22 1137 1152 H67 

GIG ACT CAC CTC CAT CAG ACT CGG ACC CAC CAG GGC CAG CAX'CTC AGG ATT* AGC 
Val Ihr His Leu His Gin Thr Arg T^r His Gin Gly Gin His Val Arg He Ser 



59 



EP 0 313 578 B1 



1182 H97 1212 

OGA TCG OCT C?A GGG AST GGG AAT TCG GCC CAG CTC CGG CCC CTC CIG GTC 
Arg Ser Leu Pro Gin Gly Ser Gly Asn Ttd Ala Gin Leu Arg Pro Leu Lau Val 

5 

^7 1242 1257 1272 

ACC ITT GGC CAT GAT GGC aKGGCCTC<rmAOCaaCKCXA3GGCCM 
Tfcr Rie Gly His Asp Gly Arg Gly Kis Ala Leu Tfrr Arg Arg Arg Arg Ala Lys 

io 1221 1302 1317 

OST AGC CCT AAG CAT CAC TCA CAG CSG GCC AGG AAG AAG AAT AAG AAC TGC CGG 
Arg Ser Pro Lys His Kis Ser Gin Arg Ala Arg Lys Lys Asn Lys Asn Cys Arg 

133 2 1347 1362 1377 

is CGC CAC TCG CTC TAT GIG GAC TTC AGC GAT GIG GGC TGG AAT GAC TCG ATT GIG 
Arg His Ser Ihu Tyr Val Asp Phe Ser Asp Val Gly Trp Asn Asp Trp He Val 

1392 1407 1422 1437 

GCC OCA CCA GGC TAC CSG GCC TTC TAC TGC CAT GGG GAC TGC CCC TTT CCA CIG 
20 Ma ^ro Pro Glv Tvr Gin Ala Hie TVr Cvs His Glv A,so CVs Pro Fhe Pro Leu 

1452 1467 1482 

GCT GAC CAC CTC AAC TCA ACC AAC CAT GCC ATT GIG CAG ACC CIG GTC AAT TCT 
Ala Asp His Leu Asn Ser Tfcr Asn His Ala lie Val Gin Thr Leu Val Asn Ser 

1497 1512 1527 1542 

GTC AAT TCC ACT ATC CCC AAA GCC TGT TCT GIG CCC ACT GAA CIG AGT GCC ATC 
Val Asn Ser Ser lie Pro Lys Ala Cys Cys Val Pro Tiir Glu Leu Ser Ala lie 

1557 1572 1587 

30 TCC ATC CIG TAC CTC GAT GAG TAT GAT AAG GIG GIA CIG AAA AAT TAT CAG GrJS 

Ser MET Leu Tyr Lsu Asp Glu Tyr Asp Lys Val Val Leu Lys Asn Tyr Gin Glu 

1602 1617 (408) 1636 1646 1656 

ATC GTA GTA GAG GGA TGT GGG TGC GGC TGAGATCAGG CAGICCTTGA GGAIftGACAG 
3s MET Val Val Glu Gly cys Gly Cys Arg 

1666 . 1676 16B6 1696 1706 1716 1726 

ATATACACAC CACACACACA CACCACATAC ACCACACACA CACGITCCCA TCCACTCACC CACACACTAC 



25 



40 



45 



50 



55 



1736 1746 1756 1766 1776 1786 1795 

ACAGACIGCT TOCITMMC TCGACITTTA TTTAAAAAAA AAAAAAAAAA AATGGAAAAA ATC2CISAAC 



1806 1816 1326 1336 1646 1856 1866 

ATTCAOCITG ACCTT2-TITA TGACITTACG TCCAAAIGIT TTGACCATAT TGATCnTATA TTTTGACAAA 

- 1376 1586 1S96 1906 1916 1925 1935 

AIATATTTAT AACTACGIAT TAAAAGAAAA AA-TAAAATC ACTCATTATT TEAAAAAAAA AAAAAAAACT 



1946 

CTAGACTCGA CGGAA1TC 

12. Gene codant pour la BMP-4 humaine comportant la sequence d'acides amines donnee a la revendication 11. 

13. Gene codant pour une proteine montrant des propri&es de la BMP-4 et comprenant une sequence d'AON : 



60 



EP 0 313 578 B1 



10 



15 



20 



(a) qui differe d'une sequence d'ADN de la revendication 11 dans la sequence des codons du fait de la dege- 
nerescence du code genetique ; 

(b) qui s'hybride avec une sequence d'ADN de ia revendication 11 ou du paragraphe (a) ci-dessus ; ou 

(c) represente un fragment, une variation allelique ou autre d'une sequence d'ADN de la revendication 11, 
que cette variation resulte de changements dans la sequence peptidique ou non. 

14. Sequence d'ADN suivant la revendication 13, qui est une sequence d'ADN genomique. 

15. Sequence d'ADN suivant la revendication 13, qui est une sequence d'ADNc. 

16. Vecteur contenant le gene ou la sequence d'ADN suivant I'une quelconque des revendications 1 a 15. en asso- 
ciation active avec une sequence de contr6le d'expression. 

17. Cellule transformee avec un vecteur de la revendication 16. 

18. Cellule suivant la revendication 17, qui est une cellule mammifere, une cellule bacterienne, une cellule d'insecte 
ou une cellule de levure. 

19. Cellule suivant la revendication 18, qui est une cellule CHO. 

20. Proteine montrant des proprietes de la BMP-2, qui est codee par un gene ou une sequence d'ADN de I'une quel- 
conque des revendications 1 a 1 0. 

21 . Proteine montrant des proprietes de la BMP-2 ; qui est obtenable par les etapes de culture dans un milieu de culture 
25 approprie d'une cellule transformee avec un vecteur d'expression comprenant un gene ou une sequence d'ADN 

de I'une quelconque des revendications 1 a 10, et de recuperation de ladite proteine du milieu de culture precite. 

22. Proteine montrant des proprietes de la BMP-4, qui est codee par un gene ou une sequence d'ADN de I'une quel- 
conque des revendications 11 a 15. 

30 

23. Proteine montrant des proprietes de la BMP-4, qui est obtenable par les etapes de culture dans un milieu de culture 
approprie d'une cellule transformee avec un vecteur d'expression comprenant un gene ou une sequence d'ADN 
de I'une quelconque des revendications 11 a 15, et de recuperation de ladite proteine du milieu de culture precite. 

35 24. Precede de production de la proteine suivant I'une ou Taut re des revendications 21 et 23, comprenant les Stapes 
de culture dans un milieu de culture approprie de la cellule de la revendication 17 et d'isolement de ladite proteine 
du milieu de culture precite. 

25. Composition pharmaceutique comprenant les proteines de I'une quelconque des revendications 20 a 23 s indivi- 
40 duellement ou en combinaison, et un vehicule pharmaceutiquement acceptable. 

26. Composition pharmaceutique suivant la revendication 25, comprenant de plus une matrice pouvant distribuer la 
composition au site de I'anomalie osseuse ou cartilagineuse et formant une structure pour induire une formation 
osseuse ou cartilagineuse. 

45 

27. Composition pharmaceutique suivant la revendication 26, dans laquelle ladite matrice comprend de I'hydroxya- 
patite, du collagene, de I'acide polylactique ou du phosphate tricalcique. 

28. Utilisation d'une proteine suivant I'une quelconque des revendications 20 a 23, individueliementou en combinaison, 
50 pour la preparation d'une composition pharmaceutique pour induire une formation osseuse ou cartilagineuse. 

Revendications pour I'Etat contractant suivant : AT 

55 1. Procede de preparation d'un gene codant pour la BMP-2 humaine comprenant la sequence d'ADN suivante : 



61 



EP 0 313 578 B1 



10 20 30 40 50 60 70 

CICSACTCTA GAGTGICTGT CUSCACTIGG CTGGGGACTT CTTGAACITG CAGGGAGAAX AACETGCSCA 

5 

80 90 100 110 120 130 _140 

CCCCACiTIt, CGOOGGIGCC TTIGCCCCAG OGGAGCCTGC TTCGCQ1CT COSAGCOOCA OOGOCXCTCC 

?o 150 160 170 180 190 200 210 

ACTCCTCEGC CITGCCOGAC ACIGAGACSC TGTTCCCAGC GIGAAAAGAG AGACIGOGCG GCCGGCACCC 



75 



£0 



25 



30 



35 



40 



220 230 240 250 260 270 ' 230 

GGGAGAAGGA GGAGGCAAAG AAAAGGAAOG GAQTTOGGT (XTIUCSCCA GGTOCTTTGA CCAGAGnTT 



29.0 300. -310 . 3-20 \330 340 :-350 

TCCATGTGGA CC<T CT1TC A AIGGACGICT CCCCSOGIGC TTCTOGAOG GACIGGSGIC TCCTAAAGGT 



(1) 370 335 400 

CX1-.CC ATO GIG GOC GGG ACC CSC TCI CTT CIA GOG TIG CIG CTT COC CAG GTC 
KrT Val Ala Gly Eir Arg Cys Leu Leu Ala Leu leu Leu Pro Gin Val 

415 430 445 

CIC GG GGC GGC GCG GCT GGC CIC GIT CCS GAS CTG GGC GGC AGG AAG TTC GCG 
Leu Leu Gly Gly Ala Ala Gly Leu Val Pro Glu Leu Gly Arg Arg Lys Phe Ala 

460 475 490 505 

GCS GCS TCG TCG GGC CGC COC TCA TCC C-G CCC TCT GAC GAG GTC CIG AGC G=G 
-Ala Ala Ser Ser Gly Arg Pro Ser Ser Gin Pro Ser Asp Glu Val Lsu Ser Glu 

520 535 550 555 

TTC GAG TIG CSG CIG CIC AGC ATS TTC GGC CIG AAA CAG AGA CCC ACC CCC AGC 
.Phe Glu Leu Arg tpm Leu Ser MET Phe Gly Leu Lys Gin Arg Pro Thr Pro Ser 

580 595 610 

AGG GAC GOC CIG GIG CCC CCC TAC AIG CIA GAC CIG TAX CGC AGG CAC TCG GG? 
Arg Asp Ala Val Val Pro Pro Tyr MIT. Leu >jsp Leu Tyr Arg Arg Kis Ser Gly 

625 640 655 670 

C^G CCS GGC TCA CCC GCC CCA GAC CAC CSG TIG GAG AGG GCA GCC AGC CSA GCC 
Gin Pro Gly Ser Pro Ala Pro Asp His Arg Lsu Glu Arg Ala Ala Ser Arg Ala 

45 635 700 715 

AAC ACT GIG CSC AGC TIC CAC C-T GAA GAA TCT TIG GAA GAA CTA CCA GAA ACS 
Asn Thr Val Arg Ser Fhe His His Glu Glu Ser Leu Glu Glu Leu Pro Glu Ttir 



50 



55 



62 



EP 0 313 578 B1 



730 745 760 775 

ACT GGG AAA ACA ACC OGG AGA TTC TTC TTT AAT TXA ACT TCT ATC. CCC AOG GAG 
Ser Gly Lys Thr Th.r Arg Arg Phe Phe ?he Asn Leu Ser Ser He Pro Thr Glu 

790 805 820 835 

GAG TTT ATC ACC TCA GCA GAG CTT CAG GIT TTC GGA GAA CAG ATC CAA GAT GOT 
Glu 5>ie He Thr Ser Ala Glu Leu Gin Val Phe Arg Glu Gin MET Gin Asp Ala 

850 .865 880 

TEA GGA AAC AAT AGC ACT TIC CAT CAC CGA ATT AAT ATT TAT GAA ATC ATA AAA 
Leu Gly Asn Asn Ser Ser Phe His His Arg He Asn lie TVr Glu lie lie Lys 

695 910 925 940 

CCT GCA ACA GCC AAC TOG AAA TIC CCC GIG ACC ACT CTT TIG GAC ADC AGG TIG 
Pro Ala Thr Ala Asn Ser Lys Phe Rot Val Thr Ser leu Leu Asp Thr Arg leu 

955 970 935 

GIG AAT CAG AAT GCA AGC AGG TCG GAA ACT TIT GAT GIC ACC CCC GCT GIG ATC 
Val Asn Gin Asn Ala Ser Arg Trp Glu Ser Phe Asp Val Thr Pro Ala Val MTT 

1000 1015 1030 1045 

CGG TCG ACT GCA CAG GGA CAC GCC AAC CAT GGA TIC GIG GIG GAA GIG GCC CAC 

Arg Trp Thr Ala Gin Gly His Ala Asn His Gly Phe Val Val Glu Val Ala His 

25 1060 1075 1090 11*05 

TIG GAG GAG AAA CAA GGT GIC TCC AAG AGA CAT GIT AGG ATA AGC AGG TCT TIG 
' Leu Glu Glu Lys Gin Gly Val Ser Lys Arg His Val\Arg lie Ser Arg ber ueu 

H20 H35 1150 

30 CAC CAA GAT GAA CAC AGC TCG TCA CAG ATA AGG CCA TTC CTA GTA ACT TTT GGC 

His Gin Asp Glu His Ser Trp Ser Gin He Arg Pro Leu Leu Val Cir Rie Gly 

H65 1180 1195 1210 

CAT GAT GGA AAA GGG CAT CCT CIC CAC AAA AGA GAA AAA CCT CAA GCC AAA CAC 
His Asp Gly Lys Gly His Pro Leu His Lys Arg Glu Lys Arg Gin Ala Lys His 



10 



is 



20 



35 



40 



45 



50 



1225 L240 1255 

AAA CAG CGG AAA CGC CTT AAG TCC AGC TCT AAG AGA CAC CCT TIG TAC GIG GAC 
Lys Gin Arg Lys Arg Leu Lys Ser Ser Cys Lys Arg His Pro Leu TVr Val Asp 

1270 12S5 1300 1315 

•TIC ACT GAC GIG GGG TCG AAT -GAC TGG ATT GIG GCT CCC CCG GGG TAT CAC GCC 

Phe Ser Asp Val Gly Trp Asn Asp Trp lie Val Ala Pro Pro Gly TVr His Ala 

1330 1345 1350 1375 

TAC TGC CAC GGA GAA TCC CCT TTT CCT CTC GCT CAT CAT CIG AAC TCC ACT 
Phe T/r Cys His Gly Glu Cys Pro Phe Pro Leu Ala Asp His Leu Asn Sar Thr 

13S0 1405 1420 

AAT GCC ATT CTT CAG ACG TTG GIC AAC TCT GTT A.AC TCT AAG ATT CCT AAG 
Asn His Ala He Val Gin Ttir Leu Val Asn Ser Val Asn Ser Lvs He Pro Lvs 



55 



63 



EP 0 313 578 B1 



1<35 K50 . 1465 1480 

CCk TGC ICT GTC CCG ACA GAA CTC ACT CCT ATC TCS AZG CTG 3AC dT GAC GAG 
Ala Cys cys Val Pro Shr Glu Leu Ser Ala lie Ser MET Leu TVr Leu Asp Glu 

1495 1510 1525 

AAT GAA AAG GIT GIA TTA AAG AAC TAT CAG GAC ATC GIT GIG GAG GGT TCT GGG 
Asn Glu Lys Val Val Leu lys Asn Tyr Gin Asp KET Val Val Glu Gly Cys Gly 

1540(396) 1553 1563 1573 1583 1593 1603 

TCT CGC TAGTACAGCA AAATIAAAIA CAXAAXBOA TA330MATA TAIAITITAG AAAAAAGAAA 
Cys Arg 



AAAA , 

dans lequel ledit precede comprend les etapes suivantes 

a) la selection d'une bibliotheque de genes construite a partir d'ADN ou d'ADNc provenant de U-2 OS avec 
un fragment de bBMP-2 marque par hybridation, 

b) I'isolement des clones positifs, et 

c) I'isolement des inserts d'ADN de ces clones. 

Procede suivant la revendication 1 , dans lequel le gene code pour la BMP-2 humaine ayant la sequence d'acides 
amines donnee a la revendication 1 . 

Proc6d6 de preparation d'un gene codant pour une proline montrant des proprietes de la BMP-2 humaine et 
comprenant une sequence d'ADN : 

a) qui differe d'une sequence d'ADN de la revendication 1 dans la sequence des codons du fait de la d6g6- 
nerescence du code genetique ; 

b) qui s'hybride avec une sequence d'ADN de la revendication 1 ou du paragraphe (a) ci-dessus ; ou 

c) represente un fragment, une variation allelique ou autre d'une sequence d'ADN de la revendication 1, que 
cette variation resulte de changements dans la sequence peptidique ou non, 

dans lequel le procede susdit comprend des techniques standards de biologie moleculaire. 

Procede suivant la revendication 3, dans lequel la sequence d'ADN est une sequence d'ADN genomique. 

Procede suivant la revendication 3, dans lequel la sequence d'ADN est une sequence d'ADNc. 

Procede de preparation d'un gene codant pour la BMP-2 bovine comprenant la sequence d'ADN suivante : 



64 



EP 0 313 578 B1 



(1) 15 30 *=> 

GGC CAC GAT GGG AAA GGA CAC CCT CTC CAC AGA AGA GAA AAG CGG 
GHDGXGHPLH3R2XH 

60 75 90 

CAA GCA AAA CAC AAA CAG CGG AAA CGC CTC AAG TCC AGC TGT AAG 
QAXHXQRKRLKSSCK 

105 120 135 

AGA CAC CCT TTA TAT GTG GAC TTC AGT GAT GTG GGG TGG AAT GAC 
RHPLYVDF-SDVGWN D 

150 165 - 180 

TGG ATC GTT GCA CCG CCG GGG TAT CAT GCC TTT TAC TGC CAT GGG 
WIVAPPGYH AFYCHG 

195 .210 225 

GAG TGC CCT TTT CCC CTG GCC GAT CAC CTT AAC TCC ACG AAT CAT 
E C P T ? L A D H L N S T N H 

240 255. 270 

GCC ATT ' CTC " CAA ' ACT' "CTG r GTC ' 'AAC *TCA GTT AAC TCT AAG ATT CCC 
AIVQTLVNSVNSKI? 

3 85 3*00 315 

AAG GCA TGC TGT GTC CCA ACA GAG CTC AGC GCC ATC TCC ATG CTG 
X A C C V P T E L S A I S M L 

330 345 _ \ 360 
TAC CTT GAT GAG AAT GAG AAG GTG GTA TTA AAG AAC TAT CAG GAC 
v L D Z N Z X V V L X N Y Q 2 



375 * • (129) 397 407 

ATG GTT GTC GAG GGT TGT GGG TGT CGT TAG CAC AGC A AAAT AAAAT A 
M' V V Z G C G C R 



417 427 437 447 457 

TAAATATATA TATATATATA TTAGAAAAAC AGCAAAAAAA TCAAGTTGAC 

467 477 487 497 507 

ACTTTAATAT TTCCCAATGA AGACTTTATT TATGGAATGG AATGG AG AAA 

517 527 537 547 557 

AAGAAAAACA CAGCTATTTT GAAAACTATA TTTATATCTA • CCGAAAAGAA 

567 577 587 

GTTGGGAAAA CAAATATTTT AAT CAG AG AA TTATT , 

dans lequel ledit procede comprend les etapes suivantes : 

a) la selection d'une bibliotheque de genes construite a partir d'ADN ou d'ADNc provenant de foie bovin avec 
une sonde marquee congue sur la base de la sequence d'acides amines d'un fragment de bBMP-2, 

b) I'isolement des clones posit its, et 

c) I'isolement des inserts d'ADN de ces clones. 

Proced6 suivant la revendication 6, dans lequel le gene code pour de la BMP-2 bovine ayant la sequence d'acides 



65 



EP 0 313 578 B1 



amines de la revendication 6. 

8. Proc6d§ de preparation d'un gene codant pour une prot6ine montrant des propri6t6s de la BMP-2 bovine et com- 
prenant des sequences d'ADN : 

a) qui different d'une sequence d'ADN de la revendication 7 dans la sequence des codons du fait de la d6g6- 
n6rescence du code g6n6tique ; 

b) qui s'hybrident avec une sequence d'ADN de la revendication 7 ou du pa rag raphe a) ci-dessus ; ou 

c) represented des fragments, des variations alleliques ou autres d'une sequence d'ADN de la revendication 
7, que ces variations resuftent de changements dans la sequence peptidique ou non, 

dans lequel le procede precite comprend des techniques standards de biologie moleculaire. 

9. Procede suivant la revendication 8, dans lequel la sequence d'ADN est une sequence d'ADN genomique. 

10. Proc6d6 suivant la revendication 8, dans lequel la sequence d'ADN est une sequence d'ADNc. 

11. Procede de preparation d'un gene codant pour la BMP-4 humaine comprenant la sequence d'ADN suivante : 



EP 0 313 578 B1 



10 20 30 40 SO 60 70 

CTCIAGAGGG cagaggagga gsgagggagg gaaggagogc ggagcooggc otsc^agcta ggigagigtc 

£ 

80 90 100 110 120 130 140 

GCAIOOGAGC TSAGGGAOGC GAGCCIGAGA GSC0GC1GCT GCIOCGGCIG TTC1CTC00C 

70 130 160 170 180 190 200 210 

GATOSGATIC CCSICCAAGC TATCTOGAGC OGCAGOGCC ACAGTCCOCG GCOCTOGCCC AGGTICACTG 



75 



20 



25 



30 



35 



40 



45 



50 



220 230 240 250 260 270 280 

cAAcrrrrcA gaggixxtca ggagcigcig ciggcgagcc cgciacigca gggacosig gagocaticc 



290 300 310 320 330 340 350 

GTAGTGCCAT CCCGAGCAAC GCACTSCTGC AGCi'lUX T G AGCCTTTCCA GCAACTTTGT TCAAG^ITCG 



360 370' *330 390 400 (1) 

CIGICAAGAA TCATGGACIG TIATTATATG CTTSITTIC TGTCAACACA CC ATS ATT OCT 

JCT.Ile Pro.. 



417 432 447 462 

GGT AAC CGA ATS CIG ATS GTC GIT 7TA TTA TGC CAA CTC CIG CIA GGA GGC GCS 
Gly Asn Arg MET KTT Val val Lszi Lsu cys Gin Val Leu Leu Gly Gly Ala 

477 492 507 

AGC CAT OCT AGT TIG ATA OCT G-G AOS GGG AAG AAA AAA GTC GGC GAG ATT OG 
Ser His Ala Ser Leu He Pro Glu Thr Gly Lys Lys Lys Val Ala Glu He Gin 

522 537 552 557 

GGC CAC GCS GGA GGA CSC CSC TCA GGG CAG AGC CAT GAG CTC CIG CSG GAC TIC 

Gly Kis Ala Gly Gly Arg Arg Ser Gly Gin Ser His Glu Leu Leu Arg Asp Pfce 

582 597 612 627 

GAG GOG ACA CIT CPS CAG ATS TTT GGG CIG CSC CGC CGC COS CAG CCT AGC AAG 
Glu Ala 2ir Lsu Leu Gin MET ?r.e Gly leu Arg Arg Arg Pro Gin Pro Ser Lys 

64 2 657 672 

ACT GCC GTC ATT CCS GAC TAC ATG CGG GAT CTT TAC CGG CTT GjG TCT GGG GAG 
Ser Ada Val He Pro Asp Tyr MIT Arg Asp leu Tyr Arg Gin Ser Gly Glu 

637 702 717 732 

GAG GAG GAA GAG CAG ATC CAC AGC ACT GGT CTT GAG TAT CCT GAG CSC CCS GCC 
Glu Glu Glu Glu Gin lie His Ser Tnr Gly leu Glu Tyr Pro Glu Arg Pro Ala 



55 



67 



EP 0 313 578 B1 



747 762 777 

AGC OGG GCC AAC AOC GIG AGG AGC TTC CAC CAC GAA GAA CAT CIG GAG AAC ATC 
Ser Arg Ala Asn Ear Val Arg Ser Phe His His Glu Glu Kis-Leu-Glu Asn lie 

7S2 807 822 837 

CCA GGG ACC ACT GAA AAC TCT GCT TTT CGT TIC CTC ITT AAC CTC AGO AGC ATC 
Pro Gly TJir Ser Glu Asn Ser Ala Rie Arg ae leu I^ie Asn Leu Ser Ser He 

852 867 882 897 

CCT GAG AAC GAG GIG ATC TCC TCT GCA GAG CIT CGG CTC TTC GGG GAG CAG GIG 
Pro Glu Asn Glu Val lie Ser Ser Ala Glu leu Arg Leu Rie Arg Glu Gin Val 

912 927 942 

GAC CAG GGC OCT GAT TGG GAA AGG GGC TTC CAC CCT ATA AAC ATT TAT GAG GIT 
Asp Gin Gly Pro Asp Trp Glu Arg Gly Hie His Arg lie Asn lie Tyr Glu Val 

957 972 987 1002 

ATC AAG COC CCA GCA GAA GIG GIG CCT GGG CAC CTC ATC ACA CGA CTA CTG GAC 
MET Lys Pro Pro Ala Glu Val Val Pro Gly His Leu lie Uir Arg Leu Leu Asp 

1017 1032 1047 

ACE AGA CIG" GTC CAC CAC AAT GIG ACA CGG TGG <LAA' ACT TTT GAT GIG AGC CCT 
Thr Arg Leu Val His His Asn Val T^jr.Arg. Trp Glu TJir-Fhe Asp Val Ser Pro 

25 1062 1077 1092 1107 

GOG GIG CTT CSC TGG ACC CGG GAG . AAG .CAG CCA AAC TAT GGG CIA. GCC. AIT- GAG ~ 
Ala Val Leu Arg Trp' Thr Arg Glu Lys Gin Pro Asn Tyr Gly' Leu Ala lie Glu 



70 



15 



20 



30 



1122 1137 1152 1167 

GIG ACT CAC CTC CAT CAG ACT CGG ACC CAC CAG GGC CAG CAT GTC AGG ATT* AGC 
Val Uir His Leu His Gin T^^r Arg T^ir His Gin Gly Gin His Val Arg He Ser 



1182 1197 1212 

35 CGA TOG TEA CCT CAA GGG AGT GGG AAT TGG GCC CAG CTC CGG CCC CTC CIG GTC 

Arg Ser Leu Pro Gin Gly Ser Gly Asn Trp Ala Gin Leu Arg Pro Lsu Lsu Val 

. 1227 1242 1257 1272 

ACC TTT GGC CAT GAT GGC CGG GGC CAT GCC TTG ACC CGA CGC GGG AGG GCC AAG 
40 Thr She Gly His Asp Gly Arg Gly His Ala Leu Tlir Arg Arg Arg Arg Ala Lys 

1287 1302 1317 

-CGT AGC CCT AAG CAT CAC TCA CAG CGG GCC AGG AAG AAG AAT AAG AAC TGC CGG 
Arg Ser Pro Lys His His Ser Gin Arg Ala Arg Lys Lys Asn Lys Asn Cys Arg 



45 



so 



55 



1332 1347 1362 1377 

CGC CAC TCG CTC TAT GIG GAC TTC AGC GAT GIG GGC TGG AAT 'GAC TGG ATT GIG 

Arg His Ser Leu Tyr Val Asp She Ser Asp Val Gly Trp Asn Asp Trp He Val 

1392 1407 1422 1437 

GCC CCA OCA GGC TAC CAG GCC TTC TAC TGC CAT GGG GAC TGC CCC TTT CCA CIG 
Ala Pro Pro GIv TVr Gin Ala Pie TVr C/s His Glv Aso Cvs Pro Pr.e Fro leu 

1452 1467 14S2 

GCT GAC CAC CTC AAC TCA ACC AAC CAT GCC ATT GIG CAG ACC CIG GTC AAT TCT 
Ala Aso His Leu Asn Ser Tnr Asn His Ala lie Val Gin Thr Leu Val Ash Ser 



68 



EP 0 313 578 B1 



10 



is 



20 



25 



• 1497 1512 1527 1542 

CTC AAT TCC AGT ATC COC AAA GGC TCP 1CT GIG CCC ACT GAA CTC ACT GOC ATC 
Val Asn Ser Ser lie Pro Lys Ala cys Cys Val Pro !&r Glu Leu Ser Ala lie 

1557 1572 1587 

TCC ATC CIG TAC CIG GAT GAG TAT GAT AAG GIG GTA CIG AAA AAT TAT CAG GAG. 
Ser MET lau iyr Leu Asp Glu Tyr Asp lys Val Val Leu lys Asn Tyr Gin Glu 

* 602 1617 (408) 1636 1646 1656 

ATG CTA GTA GAG GGA TGT GGG TCC CGC TGAGATCAGG CAGTCCTTGA GGAXAGACAG 
KET Val Val Glu Gly Cys Gly Cys Arg 

1666 1676 1686 1696 1706 1716 1726 

AIATACACAC CACACACACA OlCCACATAC AOCACACACA CAOGITOCCA TCCACTCAOC CACACACIAC 

"36 1746 1756 1766 1776 .1786 1796 

ACAGACTGCT IwixaTAGC IGGACllYIA UTAAAAAAA AAAAAAAAAA AATCGAAAAA ATCCTAAC' 

1806 1316 1826 1836 . 1846 1856 1B66 

ATTCAOCTIG ACCITnTTZ?> TGACTJTAC3 TGCAAAIGTT TTGACCATAT . *IGATCATAXA TITIGACAAA : 

m 1876 1336 1896 1906 1916 1926 1936 

■ATAIATTrAT AACHACGTAT TAAAAGAAAA AAATAAAA2G ACTX1AITATT TTAAAAAAAA AAAAA.AAACT 

30 1946 

CIAGAGTCGA CSGAA3TC , 

dans lequel le proced6 precite" com p rend les eta pes suivantes : 

55 a) la selection d'une bibliotheque de genes construite a partir d'ADN ou d'ADNc provenant d'U-20S avec un 

fragment bBMP-2 marqu6 par hybridation, 

b) Pisolement des clones positits, et 

c) I'isolement des inserts d'ADN de ces clones. 

40 12. Proced6 suivant la revendication 11 , dans lequel ie gene code pour la BMP-4 humaine ayant la sequence d'acides 
amines donnee a la revendication 11. 

13. Proced6 de preparation d'un gene codant pour une proline montrant des propri6tes de la BMP-4 et comprenant 
une sequence d'ADN : 

45 

a) qui differe d'une sequence d'ADN de la revendication 11 dans la sequence des codons du fait de la dege- 
nerescence du code genetique ; 

b) qui s'hybride avec une sequence d'ADN de la revendication 11 ou du paragraphe a)ci-dessus ; ou 

c) represente un .fragment, une variation allelique ou autre d'une sequence d'ADN de la revendication 11, que 
50 cette variation resulte de changements dans la sequence peptidique ou non, 

dans lequel le procede precite comprend des techniques standards de biologie moleculaire. 

14. Procede suivant la revendication 13, dans lequel la sequence d'ADN est une sequence d'ADN genomique. 

15. Procede suivant la revendication 13, dans lequel la sequence d'ADN est une sequence d'ADNc. 

16. Vecteur contenant le gene ou la sequence d'ADN prepare suivant I'une quelconque des revendications 1 a 15, en 



55 



69 



EP 0 313 578 B1 



association active avec une sequence de contrdle d'expression. 

17. Cellule transformee avec un vecteur de la revendication 16. 

5 18. Cellule suivant la revendication 17, qui est une cellule mammifere, une cellule bactenenne, une cellule d'insecte 
ou une cellule de levure. 

19. Cellule suivant la revendication 18, qui est une cellule CHO. 

io 20. Procede de preparation d'une proline montrant des proprietes de la BMP-2, dans lequel ledit precede comprend 
les etapes de culture dans un milieu de culture approprie d'une cellule transformee avec un vecteur d'expression 
comprenant un gene ou une sequence d'ADN prepare suivant Tune quelconque des revendications 1 a 10 et de 
recuperation de ladite proline du milieu de culture pr6cite\ 

is 21 . Precede de preparation d'une proteine montrant des proprietes de la BMP-4, dans lequel ledit procede comprend 
les etapes de culture dans un milieu de culture approprie d'une cellule transformee avec un vecteur d'expression 
comprenant un gene ou une sequence d'ADN prepare suivant Tune quelconque des revendications 11 a 15 et de 
recuperation de ladite proteine du milieu de culture precite. 

20 22. Procede de production d'une proteine montrant des proprietes de la BMP-2 ou BMP-4, comprenant les etapes de 
culture dans un milieu de culture approprie de la cellule de la revendication 17 et d'isolement de ladite proteine 
du milieu de culture precite. 

23. Procede de preparation d'une composition pharmaceutique comprenant la combinaison des proteines prepar6es 
25 suivant I'une quelconque des revendications 20 a 22, individuellement ou en combinaison avec un v6hicule phar- 

maceutiquement acceptable. 

24. Procede suivant la revendication 23, dans lequel la composition pharmaceutique susdite comprend de plus une 
matrice pouvant distribuer la composition au site de I'anomalie osseuse ou cartilagineuse et constituer une struc- 

30 ture pour induire une formation osseuse ou cartilagineuse. 

25. Procede suivant la revendication 24, dans lequel la matrice comprend de I'hydroxyapatite, du collagene, de I'acide 
polylactique ou du phosphate tricalcique. 

35 26. Utilisation d'une proteine pr6par6e suivant I'une quelconque des revendications 20 a 22, individuellement ou en 
combinaison, pour la preparation d'une composition pharmaceutique pour induire une formation osseuse ou car- 
tilagineuse. 



40 



45 



so 



55 



70 



This Page is Inserted by IFW Indexing and Scanning 
Operations and is not part of the Official Record 

BEST AVAILABLE IMAGES 

Defective images within this document are accurate representations of the original 
documents submitted by the applicant. 

Defects in the images include but are not limited to the items checked: 

□ BLACK BORDERS 

□ IMAGE CUT OFF AT TOP, BOTTOM OR SIDES 
□(FADED TEXT OR DRAWING 
[^BLURRED OR ILLEGIBLE TEXT OR DRAWING 

□ SKEWED/SLANTED IMAGES 

□ COLOR OR BLACK AND WHITE PHOTOGRAPHS 

□ GRAY SCALE DOCUMENTS 

□ LINES OR MARKS ON ORIGINAL DOCUMENT 

□ REFERENCE(S) OR EXHIBIT(S) SUBMITTED ARE POOR QUALITY 

□ OTHER: ' 

IMAGES ARE BEST AVAILABLE COPY. 
As rescanning these documents will not correct the image 
problems checked, please do not report these problems to 
the IFW Image Problem Mailbox.