Skip to main content

Full text of "USPTO Patents Application 09804625"

See other formats


PATENT 
CUSTOMER NO. 22,852 
ATTORNEY DOCKET NO. 08702.0039-02000 



IN THE UNITED STATES PATENT AND TRADEMARK OFFICE 
In re Application of: 
WANG et al. 

Application No.: 09/804,625 
Filed: March 9, 2001 
For: BMP PRODUCTS 



Group Art Unit: 1647 
Examiner: D. Romeo 
Confirmation No.: 2656 



Commissioner for Patents 
P.O. Box 1450 
Alexandria, VA 22313-1450 

SIR: 

AFFIDAVIT REGARDING AMENDMENT OF APPLICATION TO INSERT MATERIAL 

INCORPORATED BY REFERENCE 

I, the undersigned, hereby declare: 



1 . That I have reviewed and understand the contents of this Application, including 
the claims; 



That this Application in part refers to subject matter disclosed in Maniatis et al, 
- Molecular Cloning (A Laboratory Manual), Cold Spring Harbor Laboratory (1 982), 
pages 387 to 389, which was published in 1982, before the effective filing date of 
this application, April 8, 1988; 



That the material added to the paragraph beginning on page 7, line 35 by the 
amendment filed concurrently with this affidavit consists of the same material 



incorporated into the application by reference to Maniatis etal, Molecular Cloning 
(A Laboratory Manual), Cold Spring Harbor Laboratory (1982), pages 387 to 389; 

That all statements made herein of my own knowledge are true and that all 
statements made on information and belief are believed to be true; and further 
that these statements were made with the knowledge that willful false statements 
and the like so made are punishable by fine or imprisonment, or both, under 
Section 1001 of Title 18 of the United States Code, and that such willful false 
statements may jeopardize the validity of the application or any patent issuing 
thereon. 



Respectfully submitted, 

FINNEGAN, HENDERSON. FARABOW, 
GARRETT & DUNNER, LLP. 



Dated: November 1 6, 2005 



Elizabeth E. Mathiesen 
Reg. No. 54,696 



CERTIFICATE UNDER 37 CFR § 1.10 OF 
MAIUNG BY "EXPRESS MAIL" 



EV 684956338 US 



November 16, 2005 



USPS Express Mail Label Number 



Date of Deposit 



I hereby certify that this correspondence is being deposited with the United States Postal Services "Express Mail Post Office to Addressee" service 
under 37 CFR § 1.10 on the date indicated above and is addressed to the Commissioner for Patents, P.O. Box 1450, Alexandria, VA 22313-1450. 



Bv: /^iXZ^ityU^ ^^d-Mj<^ 



Katherine L. Staba 



t 



Molecular 
Cloning 

A LABORATORY MANUAL 



T. Maniatis Harvard university 

E. F. Fritsch iviichigan State University 

J. Sambrook Cold Spring Harbor Laboratory 




Cold Spring Harbor Laboratory 
1982 



?^ropftfty of 



FiN^:E:G/,:.^ 



SOUTHERN TRANSFER 387 



HYBRIDIZATION OF SOUTHERN FILTERS 

1. Float the baked filter on the surface of 6^ SSC until it wets from 
beneath. Inamerse the filter in the 6x SSC for 2 minutes. 

2. Slip the wet filter into a heat-sealable plastic bag (e.g., Sears' Seal-n- 
Save). 

3. Add 0.2 ml of prehybridization fluid warmed to 68°C for each square 
centimeter of nitrocellulose filter. 

Prehybridization fluid 

6x SSC 
0.5% SDS 

5x Denhardt*s solution (see page 448) 

100 fJLg/m\ denatured, salmon sperm DNA (see page 327) 

4. Squeeze as much air as possible from the bag. Seal the open end of the 
bag with the heat sealer. Incubate the bag for 2-4 hours submerged in a 
water bath at 68°C. 

Often, small bubbles of air form on the surface of the filter as the 
temperature of the prehybridization solution rises to 68°C. It is impor- 
tant that these bubbles be removed by occasionally agitating the fluid in 
the bag; otherwise the components of the prehybridization fluid will not 
be able to coat the filter evenly. 

5. Remove the bag from the water bath. Open the bag by cutting off one 
corner with scissors. Squeeze out as much prehybridization solution as 
possible. 

6. Using a pasteur pipette, add the hybridization solution to the bag. Use 
just enough solution to keep the filter wet (50 ^l/cm^ of filter). 

Hybridization solution 
6x SSC 
0.01 M EDTA 

^^P-labeled denatured probe DNA 
5x Denhardfs solution 
0.5% SDS 

100 Mg/nil denatured, salmon sperm DNA 

Typical hybridization conditions for Southern filters are given in Table 
11.1. 

7. Squeeze as much air as possible from the bag. Seal the cut edge with the 
heat sealer so that as few air bubbles as possible are trapped in the bag. 



388 ANALYSIS OF RECOMBINANT DNA CLONES 



TABLE 11.1 HYBRIDIZATION CONDITIONS FOR SOUTHERN FILTERS 



sp. act 

DNA on of probe DNA Amount of Time of 

filter (cpm/^g) probe added hybridization (hr) 



Fragments of 


10' 


lO'-lO' cpm 


3-4 


cloned DNA 




(0.01-0.1 Mg) 




(~ 100 ng/fragment) 








Total eukaryotic 


10* 


Ix 10' cpm 


12-16 


DNA (10 ng) 




-5x10' 
(0.1-0.5 Mg) 





8. Incubate the bag submerged in a water bath at 68°C for the required 
hybridization period. 

9. Remove the bag from the water bath and quickly cut along the length of 
three sides. Using gloves, remove the filter and immediately submerge it 
in a tray containing a solution of 2x SSC and 0.5% SDS at room 
temperature. 

Note. Do not allow the filter to dry out at any stage during the washing 
procedure. 

10. After 5 minutes, transfer the filter to a fresh tray containing a solution of 
2x SSC and 0.1% SDS and incubate for 15 minutes at room temperature 
with occasional gentle agitation. 

11. Transfer the filter to a flat-bottomed plastic box containing a solution of 
O.lx SSC and 0.5% SDS. Incubate at 68°C for 2 hours with gentle agita- 
tion. Change the buffer and continue incubating for a further 30 
minutes. 

Note, If the homology between the probe and the DNA bound to the filter 
is inexact, the washing should be carried out under less stringent condi- 
tions. In general, washing should be carried out at Tm - -12''C. 
The following relationships are useful: 

a. Tm- 69.3 + 0.41 (0 + 0)% (Marmur and Doty 1962) 

b. The Tm of a duplex DNA decreases by 1°C with every increase of 1% 
in the number of mismatched base pairs (Bonner et al. 1973). 

c. (r„0M2 - {Tn.hi = 18.5 logio 

where mi and fxi are the ionic strengths of two solutions (Dove 
and Davidson 1962). 



SOUTHERN TRANSFER 389 



12. Dry the filter at room temperature on a sheet of Whatman 3MM paper. 

13. Wrap the filter in Saran Wrap and apply to X-ray film to obtain an 
autoradiographic image (see page 470). 

Notes 

Hybridization may also be carried out in: 

a. flat-bottomed plastic boxes. 

b. buffers containing formamide. Each increase of 1% in the formamide 
concentration lowers the of a DNA duplex by 0.7°C (McConaughy et 
al. 1969; Casey and Davidson 1977). 



.-express Mail** maU^ label number 
Date of Pepoair ^ ^"^ ? 



I hereby certify that tfito paper ar fee it being 
depoaited with the United Stetea Poatal Service 
"Expreaa IMail Poal Office to Addreeaee" service 
under 37 CFiiL 10 on the date mdicated above 
and is eddi eia e d la the Cu i iM ii ia aie n er of Patents 
and Trademaiia. V^fca t i Mpa a& 20231. 




fGI5071Hj 

NOVEL BMP - 2 mODUCTS a^^^^^i^ - ^- 



The present invention relates to a novel family of purified 
proteins designated BMP-2 proteins and processes for obtaining 
them. These proteins may be used to induce bone and/or 
cartilage formation and in wound healing and tissue repair, 

BMP-2 proteins are produced by culturing a cell transformed 
with a CDMA sxibstantially as shown in Table II or Table III 
and recovering from the culture medium a protein containing \v 
substantially the 97 amino acid sequencer #2913^, to #396 of ^V^**^-^- 
Table II or amino acid #311 to #408 of Table III, ^5c<-- 

Some members of the BMP-2 protein family are further ^'^^Vs' 
characterized by the ability of 200 nanograms of the BMP-2 
protein to score at least +2 in the Rosen-modified Sampath- 
Reddi assay of bone and/or cartilage formation. 

BMP-2A is a member of the family of the BMP-2 proteins 
of the invention. We have previously referred to BMP-2A as 
BMP-2 or BMP-2 Class I. Human BMP-2A (or hBMP-2A) is produced 
by culturing a cell transformed with a cDNA substantially as 
shown in Table II and recovering from the culture medium a 
protein containing the amino acid sequence of amino acid #299 
to amino acid #396 as shown in Table II. Human BMP-2A is 
further characterized by the ability of 200 nanograms of the 
BMP-2A protein to score at least +2 in the Rosen-modified 
Sampath - Reddi assay of bone and/or cartilage formation. 

The bovine BMP-2A protein is a member of the family of 
BMP-2 proteins of the invention. It contains substantially 
the amino acid sequence represented by amino acid #32 to 
amino acid #12 9 of Table I. Bovine BMP-2A is further 
characterized by the ability of 200 nanograms of this protein 
to score at least +2 in the Rosen-modif ed Sampath - Reddi 
assay of bone and/or cartilage formation. 

Another member of the BMP-2 protein family is designated 
BMP-2B and which we have previously referred to as BMP-4 or 



BMP-2 Class II. BMP-2B is produced by culturing a cell 
transfojnned with a cDNA substantially as shown in Table III 
and recovering from the culture medium a protein containing 
the amino acid sequence from amino acid #3li to #408 as shown 
in Table III. BMP-2B is further characterized by the ability 
of 200 nanograms of this protein to score at least +2 in the 
Rosen-modified Sampath - Reddi assay of bone and/or cartilage 
formation. 

Another aspect of the invention provides pharmaceutical 

compositions containing a therapeutically effective amount of 

a BMP-2 protein in a pharmaceutically acceptable vehicle or 

carrier. BMP-2 compositions may also be used for wound 

healing and tissue repair. The invention further provides 

pharmaceutical compositions containing a therapeutically 

effective amount of BMP-2A or BMP-2B in a pharmaceutically 

acceptable vehicle. Further compositions may contain both 

BMP-2A and BMP-2B in a pharmaceutically acceptable vehicle. 

Compositions of the invention may further include at least 

one other therapeutically useful agent such as the BMP proteins 

BMP-1, and BMP-3 disclosed respectively in co-owned and 

concurrently filed U.S. patent applications "^ ^y D l ct -^me and'^^.^,^^ 

4rrKi^^ :^ ^^DK!t' 50?/ /^ other therapeutically useful agents include 

/e?^Z'^0 , 

growth factors such as epidermal growth factor (EGF) , 

fibroblast growth factor (FGF) , and transforming growth 

factor (TGF) • The compositions may also include an apipropriate 

matrix for instance, for supporting the composition and 

providing a surface for bone and/or cartilage growth. The 

compositions may be employed in methods for treating a number 

of bone and/or cartilage defects, periodontal disease and 

various types of wounds. These methods, according to the 

invention, entail administering to a patient needing such 

bone and/or cartilage formation wound healing or tissue 

repair, an effective amount of a BMP-2 protein such as BMP-2 A 

and/or BMP-2B. These methods may also entail the administration 

of a protein of the invention in conjunction with at least 



3 

one of the novel BMP proteins disclosed in the co-owned 
applications described above. In addition, these methods may 
also include the administration of a BMP-2 protein with other 
growth factors. 

Still a further aspect of the invention are DNA sequences 
coding on expression for a BMP-2 protein. Such sequences 
include the sequence of nucleotides in a 5' to 3' direction 
illustrated in Tables I through III or DNA sequences which 
hybridize under stringent conditions with the DNA sequences 
of Tables I - III and encode a protein having the ability of 
2 00 nanograms of the protein to score at least +2 in the 
Rosen-modified Sampath - Reddi assay of bone and/or cartilage 
formation described in Example III. Finally, allelic or 
other variations of the sequences of Tables I through III, 
whether such nucleotide changes result in changes in the 
peptide sequence or not, are also included in the present 
invention. 

Still a further aspect of the invention is a vector 
containing a DNA sequence as described above in operative 
association with an expression control sequence therefor. 
Such vector may be employed in a novel process for producing 
a BMP-2 protein of the invention in which a cell line 
transformed with a DNA sequence encoding expression of a 
BMP-2 protein in operative association with an expression 
control sequence therefor, is cultured in a suitable culture 
medixim and a BMP-^ protein is isolated and purified therefrom. 
This claimed process may employ a number of known cells both ^ 
prokaryotic and eukaryotic as host cells for expression of 
the polypeptide. 

Other aspects and advantages of the present invention will 
be apparent upon consideration of the following detailed 
description and preferred embodiments thereof. 



Detailed Description of the Invention 

The purified BMP-2 proteins of the present invention are 



4 

produced by culturing a host cell transformed wth a cDNA of 
Table II or III and recovering from the culture medium a 
protein containing the 97 amino acid sequence or a substantially 
homologous sequence as represented by amino acid #299 to #396 
of Table II or #311 to #408 of Table III. Some BMP-2 proteins 
are also characterized by the ability of 200 nanogretms (ng) 
to score at least +2 in the Rosen-modified Sampath » Reddi 
assay of bone and/or cartilage formation. 

The BMP-2 proteins provided herein also include factors 
encoded by the sequences similar to those of Tables I - III, 
but into which modifications are naturally provided (e.g. 
allelic variations in the nucleotide sequence which may 
result in amino acid changes in the polypeptide) or 
deliberately engineered. For example, synthetic polypeptides 
may wholly or partially duplicate continuous sequences of the 
amino acid residues of Tables I - III. These sequences, by 
virtue of sharing primary, secondary, or tertiary structural 
and conformational characteristics with bone growth factor 
polypeptides of Tables I - III may possess bone growth factor 
biological properties in common therewith. Thus, they may be 
employed as biologically active s\ibstitutes for naturally- 
occurring BMP-2A and BMP-2B and other BiIP-2 polypeptides in 
therapeutic processes. 

Other specific mutations of the sequences of BMP-2 
proteins described herein involve modifications of one or 
both of the glycosylation sites. The absence of glycosylation 
or only partial glycosylation results from amino acid 
substitution or deletion at one or both of the asparagine- 
1 inked glycosylation recognition sites present in the sequences 
of BMP-2 A and BMP-2B proteins shown in Tables I - III. The 
asparagine-1 inked glycosylation recognition sites comprise 
tripeptide sequences which are specifically recognized by 
appropriate cellular glycosylation enzymes. These tripeptide 
sequences are either asparagine-X-threonine or asparagine-X- 
serine, where X is usually any amino acid. A variety of 



5 

amino acid substitutions or deletions at one or both of the 
first or third amino acid positions of a glycosylatipn 
recognition site (and/or amino acid deletion at the second 
position) results in non-glycosylation at the modified 
tripeptide sequence • . ^ 

The present invention also encompasses the novel DNA 
sequences, free of association with DNA sequences encoding other 
proteinaceous materials, and coding on expression for BMP-2 
proteins such as BMP-2A and BMP-2B. These DNA sequences 
include those depicted in Tables I - III in a 5 • to 3 • direction >c> 
and those sequences which hybridize under stringent 
hybridization conditions [see, T. Maniatis et al. Molecular 
Cloning fA Labo ratory Manual) , Cold Spring Harbor Laboratory 
(1982), pages 387 to 389] to the DNA secpiences of Tables I- 
III. t{ 

Similarly, DNA sequences which code for BMP-2 proteins 
such as BMP-2A and BMP-2B polypeptides coded for by the 
sequences of Tables I - III, but which differ in codon sequence 
due to the degeneracies of the genetic code or allelic 
variations (naturally-occurring base changes in the species 
population which may or may not result in an amino acid 
change) also encode the novel factors described herein. 
Variations in the DNA sequences of Tables I - III which are 
caused by point mutations or by induced modifications (including 
insertion, deletion, and substitution) to enhance the activity, 
ha If -life or production of the polypeptides encoded thereby 
are also encompassed in the invention. 

Another aspect of the present invention provides a novel 
method for producing BMP-2 proteins. The method of the 
present invention involves culturing a suitable cell line, 
which has been transformed with a DNA sequence coding on 
expression for a BMP-2 protein of the invention, under the 
control of known regulatory sequences. Suitable cells or 
cell lines may be mammalian cells, such as Chinese hamster 
ovary cells (CHO) . The selection of suitable mammalian host 



6 

cells and methods for transformation, culture, amplification, 
screening and product production and purification are known 
in the art. See, e.g., Gething and Sambrook, Nature . 293 ; 620" 
625 (1981), or alternatively, Kaufman et al, Mol . Cell. 
Biol. . 5(7) : 1750-1759 (1985) or Howley et al, U.S. Patent 
4,419,446. Another suitable mammalian cell line, which is 
described in the accompanying examples, is the monkey COS-1 
cell line. The mammalian cell CV-1 may also be suitable. 

Bacterial cells may also be suitable hosts. For example, 
the various strains of E. coli (e.g., HBlOl, MC1061) are 
well-known as host cells in the field of biotechnology. 
Various strains of B. subtilis, Pseudomonas . other bacilli 
and the like may also be employed in this method. 

Many strains of yeast cells known to those skilled in the 
art may also be available as host cells for expression of the 
polypeptides of the present invention. Additionally, where 
desired, insect cells may be utilized as host cells in the 
method of the present invention. See, e.g. Miller et al. 
Genetic Engineering , 8.: 277-298 (Plenum Press 1986) and 
references cited therein. 

Another aspect of the present invention provides vectors 
for use in the method of expression of these novel BMP- 2?^ and 
BMP- 2^ polypeptides. Preferably the vectors contain the full ^^'^ 
novel DNA sequences described above which code for the novel 
factors of the invention. Additionally the vectors also 
contain appropriate expression control sequences permitting 
expression of the BMP-2 protein sequences. Alternatively, 
vectors incorporating modified sequences as described above 
are also embodiments of the present invention and useful in 
the production of the BMP-2A and BMP-2B and other BMP-2 
proteins. The vectors may be employed in the method of 
transforming cell lines and contain selected regulatory 
sequences in operative association with the DNA coding sequences 
of the invention which are capable of directing the replication 
and expression thereof in selected host cells. Useful 



7 

regulatory sequences for such vectors are known to one of 
skill in the art and may be selected depending upon the 
selected host cells. Such selection is routine and does not 
fona part of the present invention, 

A protein of the present invention, which induces 
cartilage and/or bone growth in circumstances where bone is not 
normally formed, has application in the healing of bone 
fractures and cartilage defects in humans and other animals. 
Such a preparation employing a BMP-2 protein such as BMP-2A 
and BMP-2B may have prophylactic use in closed as well as 
open fracture reduction and also in the improved fixation of 
artificial joints. De novo bone formation induced by an 
osteogenic agent contributes to the repair of congenital, 
trauma induced, or oncologic resection induced craniofacial 
defects, and also is useful in cosmetic plastic surgery. A 
BMP-2 protein may be used in the treatment of periodontal 
disease, and in other tooth repair processes. Such agents 
may provide an environment to attract bone-forming cells, 
stimulate growth of bone-forming cells or induce differentiation 
of progenitors of bone-forming cells. A variety of osteogenic, 
cartilage-inducing and bone inducing factors have been 
described. See, e.g. European patent applications 148,155 
and 169,016 for discussions thereof. 

The proteins of the invention may also be used in wound 
healing and related tissue repair. The types of wounds 
include, but are not limited to burns, incisions and ulcers. 
(See, e.g. PCT Publication WO84/01106 for discussion of wound 
healing and related tissue repair) . 

A further aspect of the invention is a therapeutic method 
and composition for repairing fractures and other conditions 
related to cartilage and/or bone defects or periodontal dis- 
eases. In addition, the invention comprises therapeutic 
methods and compositions for wound healing and tissue repair. 
Such compositions comprise a therapeutically effective 
amount of at least one of the BMP-2 proteins of the invention 



8 

in admixture with a pharmaceutically acceptable vehicle, carrier 
or matrix. It is expected that the proteins of the invention 
may act in concert with or perhaps synergistically with other 
related proteins and growth factors. Further therapeutic 
methods and compositions of the invention therefore comprise 
a therapeutic amount of at least one BMP-2 protien of the 
invention with a therapeutic amount of at least one of the 
other BMP proteins disclosed in co-owned and concurrently 
filed U.S. applications described above. Further, BMP-2 
proteins such as BMP-2A and BMP-2B may be combined with other 
agents beneficial to the treatment of the bone and/or cartilage 
defect, wound, or tissue in question. These agents include 
various growth factors such as epidermal growth factor (EGF) , 
platelet derived growth factor (PDGF) , transforming growth 
factor (TGF) , and insulin-like growth factor (IGF) . The 
preparation and formulation of such physiologically acceptable 
protein compositions, having due regard to pH, isotonicity, 
stability and the like, is within the skill of the art. The 
therapeutic compositions are also presently valuable for 
veterinary applications due to the lack of species specificity 
in BMP proteins. Particularly domestic animals and thoroughbred 
horses in addition to hximans are desired patients for such 
treatment with BMP-2A and BMP-2B of the present invention. 

BMP-2A may be used individually in a pharmaceutical 
composition. BMP-2 A may also be used in combination with BMP- 
2B and/or one or more of the other BMP proteins disclosed iii 
co-owned and co-pending US applications as discussed above. 

BMP-2 B may be used individually in pharmaceutical 
composition. In addition, it may be used in combination with 
other BMP proteins as described above. 

The therapeutic method includes administering the 
composition topically, systematically , or locally as an 
implant or device. When administered, the therapeutic 
composition for use in this invention is, of course, in a 
pyrogen-free, physiologically acceptable form. Further, the 



• 



9 

composition may desirably be encapsulated or injected in a 
viscous form for delivery to the site of bone cartilage or 
tissue damage. Topical administration may be suitable for wound 
healing and tissue repair. Preferably for bone and/ or cartilage 
formation, the composition would include a matrix capable of 
delivering BMP-2A, BMP-2B or other BMP protein to the site of 
bone and/or cartilage damage, providing a structure for the 
developing bone and cartilage and optimally capable of being 
resorbed into the body. Such matrices may be formed of 
materials presently in use for other implanted medical 
applications. 

The choice of matrix material is based on biocompatibility, 
biodegradability, mechanical properties, cosmetic appearance 
and interface properties. The particular application of the 
BMP-2 compositions will define the appropriate formulation. 
Potential matrices for the compositions may be biodegradable 
and chemically defined calcivim sulfate, tricalciumphosphate, 
hydroxyapatite, polylactic acid and polyanhydrides . Other 
potential materials are biodegradable and biologically well 
defined, such as bone or dermal collagen. Further matrices 
are comprised of pure protieins or extracellular matrix 
components. Other potential matrices are nonbiodegradable and 
chemically defined, such as sintered hydroxyapatite, bioglass, 
alumina tes, or other ceramics. Matrices may be comprised of 
combinations of any of the above mentioned types of material , 
such as polylactic acid and hydroxyapatite or collagen and 
tricalciumphosphate. The bioceramics may be altered in 
composition, such as in calcium-aluminate-phosphate and 
processing to alter pore size, particle size, particle shape, 
and biodegradability. 

The dosage regimen will be determined by the attending 
physician considering various factors which modify the action 
of the BMP-2 protein, e.g. amount of bone weight desired to be 
formed, the site of bone damage, the condition of the damaged 
bone, the size of a wound, type of damaged tissue, the patient's 




10 

age, sex, and diet, the severity of any infection, time of 
administration and other clinical factors. The dosage may 
vary with the type of matrix used in the reconstitution and 
the type of BMP in the composition of BMP's. The addition of 
other known growth factors, such as IGF I (insulin like growth 
factor I) f to the final composition, may also effect the dosage. 
Progress can be monitored by periodic assessment of bone 
growth and/ or repair, e.g. x-rays. 

The following examples illustrate practice of the present 
invention in recovering and characterizing bovine BMP-2A protein 
and employing it to recover the hviman proteins BMP-2A and 
BMP-2B, obtaining the human proteins and in expressing the 
proteins via recombinant techniques. 

EXAMPLE I 

Isolation of Bovine Bone Inductive Factor 

Ground bovine bone powder (2 0-120 mesh, Helitrex) is 
prepared according to the procedures of M. R. Urist et al., 
ProG, Natl Acad. Sci USA . 70:3511 (1973) with elimination of 
some extraction steps as identified below. Ten kgs of the 
ground powder is demineralized in successive changes of 0.6N 
HCl at 4*C over a 48 hour period with vigorous stirring. The 
resulting suspension is extracted for 16 hours at 4*C with 50 
liters of 2M CaCl2 and lOmM ethylenediamine-tetraacetic acid 
[EDTA], and followed by extraction for 4 hours in 50 liters of 
0.5M EDTA. The residue is washed three times with distilled 
water before its resuspension in 20 liters of 4M guanidine 
hydrochloride [GuCl], 20mM Tris (pH7.4) , ImM N-ethylmaleimide, 
ImM iodoacetamide, imM phenylmethylsulf onyl fluorine as 
described in Clin. Orthop. Rel . Res, , 171: 213 (1982) . 
After 16 to 20 hours the supernatant is removed and replaced 
with another 10 liters of GuCl buffer. The residue is extracted 
for another 24 hours. 

The crude GuCl extracts are combined, concentrated 
approximately 20 times on a Pellicon apparatus with a 10,000 



11 

molecular weight cut-off membrane, and then dialyzed in 50mM 
Tris, O.IM NaCl, 6M urea (pH7.2), the starting buffer for the 
first column. After extensive dialysis the protein is loaded 
on a 4 liter DEAE cellulose column and the unbound fractions 
are collected. 

The unbound fractions are concentrated and dialyzed against 
50mM NaAc^ 50mM NaCl (pH 4.6) in 6M urea. The unbound fractions 
are applied to a carboxymethyl cellulose colvimn. Protein not 
bound to the column is removed by extensive washing with 
starting buffer, and the material containing protiein having 
bone and/or cartilage formation activity as measured by the 
Rosen-modified Sampath - Reddi assay (described in Example 
III below) desorbed from the column by 50mM NaAc, 0.25mM NaCl, 
6M urea (pH 4.6). The protein from this step elution is con- 
centrated 2 0- to 4 0- fold, then diluted 5 times with 80mM 
KPO4, 6M urea (pH6.0). The pH of the solution is adjusted to 
6.0 with SOOmM K2HPO4 • The sample is applied to an 
hydroxylapatite column (LKB) equilibrated in 80mM KP04^ 6M 
urea (pH6.0) and all unbound protein is removed by washing 
the column with the same buffer. Protein having bone and/or 
cartilage formation activity is eluted with lOOmM KPO4 (pH7.4) 
and 6M urea. 

The protein is concentrated approximately 10 times, and 
solid NaCl added to a final concentration of 0.15M. This 
material is applied to a heparin - Sepharose column equilibrated 
in 50mM KPO4, 150mM NaCl, 6M urea (pH7.4). After extensive 
washing of the column with starting buffer, a protein with 
bone and/or cartilage inductive activity is eluted by 50mM 
KPO4, 700mM NaCl, 6M urea (pH7.4). This fraction is con- 
centrated to a minimum volume, and 0.4ml aliguots are applied 
to Superose 6 and Superose 12 columns connected in series, 
equilibrated with 4M GuCl, 20mM Tris (pH7.2) and the columns 
developed at a flow rate of 0.25ml/min. The protein demon- 
strating bone and/or cartilage inductive activity has a 
relative migration on SDS-PAGE corresponding to approximately 




12 

3 0,000 dalton protein. 

The above fractions from the superose colu3aans are pooled, 
dialyzed against SOmM NaAc, 6M urea (pH4.6), and applied to a 
Pharmacia MonoS HR column. The column is developed with a 
gradient to l.OM NaCl, 50mM NaAc, 6M urea (pH4,6). Active 
bone and/or cartilage formation fractions are pooled and 
brought to pH3,0 with 10% trif luoroacetic acid (TFA) . The 
material is applied to a 0.46 x 25cm Vydac C4 column in 0.1% 
TFA and the column developed with a gradient to 90% 
acetonitrile, 0.1% TFA (31.5% acetonitrile, 0.1% TFA to 49.5% 
acetonitrile, 0.1% TFA in 60 minutes at 1ml per minute). 
Active material is eluted at approximately 40-44% acetonitrile, 
Aliquots of the appropriate active fractions are iodinated by 
one of the following methods: P. J. McConahey et al/ 
Int, Arch. Allergy, 29:185-189 (1966); A. E. Bolton et al, 
Biochem J, , 13 3 : 529 ( 1973 ); and D. F. Bowen-Pope, 
J. Biol. Chem, , 237:5161 (1982). The iodinated proteins 
present in these fractions are analyzed by SDS gel 
electrophoresis and urea Triton X 100 isoelectric focusing. 
At this stage, the protein having bone and/or cartilage 
forming activity is estimated to be approximately 10-50% pure. 

EXAMPLE II 

Characterization of Bovine Bone Inductive Factor 
A. Molecular Weight 

Approximately 20ug protein from Example I is lyophilized 
and redissolved in IX SDS sample buffer. After 15 minutes of 
heating at 37*C, the sample is applied to a 15% SDS 
polyacrylamide gel and then electrophoresed with cooling. The 
molecular weight is determined relative to prestained molecular 
weight standards (Bethesda Research Labs) . Immediately after 
completion, the gel lane containing bone and/or cartilage 
foirming material is sliced into 0.3cm pieces. Each piece is 
mashed and 1.4ml of 0.1% SDS is added. The samples are 
shaken gently overnight at room temperature to elute the 





13 

ZB is desalted to prevent interference 
lay. The supernatant from each sample is 
0 with 10% TFA, filtered through a 0.45 
>and loaded on a 0.46cm x 5cm C4 Vydac column 
^^^Si gradient of 0.1% TFA to 0.1% TFA, 90% CH3CN. 
^^J^^^ate bone and/or cartilage inductive^ protein - 
jijij^ fractions are pooled and reconstituted with 20mg 
r'ix and assayed. In this gel system, the majority of 
^d/or cartilage inductive fractions have the mobility 
protein having a molecular weight of approximately 
,000 - 30,000 daltons. 

Isoelectric Focusing 
The isoelectric point of bone inductive factor activity 
"xs determined in a denaturing isoelectric focusing system. The 
Triton XlOO urea gel system (Hoeffer Scientific) is modified 
as follows: 1) 40% of the ampholytes used are Servalyte 
3/10; 60% are Servalyte 7-9; and 2) the catholyte used is 40mM 
NaOH. Approximately 2 0ug of protein from Example I is 
lyophilized, dissolved in sample buffer and applied to the 
isoelectrofocusing gel. The gel is run at 20 watts, 10*C for 
approximately 3 hours. At completion the lane containing 
bone and/ or cartilage inductive factor is sliced into 0.5 cm 
slices. Each piece is mashed in 1.0ml 6M urea, 5mM Tris (pH 
7.8) and the samples agitated at room temperature. The 
samples are acidified, filtered, desalted and assayed as 
described above. The major portion of activity as determined 
by the Rosen-modif ied Sampath - Reddi assay migrates in a 
manner consistent with a pi of about 8.8-9.2. 

C. subunit Characterization 

The subunit composition of the isolated bovine bone 
protein is also determined. Pure bone inductive factor is 
isolated from a preparative 15% SDS gel as described above. 
A portion of the sample is then reduced with 5mM DTT in 



f 



14 

sample buffer and re-el ectrophoresed on a 15% SDS gel. The 
approximately 28-30kd protein yields two major bands at 
approximately l8-201cd and approximately 16-18kd, as well as a 
minor band at approximately 28-30kd. The broadness of the 
two bands indicates heterogeneity caused most probably by 
glycosylation, other post translat ional modification, 
proteolytic degradation or carbamylation. 

EXAMPLE III 
Rosen Modified Sampath-Reddi Assay 

A modified version of the rat bone formation assay 
described in Sampath and Reddi, Proc. Natl. Acad. Sci, U.S.A. ^ 
80:6591-6595 (1983) is used to evaluate bone and/or cartilage 
J activity of the bovine protein obtained in Example I and the 
\^ Q BMP-/^proteins of the invention. This modified assay is 



0 



.1/ herein called the Rosen-modified Sampath-Reddi assay. The 

ethanol precipitation step of the Sampath-Reddi procedure is 
replaced by dialyzing (if the composition is a solution) or 
diafiltering (if the composition is a suspension) the fraction 
to be assayed against water. The solution or suspension is then 
redissolved in 0.1 % TFA, and the resulting solution added to 
20mg of rat matrix. A mock rat matrix sample not treated with 
the protein serves as a control. This material is frozen and 
lyophilized and the resulting powder enclosed in #5 gelatin 
capsules. The capsules are implanted subcutaneous ly in the 
abdominal thoracic area of 21 - 49 day old male Long Evans 
rats. The implants are removed after 7-14 days. Half of 
each implant is used for alkaline phosphatase analysis [See^ 
A. H. Reddi et al., Proc. Natl Acad Sci. . 69 i 1601 (1972) ] . 

The other half of each implant is fixed and processed for 
histological analysis. About lum glycolmethacrylate sections 
are stained with Von Kossa and acid fuschin to score the amount 
of induced bone and cartilage formation present in each 
implant. The terms +1 through +5 represent the area of each 
histological section of an implant occupied by new bone and/or 



15 

cartilage cells and matrix. A score of +5 indicates that 
greater than 50% of the implant is new bone and/or cartilage 
produced as a direct result of protein in the implant. A score 
of +4, +3, +2 and +1 would indicate that greater than 40% ^ 
30%^ 20% and 10% respectively of the implant contains new 
cartilage and/or bone. 

The rat matrix samples containing at least 200 ng of 
protein obtained in Example I result in bone and/or cartilage 
formation that filled more than 20% of the implant areas that 
was sectioned for histology. This protein therefore scores at 
least +2 in the Rosen-modified Sampath-Reddi assay. The dose 
response of the matrix samples indicates that the amount of bone 
and/or cartilage formed increases with the amount of protein 
in the sample. The control sample did not result in any bone 
and/br cartilage formation. The purity of the protein assayed 
is approximately 10-15% pure. 

The bone and/or cartilage formed is physically confined 
to the space occupied by the matrix. Sainples are also analyzed 
by SDS gel electrophoresis and isoelectric focusing as described 
above, followed by autoradiography. Analysis reveals a 
correlation of activity with protein bands at 28 - 30kd and a 
pi of approximately 8.8 - 9.2. To estimate the purity of the 
protein in a particular fraction an extinction coefficient of 
1 OD/mg-cm is used as an estimate for protein and the protein 
is run on SDS PAGE followed by silver straining or 
radioiodination and autoradiography. 

EXAMPLE IV 

Bovine BMP-2A 

The protein composition of Example IIA of molecular 
weight 28 - 3 0kd is reduced as described in Example IIC and 
digested with trypsin. Eight tryptic fragments are isolated 
by standard procedures having the following amino acid 
sequences: 

Fragment 1:AAFLGDIALDEEDLG 



If 



16 



Fragment 


2; 


A 


F 


Q 


V 


Q 


Q 


A 


A 


D 


L 


Fragment 


3; 


N 


Y 


Q 


D 


M 


V 


V 


E 


G 




Fragment 


4: 


S 


T 


P 


A 


Q 


D 


V 


S 


R 




Fragment 


5: 


N 


Q 


E 


A 


L 


R 










Fragment 


6: 


L 


S 


E 


P 


D 


P 


s 


H 


T 


LEE 


Fragment 


7: 


F 


D 


A 


Y 


Y 












Fragment 


8: 


L 


K 


P 


S 


N 


? 


A 


T 


I 


Q S I 



Two probes consisting of pools of oligonucleotides (or 
unique oligonucleotides) are designed according to the method 
of R. Lathe, J. Mol, Biol. , 183 (1) : 1-12 (1985) on the basis 
of the amino acid sequence of Fragment 3 and synthesized on 
an automated DNA synthesizer as described above. 
Probe #1: ACNACCAT [A/G] T C [T/C] T G [A/G] AT 
Probe #2: C A [A/G] G A [T/C] ATGGTNGTNGA 

Because the genetic code is degenerate (more than one 
codon can code for the same amino acid) , the number of oligo- 
nucleotides in a probe pool is reduced based on the frequency 
of codon usage in eukaryotes, the relative stability of G:T 
base pairs, and the relative infrequency of the dinucleotide 
CpG in eukaryotic coding sequences [See J. J. Toole et al, 
Nature , 312 : 342-347 (1984)]. Bracketed nucleotides are 
alternatives. "N" means either A, T, C or G. These probes are 
radioactively labeled and employed to screen a bovine genomic 
library. The library is constructed as follows: Bovine liver 
DNA is partially digested with the restriction endonuclease 
enzyme Sau 3A and sedimented through a sucrose gradient. Size 
fractionated DNA in the range of 15-3 Okb is then ligated to 
the vector lambda J' Bam HI arms [Mullins et al., Nature . 
308:856-858 (1984) ] . The library is plated at 8000 recombinants 
per plate. Duplicate nitrocellulose replicas of the plaques 
are made and amplified according to a modification of the 
procedure of Woo et al, Proc. Natl. Acad. Sci. USA , 75:3688- 
91 (1978). Probe #1 is hybridized to the set of filters in 3M 
tetramethylammonium chloride (TMAC) , 0. IM sodium phosphate 



17 

pH6.5, ImM EDTA, 5X Denhardts, 0.6% SDS, lOOug/ml salmon sperm 
DNA at 48 degrees C, and washed in 3M TMAC, 50mM Tris pH8.0 at 
50 degrees c. These conditions minimize the detection of 
mismatches to the 17 mer probe pool [see, Wood et al, Proc. 
Natl. Acad. Sci. U.S.A.. 82!l5a5-15ftB (1985)]. 

400,000 recombinants are screened by this procedure. 
One duplicate positive is plaque purified and the DNA is 
isolated from a plate lysate of the recombinant bacteriophage 
designated lambda bP-21. Bacteriophage bP-21 was deposited 
with the American Type Culture Collection, 12301 Parklawn 
Drive, RocJcville, Maryland USA (hereinafter the "ATCC") under 
accession number ATCC 40310 on March 6, 1987. This deposit 
as well as the other deposits contained herein meets the 
requirements of the Budapest Treaty on the International 
Recognition of the Deposit of Microorganisms for the Purposes 
of Patent Procedure and Regulations therevmder. The bP-21 
clone encodes at least a portion of a bovine BMP-2 protein 
designated bovine BMP-2A or bBMP-2A. 

The oligonucleotide hybridizing region of this BMP-2A 
clone is localized to an approximately 1.2 kb Sac I restriction 
fragment which is subcloned into M13 and sequenced by standard 
techniques. The partial DNA sequence and derived amino acid 
sequence of this Sac I fragment and the contiguous Hind III- 
Sac I restriction fragment of bP-21 are shown below in Table 
I. The BMP-2A peptide sequence from this clone is 129 amino 
acids in length and is encoded by the DNA sequence from 
nucleotide #1 through nucleotide #387. The amino acid sequence 
corresponding to the tryptic fragment isolated from the 
bovine bone 28 to 3 0kd material is underlined in Table I. 
The underlined portion of the sequence corresponds to tryptic 
Fragment 3 above from which the oligonucleotide probes for 
BMP-2A are designed. The predicted amino acid sequence 
indicates that tryptic Fragment 3 is preceded by a basic, 
residue (K) as expected considering the specif icity of trypsin. 
The arginine residue encoded by the CGT triplet is presumed 



• 



19 



TABLE I 

(1) 15 30 45 

GGC CAC GAT GGG AAA GGA CAC CCT CTC CAC AGA AGA GAA AAG CGG 
GHDGKGH PLHR REK R 

60 75 90 

CAA GCA AAA CAC AAA CAG CGG AAA CGC CTC AAG TCC AGC TGT AAG 
Q A K H K Q R K R L K S S C K 

(32) 105 120 135 

AGA CAC CCT TTA TAT GTG GAC TTC AGT GAT GTG GGG TGG AAT GAC _ 
R H P L Y V D P S D V G W M D 

150 165 180 

TGG ATC GTT GCA CC6 CCG GGG TAT CAT GCC TTT TAC TGC CAT GGG 
W I V A P P G Y H A F Y C H G (Co 

195 210 225 

GAG TGC CCT TTT CCC CTG GCC GAT CAC CTT AAC TCC AC6 AAT CAT—, 
E C P F P L A D H L N S T N H (j7 5 

240 255 270 

GCC ATT CTC CAA ACT CTG GTC AAC TCA GTT AAC TCT AAG ATT CCC 
AI VQTLVNSVNSKI P' 



385 



300 



315 



AAG GCA TGC TGT GTC CCA ACA GAG CTC AGC GCC ATC TCC ATG CTG 



K 



330 




S 



M 



345 



360 



TAC CTT GAT GAG AAT GAG AAG GTG GTA TTA AAG AAC TAT CAG GAC 



E 



K IL 



375 (129) 397 407 

ATG GTT GTC GAG GGT TGT GGG TGT CGT TAGCACAGCA AAATAAAATA 
M V V E G C G C R 

417 427 437 447 457 

TAAATATATA TATATATATA TTAGAAAAAC AGCAAAAAAA TCAAGTTGAC 

467 47^ 487 497 507 

ACTTTAATAT TTCCCAATGA AGACTTTATT TATGGAATGG AATGGAGAAA 



517 527 537 547 557 

AAGAAAAACA CAGCTATTTT GAAAACTATA TTTATATCTA CCGAAAAGAA 



567 577 587 

GTTGGGAAAA CAAATATTTT AATCAGAGAA TTATT 



20 

EXAMPLE V 

Human BMP-2A and BMP-2B 

The Hindlll-SacI bovine genomic BMP-2A fragment described 
in Example IV is siibcloned into an M13 vector. A ^^p^^^beled 
single-stranded DNA probe is made from a template preparation 
of this subclone. This probe is used to screen polyadenylated 
RNAs from various cell and tissue sources. Polyadenylated 
RNAs from various cell and tissue sources are electrophoresed 
on formaldehyde-agarose gels and transferred to nitrocellulose 
by the method of Toole et al., supra . The probe is then 
hybridized to the nitrocellulose blot in 50% formamide, 5 X 
SSC, 0.1% SDS, 40 mM sodium phosphate pH 6.5, 100 ug/ml 
denatured salmon sperm DNA, and 5 mM vanadyl ribonucleosides 
at 42® C overnight and washed at 65° C in 0.2 X SSC, 0.1% 
SDS. A hybridizing band corresponding to an mRNA species of 
approximately 3.8 kb is detected in the lane containing RNA 
from the human cell line U-2 OS. The Hindlll-SacI fragment 
is labeled with -^^p ^y nick translation and used to screen 
the nitrocellulose filter replicas of the above-described U-2 
OS cDNA library by hybridization in standard hybridization 
buffer at 65° overnight followed by washing in 1 X SSC, 0.1% 
SDS at 65°. Twelve duplicate positive clones are picked and 
replated for secondaries. Duplicate nitrocellulose replicas 
are made of the secondary plates and both sets hybridized to 
the bovine genomic probe as the primary screening was performed. 
One set of filters is then washed in 1 X SSC, 0.1% SDS; the 
other in 0.1 X SSC, 0.1% SDS at 65°. 

Two classes of hBMP-2 cDNA clones are evident based on 
strong (4 recombinants) or weak (7 recombinants) hybridization 
signals under the more stringent washing conditions (0.1 X 
SSC, 0.1% SDS). All 11 recombinant bacteriophage are plaque 
purified, small scale DNA preparations made from plate lysates 
of each, and the inserts subcloned into pSP65 and into M13 



21 

for sequence analysis. Sequence analysis of the strongly 
hybridizing clones designated hBMP-2A (previously designated 
BMP-2 and BMP-2 Class I) indicates that they have extensive 
sequence homology with the sequence given in Table I. These 
clones are therefore cDNA encoding the human equivalent of 
the protein encoded by the bBMP-2A gene whose partial sequence 
is given in Table I, Sequence analysis of the weakly 
hybridizing recombinants designated hBMP-2B (previously 
designated BMP-4 and BMP-2 Class II) indicates that they are 
also quite homologous with the sequence given in Table I at 
the 3* end of their coding regions, but less so in the more 
5' regions. Thus they encode a human protein of similar, 
though not identical, structure to that above. 

Full length human BMP-2A cDNA clones are obtained in 
the following manner. The 1.5 kb insert of one of the BMP-2B 
subclones (II-lO-l) is isolated and radioactively labeled by 
nick-translation. One set of the nitrocellulose replicas of 
the U-2 OS cDNA library screened above (50 filters, 
corresponding to 1,000,000 recombinant bacteriophage) are 
rehybridized with this probe under stringent conditions 
(hybridization at 65^ in standard hybridization buffer; 
washing at 65® in 0.2 X SSC, 0.1% SDS) . All recombinants 
which hybridize to the bovine genomic probe which do not 
hybridize to the BMP-2B probe are picked and plaque purified 
(10 recombinants) . Plate stocks are made and small scale 
bacteriophage DNA preparations made. After sxibcloning into 
M13, sequence analysis indicates that 4 of these represent 
clones which overlap the original BMP-2A clone. One of these, 
lambda U20S-39, contains an approximately 1.5 kb insert and 
was deposited with the ATCC on June 16, 1987 under accession 
number 40345. The partial DNA sequence (compiled from lambda 
U2 0S-3 9 and several other hBMP-2A cDNA recombinants) and 
derived amino acid sequence are shown below in Table II. 
Lambda U20S-39 is expected to contain all of the nucleotide 
sequence necessary to encode the entire human counterpart of 



22 

the protein BMP- 2 A encoded by the bovine gene segment whose 
partial sequence is presented in Table I. The BMP-2A protein 
encoded by Table II is contemplated to contain the 97 amino 
acid sequence from amino acid #2 99 to #396 or a sequence 
substantially homologous thereto. This human cDNA hBMP-2;Br ^ 
contains an open reading frame of 1188 bp, encoding a protein 
of 3 96 amino acids. The protein is preceded by a 5 • 
untranslated region of 342 bp with stop codons in all frames. 
The 13 bp region preceding this 5« untranslated region 
represents a linker used in the cDNA cloning procedure. This 
protein of 396 amino acids has a molecular weight of 45kd 
based on this amino acid sequence. It is contemplated that 
this sequence represents the primary translation product. It 
is further contemplated that BMP-2A may correspond to the 
approximately 18 - 20kd subunit of Example IIC. The sequence 
corresponding to the secjuence tryptic Fragment 3 of Example 
IV is underlined in Table II. 



23 

TABLE II 



10 20 30 40 50 60 70 

GTQGACTCIA GftGrSTOIGT CaGCaCITQG CTGGQGAdT CITGAACnG CftGGGAGAAT AACTIGCXXA 



80 90 100 no 120 130 140 

ocxxacmG axxxxfiGcc TrrccoocaG osGAGOcaGc TroGccsiTCT oogiagocxxa cxxscxxxtcc 



150 160 170 180 190 200 210 

ACTCXTOSGC CTTGOOaSAC ACTGRGACGC TSITCrCAGC GIGAAAAGAG AGACTGOSOG GOaSGGAOUC 



220 230 240 250 260 270 280 

GGGAGAAGGA GGAGGCAAAG AAAAGGAA06 GACATTOGGT CJCTIGOGCCA GGTOCnTGA OCS^SAGinT 



290 30 0 310 320 330 340 350 

TOCAICTQGA aSCTCITTCA AIGGAOSIGT aDOGGGSTGC TTCTERGACX5 GACTGOSGIC TOCTAAAGGT 



(1) 370 385 400 

OGACr ATG GIG GOC GGG AOC OGC TST CTT CIA GOG TTG CIG CIT OOC GAG GIC 
MET Val Ala Gly Ihr Arg cys Leu Leu Ala Leu Leu Leu Pro Gin Val 

415 430 445 

CrC CIG GGC GGC GOG GOT GGO CTC GTT COS GAG CTG GGC OGC AGG AAG TTC GOG 
Ifiu Leu Gly Gly Ala Ala Gly Leu Val Pro Glu Leu Gly Arg Arg Lys Rie Ala 

460 475 490 505 

GOG GOG TOG TOG GGC OGC COC TCA TOC GAG OOC TCT GAC GAG GTC CIG AGO GAG 

Ala Ala Ser Ser Gly Arg Pro Ser Ser Gin Pro Ser Asp Glu Val Leu Ser Glu 

520 535 550 565 

TTC GAG TTG OQG CTG CTC AGO AIG TIC GGC CTG AAA CAG AGA OOC AOC OOC AGO 
Hie Glu Leu Arg Leu Leu Ser MET Phe Gly Lai Lys Gin Arg Pro Ihr Pro Ser 

580 595 610 

AGG GAC GOC GTG GTG OOC OOC TAC ATG CTA GAC CIG TAT OGC AGG GAC TCA OCT 
Arg Asp Ala Val Val Pro Pro Tyr VEI Leu Asp Leu Tyr Arg Arg His Ser Gly 

625 640 655 670 

CAG COG GGC TCA OOC GOO OCA GAC CAC OQG TTG GAG AGG GCA GOC AGO CGA GOC 
Gin Pro Gly Ser Pro Ala Pro Asp His Arg Leu Glu Arg Ala Ala Ser Arg Ala 

685 700 715 

AAC ACT GIG OGC AGO TIC CAC CAT GAA GAA TCT TIG GAA GAA CIA CCA GAA AOG 
Asn Ihr Val Arg Ser Rie His His Glu Glu Ser Leu Glu Glu Leu Pro Glu Thr 



20 

EXAMPLE V 

Human BMP-2A and BMP-2B 

The Hindlll-SacI bovine genomic BMP-2A fragment described 
in Example IV is sxibcloned into an M13 vector. A 32p.iabeled 
single-stranded DNA probe is made from a template preparation 
of this siibclone. This probe is used to screen polyadenylated 
RNAs from various cell and tissue sources. Polyadenylated 
RNAs from various cell and tissue sources are electrophoresed 
on formaldehyde-agarose gels and transferred to nitrocellulose 
by the method of Toole et al . , supra . The probe is then 
hybridized to the nitrocellulose blot in 50% formamide, 5 X 
SSC, 0.1% SDS, 40 loM sodium phosphate pH 6.5> 100 ug/ml 
denatured salmon sperm DNA, and 5 mM vanadyl ribonucleosides 
at 42° C overnight and washed at 65® C in 0.2 X SSC, 0.1% 
SDS. A hybridizing band corresponding to an mRNA species of 
approximately 3.8 kb is detected in the lane containing RNA 
from the human cell line U-2 OS. The Hindlll-SacI fragment 
is labeled with ^y nick translation and used to screen 

the nitrocellulose filter replicas of the above-described U-2 
OS cDNA library by hybridization in standard hybridization 
buffer at 65® overnight followed by washing in 1 X SSC, 0.1% 
SDS at 65®. Twelve duplicate positive clones are picked and 
replated for secondaries. Duplicate nitrocellulose replicas 
are made of the secondary plates and both sets hybridized to 
the bovine genomic probe as the primary screening was performed. 
One set of filters is then washed in 1 X SSC, 0.1% SDS; the 
other in 0.1 X SSC, 0.1% SDS at 65®. 

Two classes of hBMP-2 cDNA clones are evident based on 
strong (4 recombinants) or weak (7 recombinants) hybridization 
signals under the more stringent washing conditions (0.1 X 
SSC, 0.1% SDS). All 11 recombinant bacteriophage are plaque 
purified, small scale DNA preparations made from plate lysates 
of each, and the inserts subcloned into pSP65 and into M13 



21 

for sequence analysis. Sequence analysis of the strongly 
hybridizing clones designated hBMP-2A (previously designated 
BMP-2 and BMP-2 Class I) indicates that they have extensive 
sequence homology with the sequence given in Table I. These 
clones are therefore cDNA encoding the human ecjuivalent of 
the protein encoded by the bBMP-2A gene whose partial sequence 
is given in Table I. Sequence analysis of the weakly 
hybridizing recombinants designated hBMP-2B (previously 
designated BMP-4 and BMP-2 Class II) indicates that they are 
also quite homologous with the sequence given in Table I at 
the 3* end of their coding regions^ but less so in the more 
5' regions. Thus they encode a hximan protein of similar, 
though not identical, structure to that above. 

Full length human BMP-2A cDNA clones are obtained in 
the following manner. The 1.5 kb insert of one of the BMP-2B 
subclones (II-lO-l) is isolated and radioactively labeled by 
nick-translation. One set of the nitrocellulose replicas of 
the U-2 OS cDNA library screened above (50 filters, 
corresponding to 1,000,000 recombinant bacteriophage) are 
rehybridized with this probe under stringent conditions 
(hybridization at 65^ in standard hybridization buffers- 
washing at 65^ in 0.2 X SSC, 0.1% SDS) . All recombinants 
which hybridize to the bovine genomic probe which do not 
hybridize to the BMP-2B probe are picked and plaque purified 
(10 recombinants) • Plate stocks are made and small scale 
bacteriophage DNA preparations made. After subcloning into 
M13, sequence analysis indicates that 4 of these represent 
clones which overlap the original BMP-2A clone. One of these, 
lambda U20S-39, contains an approximately 1.5 kb insert and 
was deposited with the ATCC on June 16, 1987 under accession 
number 40345. The partial DNA sequence (compiled from lambda 
U2 0S-3 9 and several other hBMP-2A cDNA recombinants) and 
derived amino acid sequence are shown below in Table II. 
Lambda U20S-39 is expected to contain all of the nucleotide 
sequence necessary to encode the entire human counterpart of 



22 

the protein BMP-2A encoded by the bovine gene segment whose 
partial sequence is presented in Table I. The BMP-2A protein 
encoded by Table II is contemplated to contain the 97 amino 
acid sequence from amino acid #299 to #396 or a sequence 
substantially homologous thereto. This hviman cDNA hBMP-2^^ 
contains an open reading frame of 1188 bp, encoding a protein 
of 396 amino acids. The protein is preceded by a 5' 
untranslated region of 342 bp with stop codons in all frames. 
The 13 bp region preceding this 5' untranslated region 
represents a linker used in the cDNA cloning procedure. This 
protein of 3 96 amino acids has a molecular weight of 45kd 
based on this amino acid sequence. It is contemplated that 
this sequence represents the primary translation product, it 
is further contemplated that BMP-2A may correspond to the 
approximately 18 - 20kd subunit of Example IIC. The sequence 
corresponding to the sequence tryptic Fragment 3 of Example 
IV is underlined in Table II. 



23 

TABLE II 



10 20 30 40 50 60 70 

GICEliCICIk GAGTDGTCnGT CAGCACITGG CDGGGGACIT CTTGAACTZG CAGGGAGAAT MiCnXSCGCk 

80 90 100 no 120 130 140 

OCJOCACiTiG OGOOGGTGOC TITGCJOCXftG OQGRGCJCIGC TTOGCCftTCr CCX3AG0CXXA C30G00CX3OC 

150 160 170 180 190 200 210 

ACrCCTOGGC CITGCXXSGAC ACIGAGAOGC TSTTCXXAGC GTGAAAAGAG AGACTGOSOS GOOQGCACXX: 

220 230 240 250 260 270 280 

GGAQGCAAAG AAAAQGAAOG GACSOTOSGr OCrrGOaOCA GGTOCITIGA OCaGft bTlTi ' 

290 300 310 320 330 340 350 

TOCATSIGGA CJGCTCTITCA AIGGAOSIGT OOOOGOGriGC TTCTTftGAOS GAdGOSGTC T0CI3^AAGGT 

(1) 370 385 400 

aSkCC KEG GIG GOC GGG AOC GGC TGT CTT CIA GOG TTG CTG CIT GCC CftG GIC 
MET Val Ala Gly Thr Arg Cys Leu Lai Ala Leu Leu Leu Pro Gin Val 

415 430 445 

dC CTG GGC GGC GOG GCT GGC CTC GIT COG GAG CTG GGC OGC AQ6 AA6 ITC GOG 
Leu Leu Gly Gly Ala Ala Gly Leu Val Pro Glu Leu Gly Arg Arg Lys Hie Ala 

460 475 490 505 

GOG GOS TOG TOS GGC OGC OOC TCA TOC CAG OOC TCr GAC GAG GIC CIG AGC Gft^ 

Ala Ala Ser Ser Gly Axg Pro Ser Ser Gin Pro Ser Asp Glu Val Leu Ser Glu 

520 535 550 565 

TIC GAG TIG OGG CIG CTC AGO AXG TIC GGC CIG AAA CAG AGA OOC ADC OOC AGO 
£lie Glu Leu Arg Leu lea Ser ME:! Fhe Gly Leu Lys Gin Axg Pro Thr Fzo Ser 

580 595 610 

AG6 GAC GCC GIG GIG COC OCC TAC ATG CIA GAC CIG TAT GGC AGG CAC TCA GGT 
Arg Asp Ala Val Val Pro Pro Tyr MET Leu Asp Leu lyr Arg Arg His Ser Gly 

625 640 655 670 

CAG COG GGC TCA OOC GOC OCA GAC CAC OGG TIG GAG AGG GCA GOC AGO OGA GOC 
Gin Pro Gly Ser Pro Ala Pro Asp His Arg Leu Glu Arg Ala Ala Ser Arg Ala 



685 700 715 

AAC ACT GIG OGC AGO TIC CAC CAT GAA GAA TCT TIG GAA GAA CIA 
Asn !Ihr Val Arg Ser Ihe His His Glu Glu Ser Leu Glu Glu Lea 



CCA GAA AOG 
Pro Glu Thr 



• 



24 



730 745 760 775 

AGT GGG AAA AC3^ ACC COG AGA TTC TTC TIT AAT TTA AC?! TCT ATC OCC ADG GAG 

Ser Gly Lys Ihr Thr Arg Arg Rie Fhe Hie Asn Leu Ser Ser He Pro Uir Glu 

790 805 820 835 

GAG TIT ATC AOC TCA QCk GAG CTT CftG GTT TTC CGA GAA CAG ATG CAA GAT GCT 
Glu Hie lie Ihr Ser Ala Glu Leu Gin Val Hie Arg Glu Gin MET Gin Asp Ala 

850 865 880 

TTA GGA AAC AAT AGO AGT TTC CAT CAC OSA ATT AAT ATT TAT GAA ATC AIA AAA 
Leu Gly Asn Asn Ser Ser Hie His His Arg lie Asn lie Tyr Glu He He lys 

895 910 925 940 

OCT GCA ACA GOC AAC TCS AAA TTC OOC GIG AOC AGA CTT TIG GAC ACC AG6 TIG 
Pro Ala Hit Ala Asn Ser Lys Hie Pro Val Thr Arg Leu Leu Asp Thr Arg Leu 

955 970 985 

GIG AAT GAG AAT GCA AGC AGG TGG GAA AGT TTT GAT GIC AOC OOC Gd GTS ATS 
Val Asn Gin Asn Ala Ser Arg Trp Glu Ser Hie Asp Val Thr Pro Ala Val MET 

1000 1015 1030 1045 

0G6 TOG ACT GCA CAG GGA CAC GOC AAC CAT GGA TTC GIG GIG GAA GTS GOC CAC 

Axg Trp Thr Ala Gin Gly His Ala Asn His Gly Hie Val Val Glu Val Ala His 

1060 1075 1090 1105 

TIG GAG GAG AAA CAA GGT GTC TOO AAG AGA CAT GIT AGG ATA AGC AGG TCP TIG 
Leu Glu Glu Lys Gin Gly Val Ser lys Arg His Val Arg He Ser Arg Ser Leu 

1120 1135 1150 

CAC CAA GAT GAA CAC AGC TGG TCA CAG ATA AGG OCA TTG CIA GIA ACT TTT GGC 
His Gin Asp Glu His Ser Trp Ser Gin He Arg Pro Leu Leu Val Thr Hie Gly 

H65 1180 H95 1210 

CAT GAT GGA AAA GGG CAT OCT CTC CAC AAA AGA GAA AAA OGT CAA GOC AAA CAC 
His Asp Gly lys Gly His Pro Leu His Lys Arg Glu Lys Arg Gin Ala lys His 

■ ^ — ■ 

1225 1240 (299)1255 

AAA CAG OGG AAA OSC CTT AAG TOO AGC TGT AAG AGA CAC OCT TIG TAC GTS GAC 
Lys Gin Arg Lys Arg Leu Lys Ser Ser Cys Lys Arg His/Pro Leu Tyr Val Asp 

1270 1285 1300 1315 

TTC AGT GAC GIG GGG TGG AAT GAC TGG ATT GTG GCT OOC OOG GGG TAT CAC GOC 

Hie Ser Asp Val Gly Trp Asn Asp Trp He Val Ala Pro Pro Gly Tyr His Ala 

1330 1345 1360 1375 

TTT TAC TGC CAC GGA GAA TGC OCT TIT OCT CTG GCT GAT CAT CIG AAC TOO ACT 
Hie Tyr His Gly Glu Cys Pro Hie Pro Leu Ala Asp His Leu Asn Ser Thr 

1390 1405 1420 

AAT CAT GOC ATT GTT CAG AOG TTG GTC AAC TCT GIT AAC TCT AAG ATT OCT AAG 
Asn His Ala He Val Gin Thr Leu Val Asn Ser Val Asn Ser Lys He Pro Lys 



24 



730 745 760 775 

AGT GG6 AAA ACA AOC 036 AGA TIC TIC TTT AAT TTA AGTT TCT AIC CCC AOG GAG 

Ser Gly Lys Itir Ttar Arg Arg Hie fhe Fhe Asn Leu Ser Ser lie Fro Ihr Glu 

790 805 820 835 

GAG TIT ATC AOC TCA GCA GAG dT CAG GIT TTC OGA GAA CAG AUG CAA GAT GCT 
Glu Hie lie Hit Ser Ala Glu Leu Gin Val Hie Arg Glu Gin MET Gin Asp Ala 

850 865 880 

TIA GGA AAC AAT AGC AGT TIC CAT CAC CSA ATT AAT ATT TAT GAA ATC A!I!A AAA 
Leu Gly Asn Asn Ser Ser Hie His His Arg lie Asn lie Glu lie lie lys 

895 910 925 940 

OCT GCA ACA GCC AAC TOS AAA TIC CCC GTS ACC AGA dT TTS GAC AOC AGG TIG 
Pro Ala Ihr Ala Asn Ser Lys Hie Fro Val Ttir Arg Leu Leu Asp Itir Arg Leu 

955 970 985 

GIG AAT CAG AAT GCA AGC AGG TGG GAA AGT TTT GAT GIC AOC COC GCT GIG ATG 
Val Asn Gin Asn Ala Ser Arg Trp Glu Ser Hie Asp Val Thr Pro Ala Val KET 

1000 1015 1030 1045 

OGG TGG ACT GCA CAG GGA CAC GCC AAC CAT GGA TIC GIG GIG GAA GTG GCC CAC 

Arg Tcp Hir Ala Gin Gly His Ala Asn His Gly Hie Val Val Glu Val Ala His 

1060 1075 1090 1105 

TTG GAG GAG AAA CAA GGT GTC TOC AAG AGA CAT GIT AGG ATA AGC AGG TCT TIG 
Leu Glu Glu lys Gin Gly Val Ser Lys Arg His Val Arg lie Ser Arg Ser Leu 

1120 1135 1150 

CAC CAA GAT GAA CAC AGC TGG TCA CAG ATA AGG OCA TIG CIA GIA Ad TIT GGC 
His Gin Asp Glu His Ser Trp Ser Gin lie Arg Pro Leu Leu Val Dir Hie Gly 

1165 1180 1195 1210 

CAT GAT GGA AAA GG6 CAT Od CIC CAC AAA AGA GAA AAA OGT CAA GOC AAA CAC 
His Asp Gly lys Gly His Pro Leu His lys Arg Glu Lys Arg Gin Ala lys His 

1225 1240 ^99)1255 

AAA CAG OGG AAA OGC CIT AAG TOC AGC TGI AAG AGA^ CAC Od TIG TAC GIG GAC 
Lys Gin Arg lys Arg Leu Lys Ser Ser cys Lys Arg His/Pro Leu Tyr Val Asp 

1270 1285 1300 1315 

TIC AGI GAC GIG GGG TGG AAT GAC TGG ATI GIG Gd OOC 003 GGG TAT CAC GOC 

Hie Ser Asp Val Gly Trp Asn Asp Trp He Val Ala Pro Pro Gly Tyr His Ala 

1330 1345 1360 1375 

TIT TAC TGC CAC GGA GAA TGC Od TTT Od CIG Gd GAT CAT CIG AAC TOC Ad 
Hie Tyr Cys His Gly Glu Cys Pro Ftie Pro Leu Ala Asp His Leu Asn Ser Tbr 



AAT CAT GOC 
Asn His Ala 



1390 
An GIT CAG 
He Val Gin 



1405 1420 
AOG TIG GIC AAC Td GIT AAC Td AAG ATI 
Hit Leu Val Asn Ser Val Asn Ser Lys lie 



Od AAG 
Pro Lys 



25 



1435 1450 1465 1480 

GO^TGCTGTGrcCOGAC^GAACrCi^GCTArcTOS AIG CIG TAG CIT GAC GAG 
Ala cys Cys Val Fro Thr Glu HEfiu Ser Ala lie Ser MET Leu Tyr Leu Asp Glu 

■ . ■ 

1495 1510 1525 

AAT GAA AAG GIT GTA TTA AAG AAC TAT GAG GAC ATS GIT GTS GAG GGT TGT GGG 
AsKpiu lys Val Val Lai lys Asn Tyr Gin Asp MET Val Val Glu Gly cys; Gly 

"1540 (396y 1553 1563 1573 1583 159 3 1603 

TSriCGC TAGTACAGCA AAATIAAATA CATAAATATA TATATATATA TATATTITAG AAAAAAGAAA 

cys'Arg/ 



AAAA 



26 

Full-length BMP-2B human cDNA clones are obtained in the 
following manner. The 200 bp EcoRI-SacI fragment from the 5' 
end of the BMP-2B recombinant II-lO-l is isolated from its 
plasmid subclone, labeled by nick-translation, and hybridized 
to a set of duplicate nitrocellulose replicas of the U-2 OS cDNA 
library (25 filters/set; representing 500,000 recombinants). 
Hybridization and washing are performed under stringent 
conditions as described above. 16 duplicate positives are 
picked and replated for secondaries. Nitrocellulose filter 
replicas of the secondary plates are made and hybridized to 
an oligonucleotide which was synthesized to correspond to 
the sequence of II-lO-l and is of the following sequence: 
CGGGCGCTCAGGATACTCAAGACGAGTGCTG 

Hybridization is in standard hybridization buffer AT 50® C 
with washing at 50® in 1 X SSC, 0.1% SDS. 14 recombinant 
bacteriophage which hybridize to this oligonucleotide are 
plague purified. Plate stocks are made and small scale 
bacteriophage DNA preparations made. After sucloning 3 of 
these into M13, sequence analysis indicates that they represent 
clones which overlap the original BMP-2B clone. One of these, 
lambda U20S-3, was deposited with the ATCC under accession 
number 40342 on June 16, 1987. U20S-3 contains an insert of 
approximately 1.8 kb. The partial DNA sequence and derived 
amino acid sequence of U20S-3 are shown below in Table III. 
This clone is expected to contain all of the nucleotide 
sequence necessary to encode the entire human BMP-2B protein. 
The BMP-2B protein encoded by Table III is contemplated to 
contain the 97 amino acid sequence from amino acid #311 to 
#4 08 or a sequence substantially homologous thereto. This 
cDNA contains an open reading frame of 1224 bp, encoding a 
protein of 408 amino acids, preceded by a 5' untranslated 
region of 394 bp with stop codons in all frames, and contains 
a 3» untranslated region of 308 bp following the in-frame 
stop codon. The 8 bp region preceding the 5* untranslated 



27 

region represents a linker used in the cDNA cloning procedure. 
This protein of 408 amino acids has molecular weight of 47kd 
and is contemplated to represent the primary translation 
product. A sequence similar though not idential to tryptic 
Fragment 3 of Example IV is underlined in Table III. 



• 



28 



T2^BI£ in 



10 20 30 40 50 60 70 

CrCXT^GAGGG CAGAOGAGGA GGGAGGGAGG GAAGGAGGGC GGAGOOOGGC OOGGAAGCIA GGrTGAGIGIG 



80 90 100 110 120 130 140 

GCAT0C3GAGC TSAGGGACXSC Q^GOCIGAGA aXXSCTGCT GCTCXJGGCIG AGIATCTAGC T r gTCTOCOC 



150 160 170 180 190 200 210 

GA!rGGGATrC OOCSIOCfAOC TATCTOGAGC CIGCAGOGOC ACACTOOCXS QCCCICQCCC AGCJETCACIG 



220 230 240 250 260 270 280 

CaAOCTTCA GftGGaXXXXA GGAGCTGCTG CTGGOGAGCC OCSCEACIGCA GGGAOCEAIG GftGCXaTTOC 



290 300 310 320 330 340 350 

GIAGrrGOCAT CCCCSMXTAC GCACIGCIGC AGCT1X30CTS AGOCTTTOO^ CCfiMSmXSI ICMtCKTICG 



360 370 380 390 400 (1) 

CTGTCAAGAA TCATQGACIG TEMTAIMG CL ' i ' im ' mV TSICAAGACA OC ATG AIT OCT 

MET lie Pro 

417 432 447 462 

GGT AAC CXSA A!IG CIG ATC3 CTC GIT TIA TEA TGC CAA GTC CIG CIA GGA GGC GOS 
Gly Asn Arg MET Leu MET Val Val Leu Leu cys Gin Val Leu Leu Gly Gly Ala 

477 492 507 

AGC CAT GCT AGT TIG ATA CCT GAG AOS GGG AAG AAA AAA GTC GGC GAG ATT CAG 
Ser His Ala Ser Leu He Pro Glu Thr Gly lys Lys lys Vcd Ala Glu He Gin 

522 537 552 567 

GGC CAC GOS OGA GGA OGC OGC TCA GGG CAG AGC CAT GAG dC dG OGG GAC TTC 

Gly His Ala Gly Gly Arg Arg Ser Gly Gin Ser His Glu Leu Leu Arg Asp Rie 

582 597 612 627 

GAG GOG ACA CTT CTS CAG ATS TIT GGG CTG GGC OGC CSC COG CAG OCT AGC AA6 
Glu Ala Ihr Leu Leu Gin MET Fhe Gly Leu Arg Arg Arg Fro Gin Pro Ser lys 

642 657 672 

AGT GCC GTC ATT COG GAC TAC ATG OGG GAT CIT TAC GGG dT CAG TCT GGG GAG 
Ser Ala Val He Pro Asp lyr MET Arg Asp Leu Tyv Arg Leu Gin Ser Gly Glu 

687 702 717 732 

GAGGAGGAAGAGCAGATCCACAGCACIGGTCITGAGTATCCrGAG OGC COS GCC 
Glu Glu Glu Glu Gin lie His Ser Ihr Gly Leu Glu lyr Pro Glu Arg Pro Ala 



29 

747 762 777 

AGC OGG GCX: AAC AOC GTC AGG AGC TTC C3^ C3^ GAA GAA CAT CTG GAG AAC ATC 
Ser Arg Ala Asn Olir Val Arg Ser Hie His His Glu Glu His Leu Glu Asn lie 

792 807 822 837 

OCA GOG ACX: ACT GAA AAC TCT GCT TTT 031 TTC CTC TTI AAC CTC AGC AGC ATC 

Pro Gly Thr Ser Glu Asn Ser Ala Fhe Arg rtie leu rtie Asn Leu Ser Ser lie 

852 867 882 897 

OCT GAG AAC GAG CTG ATC TOC TCT GCA GAG CTT OSG CTC TIC OQG GAG CAG GIG 
Pro Glu Asn Glu Val He Ser Ser Ala Glu Leu Arg Leu Ehe Arg Glu Gin Val 

912 927 942 

GAC CAG GGC OCT GAT TOG GAA AGG GGC TTC CAC OCT ATA AAC ATT TAT GAG GTT 
Asp Gin Gly Pro Asp Tcp Glu Arg Gly Ehe His Arg He Asn He Ty^ Glu Val 

957 972 987 1002 

ATG AAG OOC CCA GCA GAA CTG G?IG CCT GGG CAC CIC ATC ACA OSA CEA CTG GAC 
MET lys Pro Pro Ala Glu Val Vsd fto Gly His Leu He Ihr Arg Leu Leu Asp 

1017 1032 1047 

AOS AGA CTG CTC CAC CAC AAT GTG ACA OGG TGG GAA ACT TTT GAT CTG AGC OCT 
Hir Arg Leu Val His His Asn Val Uir Arg Trp Glu Thr Hie Asp Val Ser Pro 

1062 1077 1092 1107 

GOG GTC err OGC TOG AOC OGG GAG AAG CAG OCA AAC TAT GGG CEA GOC ATT GAG 

Ala Val Leu Arg Trp Thr Arg Glu Lys Gin Pro Asn lyr Gly Lai Ala He Glu 

1122 1137 1152 1167 

GTG ACT CAC CTC CAT CAG ACT OQG ADC CAC CAG GGC CAG CAT GTC AGG ATT AGC 
Val Ihr His Leu His Gin Ihr Arg Ihr His Gin Gly Gin His Val Arg He Ser 

H82 1197 1212 

OGA TOG TEA OCT CAA GGG ACT GGG AAT TOG GOC GAG CTC OGG OOC CTC CIG CTC 
Arg Ser Leu Pro Gin Gly Ser Gly Asn Trp Ala Gin Leu Arg Pro Leu Lsu Val 

1227 1242 1257 1272 

AOC TIT GGC CAT GAT GGC OGG GGC CAT GOC TTG AOC OGA OGC OGG AGG GOC AAG 
Ihr Fhe Gly His Asp Gly Arg Gly His Ala Leu Ihr Arg Arg Arg Arg Ala Lys 

1287 1302 1317 

OCT AGC OCT AAG CAT CAC TCA CAG OQG GOC AGG AAG AAG AAT AAG AAC TOO OQG 
Arg Ser Pro lys His His Ser Gin Arg Ala Arg Lys lys Asn Lys Asn cys Arg 

1332(311)/ 1347 1362 1377 

OQC CAC TOG CTC TAT GTG GAC ITC AGC GAT GIG GGC IQG AAT GAC TOG ATT CTG 

Arg JlLs, Ser Leu Tyr Val Asp Fhe Ser Asp Val Gly Trp Asn Asp Trp He Val 

1392 1407 1422 1437 

GOC OCA OCA 000 TAC CAG GOC TTC TAC IGC CAT GGG GAC TOO 000 TIT OCA CIG 
Ala Pro Pro Gly Tyr Gin Ala Ehe lyr cys His Gly Asp cys Pro Ehe Pro Leu 



30 

1452 1467 1482 

GCr GAC C3^ CIC AAC TCA AOC AAC CM GOC ATT GIG CAG AOC CIG GTC AAT TCT 
Ala Asp His Lbu Asn Ser TSar Asn His Ala lie Val Gin Har Leu Val Asn Sec 

1497 1512 1527 1542 

GIC AAT TOC AGT ATC CCC AAA GCC TST TGI GIG OOC ACT GAA CIG AGT GOC ATC 
Val Asn Ser Ser He Pro lys Ala O/a cys Val Pro Qxr Glu Lsu Ser Ala lie 

1557 1572 1587 

TCC AIG CIG lAC CIG GAT GAG TAT GAT AAG GIG GIA CIG AAA AAT TAT CA6 GAG 
Ser MET Leu lyr I«i Asp Glu T:fc Asp lys Val Val Lsu lys Asn Tvr Gin Glu 

1602 1617 (408) 1636 1646 1656 

ATG GIA GTA GAG GGA TGI GGG TGC OGC IGAGATCAGG CAGTOCTIGA GGATAGACAG 
MET Val Val Glu Glv cys Gly cys Arg 

1666 1676 1686 1696 1706 1716 1726 

AZATACACAC CACACACACA CAOCACATAC AOCACACACA CAGGITCXXA TCCACTCAaC CACACACTAC 

1736 1746 175 6 1766 1776 1786 1796 

ACAGACTGCr TOdTATAGC TGGACiTi'lA TTIAAAAAAA AAAAAAAAAA AATGGAAAAA ATCXXTAAAC 

1806 1816 1826 1836 1846 1856 1866 

ATTCAOCnG AOCTTATTTA TGACi'i'JLAOG TGCAAATCTT TIGAGCAIAT TGATCATAIA TTTIGACAAA 

1876 1886 1896 1906 1916 1926 1936 

ATATATTIAT AACIAOGTAT TAAAAGAAAA AAATAAAATG AGTCATTATT TTAAAAAAAA AAAAAAAACT 



1946 

dAGAGTOGA OQGAATIC 



The sequences of BMP-2A and BMP-2B, as shown in Tables 
II and III, have significant homology to the beta (B) and 
beta (A) sxibunits of the inhibins* The inhibins are a family 
of hormones which are presently being investigated for use in 
contraception. See, A, J. Mason et al, Nature , 318:659-663 
(1985). To a lesser extent they are also homologous to 
Mullerian inhibiting substance (MIS), a testicular glycoprotein 
that causes regression of the Mullerian duct during development 
of the male embryo and transforming growth factor-beta (TGF- 
b) which can inhibit or stimulate growth of cells or cause 
them to differentiate. Furthermore, the sequences of Tables 
II and III indicate that BMP-2A and 23 have significant 
homology to the Drosoohila decapentaplegic (DPP-C) locus 
transcript. See, J. Massague, Cell , 49:437-438 (1987); R. W. 
Padgett et al, Nature, 325:81-84 (1987); R. L. Gate et al. 
Cell 45: 685-698 (1986). It is considered possible therefore 
that a BMP-2 protein is the human homolog of the protein made 
from this transcript from this developmental mutant locus. 
BMP-2A and BMP-2B share sequence similarity with Vgl. vgl 
mRNA has been localized to the vegetal hemisphere of Xenopus 
oocytes. During early development, it is distributed throughout 
the endoderm, but the mRNA is not detectable after blastula 
formation has occurred. The Vgl protein may be the signal 
used by the endorderm cells to commit ectodermal cells to 
become the embryonic mesoderm. 

EXAMPLE VI 

Expression of BMP-2A and BMP-2B 

In order to produce bovine, human or other mammalian 
BMP-2 proteins, the DNA encoding it is transferred into an 
appropriate expression vector and introduced into mammalian 
cells or other preferred eukaryotic or prokaryotic hosts by 
conventional genetic engineering techniques. The presently 

preferred expression system for biologically active recombinant 



m • 



32 

human BMP-2A and BMP-2B is stably transformed mammalian cells. 

One skilled in the art can construct mammalian expression 
vectors by employing the sequence of Tables I - III or other 
modified sequences and known vectors, such as pCD [Okayama et 
al., Mol. Cell Biol> . 2:161-170 (1982)] and pJL3, pJL4 [Gough 
et al., EMBO J^, 4:645-653 (1985)]. The transformation of 
these vectors into appropriate host cells can result in 
expression of BMP-2A or BMP-2B. One skilled in the art could 
manipulate the sequences of Tables I-III by eliminating or 
replacing the mammalian regulatory sequences flanking the 
coding secjuence with bacterial sequences to create bacterial 
vectors for intracellular or extracellular expression by 
bacterial cells. For example, the coding sequences could be 
further manipulated (e.g. ligated to other known linkers or 
modified by deleting non-coding sequences there-from or 
altering nucleotides therein by other known techniques) . The 
modified BMP-2A or BMP-2B coding sequence could then be 
inserted into a known bacterial vector using procedures such 
as described in T. Taniguchi et al., Proc. Natl Acad. Sci. 
USA, 77:5230-5233 (1980). This exemplary bacterial vector 
could then be transformed into bacterial host cells and a 
BMP-2 protein expressed thereby. For a strategy for producing 
extracellular expression of a BMP-2 protein in bacterial 
cells., seei, e.g. European patent application EPA 177,343. 

Similar manipulations can be performed for the 
construction of an insect vector [See, e.g. procedures described 
in published European patent application 155,476] for expression 
in insect cells. A yeast vector could also be constructed 
employing yeast regulatory sequences for intracellular or 
extracellular expression of the factors of the present invention 
by yeast cells. [See, e.g., procedures described in published 
PCT application W08 6/0063 9 and European patent application EPA 
123,289]. 

A method for producing high levels of a BMP-2 protein of 
the invention from mammalian cells involves the construction 



33 

of cells containing multiple copies of the heterologous BMP- 
2 gene. The heterologous gene can be linked to an amplifiable 
marker, e.g. the dihydrof olate reductase (DHFR) gene for 
whicli cells containing increased gene copies can be selected 
for propagation in increasing concentrations of methotrexate 
(MTX) according to the procedures of Kaufman and Sharp, J. 
Mol, Biol, . 159:601-629 (1982). This approach can be employed 
with a number of different cell types. For example, a plasmid 
containing a DNA sequence for a BMP-2A or BMP-2B of the 
invention in operative association with other plasmid sequences 
enabling expression thereof and the DHFR expression plasmid 
pAdA26SV(A)3 [Kaufman and Sharp, Mol. Cell. Biol. , 2:1304 
(19 82)] can be co-introduced into DHFR-def icient CHO cells, 
DUKX-BII, by calcium phosphate coprecipitation and transfection, 
electroperation or protoplast fusion. DHFR expressing 
transf ormants are selected for growth in alpha media with 
dialyzed fetal calf serum, and subsequently selected for 
amplification by growth in increasing concentrations of MTX 
(sequential steps in 0.02, 0.2, 1.0 and 5uH MTX) as described 
in Kaufman et al . , Mol Cell Biol. . 5:1750 (1983). Transformants 
are cloned, and biologically active BMP-2A or BMP-2B expression 
is monitored by the Rosen-modified Sampath - Reddi rat bone 
formation assay described above in Example III. BMP-2A and 
BMP*2B expression should increase with increasing levels of 
MTX resistance. Similar procedures can be followed to produce 
other related BMP-2 proteins. 

As one specific example, to produce the BMP-2A or BMP- 
2B of Example V, the insert of U20S-39 or U2QS respectively, 
is released from the vector arms by digestion with ECORI and 
subcloned into the mammalian expression vector pMT2CX digested 
with ECORI. Plasmid DNA from this subclone is transf ected 
into COS cells by the DEAE-dextran procedure [Sompayrac and 
Danna PNAS 78_: 7575-7578 (1981); Luthman and Magnusson, 
Nucl. Acids Res . 11: 1295-1308 (1983 )] and the cells are 




34 

cultured. Semim-free 24 hr. conditioned medium supernatant 
is collected from the cells starting 40 - 70 hr. post- 
transfection. 

The mammalian expression vector pMT2 Cla-Xho (pMT2 CX) 
is a derivative of p91023 (b) (Wong et al., Science 228:810- 
815, 1985) differing from the latter in that it contains the 
ampicillin resistance gene in place of the tetracycline 
resistance gene and further contains a Xhol site for insertion 
of cDNA clones. The functional elements of pMT2 Cla-Xho have 
been described (Kaufman/ R.J., 1985, Proc. Natl. Acad. Sci. 
USA 82.: 689-693) and include the adenovirus VA genes, the SV40 
origin of replication including the 72 bp enhancer, the 
adenovirus major late promoter including a 5' splice site and 
the majority of the adenovirus tripartite leader sequence 
present on adenovirus late mRNAs, a 3* splice acceptor site, 
a DHFR insert , the SV40 early polyadenylation site (SV40) , 
and pBR322 sequences needed for propagation in Ej. coli. 

Plasmid pMT2 Cla-Xho is obtained by EcoRI digestion of 
pMT2-yWF, which has been deposited with the American Type 
Culture Collection (ATCC) , Rockville, MD (USA) under accession 
number ATCC 67122. EcoRI digestion excises the cDNA insert 
present in pMT2-VWF, yielding pMT2 in linear form which can be 
ligated and used to transform E. coli HB 101 or DH-5 to 
ampicillin resistance. Plasmid pMT2 DNA can be prepared by 
conventional methods. pMT2CX is then constructed by digesting 
pMT2 with Eco RV and Xbal, treating the digested DNA with 
Klenow fragment of DNA polymerase I, and ligating Cla linkers 
(NEBiolabs, CATC6ATG) • This removes bases 2266 to 2421 
starting from the Hind III site near the SV40 origin of 
replication and enhancer sequences of pMT2. Plasmid DNA is 
then digested with EcoRI, blunted as above, and ligated to an 
EcoRI adapter, 

5« PO4-AATTCCTCGAGAGCT 3* 
3« GGAGCTCTCGA 5» 
digested with Xhol, and ligated, yielding pMT2 Cla-Xho , which 



• 



• 



35 



may then be used to transform E. coli to ampicillin resistance. 
Plasmid pMT2 Cla-Xho DNA may be prepared by conventional 
methods • 



Biological Activity of Expressed BMP-2A and BMP-2B 

To measure the biological activity of the expressed 
BMP-2A and BMP-2B obtained in Example VI above, the protein is 
partially purified on a Heparin Sepharose column. 4 ml of 
the collected post transf ection conditioned medium supernatant 
from one 100 mm culture dish is concentrated approximately 10 
fold by ultrafiltration on a YM 10 membrane and then dialyzed 
against 20mM Tris, 0.15 M NaCl, pH 7.4 (starting buffer) . 
This material is then applied to a 1.1 ml Heparin Sepharose 
column in starting buffer. Unbound proteins are removed by 
an 8 ml wash of starting buffer, and bound proteins, including 
BMP-l, are desorbed by a 3-4 ml wash of 20 mM Tris, 2.0 M 
NaCl, pH 7.4. 

The proteins bound by the Heparin column are concentrated 
approximately 10-fold on a Centricon 10 and the salt reduced 
by diaf iltration with 0.1% trifluoroacetic acid. Purified 
BMP-2 proteins are approximately 95% sxibstantially free from 
other proteinaceous materials. The appropriate amount of this 
solution is mixed with 20 mg of rat matrix and then assayed 
for in vivo bone and/or cartilage formation activity by the 
Rosen-modified Sampath - Reddi assay. A mock transfection 
supernatant fractionation is used as a control . 

The implants containing rat matrix to which specific 
amounts of human BMP-2 A or BMP-2 B have been added are removed 
from rats after seven days and processed for histological 
evaluation. Representative sections from each implant are 
stained for the presence of new bone mineral with von Kossa 
and acid fuschin, and for the presence of cartilage-specific 
matrix formation using toluidine blue. The types of cells 



Example VII 



36 

present within the section, as well as the extent to which 
these cells display phenotype are evaluated and scored as 
described in Example III. 

Addition of human BMP-2A or BMP-2B to the matrix material 
resulted in formation of cartilage-like nodules at 7 days post 
implantation • The chondroblast-type cells were recognizable 
by shape and expression of metachromatic matrix. The assay 
results indicate that approximately 200 ng of BMP-2A or BMP- 
2B results on a score of at least +2. The amount of activity 
observed for human BMP-2A or BMP-2B indicates that it may be 
dependent upon the amount of human BMP-2A or BMP-2B protein 
added to the matrix sample. 

Similar levels of activity are seen in the Heparin 
Sepharose fractionated COS cell extracts. Partial purification 
is accomplished in a similar manner as described above except 
that 6 M urea is included in all the buffers. 

The procedures described above may be employed to isolate 
other related BMP-2 proteins of interest by utilizing the 
bovine BMP-2A and BMP-2B proteins as a probe source. Such 
other BMP-2 proteins may find similar utility in, inter 
alia, fracture repair, wound healing and tissue repair. 

The foregoing descriptions detail presently preferred 
embodiments of the present invention. Numerous modifications 
and variations in practice thereof are expected to occur to 
those skilled in the art upon consideration of these descrip- 
tions. Those modifications and variations are believed to be 
encompassed within the claims appended hereto. 



37 

What is claimed is: 

1. A purified BMP-2 protein produced by the steps of 

(a) culturing a cell transformed with a cDNA substantially 
as shown in Table III; and 

(b) recovering from said culture medium a protein 
containing substantially the 97 amino acid sequence from amino 
acid #299 to amino acid #396 as shown in Table II. 

2. A purified BMP-2 protein produced by the steps of 

(a) culturing a cell transformed with a cDNA substantially 
as shown in Table II; and 

(b) recovering form said culture medium a protein 
containing substantially the 97 amino acid sequence from 
amino acid #311 to amino acid #408 as shown in Table III. 

3. A protein of claim 1 or 2 further characterized by the 
ability of 200 nanograms of said protein to score at least +2 
in the Rosen-modified Sampath-Reddi-Rosen assay. 

4. A cDNA sequence encoding a protein of claim 3. 

5. A host cell transformed with a cDNA of claim 4. 

6. A method for producing a purified BMP-2 protein said method 
comprising the steps of 

(a) culturing in a suitable culture medixim said transformed 
host cells of claim 5; and 

(b) isolating and purifying said BMP-2 from said culture 
medium. 

7. A pharmaceutical composition comprising an effective 
amount of a protein of claim 1 or 2 in admixture with a 
pharmaceutically acceptable vehicle. 



# # 



39 



(1) hybridize to any of sequences (a), (b) , /orj (c) ^^-(^L^ 
under stringent hybridization conditions; and 

(2) encode a protein characterized by the ability 
[of 200 nanograms of said protein having the ability 
to score at least +2 in the Rosen-modified Sampath- 
Reddi assay 7| - /f /.pi a^ot^ J/t^ ^^'^ ^ ^ ^ -^(Z^^ 



15. A vector comprising a DNA sequence of Claim 14 in operative 
association with an expression control sequence /theref o^. , ... 

^ JA ^^'i -^'^-^/ ^^'^ 

16. A host cell transformed with a DNA sequence of Claim 14/ 

17. A method for producing a BMP-2 protein, said method 
comprising the steps of 

(a) culturing in a suitable culture medium said 
transformed host cell of claim 16; and 

(b) isolating and purifying said BMP-2 from said culture 
medium. 



40 

ABSTRACT 

Purified BMP-2 proteins and processes for producing them 
are disclosed. They may be used in the treatment of bone and 
cartilage defects and in wound healing and related tissue 
repair. 



This Page is Inserted by IFW Indexing and Scanning 
Operations and is not part of the Official Record 



Defective images within this document are accurate representations of the original 
documents submitted by the applicant. 

Defects in the images include but are not limited to the items checked: 



UHBL ACK BORDERS 

□ IMAGE CUT OFF AT TOP, BOTTOM OR SIDES 

□ FADED TEXT OR DRAWING 

□ BLURRED OR ILLEGIBLE TEXT OR DRAWING 

□ SKEWED/SLANTED IMAGES 



LT LINES OR MARKS ON ORIGINAL DOCUMENT 

□ REFERENCE(S) OR EXHIBIT(S) SUBMITTED ARE POOR QUALITY 

□ OTHER: 



IMAGES ARE BEST AVAILABLE COPY. 
As rescanning these documents will not correct the image 
problems checked, please do not report these problems to 
the IFW Image Problem Mailbox. 



BEST AVAILABLE IMAGES 





COLOR OR BLACK AND WHITE PHOTOGRAPHS 



□ GRAY SCALE DOCUMENTS