Skip to main content

Full text of "USPTO Patents Application 09848616"

See other formats


r. 



WORLD INTELLECTUAL PROPERTY ORGANIZATION 
International Bureau 




PCT 

INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) 



(51) International Patent Classification 7 : 
A61K 39/00 



A2 



(11) International Publication Number: 
(43) International Publication Date: 



WO 00/32227 

8 June 2000 (08.06.00) 



(21) International Application Number: PCT/1B99/01925 

(22) International Filing Date: 30 November 1999 (30 J 1.99) 



(30) Priority Data: 
60/110,414 
60/142,788 



30 November 1 998 (30. 1 1 .98) US 
8 July 1999 (08.07.99) US 



(71) Applicant: CYTOS BIOTECHNOLOGY AG [CH/CH]; Wag- 

istrasse 21, CH-8952 Zurich (CH). 

(72) Inventors: RENNER, Wolfgang, A.; Weinbergstrasse 64, 

CH-8006 Zurich (CH). HENNECKE, Frank; Bombachsteig 
16, CH-8049 Zurich (CH). NIEBA, Lars; Gottfried-Keller 
Strasse 63B, CH-8400 Winterthur (CH). BACHMANN, 
Martin; Stemengasse 8, CH-4125 Riehen (CH). 



(81) Designated States: AE, AL, AM, AT, AU, AZ, BA, BB BG 
BR, BY, CA, CH, CN, CR, CU, CZ, DE, DK, DM* EE* 
ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS JP 
KE, KG, KP, KR, KZ, LC, LK; LR, LS, LT, LU, LV, MA, 
MD, MG, MK, MN, MW, MX, NO, NZ, PL, PT RO RU 
SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, TZ, UA UG,' 
UZ, VN, YU, ZA, ZW, ARIPO patent (GH, GM, KE, LS 
MW, SD, SL, SZ, TZ, UG, ZW), Eurasian patent (AM, AZ, 
BY, KG, KZ, MD, RU, TJ, TM), European patent (AT, BE, 
CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, 
NL, PT, SE), OAPI patent (BF, BJ, CF, CG, CI, CM, GA 
GN, GW, ML, MR, NE, SN, TO, TG). 



Published 

Without international search report and to be republished 
upon receipt of that report. 



(54) Title: ORDERED MOLECULAR PRESENTATION OF ANTIGENS, METHOD OF PREPARATION AND USE 
(57) Abstract 

The invention provides compositions and processes for the production of ordered and repetitive antigen or antigenic determinant 
arrays. The compositions of the invention are useful for the production of vaccines for the prevention of infectious diseases, the treatment 
of allergies and the treatment of cancers. Various embodiments of the invention provide for a virus, virus-like particle viral capsid particle 
phage or recombinant form thereof coated with any desired antigen in a highly ordered and repetitive fashion as the result of specific 
interactions. In one specific embodiment, a versatile new technology based on a cassette-type system (Alpha Vaccine Technology) allows 
production of antigen coated viral particles. Other specific embodiments allow the production of antigen coated hepatitis B virus-like 
particles or antigen coated Measles virus-like particles. 



Document AM4 ^ 
Appl.No. 09/848,616 | 

j 



MSDOCID: <WO 003222 7 A2_L> 



FOR THE PURPOSES OF INFORMATION ONLY 



Codes used to identify States party to the PCT on the front pages of pamphlets publishing international applications under the PCT. 



AL 


Albania 


ES 


Spain 


LS 


Lesotho 


SI 


Slovenia 


AM 


Armenia 


FI 


Finland 


LT 


Lithuania 


SK 


Slovakia 


AT 


Austria 


FR 


France 


LU 


Luxembourg 


SN 


Senegal 


AU 


Australia 


GA 


Gabon 


LV 


Latvia 


sz 


Swaziland 


AZ 


Azerbaijan 


GB 


United Kingdom 


MC 


Monaco 


TO 


Chad 


BA 


Bosnia and Herzegovina 


GE 


Georgia 


MD 


Republic of Moldova 


TG 


Togo 


BB 


Barbados 


GH 


Ghana 


MG 


Madagascar 


TJ 


Tajikistan 


BE 


Belgium 


GN 


Guinea 


MK 


The former Yugoslav 


TM 


Turkmenistan 


BF 


Burkina Faso 


GR 


Greece 




Republic of Macedonia 


TR 


Turkey 


BG 


Bulgaria 


HU 


Hungary 


ML 


Mali 


TT 


Trinidad and Tobago 


Bj 


Benin 


IE 


Ireland 


MN 


Mongolia 


UA 


Ukraine 


BR 


Brazil 


IL 


Israel 


MR 


Mauritania 


UG 


Uganda 


BY 


Belarus 


IS 


Iceland 


MW 


Malawi 


US 


United Stales of America 


CA 


Canada 


IT 


Italy 


MX 


Mexico 


UZ 


Uzbekistan 


CF 


Central African Republic 


JP 


Japan 


NE 


Niger 


VN 


Viet Nam 


CG 


Congo 


KE 


Kenya 


NL 


Netherlands 


YU 


Yugoslavia 


CH 


Switzerland 


KG 


Kyrgyzstan 


NO 


Norway 


ZW 


Zimbabwe 


a 


Cote d'lvoire 


KP 


Democratic People's 


NZ 


New Zealand 






CM 


Cameroon 




Republic of Korea 


PL 


Poland 






CN 


China 


KR 


Republic of Korea 


PT 


Portugal 






cu 


Cuba 


KZ 


Kazakstan 


RO 


Romania 






cz 


Czech Republic 


LC 


Saint Lucia 


RU 


Russian Federation 






DE 


Germany 


LI 


Liechtenstein 


SD 


Sudan 






DK 


Denmark 


LK 


Sri Lanka 


SE 


Sweden 






EE 


Estonia 


LR 


Liberia 


SG 


Singapore 







BNSDOCID: <WO 0032227 A2J_> 



WO 00/32227 



PCT/IB99/01925 



Ordered Molecular Presentation of Antigens, Method of 

Preparation and Use 

Background of the Invention 
Field of the Invention 

The present invention is related to the fields of molecular biology, 
virology, immunology and medicine. The invention provides a composition 
comprising an ordered and repetitive antigen or antigenic determinant array. The 
invention also provides a process for producing an antigen or antigenic 
determinant in an ordered and repetitive array. The ordered and repetitive antigen 
or antigenic determinant is useful in the production of vaccines for the treatment 
of infectious diseases, the treatment of allergies and as a pharmaccine to prevent 
or cure cancer and to generate defined self-specific antibodies. 

Related Art 

Vaccine development for the prevention of infectious disease has had the 
greatest impact on human health of any medical invention. It is estimated that 
three million deaths per year are prevented worldwide by vaccination (Hillemanri, 
Nature Medicine 4:501 (1 998)). The most common vaccination strategy, the use 
of attenuated (i.e. less virulent) pathogens or closely related organisms, was first 
demonstrated by Edward Jenner in 1 796, who vaccinated against smallpox by the 
administration of a less dangerous cowpox virus. Although a number of live 
attenuated viruses (e, g. measles, mumps, rubella, varicella, adenovirus, polio, 
influenza) and bacteria (e. g. bacille Calmette-Guerin (BCG) against tuberculosis) 
are successfully administered for vaccination, there is a risk for the development 
of serious complications related to a reversion to virulence and infection by the 
vaccine' organism, in particular in immunocompromised individuals. 



CONFIRMATION COPY 



WO 00/32227 



PCT/IB99/01925 



-2- 

The specific design of attenuated viruses is now enabled by recombinant 
DNA technology (i.e., genetic engineering) through the generation of deletion or 
mutation variants. For example, the administration of an engineered Simian 
Immunodeficiency Virus (SIV) with a deletion within the nef gene was shown to 
protect macaques from subsequent infection with a pathogenic SIV strain (Daniel 
et aL, Science 255:1938-1941 (1992)). However, the progression of acquired 
immunodeficiency syndrome (AIDS)-like symptoms in animals administered 
attenuated SIV raises safety concerns (Baba et aL, Science 267:1820-1825 
((1995)). 

As an alternative approach, attenuated viruses or bacteria may be used as 
carriers for the antigen-encoding genes of a pathogen that is considered too unsafe 
to be administered in an attenuated form (e.g., Human Immunodeficiency Virus 
(HIV)). Upon delivery of the antigen-encoding gene to the host, the antigen is 
synthesized in situ. Vaccinia and related avipox viruses have been used as such 
carriers for various genes in preclinical and clinical studies for a variety of 
diseases (e.g., Shen et aL, Science 252:440 (1991)). One disadvantage of this 
vaccination strategy is that it does not mimic the virion surface, because the 
recombinant protein is expressed on the surface of the host cell. Additionally, 
complications may develop in immunocompromised individuals, as evidenced by 
life-threatening disseminated vaccinia infections (Redfield, N. Eng. J. Med 
316:673 ((1998)). 

A fourth vaccination approach involves the use of isolated components of 
a pathogen, either purified from the pathogen grown in vitro (e.g. influenza 
hemagglutinin or neuraminidase) or after heterologous expression of a single viral 
protein (e.g. hepatitis B surface antigen). For example, recombinant, mutated 
toxins (detoxified) are used for vaccination against diphtheria, tetanus, cholera 
and pertussis toxins (Levine et aL, New generation vaccines. 2nd edn., Marcel 
Dekker, Inc., New York 1 997), and recombinant proteins of HIV (gpl 20 and full- 
length gp 1 60) were evaluated as a means to induce neutralizing antibodies against 
HIV with disappointing results (Connor et aL, J. Virol. 72:1552 (1998)). 



WO 00/32227 PCT/IB99/01925 

-3- 



Recently, promising results were obtained with soluble oligomeric gp!60, that 
can induce CTL response and elicit antibodies with neutralizing activity against 
HIV- 1 isolates (Van Cortt et al. , J. Virol. 71:4319(1 997)). In addition, peptide 
vaccines may be used in which known B- or T-cell epitopes of an antigen are 
5 coupled to a carrier molecule designed to increase the immunogenicity of the 

epitope by stimulating T-cell help. However, one significant problem with this 
approach is that it provides a limited immune response to the protein as a whole. 
Moreover, vaccines have to be individually designed for different MHC 
haplotypes. The most serious concern for this type of vaccine is that protective 
1 0 antiviral antibodies recognize complex, three-dimensional structures that cannot 

be mimicked by peptides. 

A more novel vaccination strategy is the use of DNA vaccines (Donnelly 
et al, Ann. Rev. Immunol. 15:617 (1997)), which may generate MHC Class I- 
restricted CTL responses (without the use of a live vector). This may provide 
1 5 broader protection against different strains of a virus by targeting epitopes from 

conserved internal proteins pertinent to many strains of the same virus. Since the 
antigen is produced with mammalian post-translational modification, 
conformation and oligomerization, it is more likely to be similar or identical to 
the wild-type protein produced by viral infection than recombinant or chemically 
20 modified proteins. However, this distinction may turn out to be a disadvantage 

for the application of bacterial antigens, since non-native post-translational 
modification may result in reduced immunogenicity. In addition, viral surface 
proteins are not highly organized in the absence of matrix proteins. 

In addition to applications for the prevention of infectious disease, vaccine 
technology is now being utilized to address immune problems associated with 
allergies. In allergic individuals, antibodies of the IgE isotype are produced in an 
inappropriate humoral immune response towards particular antigens (allergens). 
The treatment of allergies by allergy immunotherapy requires weekly 
administration of successively increasing doses of the particular allergen over a 
period of up to 3-5 years. Presumably, 'blocking' IgG antibodies are generated 



25 



30 



JNSDOCID: <WO 0032227A2J_> 



WO 00/32227 



PCT/IB99/01925 



-4- 

that intercept allergens in nasal or respiratory secretions or in membranes before 
they react with IgE antibodies on mast cells. However, no constant relationship 
exists between IgG titers and symptom relief. Presently, this is an extremely 
time- and cost-consuming process, to be considered only for patients with severe 
symptoms over an extended period each year. 

It is well established that the administration of purified proteins alone is 
usually not sufficient to elicit a strong immune response; isolated antigen 
generally must be given together with helper substances called adjuvants. Within 
these adjuvants, the administered antigen is protected against rapid degradation, 
and the adjuvant provides an extended release of a low level of antigen. 

Unlike isolated proteins, viruses induce prompt and efficient immune 
responses in the absence of any adjuvants both with and without T-cell help 
(Bachmann & Zinkernagel, Rev, Immunol, 15:235-270 (1997)). Although 
viruses often consist of few proteins, they are able to trigger much stronger 
immune responses than their isolated components. For B cell responses, it is 
known that one crucial factor for the immunogenicity of viruses is the 
repetitiveness and order of surface epitopes. Many viruses exhibit a quasi- 
crystalline surface that displays a regular array of epitopes which efficiently 
crosslinks epitope-specific immunoglobulins on B cells (Bachmann & 
Zinkernagel, Immunol Today 77:553-558 (1996)). This crosslinking of surface 
immunoglobulins on B cells is a strong activation signal that directly induces cell- 
cycle progression and the production of IgM antibodies. Further, such triggered 
B cells are able to activate T helper cells, which in turn induce a switch from IgM 
to IgG antibody production in B cells and the generation of long-lived B cell 
memory - the goal of any vaccination (Bachmann & Zinkernagel, Ann. Rev, 
Immunol, 75.235-270 (1 997)). Viral structure is even linked to the generation of 
anti-antibodies in autoimmune disease and as a part of the natural response to 
pathogens (see Fehr ? T., et al. t J. Exp, Med, 755:1785-1792 (1997)). Thus, 
antigens on viral particles that are organized in an ordered and repetitive array are 
highly immunogenic since they can directly activate B cells. 



WO 00/32227 



PCT/IB99/01925 



-5- 

In addition to strong B cell responses, viral particles are also able to 
induce the generation of a cytotoxic T cell response, another crucial arm of the 
immune system. These cytotoxic T cells are particularly important for the 
elimination of hon-cytopathic viruses such as HIV or hepatitis B virus and for the 
eradication of tumors. Cytotoxic T cells do not recognize native antigens but 
rather recognize their degradation products in association with MHC class I 
molecules (Townsend & Bodmer, Ann. Rev. Immunol. 7:601-624 (1989)). 
Macrophages and dendritic cells are able to take up and process exogenous viral 
particles (but not their soluble, isolated components) and present the generated 
degradation product to cytotoxic T cells, leading to their activation and 
proliferation (Kovacsovics-Bankowski et al, Proc. Natl. Acad. Sci. USA 
90:4942-4946 (1993); Bachmann et al, Eur. J. Immunol. 25:2595-2600 (1996)). 

Viral particles as antigens exhibit two advantages over their isolated 
components: (1) Due to their highly repetitive surface structure, they are able to 
directly activate B cells, leading to high antibody titers and long-lasting B cell 
memory; and (2) Viral particles but not soluble proteins are able to induce a 
cytotoxic T cell response, even if the viruses are non-infectious and adjuvants are 
absent. 

Several new vaccine strategies exploit the inherent immunogenicity of 
viruses. Some of these approaches focus on the particulate nature of the virus 
particle; for example see Harding, C.V. and Song, R., (J. Immunology 755:4925 
(1994)), which discloses a vaccine consisting of latex beads and antigen; 
Kovacsovics-Bankowski, M, et al (Proc. Natl. Acad. Sci. USA 20:4942-4946 
(1993)), which discloses a vaccine consisting of iron oxide beads and antigen; 
U.S. Patent No: 5,334,394 to Kossovsky, N., et al , which discloses core particles 
coated with antigen; U.S. Patent No. 5,871,747, which discloses synthetic 
polymer particles carrying on the surface one or more proteins covalently bonded 
thereto; and a core particle with a non-covalently bound coating, which at least 
partially covers the surface of said core particle, and at least one biologically 
active agent in contact with said coated core particle (see. e.g., WO/94/1 5585). 



WO 00/32227 



PCT/IB99/01925 



-6- 

However, a disadvantage of these viral mimicry systems is that they are 
not able to recreate the ordered presentation of antigen found on the viral surface. 
Antigens coupled to a surface in a random orientation are found to induce CTL 
response and no or only weak B-cell response. For an efficient vaccine, both 
arms of the immune system have to be strongly activated, as described above and 
in Bachmann & Zinkernagel, Ann. Rev. Immunol 1 5:235 (1997). 

In another example, recombinant viruses are being utilized for antigen 
delivery. Filamentous phage virus containing an antigen fused to a capsid protein 
has been found to be highly immunogenic (see Perham R.N., et al y FEMS 
Microbiol Rev. 77:25-31 (1995); Willis et aL, Gene 72<S:85-88 (1993); 
Minenkova et al y Gene 725:85-88 (1993)). However, this system is limited to 
very small peptides (5 or 6 amino acid residues) when the fusion protein is 
expressed at a high level (Iannolo et al, J. Mol Biol 245:835-844 (1995)) or 
limited to the low level expression of larger proteins (de la Cruz et al y J. Biol 
Chem. 263:43 1 8-4322 (1 988)). For small peptides, so far only the CTL response 
is observed and no or only weak B-cell response. 

In yet another system, recombinant alphaviruses are proposed as a means 
of antigen delivery (see U.S. Patent Nos. 5,766,602; 5,792,462; 5,739,026; 
5;789,245 and 5,814,482). Problems with the recombinant virus systems 
described so far include a low density expression of the heterologous protein on 
the viral surface and/or the difficulty of successfully and repeatedly creating a 
new and different recombinant viruses for different applications. 

In a further development, virus-like particles (VLPs) are being exploited 
in the area of vaccine production because of both their structural properties and 
their non-infectious nature. VLPs are supermolecular structures built in a 
symmetric manner from many protein molecules of one or more types. They lack 
the viral genome and, therefore, are noninfectious. VLPs can often be produced 
in large quantities by heterologous expression and can be easily be purified. 

Examples of VLPs include the capsid proteins of hepatitis B virus (Ulrich, 
et al y Virus Res. 50:141-182 (1998)), measles virus (Warnes, et al f Gene 



WO 00/32227 



PCT/IB99/01925 



-7- 

760:173-178 (1995)) r Sindbis virus, rotavirus (US Patent Nos. 5,071,651 and 
5,374,426), foot-and-mouth-disease virus (Twomey, et aL, Vaccine 13: 
1603-1610, (1995)), Norwalk virus (Jiang, X., et al. 9 Science 250:1580-1583 
(1990); Matsui,S.M.,e/ Clin. Invest, 87:1456-1461 (1991)), the retroviral 
GAG protein (PCT Patent AppL No. WO 96/30523), the retrotransposon Ty 
protein pi, the surface protein of Hepatitis B virus (WO 92/1 1291) and human 
papilloma virus (WO 98/15631). In some instances, recombinant DNA 
technology may be utilized to fiise a heterologous protein to a VLP protein 
(Kratz, P.A., et al 9 Proa Natl Acad. Sci. USA 96: 19151920 (1999)). 

Thus, there is a need in the art for the development of new and improved 
vaccines that promote a strong CTL and B-cell immune response as efficiently as 
natural pathogens. 

Summary of the Invention 

The invention provides a versatile new technology that allows production 
of particles coated with any desired antigen. The technology allows the creation 
of highly efficient vaccines against infectious diseases and for the creation of 
vaccines for the treatment of allergies and cancers. 

In a first embodiment, the invention provides a novel composition 
comprising (A) a non-natural molecular scaffold and (B) an antigen or antigenic 
determinant. 

The non-natural molecular scaffold comprises (i) a core particle selected 
from the group consisting of (1) a core particle of non-natural origin and (2) a 
core particle of natural origin; and (ii) an organizer comprising at least one first 
attachment site, wherein said organizer is connected to said core particle by at 
least one covalent bond. 

The antigen or antigenic determinant has at least one second attachment 
site which is selected from the group consisting of (i) an attachment site not 



WO 00/32227 



PCT/IB99/01925 



-8- 

naturally occurring with said antigen or antigenic determinant; and (ii) an 
attachment site naturally occurring with said antigen or antigenic determinant. 

The invention provides for an ordered and repetitive antigen array through 
an association of the second attachment site to the first attachment site by way of 
at least one non-peptide bond. Thus, the antigen or antigenic determinant and the 
non-natural molecular scaffold are brought together through this association of 
the first and the second attachment site to form an ordered and repetitive antigen 
array. 

In another embodiment, the core particle of the aforementioned 
composition comprises a virus, a virus-like particle, a bacteriophage, a viral 
capsid particle or a recombinant form thereof. Alternatively, the core particle 
may be a synthetic polymer or a metal. 

In a particular embodiment, the organizer may comprise at least one first 
attachment site. The first and the second attachment sites are particularly 
important elements of the composition of the invention. In various embodiments 
of the invention, the first and/or the second attachment site may be an antigen and 
an antibody or antibody fragment thereto; biotin and avidin; strepavidin and 
biotin; a receptor and its ligand; a ligand-binding protein and its ligand; 
interacting leucine zipper polypeptides; an amino group and a chemical group 
reactive thereto; a carboxyl group and a chemical group reactive thereto; a 
sulfhydryl group and a chemical group reactive thereto; or a combination thereof. 

In a more preferred embodiment, the invention provides the coupling of 
almost any antigen of choice to the surface of a virus, bacteriophage, virus-like 
particle or viral capsid particle. By bringing an antigen into a quasi-crystalline 
'virus-like' structure, the invention exploits the strong antiviral immune reaction 
of a host for the production of a highly efficient immune response, i.e., a 
vaccination, against the displayed antigen. 

In one preferred embodiment, the core particle may be selected from the 
group consisting of: recombinant proteins of Rotavirus, recombinant proteins of 
Norwalkvirus, recombinant proteins of Alphavirus, recombinant proteins of Foot 



WO 00/32227 



PCT/IB99/01925 



-9- 

and Mouth Disease virus, recombinant proteins of Retrovirus, recombinant 
proteins of Hepatitis B virus, recombinant proteins of Tobacco mosaic virus, 
recombinant proteins of Flock House Virus, and recombinant proteins of human 
Papilomavirus. 

In another preferred embodiment, the antigen may be selected from the 
group consisting of: (1) a protein suited to induce an immune response against 
cancer cells; (2) a protein suited to induce an immune response against infectious 
diseases; (3) a protein suited to induce an immune response against allergens; and 
(4) a protein suited to induce an immune response in farm animals. 

In a particularly preferred embodiment of the invention, the first 
attachment site and/or the second attachment site comprise an interacting leucine 
zipper polypeptide. In most preferred embodiment, the first attachment site 
and/or the second attachment site are selected from the group comprising: (1) the 
JUN leucine zipper protein domain; and (2) the FOS leucine zipper protein 
domain. 

In another preferred embodiment, the first attachment site and/or the 
second attachment site are selected from the group comprising: (1) a genetically 
engineered lysine residue and (2) a genetically engineered cysteine residue, two 
residues that may be chemically linked together. 

Other embodiments of the invention include processes for the production 
of the compositions of the invention and a methods of medical treatment using 
said compositions. 

It is to be understood that both the foregoing general description and the 
following detailed description are exemplary and explanatory only and are 
intended to provide further explanation of the invention as claimed. 



WO 00/32227 



PCT/IB99/01925 



-10- 

Brief Description of the Drawings 

Figure 1 Western blot demonstrating the production of viral particles 
containing the E2-JUN fusion protein using the pCYTts::E2Ji/Af expression 
vector. 

Figure 2 Western blot demonstrating the production of viral particles 
containing the E2-JUN fusion protein expressed from pTE5'2J::E2Jf//V 
expression vector. 

Figure 3 Western dot blot demonstrating bacterial and eukaryotic 
expression of the FOS-hgh antigen. 

Figure 4 Expression of HBcAg-JUN in E. coli cells. 

Figure 5 Western blot demonstrating that HBcAg-JUN is soluble in 
E. coli lysates. 

Figure 6 SDS-PAGE analysis of enrichment of HBcAg-JUN capsid 
particles on a sucrose density gradient. 

Figure 7 Non-reducing SDS-PAGE analysis of the coupling ofhGH-FOS 
and HBcAg-JUN particles. 

Detailed Description of the Preferred Embodiments 
L Definitions 

The following definitions are provided to clarify the subject matter which 
the inventors consider to be the present invention. 

Alphavirus: As used herein, the term "alphavirus" refers to any of the 
RNA viruses included within the genus Alphavirus. Descriptions of the members 
of this genus are contained in Strauss and Strauss, Microbiol. Rev., 55:491-562 
(1994). Examples of alphaviruses include Aura virus, Bebaru virus, Cabassou 
virus, Chikungunya virus, Easter equine encephalomyelitis virus, Fort morgan 
virus, Getah virus, Kyzylagach virus, Mayoaro virus. Middleburg virus. 



WO 00/32227 



PCT/IB99/01925 



-11- 



Mucambo virus, Ndumu virus, Pixuna virus, Tonate virus, Triniti virus, Una 
virus, Western equine encephalomyelitis virus, Whataroa virus, Sindbis virus 
(SIN), Semliki forest virus (SFV), Venezuelan equine encephalomyelitis virus 
(VEE), and Ross River virus. 

Antigen: As used herein, the term "antigen" is a molecule capable of 
being bound by an antibody. An antigen is additionally capable of inducing a 
humoral immune response and/or cellular immune response leading to the 
production of B- and/or TVlymphocytes. An antigen may have one or more 
epitopes (B- and T- epitopes). The specific reaction referred to above is meant 
to indicate that the antigen will react, in a highly selective manner, with its 
corresponding antibody and not with the multitude of other antibodies which may 
be evoked by other antigens. 

Antigenic determinant: As used herein, the term"antigenic determinant" 
is meant to refer to that portion of an antigen that is specifically recognized by 
either B- or T-lymphocytes. B-lymphocytes respond to foreign antigenic 
determinants via antibody production, whereas T-lymphocytes are the mediator 
of cellular immunity. Thus, antigenic determinants or epitopes are those parts of 
an antigen that are recognized by antibodies, or in the context of an MHC, by T- 
cell receptors. 

Association: As used herein, the term "association" as it applies to the 
first and second attachment sites, is used to refer to at least one non-peptide bond. 
The nature of the association may be covalent, ionic, hydrophobic, polar or any 
combination thereof. 

Attachment Site, First: As used herein, the phrase "first attachment site" 
refers to an element of the "organizer", itself bound to the core particle in a non- 
random fashion, to which the second attachment site located on the antigen or 
antigenic determinant may associate. The first attachment site may be a protein, 
a polypeptide, a peptide, a sugar, a polynucleotide, a natural or synthetic polymer, 
a secondary metabolite or compound (biotin, fluorescein, retinol, digoxigenin, 
metal ions, phenylmethylsulfonylfluoride), or a combination thereof, or a 



WO 00/32227 



PCT/IB99/01925 



-12- 

chemically reactive group thereof. Multiple first attachment sites are present on 
the surface of the non-natural molecular scaffold in a repetitive configuration. 

Attachment Site, Second: As used herein, the phrase "second attachment 
site" refers to an element associated with the antigen or antigenic determinant to 
which the first attachment site of the "organizer" located on the surface of the 
non-natural molecular scaffold may associate. The second attachment site of the 
antigen or antigenic determinant may be a protein, a polypeptide, a peptide, a 
sugar, a polynucleotide, a natural or synthetic polymer, a secondary metabolite or 
compound (biotin, fluorescein, retinol, digoxigenin, metal ions, 
phenylmethylsulfony Ifluoride), or a combination thereof, or a chemically reactive 
group thereof At least one second attachment site is present on the antigen or 
antigenic determinant. 

Core particle: As used herein, the term "core particle" refers to a rigid 
structure with an inherent repetitive organization that provides a foundation for 
attachment of an "organizer". A core particle as used herein may be the product 
of a synthetic process or the product of a biological process. 

C&-acting: As used herein, the phrase "exacting" sequence refers to 
nucleic acid sequences to which a replicase binds to catalyze the RNA-dependent 
replication of RNA molecules. These replication events result in the replication 
of the full-length and partial RNA molecules and, thus, the alpahvirus 
subgenomic promoter is also a "c/s-acting" sequence. C/s-acting sequences may 
be located at or near the 5' end, 3' end, or both ends of a nucleic acid molecule, 
as well as internally. 

Fusion: As used herein, the term "fusion" refers to the combination of 
amino acid sequences of different origin in one polypeptide chain by in-frame 
combination of their coding nucleotide sequences. The term "fusion" explicitly 
encompasses internal fusions, i.e., insertion of sequences of different origin 
within a polypeptide chain, in addition to fusion to one of its termini. 

Heterologous sequence: As used herein, the term "heterologous 
sequence" refers to a second nucleotide sequence present in a vector of the 



WO 00/32227 



PCT/IB99/0I925 



-13- 

invention. The term "heterologous sequence" also refers to any amino acid or 
RNA sequence encoded by a heterologous DNA sequence contained in a vector 
of the invention. Heterologous nucleotide sequences can encode proteins or RNA 
molecules normally expressed in the cell type in which they are present or 
molecules not normally expressed therein (e.g., Sindbis structural proteins). 

Isolated: As used herein, when the term "isolated" is used in reference to 
a molecule, the term means that the molecule has been removed from its native 
environment. For example, a polynucleotide or a polypeptide naturally present 
in a living animal is not "isolated," but the same polynucleotide or polypeptide 
separated from the coexisting materials of its natural state is "isolated." Further, 
recombinant DNA molecules contained in a vector are considered isolated for the 
purposes of the present invention. Isolated RNA molecules include in vivo or in 
vitro RNA replication products of DNA and RNA molecules. Isolated nucleic 
acid molecules further include synthetically produced molecules. Additionally, 
vector molecules contained in recombinant host cells are also isolated. Thus, not 
all "isolated" molecules need be "purified." 

Immunotherapeutic: As used herein, the term "immunotherapeutic" is 
a composition for the treatment of diseases or disorders.. More specifically, the 
term is used to refer to a method of treatment for allergies or a method of 
treatment for cancer. 

Individual: As used herein, the term "individual" refers to multicellular 
organisms and includes both plants and animals. Preferred multicellular 
organisms are animals, more preferred are vertebrates, even more preferred are 
mammals, and most preferred are humans. 

Low or undetectable: As used herein, the phrase "low or undetectable," 
when used in reference to gene expression level, refers to a level of expression 
which is either significantly lower than that seen when the gene is maximally 
induced (e.g., at least five fold lower) or is not readily detectable by the methods 
used in the following examples section. 



WO 00/32227 



PCT/IB99/0I925 



-14- 

Lectin: As used herein, proteins obtained particularly from the seeds of 
leguminous plants, but also from many other plant and animal sources, that have 
binding sites for specific mono- or oligosaccharides. Examples include 
concanavalin A and wheat-germ agglutinin, which are widely used as analytical 
and preparative agents in the study of glycoproteins. 

Natural origin: As used herein, the term "natural origin" means that the 
whole or parts thereof are not synthetic and exist or are produced in nature. 

Non-natural: As used herein, the term generally means not from nature, 
more specifically, the term means from the hand of man. 

Non-natural origin: As used herein, the term "non-natural origin" 
generally means synthetic or not from nature; more specifically, the term means 
from the hand of man. 

Non-natural molecular scaffold: As used herein, the phrase "non-natural 
molecular scaffold" refers to any product made by the hand of man that may serve 
to provide a rigid and repetitive array of first attachment sites. Ideally but not 
necessarily, these first attachment sites are in a geometric order. The non-natural 
molecular scaffold may be organic or non-organic and may be synthesized 
chemically or through a biological process, in part or in whole. The non-natural 
molecular scaffold is comprised of: (a) a core particle, either of natural or non 
natural origin; and (b) an organizer, which itself comprises at least one first 
attachment site and is connected to a core particle by at least one covalent bond. 
In a particular embodiment, the non-natural molecular scaffold may be a virus, 
virus-like particle, a virus capsid particle, a phage, a recombinant form thereof, 
or synthetic particle. 

Ordered and repetitive antigen or antigenic determinant array: As 
used herein, the term "ordered and repetitive antigen or antigenic determinant 
array" generally refers to a repeating pattern of antigen or antigenic determinant, 
characterized by a uniform spacial arrangement of the antigens or antigenic 
determinants with respect to the scaffold. In one embodiment of the invention, 
the repeating pattern may be a geometric pattern. An ideal ordered and repetitive 



WO 00/32227 



PCT/IB99/01925 



-15- 

antigen or antigenic determinant array will possess a strictly repetitive 
paracrystalline order of antigen or antigenic determinant with a spacing of 5 to 1 5 
nanometers. 

Organizer: As used herein, the term "organizer" is used to refer to an 
element bound to a core particle in a non-random fashion that provides a 
nucleation site for creating an ordered and repetitive antigen array. An organizer 
is any element comprising at least one first attachment site that is bound to a core 
particle by at least one covalent bond. An organizer may be a protein, a 
polypeptide, a peptide, an amino acid (i.e., a residue of a protein, a polypeptide 
or peptide), a sugar, a polynucleotide, a natural or synthetic polymer, a secondary 
metabolite or compound (biotin, fluorescein, retinol, digoxigenin, metal ions, 
phenylmethylsulfony Ifluoride), or a combination thereof, or a chemically reactive 
group thereof. 

Permissive temperature: As used herein, the phrase "permissive 
temperature" refers to temperatures at which an enzyme has relatively high levels 
of catalytic activity. 

Purified: As used herein, when the term "purified" is used in reference to 
a molecule, it means that the concentration of the molecule being purified has 
been increased relative to molecules associated with it in its natural environment. 
Naturally associated molecules include proteins, nucleic acids, lipids and sugars 
but generally do not include water, buffers, and reagents added to maintain the 
integrity or facilitate the purification of the molecule being purified. For 
example, even if mRNA is diluted with an aqueous solvent during oligo dT 
column chromatography, mRNA molecules are purified by this chromatography 
if naturally associated nucleic acids and other biological molecules do not bind 
to the column and are separated from the subject mRNA molecules. 

Receptor: As used herein, the term "receptor" refers to proteins or 
glycoproteins or fragments thereof capable of interacting with another molecule, 
called the ligand. The ligandmay belong to any class of biochemical or chemical 
compounds. The receptor need not necessarily be a membrane-bound protein. 



WO 00/32227 



PCT/IB99/01925 



-16- 

Soluble protein, like e.g. maltose binding protein or retinol binding protein are 
receptors as well. 

Residue. As used herein, the term "residue" is meant to mean a specific 
amino acid in a polypeptide backbone or side chain. 

Temperature-sensitive: As used herein, the phrase "temperature- 
sensitive" refers to an enzyme which readily catalyzes a reaction at one 
temperature but catalyzes the same reaction slowly or not at all at another 
temperature. An example of a temperature-sensitive enzyme is the replicase 
protein encoded by the pCYTts vector, which has readily detectable replicase 
activity at temperatures below 34 °C and has low or undetectable activity at 37 °C. 

Transcription: As used herein, the term "transcription" refers to the 
production of RNA molecules from DNA templates catalyzed by RNA 
polymerases. 

Recombinant host cell: As used herein, the term "recombinant host cell" 
refers to a host cell into which one ore more nucleic acid molecules of the 
invention have been introduced. 

Recombinant virus: As used herein, the phrase "recombinant virus" 
refers to a virus that is genetically modified by the hand of man. The phrase 
covers any virus known in the art. More specifically, the phrase refers to a an 
alphavirus genetically modified by the hand of man, and most specifically, the 
phrase refers to a Sinbis virus genetically modified by the hand of man. 

Restrictive temperature: As used herein, the phrase "restrictive 
temperature" refers to temperatures at which an enzyme has low or undetectable 
levels of catalytic activity. Both "hot" and "cold" sensitive mutants are known 
and, thus, a restrictive temperature may be higher or lower than a permissive 
temperature. 

RNA-dependent RNA replication event: As used herein, the phrase 
"RNA-dependent RNA replication event" refers to processes which result in the 
formation of an RNA molecule using an RNA molecule as a template. 



WO 00/32227 



PCT/IB99/0192S 



-17- 



RNA-Dependent RNA polymerase: As used herein, the phrase "RNA- 
Dependent RNA polymerase" refers to a polymerase which catalyzes the 
production of an RNA molecule from another RNA molecule. This term is used 
herein synonymously with the term "replicase." 
5 Untranslated RNA: As used herein, the phrase "untranslated RNA" refers 

to an RNA sequence or molecule which does not encode an open reading frame 
or encodes an open reading frame, or portion thereof, but in a format in which an 
amino acid sequence will not be produced (e.g. , no initiation codon is present). 
Examples of such molecules are tRNA molecules, rRNA molecules, and 
1 0 ribozymes. 

Vector: As used herein, the term "vector" refers to an agent (e.g., a 
plasmid or virus) used to transmit genetic material to a host cell. A vector may 
be composed of either DNA or RNA. 

one, a, or an: When the terms "one," "a," or "an" are used in this 
1 5 disclosure, they mean "at least one" or "one or more," unless otherwise indicated. 

2. Compositions of Ordered and Repetitive Antigen or Antigenic 
Determinant Arrays and Methods to Make the Same 

The disclosed invention provides compositions comprising an ordered and 
repetitive antigen or antigenic determinant. Furthermore, the invention 
conveniently enables the practitioner to construct ordered and repetitive antigen 
or antigenic determinant arrays for various treatment purposes, which includes the 
prevention of infectious diseases, the treatment of allergies and the treatment of 
cancers. 

Compositions of the invention essentially comprise two elements: (1) a 
non-natural molecular scaffold; and (2) an antigen or antigenic determinant with 
at least one second attachment site capable of association through at least one 
non-peptide bond to said first attachment site. 

The non-natural molecular scaffold comprises (a) a core particle selected 
from the group consisting of (1) a core particle of non-natural origin and (2) a 



20 



25 



3NSDOCID; <WO_0032227A2_I_> 



WO 00/32227 



PCT/IB99/01925 



-18- 

core particle of natural origin; and (b) an organizer comprising at least one first 
attachment site, wherein said organizer is connected to said core particle by at 
least one covalent bond. 

The antigen or antigenic determinant has at least one second attachment 
site which is selected from the group consisting of (a) an attachment site not 
naturally occurring with said antigen or antigenic determinant; and (b) an 
attachment site naturally occurring with said antigen or antigenic determinant. 

The invention provides for an ordered and repetitive antigen array through 
an association of the second attachment site to the first attachment site by way of 
at least one non-peptide bond. Thus, the antigen or antigenic determinant and the 
non-natural molecular scaffold are brought together through this association of 
the first and the second attachment site to form an ordered and repetitive antigen 
array. 

The practioner may specifically design the antigen or antigenic 
determinant and the second attachment site such that the arrangement of all the 
antigens or antigenic determinants bound to the non-natural molecular scaffold 
will be uniform. For example, one may place a single second attachment site on 
the antigen or antigenic determinant at the carboxyl or amino terminus, thereby 
ensuring through design that all antigen or antigenic determinant molecules that 
are attached to the non-natural molecular scaffold are positioned in a uniform 
way. Thus, the invention provides a convenient means of placing any antigen or 
antigenic determinant onto a non-natural molecular scaffold in a defined order 
and repetition. 

As will be clear to those skilled in the art, certain embodiments of the 
invention involve the use of recombinant nucleic acid technologies such as 
cloning, polymerase chain reaction, the purification of DNA and RNA, the 
expression of recombinant proteins in prokaryotic and eukaryotic cells, etc. Such 
methodologies are well known to those skilled in the art and may be conveniently 
found in published laboratory methods manuals (e.g., Sambrook, J. et al. 9 eds., 
Molecular Cloning, A Laboratory Manual, 2nd. edition, Cold Spring 



WO 00/32227 



PCT/1B99/01925 



-19- 

Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989): Ausubel, F. el al., 
eds., CurrentProtocols inMolecularBiology, John H. Wiley & Sons, Inc. 
( 1 997)). Fundamental laboratory techniques for working with tissue culture cell 
lines (Celis, J., ed., Cell Biology, Academic Press, 2 nd edition, (1998)) and 
antibody-based technologies (Harlow, E. and Lane, D., "Antibodies: A Laboratory 
Manual," Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (1988); 
Deutscher,M.P., "Guide to Protein Purification," Meth. Enzymol. 128, Academic 
Press San Diego (1990); Scopes, R.K., "Protein Purification Principles and 
Practice," 3 rd ed., Springer- Verlag, New York (1994)) are also adequately 
described in the literature, all of which are incorporated herein by reference. 

A. Construction of a Non-natural Molecular Scaffold 

One element in the composition of the invention is a non-natural, 
molecular scaffold comprising a core particle and an organizer. As used herein, 
the phrase "non-natural molecular scaffold" refers to any product made by the 
hand of man that may serve to provide a rigid and repetitive array of first 
attachment sites. More specifically, the non-natural molecular scaffold comprises 
(a) a core particle selected from the group consisting of ( 1 ) a core particle of non- 
natural origin and (2) a core particle of natural origin; and (b) an organizer 
comprising at least one first attachment site, wherein said organizer is connected 
to said core particle by at least one covalent bond. 

As will be readily apparent to those skilled in the art, the core particle of 
the non-natural molecular scaffold of the invention is not limited to any specific 
form. The core particle may be organic or non-organic and may be synthesized 
chemically or through a biological process. 

In one embodiment, a non-natural core particle may be a synthetic 
polymer, a lipid micelle or a metal. Such core particles are known in the art, 
providing a basis from which to build the novel non-natural molecular scaffold 
of the invention. By way of example, synthetic polymer or metal core particles 



3NSOOCID: <WO 0032227 A2J_> 



WO 00/32227 



PCT/IB99/01925 



-20- 



are described in U.S. Patent No. 5,770,380, which discloses the use of a 
calixarene organic scaffold to which is attached a plurality of peptide loops in the 
creation of an 'antibody mimic\ and U.S. Patent No. 5,334,394 describes 
nanocrystalline particles used as a viral decoy that are composed of a wide variety 
of inorganic materials, including metals or ceramics. Preferred metals in this 
embodiment include chromium, rubidium, iron, zinc, selenium, nickel, gold, 
silver, platinum. Preferred ceramic materials in this embodiment include silicon 
dioxide, titanium dioxide, aluminum oxide, ruthenium oxide and tin oxide. The 
core particles of this embodiment may be made from organic materials including 
carbon (diamond). Preferred polymers include polystyrene, nylon and 
nitrocellulose. For this type of nanocrystalline particle, particles made from tin 
oxide, titanium dioxide or carbon (diamond) are particularly preferred. A lipid 
micelle may be prepared by any means known in the art. For example micelles 
may be prepared according to the procedure of Baiselle and Millar (Baiselle, C J. 
and Millar, D.B., Biophys. Chem. 4:355-361 (1975)) or Corti et al (Corti, M., 
Degriorgio, V., Sonnino, S., Ghidoni R., Masserini, M. and Tettamanti, G., 
Chem. Phys. Lipids 38: 197-214 (1981)) or Lopez et al (Lopez, O. de la Maza, 
A., Coderch, L., Lopez-Iglesias, C, Wehrli, E. and Parra, J.L., FEBS Lett. 426: 
314-318 (1998)) or Topchieva and Karezin (Topchieva, 1. and Karaezin, K., J. 
Colloid Interface Sci. 213: 29-35 (1999)) or Morein et al, (Morein, B., 
Sundquist, B., Hoglund, S., Dalsgaard K. and Osterhaus, A. ? Nature 308: 457-60 
(1984)), which are all incorporated herein by reference. 

The core particle may also be produced through a biological process, 
which may be natural or non-natural. By way of example, this type of 
embodiment may includes a core particle comprising a virus, virus-like particle, 
a phage, a viral capsid particle or a recombinant form thereof In a more specific 
embodiment; the core particle may comprise recombinant proteins of Rotavirus, 
recombinant proteins of Norwalkvirus, recombinant proteins of Alphavirus, 
recombinant proteins of Foot and Mouth Disease virus, recombinant proteins of 
Retrovirus, recombinant proteins of Hepatitis B virus, recombinant proteins of 



WO 00/32227 



PCT/IB99/01925 



-21- 



10 



15 



20 



25 



30 



Tobacco mosaic virus, recombinant proteins of Flock House Virus, and 
recombinant proteins of human Papilomavirus. 

Whether natural or non-natural, the core particle of the invention is 
characterized by comprising organizer that is attached to the natural or non- 
natural core particle by at least one covalent bond. The organizer is an element 
bound to a core particle in a non-random fashion that provides a nucleation site 
for creating an ordered and repetitive antigen array. Ideally, but not necessarily, 
the organizer is associated with the core particle in a geometric order. Minimally, 
the organizer comprises a first attachment site. 

As previously stated, the organizer may be any element comprising at 
least one first attachment site that is bound to a core particle by at least one 
covalent bond. An organizer may be a protein, a polypeptide, a peptide, an 
amino acid {i.e., a residue of a protein, a polypeptide or peptide), a sugar, a 
polynucleotide, a natural or synthetic polymer, a secondary metabolite or 
compound (biotin, fluorescein, retinol, digoxigenin, metal ions, 
phenylmethylsulfonylfluoride), or a combination thereof, or a chemically reactive 
group thereof. In a more specific embodiment, the organizer may comprise a first 
attachment site comprising an antigen, an antibody or antibody fragment, biotin, 
avidin, strepavidin, a receptor, a receptor ligand, a ligand, a ligand-binding 
protein, an interacting leucine zipper polypeptide, an amino group, a chemical 
group reactive to an amino group; a carboxyl group, chemical group reactive to 
a carboxyl group, a sulfhydryl group, a chemical group reactive to a sulfhydryl 
group, or a combination thereof. 

In a preferred embodiment, the core particle of the non-natural molecular 
scaffold comprises a virus, a bacteriophage, a virus-like particle, a viral capsid 
particle or a recombinant form thereof. Any virus known in the art having an 
ordered and repetitive coat and/or core protein structure may be selected as a non- 
natural molecular scaffold of the invention; examples of suitable viruses include: 
sindbis and other alphaviruses; vesicular somatitis virus; rhabdo-, (e.g. vesicular 
stomatitis virus), picoma-, toga-, orthomyxo-, polyoma-, parvovirus, rotavirus, 



NSDOCID: < WO 0032227 A2_ l_ > 



WO 00/32227 



PCT/IB99/0I925 



-22- 

norwalkvirus, foot and mouth disease virus, a retrovirus, hepatitis B virus, 
tobacco mosaic virus, flock house virus, human papilomavirus (for example, see 
Table 1 in Bachman, M.F. and Zinkernagel, R.M., Immunol. Today 77:553-558 
(1996)). 

In one embodiment, the invention utilizes genetic engineering of a virus 
to create a fusion between an ordered and repetitive viral envelope protein and an 
organizer comprising a heterologous protein, peptide, antigenic determinant or a 
reactive amino acid residue of choice. Other genetic manipulations known to 
those in the art may be included in the construction of the non-natural molecular 
scaffold; for example, it may be desirable to restrict the replication ability of the 
recombinant virus through genetic mutation. The viral protein selected for fusion 
to the organizer (i.e., first attachment site) protein should have an organized and 
repetitive structure, more preferably a paracrystalline organization optimally with 
a spacing of 5-15nm on the surface of the virus. The creation of this type of 
fusion protein will result in multiple, ordered and repetitive organizers on the 
surface of the virus. Thus, the ordered and repetitive organization of the first 
attachment sites resulting therefrom will reflect the normal organization of the 
native viral protein. 

As will be discussed in more detail herein, in a preferred embodiment of 
the invention, the scaffold is a recombinant alphavirus, and more specifically, a 
recombinant Sinbis virus. Alphaviruses are positive stranded RNA viruses that 
replicate their genomic RNA entirely in the cytoplasm of the infected cell and 
without a DNA intermediate (Strauss, J. and Strauss, E., Microbiol. Rev. 55:491 - 
562 (1 994)). Several members of the alphavirus family, Sindbis (Xiong, C. et al f 
Science 24J:1 188-1 191 (1989); Schlesinger, S., Trends Biotechnol 77:18-22 
( 1 993)), Semliki Forest Virus (SFV) (Liljestrom, P. & Garoff. H., Bio/Technology 
9:1356-1361 (1991)) and others (Davis, N.L. et al, Virology 777:189-204 
(1989)), have received considerable attention for use as virus-based expression 
vectors for a variety of different proteins (Lundstrom, K., Curr. Opin. Biotechnol 
5:578-582 (1 997); Liljestrom, P., Curr, Opin. Biotechnol 5:495-500 ( 1 994)) and 



WO 00/32227 



PCT/IB99/01925 



-23- 

as candidates for vaccine development. Recently, a number of patents have 
issued directed to the use of alphaviruses for the expression of heterologous 
proteins and the development of vaccines (see U.S. Patent Nos. 5,766,602; 
5,792,462; 5,739,026; 5;789,245 and 5,814,482). The construction of the 
alphaviral scaffold of the invention may be done by means generally known in the 
art of recombinant DNA technology, as described by the aforementioned articles, 
which are incorporated herein by reference. 

A variety of different recombinant host cells can be utilized to produce a 
viral-based core particle for antigen or antigenic determinant attachment. For 
example, Alphaviruses are known to have a wide host range; Sindbis virus infects 
cultured mammalian, reptilian, and amphibian cells, as well as some insect cells 
(Clark, H., J. Natl. Cancer Inst. 51:645 (1973); Leake, C.,J. Gen. Virol. 55:335 
(1 977); Stollar, V. in TheTogaviruses, R.W. Schlesinger, Ed., Academic Press, 
(1980), pp.583-621). Thus, numerous recombinant host cells can be used in the 
practice of the invention. BHK, COS, Vero, HeLaand CHO cells are particularly 
suitable for the production of heterologous proteins because they have the 
potential to glycosylate heterologous proteins in a manner similar to human cells 
(Watson, E. et ai, Glycobiology 4:221 , (1994)) and can be selected (Zang, M. et 
al, Bio/Technology 75:389 (1995)) or genetically engineered (Renner W. et ah, 
Biotech. Bioeng 4:476 (1995); Lee K. et al. Biotech. Bioeng. 50:336 (1996)) to 
grow in serum-free medium, as well as in suspension. 

Introduction of the polynucleotide vectors into host cells can be effected 
by methods described in standard laboratory manuals (see, e.g., Sambrook, J. et 
al, eds., Molecular Cloning, A Laboratory Manual. 2nd. edition, Cold ' 
Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989), Chapter 9; 
Ausubel, F. et al, eds.. Current Protocols in Molecular Biology, John H. 
Wiley & Sons, Inc. (1997), Chapter 16), including methods such as 
electroporation, DEAE-dextran mediated transfection, transfection, 
microinjection, cationic lipid-mediated transfection, transduction, scrape loading, 
ballistic introduction., and infection. Methods for the introduction of exogenous 



WO 00/32227 



PCT/IB99/0I925 



-24- 

DNA sequences into host cells are discussed in Feigner, P. et ah, U.S. Patent No. 
5,580,859. 

Packaged RNA sequences can also be used to infect host cells. These 
packaged RNA sequences can be introduced to host cells by adding them to the 
culture medium. For example, the preparation of non-infective alpahviral 
particles is described in a number of sources, including "Sindbis Expression 
System", Version C, (Invitrogen Catalog No. K750-1). 

When mammalian cells are used as recombinant host cells for the 
production of viral-based core particles, these cells will generally be grown in 
tissue culture. Methods for growing cells in culture are well known in the art 
(see, e.g., Celis, J., ed., Cell BIOLOGY, Academic Press, 2 nd edition, (1998); 
Sambrook, J. et ah , eds., Molecular Cloning, A Laboratory Manual, 2nd. 
edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989); 
Ausubel, F. et ah, eds. r Current Protocols in Molecular Biology, John H. 
Wiley & Sons, Inc. (1997); Freshney, R., Culture of Animal Cells, Alan R. 
Liss, Inc. (1983)). 

As will be understood by those in the art, the first attachment site may be 
or be a part of any suitable protein, polypeptide, sugar, polynucleotide, peptide 
(amino acid), natural or synthetic polymer, a secondary metabolite or combination 
thereof that may serve to specifically attach the antigen or antigenic determinant 
of choice to the scaffold. In one embodiment, the attachment site is a protein or 
peptide that may be selected from those known in the art. For example, the first 
attachment site may selected from the following group: a ligand, a receptor, a 
lectin, avidin, streptavidin, biotin, an epitope such as an HA or T7 tag, Myc, Max, 
immunoglobulin domains and any other amino acid sequence known in the art 
that would be useful as a first attachment site. 

It should be further understood by those in the art that with another 
embodiment of the invention, the first attachment site may be created secondarily 
to the organizer (i.e., protein or polypeptide) utilized in constructing the in-frame 
fusion to the capsid protein. For example, a protein may be utilized for fusion to 



WO 00/32227 



PCT/1B99/01925 



-25- 

the envelope protein with an amino acid sequence known to be glycosylated in a 
specific fashion, and the sugar moiety added as a result may then serve at the first 
attachment site of the viral scaffold by way of binding to a lectin serving as the 
secondary attachment site of an antigen. Alternatively, the organizer sequence 
may be biotinylated in vivo and the biotin moiety may serve as the first 
attachment site of the invention, or the organizer sequence may be subjected to 
chemical modification of distinct amino acid residues in vitro, the modification 
serving as the first attachment site. 

One specific embodiment of the invention utilizes the Sinbis virus. The 
Sinbis virus RNA genome is packaged into a capsid protein that is surrounded by 
a lipid bilayer containing three proteins called El, E2, and E3. These so-called 
envelope proteins are glycoproteins, and the glycosylated portions are located on 
the outside of the lipid bilayer, where complexes of these proteins form the 
"spikes" that can be seen in electron micrographs to project outward from the 
surface of the virus. In a preferred embodiment of the invention, the first 
attachment site is selected to be the JUN or FOS leucine zipper protein domain 
that is fused in frame to the E2 envelope protein. However, it will be clear to all 
individuals in the art that other envelope proteins may be utilized in the fusion 
protein construct for locating the first attachment site in the scaffold of the 
invention. 

In a most preferred embodiment of the invention, the first attachment site 
is selected to be the JUN-FOS leucine zipper protein domain that is fused in 
frame to the Hepatitis B capsid (core) protein. However, it will be clear to all 
individuals in the art that other viral capsid proteins may be utilized in the fusion 
protein construct for locating the first attachment site in the scaffold of the 
invention. 

In another preferred embodiment of the invention, the first attachment site 
is selected to be a lysine or cysteine residue that is fused in frame to the Hepatitis 
core (capsid) protein. However, it will be clear to all individuals in the art that 



WO 00/32227 



PCT/IB99/01925 



-26^ 

other viral capsid or virus-like particles may be utilized in the fusion protein 
construct for locating the first attachment in the scaffold of the invention. 

Example 1 is provided to demonstrate the construction of an in-frame 
fusion protein between the Sinbis virus E2 envelope protein and the JUN leucine 
zipper protein domain using the pTE5'2J vector of Hahn et al. (Proc. NatL Acad. 
ScL USA 59:2679-2683 (1992)). The JUN amino acid sequence utilized for the 
first attachment site is the following: 

CGGRIARLEEKVKTLKAQNSELASTANMLREQVAQLKQKVMNHVGC 
(SEQ ID NO:59) 

In this instance, the anticipated second attachment site on the antigen would be 
the FOS leucine zipper protein domain and the amino acid sequence would be the 
following: 

CGGLTDTLQAETDQVEDEKSALQTEIANLLKEKEKLEFILAAHGGC (SEQ 
IDNO:60) 

These sequences are derived from the transcription factors JUN and FOS, 
each flanked with a short sequence containing a cysteine residue on both sides. 
These sequences are known to interact with each other. The original hypothetical 
structure proposed for the JUN-FOS dimer assumed that the hydrophobic side 
chains of one monomer interdigitate with the respective side chains of the other 
monomer in a zipper-like manner (Landschulz et al, Science 240:1759-1764 

(1988) ). However, this hypothesis proved to be wrong, and these proteins are 
known to form an a-helical coiled coil (O'Shea et aL, Science 243:538-542 

(1989) ; O'Shea et al, Cell 65:699-708 (1992); Cohen & Parry, Trends Biochem. 
ScL 77:245-248 (1986)), Thus, the term "leucine zipper" is frequently used to 
refer to these protein domains for more historical than structural reasons. 
Throughout this patent, the term "leucine zipper" is used to refer to the sequences 
depicted above or sequences essentially similar to the ones depicted above. The 
terms JUN and FOS are used for the respective leucine zipper domains rather than 
the entire JUN and FOS proteins. 



WO 00/32227 



PCT/IB99/01925 



-27- 

In one embodiment, the invention provides for the production of a Sinbis 
virus E2-JUN scaffold using the pCYTts expression system (US Patent 
Application Appl. No. 60/079,562; Filed March 27,1998). The pCYTts 
expression system provides novel expression vectors which permit tight 
regulation of gene expression in eucaryotic cells. The DNA vectors of this 
system are transcribed to form RNA molecules which are then replicated by a 
temperature-sensitive replicase to form additional RNA molecules. The RNA 
molecules produced by replication contain a nucleotide sequence which may be 
translated to produce a protein of interest or which encode one or more 
untranslated RNA molecules. Thus the expression system enables the production 
of recombinant Sinbis virus particles. 

Example 2 provides details on the production of the E2-JLW Sinbis non- 
natural, molecular scaffold of the invention. Additionally provided in Example 
3 is another method for the production of recombinant E2-JUN Sinbis virus 
scaffold using the pTE5'2JE2:Jf/;V vector produced in Example 1. Thus the 
invention provides two means, the pCYTts expression system (Example 2) and 
the pTE5^2J vector system (Example 3) by which recombinant Sinbis virus E2- 
JUN non-natural, molecular scaffold may be produced. An analysis of viral 
particles produced in each system is proved in Figure 1 and Figure 2. 

As previously stated, the invention includes viral-based core particles 
which comprise a virus, virus-like particle, a phage, a viral capsid particle or a 
recombinant form thereof. Skilled artisans have the knowledge to produce such 
core particles and attach organizers thereto. By way of providing other examples, 
the invention provides herein for the production of hepatitis B virus-like particles 
and measles viral capsid particles as core particles (Examples 17 to 22). In such 
an embodiment, the JUN leucine zipper protein domain or FOS leucine zipper 
protein domain may be used as an organizer, and hence as a first attachment site, 
for the non-natural molecular scaffold of the invention. 

Examples 23-29 provide details of the production of Hepatitis B core 
particles carrying an in-frame fused peptide with a reactive lysine residue and 



WO 00/32227 



PCT/IB99/01925 



-28- 

antigens carrying a genetically fused cysteine residue, as first and second 
attachment site, respectively. 

B. Construction of an Antigen or Antigenic Determinant with a 
Second Attachment Site 

The second element in the composition of the invention is an antigen or 
antigenic determinant possessing at least one second attachment site capable of 
association through at least one non-peptide bond to the first attachment site of 
the non-natural molecular scaffold. The invention provides for compositions that 
vary according to the antigen or antigenic determinant selected in consideration 
of the desired therapeutic effect. Other compositions are provided by varying the 
molecule selected for the second attachment site. 

Antigens of the invention may be selected from the group consisting of the 
following: (a) proteins suited to induce an immune response against cancer cells; 
(b) proteins suited to induce an immune response against infectious diseases; (c) 
proteins suited to induce an immune response against allergens, and (d) proteins 
suited to induce an immune response in farm animals. 

In one specific embodiment of the invention, the antigen or antigenic 
determinant is one that is useful for the prevention of infectious disease. Such 
treatment will be useful to treat a wide variety of infectious diseases affecting a 
wide range of hosts, e.g., human, cow, sheep, pig, dog, cat, other mammalian 
species and non-mammalian species as well. Treatable infectious diseases are 
well known to those skilled in the art, examples include infections of viral 
etiology such as HIV. influenza, Herpes, viral hepatitis, Epstein Bar, polio, viral 
encephalitis, measles, chicken pox, etc.; or infections of bacterial etiology such 
as pneumonia, tuberculosis, syphilis, etc.; or infections of parasitic etiology such 
as malaria, trypanosomiasis, leishmaniasis, trichomoniasis, amoebiasis, etc. 
Thus, antigens or antigenic determinants selected for the compositions of the 
invention will be well known to those in the medical art; examples of antigens or 
antigenic determinants include the fol lowing: the HI V antigens gp 1 40 and gp 1 60; 



WO 00/32227 



PCT/IB99/0I925 



-29- 

the influenaza antigens hemagglutinin and neuraminidase, hepatitis B surface 
antigen, circumsporozoite protein of malaria. 

In another specific embodiment, the compositions of the invention are an 
immunotherapeutic that may be used for the treatment of allergies or cancer. 

The selection of antigens or antigenic determinants for the composition 
and method of treatment for allergies would be known to those skilled in the 
medical art treating such disorders; representative examples of this type of 
antigen or antigenic determinant include the following: bee venom phospholipase 
A 2 , Bet v.I (birch pollen allergen), 5 Dol m V (white-faced hornet venom 
allergen), Der p I (House dust mite allergen). 

The selection of antigens or antigenic determinants for the composition 
and method of treatment for cancer would be known to those skilled in the 
medical art treating such disorders; representative examples of this type of 
antigen or antigenic determinant include the following: Her2 (breast cancer), 
GD2 (neuroblastoma), EGF-R (malignant glioblastoma), CEA (medullary thyroid 
cancer), CD52 (leukemia). 

In a particular embodiment of the invention, the antigen or antigenic 
determinant is selected from the group consisting of: (a) a recombinant protein 
of HIV, (b) a recombinant protein of Influenza virus, (c) a recombinant protein 
of Hepatitis C virus, (d) a recombinant protein of Toxoplasma, (e) a recombinant 
protein of Plasmodium falciparum, (f) a recombinant protein of Plasmodium 
vivax, (g) a recombinant protein of Plasmodium ovale, (h) a recombinant protein 
of Plasmodium malariae, (i) a recombinant protein of breast cancer cells, (j) a 
recombinant protein of kidney cancer cells, (k) a recombinant protein of prostate 
cancer cells, (1) a recombinant protein of skin cancer cells, (m) a recombinant 
protein of brain cancer cells, (n) a recombinant protein of leukemia cells, (o) a 
recombinant profiling, (p) a recombinant protein of bee sting allergy, (q) a 
recombinant proteins of nut allergy, (r) a recombinant proteins of food allergies, 
recombinant proteins of asthma, and a recombinant protein of Chlamydia. 



WO 00/32227 



PCT/IB99/0I925 



-30- 



Once the antigen or antigenic determinant of the composition is chosen, 
at least one second attachment site may be added to the molecule in preparing to 
construct the organized and repetitive array associated with the non-natural 
molecular scaffold of the invention. Knowledge of what will constitute an 
appropriate second attachment site will be known to those skilled in the art. 
Representative examples of second attachment sites include, but are not limited 
to, the following: an antigen, an antibody or antibody fragment, biotin, avidin, 
strepavidin, a receptor, a receptor ligand, a ligand, a ligand-binding protein, an 
interacting leucine zipper polypeptide, an amino group, a chemical group reactive 
to an amino group; a carboxyl group, chemical group reactive to a carboxyl 
group, a sulfhydryl group, a chemical group reactive to a sulfhydryl group, or a 
combination thereof. 

The association between the first and second attachment sites will be 
determined by the characteristics of the respective molecules selected but will 
comprise at least one non-peptide bond. Depending upon the combination of first 
and second attachment sites, the nature of the association may be covalent, ionic, 
hydrophobic, polar, or a combination thereof. 

In one embodiment of the invention, the second attachment site may be 
the FOS leucine zipper protein domain or the JUN leucine zipper protein domain. 

In a most specific embodiment of the invention, the second attachment, 
site selected is the FOS leucine zipper protein domain, which associates 
specifically with the JUN leucine zipper protein domain of the non-natural 
molecular scaffold of the invention. The association of the JUN and FOS leucine 
zipper protein domains provides a basis for the formation of an organized and 
repetitive antigen or antigenic determinant array on the surface of the scaffold. 
The FOS leucine zipper protein domain may be fused in frame to the antigen or 
antigenic determinant of choice at either the amino terminus, carboxyl terminus 
or internally located in the protein if desired. 



WO 00/32227 PCT/IB99/01925 

-31- 



10 



15 



20 



25 



Several FOS fusion constructs are provided for exemplary purposes. 
Human growth hormone (Example 4), bee venom phospholipase A 2 (PLA) 
(Example 9), ovalbumin (Example 10) and HIV gpl40 (Example 12). 

In order to simplify the generation of FOS fusion constructs, several 
vectors are disclosed that provide options for antigen or antigenic determinant 
design and construction (see Example 6). The vectors pAV 1 -4 were designed for 
the expression of FOS fusion in R coli; the vectors pAV5 and pAV6 were 
designed for the expression of FOS fusion proteins in eukaryotic cells. Properties 
of these vectors are briefly described: 

1. pAYJ.: This vector was designed for the secretion of fusion proteins 
with FOS at the C-terminus into the E. coli periplasmic space. The gene of 
interest (g.o.i.) may be ligated into the StuI/NotI sites of the vector. 

2. pAV2 : This vector was designed for the secretion of fusion proteins 
with FOS at the N-terminus into the E. coli periplasmic space. The gene of 
interest (g.o.i.) ligated into the Notl/EcoRV (or Notl/Hindlll) sites of the vector. 

3. pAV3 : This vector was designed for the cytoplasmic production of 
fusion proteins with FOS at the C-terminus in E. coli. The gene of interest (g.o.i.) 
may be ligated into the EcoRV/NotI sites of the vector. 

4. pAV4: This vector is designed for the cytoplasmic production of 
fusion proteins with FOS at the N-terminus in E. coli. The gene of interest (g.o.i.) 
may be ligated into the Notl/EcoRV (or Notl/Hindlll) sites of the vector. The 
N-terminal methionine residue is proteolytically removed upon protein synthesis 
(Hirel etal.,Proc. Natl. Acad. Sci. USA 5(5:8247-8251 (1989)). 

5. pAV5 : This vector was designed for the eukaryotic production of 
fusion proteins with FOS at the C-terminus. The gene of interest (g.o.i.) may be 
inserted between the sequences coding for the hGH signal sequence and the FOS 
domain by ligation into the Eco47III/NotI sites of the vector. Alternatively, a 
gene containing its own signal sequence may be fused to the FOS coding region 
by ligation into the StuI/NotI sites. 



MSOOCIO: <WO_0032227A2_I_> 



WO 00/32227 



PCT/IB99/01925 



-32- 

6. pAV6 : This vector was designed for the eukaryotic production of 
fusion proteins with FOS at the N-terminus. The gene of interest (g.o.i.) may be 
ligated into the Notl/StuI (or Notl/Hindlll) sites of the vector. 

As will be understood by those skilled in the art, the construction of a 
F05-antigen or -antigenic determinant fusion protein may include the addition of 
certain genetic elements to facilitate production of the recombinant protein. 
Example 4 provides guidance for the addition of certain E. coli regulatory 
elements for translation, and Example 7 provides guidance for the addition of a 
eukaryotic signal sequence. Other genetic elements may be selected, depending 
on the specific needs of the practioner. 

The invention is also seen to include the production of the FOS-antigen 
or FOS-antigenic determinant fusion protein either in bacterial (Example 5) or 
eukaryotic cells (Example 8). The choice of which cell type in which to express 
the fusion protein is within the knowledge of the skilled artisan, depending on 
factors such as whether post-translational modifications are an important 
consideration in the design of the composition. 

As noted previously, the invention discloses various methods for the 
construction of a F05-antigen or FOS-antigenic determinant fusion protein 
through the use of the pAV vectors. In addition to enabling prokaryotic and 
eukaryotic expression, these vectors allow the practitioner to choose between - 
and C- terminal addition to the antigen of the FOS leucine zipper protein domain. 
Specific examples are provided wherein - and C- terminal FOS fusions are made 
to PLA (Example 9) and ovalbumin (Example 1 0). Example 1 1 demonstrates the 
purification of the PLA and ovalbumin FOS fusion proteins. 

In a most specific embodiment, the invention is drawn to an antigen or 
antigenic determinant encoded by the HIV genome. More specifically, the HIV 
antigen is gp 1 40. As provided for in Examples 11-15, HIV gp 1 40 may be created 
with a FOS leucine zipper protein domain and the fusion protein synthesized and 
purified for attachment to the non-natural molecular scaffold of the invention. As 



WO 00/32227 



PCT/IB99/0I925 



-33- 

one skilled in the art would know, other HIV antigens or antigenic determinants 
may be used in the creation of a composition of the invention. 

In a most specific embodiment of the invention, the second attachment 
site selected is a cysteine residue, which associates specifically with a lysine 
residue of the non-natural molecular scaffold of the invention. The chemical 
linkage of the lysine residue (Lys) and cysteine residue (Cys) provides a basis for 
the formation of an organized and repetitive antigen or antigenic determinant 
array on the surface of the scaffold. The cysteine residue may be engineered in 
frame to the antigen or antigenic determinant of choice at either the amino 
terminus, carboxyl terminus or internally located in the protein if desired. By way 
of example, PL A and HIV gpl40 are provided with a cysteine residue for linkage 
to a lysine residue first attachment site. 

C Preparation of the AlphaVaccine Particles 

The invention provides novel compositions and methods for the 
construction of ordered and repetitive antigen arrays. As one of skill in the art 
would know, the conditions for the assembly of the ordered and repetitive antigen 
array depend to a large extent on the specific choice of the first attachment site 
of the non-natural scaffold and the specific choice of the second attachment site 
of the antigen or antigenic determinant. Thus, practitioner choice in the design 
of the composition (/. e. , selection of the first and second attachment sites, antigen 
and non-natural scaffold) will determine the specific conditions for the assembly 
of the AlphaVaccine particle (the ordered and repetitive antigen array and non- 
natural molecular scaffold combined). Information relating to assembly of the 
AlphaVaccine particle is well within the working knowledge of the practitioner, 
and numerous references exist to aid the practitioner {e.g., Sambrook, J. et al. 9 
eds., Molecular Cloning, A Laboratory Manual, 2nd. edition, Cold Spring 
Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989); Ausubel, F. et al. 9 
eds., Current Protocols in Molecular Biology, John H. Wiley & Sons, Inc. 



WO 00/32227 



PCT/IB99/01925 



-34- 

(1997); Celis, J., ed. ? CELL BIOLGY, Academic Press. 2 nd edition, (1998); 
Harlow, E. and Lane, D., "Antibodies: A Laboratory Manual/' Cold Spring 
Harbor Laboratory, Cold Spring Harbor, N.Y. (1988), all of which are 
incorporated herein by reference. 

In a specific embodiment of the invention, the JUN and FOS leucine 
zipper protein domains are utilized for the first and second attachment sites of the 
invention, respectively. In the preparation of AlphaVaccine particles, antigen 
must be produced and purified under conditions to promote assembly of the 
ordered and repetitive antigen array onto the non-natural scaffold. In the 
particular JUN/FOS leucine zipper protein domain embodiment, the FOS-antigen 
or FOS-antigehic determinant should be treated with a reducing agent (e.g., 
Dithiothreitol (DTT)) to reduce or eliminate the incidence of disulfide bond 
formation (Example 1 5). 

For the preparation of the non-natural scaffold (i.e., recombinant Sinbis 
virus) of the JUN/FOS leucine zipper protein domain embodiment, recombinant 
E2-JUN viral particles should be concentrated, neutralized and treated with 
reducing agent (see Example 1 6). 

Assembly of the ordered and repetitive antigen array in the JUN/FOS 
embodiment is done in the presence of a redox shuffle. E2-JUN viral particles 
are combined with a 240 fold molar excess of F05-antigen or FOS-anti genie 
determinant for 10 hours at 4 Q C. Subsequently, the AlphaVaccine particle is 
concentrated and purified by chromatography (Example 16). 

In another embodiment of the invention, the coupling of the non-natural 
molecular scaffold to the antigen or antigenic determinant may be accomplished 
by chemical crosslinking. In a most preferred embodiment, the chemical agent 
is a hetero-bifunctional crosslinking agent such as €-maleimidocaproic acid N- 
hydroxysuccinimide ester (Tanimori et al, J. Pharm. Dyn. 4:812 (1981); 
Fujiwara et ai, J. Immunol. Meth 45:195 (1981), which contains (1) a 
succinimide group reactive with amino groups and (2) a maleimide group reactive 
with SH groups.. A heterologous protein or polypeptide of the first attachment 



WO 00/32227 



PCT/IB99/01925 



-35- 



site may be engineered to contain one or more lysine residues that will serve as 
a reactive moiety for the succinimide portion of the hetero-bifunctional 
crosslinking agent. Once chemically coupled to the first attachment sites of the 
non-natural molecular scaffold, the maleimide group of the hetero-bifunctional 
crosslinking agent will be available to react with the SH group of a cysteine 
residue on the antigen or antigenic determinant. Antigen or antigenic determinant 
preparation in this instance may require the engineering of a cysteine residue into 
the protein or polypeptide chosen as the second attachment site so that it may be 
reacted to the free maleimide function on the crosslinking agent bound to the non- 
natural molecular scaffold first attachment sites. 



Compositions, Vaccines, and the Administration Thereof, and Methods 
of Treatment 



In one embodiment, the invention provides vaccines for the prevention of 
infectious diseases in a wide range of species, particularly mammalian species 
such as human, monkey, cow, dog, cat, horse, pig, etc. Vaccines may be designed 
to treat infections of viral etiology such as HIV, influenza, Herpes, viral hepatitis, 
Epstein Bar, polio, viral encephalitis, measles, chicken pox, etc.; or infections of 
bacterial etiology such as pneumonia, tuberculosis, syphilis, etc.; or infections of 
parasitic etiology such as malaria, trypanosomiasis, leishmaniasis, trichomoniasis, 
amoebiasis, etc. 

In another embodiment, the invention provides vaccines for the 
prevention of cancer in a wide range of species, particularly mammalian species 
such as human, monkey, cow, dog, cat, horse, pig, etc. Vaccines may be designed 
to treat all types of cancer: lymphomas, carcinomas, sarcomas, melanomas, etc. 

In another embodiment of the invention, the compositions of the invention 
may be used in the design of vaccines for the treatment of allergies. Antibodies 
of the IgE isotype are important components in allergic reactions. Mast cells bind 
IgE antibodies on their surface and release histamines and other mediators of 
allergic response upon binding of specific antigen to the IgE molecules bound on 



0O32227A2_l_> 



WO 00/32227 



PCT/IB99/0I925 



-36~ 

the mast cell surface. Inhibiting production of IgE antibodies, therefore, is a 
promising target to protect against allergies. This should be possible by attaining 
a desired T helper cell response. T helper cell responses can be divided into type 
1 (T H 1) and type 2 (T H 2) T helper cell responses (Romagnani, Immunol Today 
75:263-266 (1997)). T H 1 cells secrete interferon-gamma and other cytokines 
which trigger B cells to produce IgG 1 -3 antibodies. In contrast, a critical cytokine 
produced by T H 2 cells is IL-4, which drived B cells to produce IgG4 and IgE. In 
many experimental systems, the development of T H 1 and T H 2 responses is 
mutually exclusive sinceT H l cells suppress the induction of T H 2 cells and vice 
versa. Thus, antigens that trigger a strong T H 1 response simultaneously suppress 
the development of T H 2 responses and hence the production of IgE antibodies. 
Interestingly, virtually all viruses induce a T H 1 response in the host and fail to 
trigger the production of IgE antibodies (Coutelier et al,J. Exp. Med J 65:64-69 
(1987)). This isotype pattern is not restricted to live viruses but has also been 
observed for inactivated or recombinant viral particles (Lo-Man et.al., Eur. J. 
Immunol 25:1401-1407 (1998)). Thus, by using the processes of the invention 
{e.g., AlphaVaccine Technology), viral particles can be decorated with various 
allergens and used for immunization. Due to the resulting "viral structure" of the 
allergen, a T H 1 response will be elicited, "protective" IgG 1-3 antibodies will be 
produced, and the production of IgE antibodies which cause allergic reactions will 
be prevented. Since the allergen is presented by viral particles which are 
recognized by a different set of helper T cells than the allergen itself, it is likely 
that the allergen-specific IgGl -3 antibodies will be induced even in allergic 
individuals harboring pre-existing T H 2 cells specific for the allergen. The 
presence of high concentrations of IgG antibodies may prevent binding of 
allergens to mast cell bound IgE, thereby inhibiting the release of histamine. 
Thus, presence of IgG antibodies may protect from IgE mediated allergic 
reactions. Typical substances causing allergies include: grass, ragweed, birch or 
mountain cedar pollens, house dust, mites, animal danders, mold, insect venom 
or drugs {e.g. penicillin). Thus, immunization of individuals with allergen- 



WO 00/32227 



PCT/IB99/0I925 



-37- 

decorated viral particles should be beneficial not only before but also after the 
onset of allergies. 

As would be understood by one of ordinary skill in the art, when the 
compositions of the invention are administered to an individual, they may be in 
a composition which contains salts, buffers, adjuvants, or other substances which 
are desirable for improving the efficacy of the composition. Examples of 
materials suitable for use in preparing pharmaceutical compositions are provided 
in numerous sources including Remington's Pharmaceutical Sciences (Osol, 
A, ed., Mack Publishing Co., (1 980)). 

The compositions of the invention are said to be "pharmacologically 
acceptable" if their administration can be tolerated by a recipient individual. 
Further, the compositions of the invention will be administered in a 
"therapeutically effective amount" (i.e., an amount that produces a desired 
physiological effect). 

The compositions of the present invention may be administered by various 
methods known in the art, but will normally be administered by injection, 
infusion, inhalation, oral administration, or other suitable physical methods. The 
compositions may alternatively be administered intramuscularly, intravenously, 
or subcutaneously. Components of compositions for administration include 
sterile aqueous (e.g., physiological saline) or non-aqueous solutions and 
suspensions. Examples of non-aqueous solvents are propylene glycol, 
polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters 
such as ethyl oleate. Carriers or occlusive dressings can be used to increase skin 
permeability and enhance antigen absorption. 

In addition to vaccine technologies, other embodiments of the invention 
are drawn to methods of medical treatment for cancer and allergies. 

All patents and publications referred to herein are expressly incorporated 
by reference. 



NSDOCIO: <WO 0032227 A2_l_> 



WO 00/32227 



PCT/IB99/01925 



-38- 
Examples 

Enzymes and reagents used in the experiments that follow included: T4 
DNA ligase obtained from New England Biolabs; Taq DNA Polymerase, 
QIAprep Spin Plasmid Kit, QIAGEN Plasmid Midi Kit, QiaExII Gel Extraction 
Kit, QIAquick PGR Purification Kit obtained from QIAGEN; QuickPrep Micro 
mRNA Purification Kit obtained from Pharmacia; Superscript One-step RTPCR 
Kit, fetal calf serum (FCS), bacto-tryptone and yeast extract obtained from Gibco 
BRL; Oligonucleotides obtained from Microsynth (Switzerland); restriction 
endonucleases obtained from Boehringer Mannheim, New England Biolabs or 
MBI Fermentas; Pwo polymerase and dNTPs obtained from Boehringer 
Mannheim. HP-1 medium was obtained from Cell culture technologies 
(Glattbrugg, Switzerland). All standard chemicals were obtained from 
Fluka-Sigma-Aldrich, and all cell culture materials were obtained from TPP. 

DNA manipulations were carried out using standard techniques. DNA 
was prepared according to manufacturer instruction either from a 2 ml bacterial 
culture using the QIAprep Spin Plasmid Kit or from a 50 ml culture using the 
QIAGEN Plasmid Midi Kit. For restriction enzyme digestion, DNA was 
incubated at least 2 hours with the appropriate restriction enzyme at a 
concentration of 5-10 units (U) enzyme per mg DNA under manufacturer 
recommended conditions (buffer and temperature). Digests with more than one 
enzyme were performed simultaneously if reaction conditions were appropriate 
for all enzymes, otherwise consecutively. DNA fragments isolated for further 
manipulations were separated by electrophoresis in a 0.7 to 1 .5% agarose gel, 
excised from the gel and purified with the QiaExII Gel Extraction Kit according 
to the instructions provided by the manufacturer. For ligation of DNA 
fragments, 1 00 to 200 pg of purified vector DNA were incubated overnight with 
a threefold molar excess of the insert fragment at 1 6°C in the presence of 1 U T4 
DNA ligase in the buffer provided by the manufacturer (total volume: 10-20 
An aliquot (0.1 to 0.5 \x\) of the ligation reaction was used for transformation of 



WO 00/32227 



PCT/IB99/0192S 



-39- 

E. coli XL 1 -Blue (Stratagene). Transformation was done by electroporation using 
a Gene Pulser (BioRAD) and 0. 1 cm Gene Pulser Cuvettes (BioRAD) at 200 Q, 
25 uF, 1.7 kV. After electroporation, the cells were incubated with shaking for 
1 h in 1 ml S.O.B. medium (Miller, 1 972) before plating on selective S.O.B. agar. 

Example 1: 

Insertion of the JUN amphiphatic helix domain within E2 
In the vector pTE5'2J (Hahn et al., Proc. Natl. Acad. Sci. USA 
59:2679-2683, (1992)), Mlul and a BstEU restriction enzyme sites were 
introduced between codons 71 (Gin) and 74 (Thr) of the structural protein E2 
coding sequence, resulting in vector pTES^JBM. Introduction of these 
restriction enzymes sites was done by PCR using the following oligonucleotides: 

Oligo 1: 

E2insBstEII/BssHII: 

5'-ggggACGCGTGCAGCAggtaaccaccgTTAAAGAAGGCACC-3' (SEQ ID 
NO:l) 

Oligo 2: 
E2insMIuIStuI: 

5 '-cggtggttaccTGCTGCACGCGTTGCTTAAGCGACATGTAGCGG-3 ' (SEC- 
ID NO:2) 

Oligo 3: 

E2insStuI: 5'-CCATGAGGCCTACGATACCC-3' (SEQ IDNO:3) 
OHgo4: 

E2insBssHII: 5'-GGCACTCACGGCGCGCTTTACAGGC-3' (SEQIDNO:4) 

For the PCR reaction, 1 00 pmol of each oligo was used with 5 ng of the 
template DNA in a 1 00 ul reaction mixture containing 4 units of Taq or Pwo 
polymerase, 0. 1 mM dNTPs and 1 .5 mM MgS0 4 . All DNA concentrations were 
determined photometrically using the GeneQuant apparatus (Pharmacia). 
Polymerase was added directly before starting the PCR reaction (starting point 
was 95 °C). Temperature cycling was done in the following manner and order: 
95 °C for 2 minutes; 5 cycles of 95 °C (45 seconds), 53 °C (60 seconds), 72 °C 



WO 00/32227 



PCT/IB99/01925 



-40- 



(80 seconds); and 25 cycles of 95 °C (45 seconds), 57°C (60 seconds), 72°C 
(80 seconds). 

The two PCR fragments were analyzed and purified by agarose 
gelelectrophoresis. Assembly PCR of the two PCR fragments using oligo 3 and 
5 4 for amplification was carried out to obtain the final construct. 

For the assembly PCR reaction, 100 pmol of each oligo was used with 
2 ng of the purified PCR fragments in a 100 p.1 reaction mixture containing 4 
units of Taq or Pwo polymerase, 0. 1 mM dNTPs and 1 .5 mM MgS0 4 . AH DNA 
concentrations were determined photometrically using the GeneQuant apparatus 

10 (Pharmacia). Polymerase was added directly before starting the PCR reaction 

(starting point was 95 °C). Temperature cycling was done in the following 
manner and order: 95°C for 2 minutes; 5 cycles of 95 °C (45 seconds), 57°C 
(60 seconds), 72 °C (90 seconds); and 25 cycles of 95 °C (45 seconds), 59°C 
(60 seconds), 72 °C (90 seconds). 

15 The final PCR product was purified using Qia spin PCR columns 

(Qiagen) and digested in an appropriate buffer using 1 0 units each of BssHII and 
StuI restriction endonucleases for 12 hours at 37°C. The DNA fragments were 
gel-purified and ligated into BssHII/Stul digested and gel-purified pTE5 '2J vector 
(Hahn et al.Proc. Natl. Acad Sci. USA 59:2679-2683). The correct insertion of 

20 the PCR product was first analyzed by BstEIl and Mlul restriction analysis and 

then by DNA sequencing of the PCR fragment. 

The DNA sequence coding for the JUN amphiphatic helix domain was 
PCR-amplified from vector pJuFo (Crameri and Suter, Gene J 57:69 (1993)) 
using the following oligonucleotides: 



25 Oligo 5: 

JUNBstEU: 

5 '-CCTTCTTTAAcggtggttaccTGCTGGCAACCAACGTGGTTCATGAC-3 ' 
(SEQ ID NO:5) 

Oligo 6: 

30 MluL/LW: 5'-AAGCATGCTGCacgcgtgTGCGGTGGTCGGATCGCCCGGC-3 ' 

(SEQ ID NO:6) 



BNSDOCID: <WO 0O32227A2_l_> 



WO 00/32227 



PCT/IB99/01925 



-41- 



For the PCR reaction, 100 pmol of each oligo was used with 5 ng of the 
template DNA in a 100 ul reaction mixture containing 4 units of Taq or Pwo 
polymerase, 0. 1 mM dNTPs and 1 .5 mM MgSO,. All DNA concentrations were 
determined photometrically using the GeneQuant apparatus (Pharmacia). 
Polymerase was added directly before starting the PCR reaction (starting point 
was 95 °C). Temperature cycling was done in the following order and manner: 
95°C for 2 minutes; 5 cycles of 95°C (45 seconds), 60°C (30 seconds), 72°C 
(25 seconds); and 25 cycles of 95 °C (45 seconds), 68°C (30 seconds), 72 °C 
(20 seconds). 

The final PCR product was gel-purified and ligated into EcoRV digested 
and gel-purified pBluescript II(KS ). From the resulting vector, the JUN sequence 
was isolated by cleavage with MluVBstEH purified with QiaExII and ligated into 
vector pTE5 v 2JBM (previously cut with the same restriction enzymes) to obtain 
the vector pTE5* 2J.E2JUN. 

Example 2: 

Production of viral particles containing E2-JVN using the pCYTts system 
The structural proteins were PCR amplified using pTE5'2J:E2JUN as 
template and the oligonucleotides XbalStruct 

(ctatcaTCTAGAATGAATAGAGGATTCTTTAAC) and StructBspl201 
(tcgaatGGGCCCTCATCTTCGTGTGCTAGTCAG). For the PCR lOOpmolof 
each loligo was used and 5 ng of the template DNA was used in the 100 ul 
reaction mixture, containing 4 units of Tac or Pwo polymerase, 0.1 mM dNTPs 
and 1 .5 mM MgS0 4 . All DNA concentrations were determined photometrically 
using the GeneQuant apparatus (Pharmacia). The polymerase was added directly 
before starting the PCR reaction (starting point was 95 °C). The temperature 
cycles were as follows: 95 °C for 3 minutes, followed by 5 cycles of 92 °C (30 
seconds), 54 °C (35 seconds), 72 °C (270 seconds) and followed by 25 cycles of 
92°C (30 seconds), 63°C (35 seconds), 72°C (270 seconds. The PCR product 
was gel purified and digested with the restriction enzymes Xbal/Bspl201 and 



WO 00/32227 



PCT/IB99/0I925 



-42- 

ligated into vector pC YTts previously cleaved with the same enzymes (US Patent 
Application Appl. No. 60/079,562; Filed March 27,1998) 

Twenty ng of pCYTtsE2:JT/A r were incubated with 30 U of Seal in an 
appropriate buffer for at least 4 hours at 37 °C. The reaction was stopped by 
phenol/chloroform extraction, followed by ah isopropanol precipitation of the 
linerized DNA. The restriction reaction was checked by agarose gel 
eletrophoresis. For the transfection, 5.4 jag of linearized pCYTtsE2u/LW was 
mixed with 0.6 \xg of linearized pSV2Neo in 30 ^1 H 2 0 and 30 ^1 of 1 M CaCl 2 
solution were added. After addition of 60 fj.1 phosphate buffer (50 mM HEPES, 
280 mM NaCl, 1.5 mM lv^ HP0 4 , pH 7.05), the solution was vortexed for 5 
seconds, followed by an incubation at room temperature for 25 seconds. The 
solution was immediately added to 2 ml HP-1 medium containing 2% FCS (2% 
FCS medium). The medium of an 80% confluent BHK21 cell culture in a 6-well 
plate was then replaced with the DNA containing medium. After an incubation 
for 5 hours at 37 °C in a C0 2 incubator, the DNA containing medium was 
removed and replaced by 2 ml of 1 5% glycerol in 2% FCS medium. The glycerol 
containing medium was removed after a 30 second incubation phase, and the cells 
were washed by rinsing with 5 ml of HP- 1 medium containing 1 0% FCS. Finally 
2 ml of fresh HP-1 medium containing 10% FCS was added. 

Stably transfected cells were selected and grown in selection medium 
(HP-1 medium > supplementedwithG418)at37°CinaC0 2 incubator. Whenthe 
mixed population was grown to confluency, the culture was split to two dishes, 
followed by a 12 hours growth period at 37°C. One dish of the cells was shifted 
to 30 °C to induce the expression of the viral particles; the other dish was kept at 
37°C. 

The expression of viral particles was determined by Western blotting 
(Figure 1). Culture medium (0.5 ml) was methanol/chloroform precipitated, and 
the pellet was resuspended in SDS-PAGE sample buffer. Samples were heated 
for 5 minutes at 95°C before being applied to 15% acrylamide gel. After 
SDS-PAGE, proteins were transferred to Protan nitrocellulose membranes 



WO 00/32227 PCT/IB99/01925 

-43- 



(Schleicher & Schuell, Germany) as described by Bass and Yang, in Creighton, 
T.E., ed., Protein Function: A Practical Approach, 2nd Edn., IRL Press, Oxford 
( 1 997), pp. 29-55. The membrane was blocked with 1 % bovine albumin (Sigma) 
in TBS ( 1 OxTBS per liter: 87.7 g NaCl, 66. 1 g Trizma hydrochloride (Sigma) and 
9.7 g Trizma base (Sigma), pH 7.4) for 1 hour at room temperature, followed by 
an incubation with an anti-El /E2anti body (polyclonal serum) for 1 hour. The blot 
was washed 3 times for 1 0 minutes with TBS-T (TBS with 0.05% Tween20), and 
incubated for 1 hour with an alkaline-phosphatase-anti-rabbit IgG conjugate (0.1 
ug/ml, Amersham Life Science, England). After washing 2 times for 1 0 minutes 
with TBS-T and 2 times for 1 0 minutes with TBS, the development reaction was 
carried out using alkaline phosphatase detection reagents (10 ml AP buffer (100 
mM Tris/HCl, 1 00 mM NaCl, pH 9.5) with 50 ul NBT solution (7.7% Nitro Blue 
Tetrazolium (Sigma) in 70% dimethylformamide) and 37 ul of X-Phosphate 
solution (5% of 5-bromo-4-chloro-3-indolyl phosphate in dimethylformamide). 

The production of viral particles is shown in Figure 1 . The Western Blot 
pattern showed that E2-JUN (lane 1) migrated to a higher molecular weight in 
SDS-PAGE compared to wild type E2 (lane 2) and the BHK21 host cell line did 
not show any background. 

Example 3: 

Production of viral particles containing E2-JUN 
using the pTES UE2.JUN vector 

RNase-free vector (1.0 ug) was linerarized by Pvul digestion. 

Subsequently, in vitro transcription was carried out using an SP6 in vitro 

transcription kit (InvitroscripCAP by InvitroGen, Invitrogen BV, NV Leek, 

Netherlands). The resulting 5 '-capped mRNA was analyzed on a reducing 

agarose-gel. 

In vitro transcribed mRNA (5 ug) was electroporated into BHK 21 cells 
(ATCC: CCL10) according to Invitrogen's manual (Sindbis Expression system, 
Invitrogen BV, Netherlands). After 10 hours incubation at 37°C, the FCS 
containing medium was exchanged by HP-1 medium without FCS, followed by 



WO 00/32227 



PCT/IB99/01925 



an additional incubation at 37°C for 10 hours. The supernatant was harvested 
and analyzed by Western blot analysis for production of viral particles exactly as 
described in Example 2. 

The obtained result was identical to the one obtained with pC YTtsE2: J UN 
as shown in Figure 2. 

Example 4: 

Fusion of human growth hormone (ItGH) to the FOS leucine 
zipper domain (OmpA signal sequence) 

The hGH gene without the human leader sequence was amplified from the 
original plasmid (ATCC 31389) by PCR. Oligo 7 with an internal Xbal site was 
designed for annealing at the 5' end of the hGH gene, and oligo 9 with an internal 
EcoRI site primed at the 3 ' end of the hGH gene. For the PCR reaction, 1 00 pmol 
of each oligo and 5 ng of the template DNA was used in the 75 \x\ reaction 
mixture (4 units of Taq or Pwo polymerase, 0. 1 mM dNTPs and 1 .5 mM MgS0 4 ). 

PCR cycling was performed in the following manner: 30 cycles with an 
annealing temperature of 60 °C and an elongation time of 1 minute at 72 °C. 

The gel purified and isolated PCR product was used as a template for a 
second PCR reaction to introduce the ompA signal sequence and the 
Shine-Dalgarno sequence. For the PCR reaction, 1 00 pmol of oligo 8 and 9 and 
1 ng of the template PCR fragment was used in the 75 \x\ reaction mixture (4 units 
of Taq or Pwo polymerase, 0. 1 mM dNTPs and 1 .5 mM MgS0 4 ). The annealing 
temperature for the first five cycles was 55 °C with an elongation time of 60 
seconds at 72 °C; another 25 cycles were performed with an annealing 
temperature of 65 °C and an elongation time of 60 seconds at 72°C. 

Oligo 7: 

gggtctagattcccaaccattcccttatccaggctttttgacaacgctatgctccgcgcccatcgtctgcaccagct 
ggcctttgacacc (SEQ ID NO:7) 
Ol igo 8: 



WO 00/32227 PCT/1B99/0192S 



gggtctagaaggaggtaaaaaacgatgaaaaagacagctatcgcgattgcagtggcactggctggtttcgctac 
cgtagcgcaggccttcccaaccattcccttatcc (SEQ ID NO: 8) 
Oligo 9: 

cccgaattcctagaagccacagctgccctcc (SEQ ID NO: 9) 

The resulting recombinant hGH gene was subcloned into pBluescript via 
Xbal/EcoRI. The correct sequence of both strands was confirmed by DNA 
sequencing. 

The DNA sequence coding for the FOS amphiphatic helix domain was 
PCR-ampIified from vector pJuFo (Crameri & Suter Gene 1 37:69 (1993)) using 
the oligonucleotides: 
omp-FOS: 

5'- ccTGCGGTGGTCTGACCGAC ACCC-3 ' (SEQ ID NO: 10) 
FOS-hgh: 

5'- ccgcggaagagccaccGCAACCACCGTGTGCCGCCAGGATG-3' (SEQ ID 
NO:ll) 

For the PCR reaction, 100 pmol of each oligo and 5 ng of the template 
DNA was used in the 75 ul reaction mixture (4 units of Taq or Pwo polymerase, 
0.1 mM dNTPs and 1.5 mM MgSQ,). The temperature cycles were as follows: 

95 °C for 2 minutes, followed by 5 cycles of 95 °C (45 seconds), 60°C 
(30 seconds), 72°C (25 seconds) and followed by 25 cycles of 95 °C (45 seconds), 
68 °C (30 seconds), 72 °C (20 seconds). 

The PCR product was purified, isolated and cloned into the StuI digested 
pBluescript-ompA-hGH. The hybrid gene was then cloned into the pKK223-3 
Plasmid (Pharmacia). 

Example 5: 
Bacterial expression of FOS-hGH 

The ompA-FOS-hGH in pkk223-3 was expressed under the control of the 

inducible IPTG-dependend promoter using JM101 as E. coli host strain. 

Expression was performed in shaker flask. Cells were induced with 1 mM IPTG 



0032227 A2_l_> 



WO 00/32227 



PCT/IB99/01925 



-46- 

(final concentration) at an OD600 of 0.5. Expression was continued for 10 hours 
at 37°C Cells were harvested by centrifugation at 3600 at 1 0°C for 1 5 min. The 
cell pellet was frozen (-20°C or liq. N 2 ) and stored for 16 hours. The pellet was 
then thawed at 4°C and resuspended in 10 ml 10 mM Tris-HCl, pH 7.4 
containing 600 mM sucrose. After stirring for 15 min at 4°C, periplasmic 
proteins were released by an osmotic shock procedure. Chilled (4°C) deionized 
H 2 0 was added, and the suspension was stirred for 30 min at 4°C. The sludge 
was diluted, resuspended, and lysozyme was added to degrade the cell wall of the 
bacteria. The cells and the periplasmic fraction spheroplasts were separated by 
centrifugation for 20 min at 11000 g at 4°C. The FOS-hGH-containing 
supernatant was analyzed by reducing and non-reducing SDS-Page and Dot Blot. 
Dot Blot was carried out as described in Example 8, using an anti-hGH antibody 
(Sigma) as the first antibody and an alkaline phosphatase (AP)-anti-mouse 
antibody conjugate as the second antibody. 

Full length, correctly processed FOS-hGH could be detected under 
reducing and non-reducing conditions. Part of FOS-hGH was bound to other, 
non-identified proteins due to the free cysteines present in the FOS amphiphatic 
helix. However, more than 50% of expressed FOS-hGH occurred in its native 
monomeric conformation ( Figure 3). 

Purified FOS-hGH will be used to perform first doping experiments with 
JUN containing viral particles. 

Example 6: 

Construction of the pA V vector series for expression of FOS fusion proteins 
A versatile vector system was constructed that allowed either cytplasmic 
production or secretion of — or C-terminal FOS fusion proteins in E. coli or 
production of - or C-terminal FOS fusion proteins in eukaryotic cells. The 
vectors pAV 1 - pAV4 which was designed for production of FOS fusion proteins 
in £. coli y encompasses the DNA cassettes listed below, which contain the 
following genetic elements arranged in different orders: (a) a strong ribosome 
binding site and 5* -untranslated region derived from the E. coli ompA gene 



WO 00/32227 



PCT/IB99/0192S 



-47- 



(aggaggtaaaaaacg) (SEQ ID NO: 1 3); (b) a sequence encoding the signal peptide 
of E. coli outer membrane protein OmpA (MKKTAIAIAVALAGFATVAQA) 
(SEQ ID NO: 1 4); (c) a sequence coding for the FOSdimerization domain flanked 
on both sides by two glycine residues and a cystein residue 

(CGGLTDTLQAETDQVEDEKSALQTEIANLLKEKEKLEFILAAHGGC) 
(SEQ ID NO: 15); and (d) a region encoding a short peptidic linker (AAASGG 
(SEQ ID NO:16) or GGSAAA (SEQ ID NO: 17)) connecting the protein of 
interest to the FOS dimerization domain. Relevant coding regions are given in 
upper case letters. The arrangement of restriction cleavage sites allows easy 
construction of FOS fusion genes with or without a signal sequence. The 
cassettes are cloned into the EcoRI/HindlH restriction sites of expression vector 
pKK223-3 (Pharmacia) for expression of the fusion genes under control of the 
strong tac promotor. 

pAVI 

This vector was designed for the secretion of fusion proteins with FOS at 
the C-terminus into the E. coli periplasmic space. The gene of interest (g.o.i.) 
may be ligated into the StuI/NotI sites of the vector. 



ecori 31/11 

qaa ttC - 339 a 99 taa aaa ac 9 AT G AAA AAG ACA GCT ATC GCG ATT GCA GTG GCA CTG GCT 

M K K T A I A I A V A L A 



NotI 



61/21 stul 

GGT TTC GCT ACC GTA GCG CAG GCC tgg gtg ggg GCG GCC GCT TCT GGT GGT TGC GGT GGT 
GFATVAQA (goi) AAAS GGCGG 

121/41 151/S1 

CTG ACC GAC ACC CTG CAG GCG GAA ACC GAC CAG GTG GAA GAC GAA AAA TCC GCG CTG CAA 
LTDTLOAETDQVEDEKSALQ 

181/61 211/71 

ACC GAA ATC GCG AAC CTG CTG AAA GAA AAA GAA AAG CTG GAG TTC ATC CTG GCG GCA CAC 
T - IA NLLK EKEKLEFILAAH 
241/81 Hindlll 

GGT GGT TGC t aa oct r (SEQ ID NO: 18) 

G 6 c . A (SEQIDNO:19) 



0032227A2_I_> 



WO 00/32227 



PCT/1B99/01925 



-48- 



pAV2 

This vector was designed for the secretion of fusion proteins with FOS at 
the N-terminus into the E, coli periplasmic space. The gene of interest (g.o.i.) 
ligated into the Notl/EcoRV (or Notl/Hindlll) sites of the vector. 



5 EcoRI 31/11 

qaa ttc agg agg taa aaa a eg ATG AAA AAG ACA GCT ATC GCG ATT GCA GTG GCA CTG GCT 

MKKTAIAI A V A L A 

61/21 StuI 91/31 

GGT TTC GCT ACC GTA GCG CAG GCC T GC GGT GGT CTG ACC GAC ACC CTG CAG GCG GAA ACC 
10 G PATVAQACGGLTDT LQA .ET 

121/41 151/51 

GAC CAG GTG GAA GAC GAA AAA TCC GCG CTG CAA ACC GAA ATC GCG AAC CTG CTG AAA GAA 
DQVEDEKSALQTEIANL1.KE 

181/61 211/71 NotI 

15 AAA GAA AAG CTG GAG TTC ATC CTG GCG GCA CAC GGT GGT TGC GGT GGT TCT GCG GCC GC T 

KEKLEFILAAHGGCG GSAAA 

241/81 EcoRV Hindlll 

ggg tgt ggg gat ate aag ctt (SEQ ID NO:20) 

(goi> (SEQIDNO:21) 
20 pAV3 

This vector was designed for the cytoplasmic production of fusion 
proteins with FOS at the C-terminus in E. coli. The gene of interest (g.o.i.) may 
be ligated into the EcoRV/NotI sites of the vector. 



25 



EcoRI EcoRV NotI 

qaa ttc agg agg taa aaa aat ate ggg tgt ggg GCG GCC GC T TCT GGT GGT TGC GGT GGT 

(goi) AAASGGCGG 

€1/21 91/31 

CTG ACC GAC ACC CTG CAG GCG GAA ACC GAC CAG GTG GAA GAC GAA AAA TCC GCG CTG CAA 
LTDTLQAETDQVEDE KSALQ 

30 121/41 151/51 

ACC GAA ATC GCG AAC CTG CTG AAA GAA AAA GAA AAG CTG GAG TTC ATC CTG GCG GCA CAC 
TE I A NLLKEKEKLE F I LAAH 

181/61 Hindlll 

GGT GGT TGC t aa get t (SEQ ID NO:22) 

35 g g c * (SEQIDNO:23) 



BNSOOC1D: <WO 0032227A2_I_> 



WO 00/32227 



PCT/IB99/01925 



-49- 



pAV4 

This vector is designed for the cytoplasmic production of fusion proteins 
with FOS at the N-terminus in E. colt. The gene of interest (g.o.i.) may be ligated 
into the Notl/EcoRV (or Notl/HindlH) sites of the vector. The N-terminal 
5 methionine residue is proteolytically removed upon protein synthesis (Hirel et al, 

Proc. Natl. Acad. Sci. USA 5^:8247-8251 (1989)). 

EcoRI 31/11 

ttc a 99 a 99 taa aaa a cg ATG GCT TGC GGT GGT CTG ACC GAC ACC CTG CAG GCG GAA 
EFRR *KTMACGGLTDTLQAE 

10 61/21 91/31 

ACC GAC CAG GTG GAA GAC GAA AAA TCC GCG CTG CAA ACC GAA ATC GCG AAC CTG CTG AAA 
TDQVEDEKSALQTEIANLLK 

lfl/41 a51/51 WotJ 
, xr GAA AAA GAA AAG CTG GAG TTC ATC CTG GCG GCA CAC GGT GGT TGC GGT GGT TCT GCG GCC 
lJ EK EKLEFILAAHGGCGGS A A~~ 

181/61 EcoRV Hindlll 

GCT ggg tgt ggg gat ate aaq ctt (SEQ ID NO:24) 

A <9°i) (SEQ IDNO:25) 



25 



The vectors pAV5 and pAV6, which are designed for eukaryotic 
20 production of FOS fusion proteins, encompasses the following genetic elements 

arranged in different orders: (a) a region coding for the leader peptide of human 
growth hormone (MATGSRTSLLLAFGLLCLPWLQEGSA) (SEQ ID NO:26); 

(b) a sequence coding for the FOSdimerization domain flanked on both sides by 
two glycine residues and a cysteine residue 

(CGGLTDTLQAETDQVEDEKSALQTEIANLLKEKEKLEFILAAHGGC) 
(SEQ ID NO: 15); and 

(c) a region encoding a short peptidic linker (AAASGG (SEQ ID NO: 16) or 
GGSAAA (SEQ ID NO: 17)) connecting the protein of interest to the FOS 
dimerization domain. Relevant coding regions are given in upper case letters. 
The arrangement of restriction cleavage sites allows easy construction of FOS 
fusion genes. The cassettes are cloned into the EcoRI/Hindlll restriction sites of 
the expression vector pMPSVEH (Artelt et al, Gene 65:213-219 (1988)). 



30 



INSDOCIO <WO 0032227A2_I_> 



WO 00/32227 



PCT/IB99/01925 



-so- 



lo 



pAV5 

This vector is designed for the eukaryotic production of fusion proteins 
with FOS at the C-terminus. The gene of interest (g.o.i.) may be inserted between 
the sequences coding for the hGH signal sequence and the FOS domain by 
ligation into the Eco47III/NotI sites of the vector. Alternatively, a gene 
containing its own signal sequence may be fused to the FOS coding region by 
ligation into the StuI/NotI sites. 



EcoRI StuI 31/11 

qaa ttc aqq cct ATG GCT ACA GGC TCC CGG ACG TCC CTG CTC CTG GCT TTT GGC CTG CTC 
MATGSRT SLLLAFGLL 

61/21 Eco47III NotI 

TGC CTG CCC TGG CTT CAA GAG GGC AGC GCT ggg tgt ggg GCG GCC GC T TCT GGT GGT TGC 
CLPWLQEGSA (goi) A A A S G G C 

121/41 151/51 

GGT GGT CTG ACC GAC ACC CTG CAG GCG GAA ACC GAC CAG GTG GAA GAC GAA AAA TCC GCG 
GGLTDTLQAETDQVEDEK SA 

181/61 211/71 

CTG CAA ACC GAA ATC GCG AAC CTG CTG AAA GAA AAA GAA AAG CTG GAG TTC ATC CTG GCG 
LQTEIANLbKEKEKLEFlLA 

20 241/81 Hindlll 

GCA CAC GGT GGT TGC t aa get t (SEQ ID NO:27) 

a h g g c * (SEQlDNO:28) 
pAV6 

This vector is designed for the eukaryotic production of fusion proteins 
25 with FOS at the N-terminus. The gene of interest (g.o.i.) may be ligated into the 

Notl/StuI (or N6tI/HindIII) sites of the vector. 



EcoRI 31/11 

qaa ttc ATG GCT ACA GGC TCC CGG ACG TCC CTG CTC CTG GCT TTT GGC CTG CTC TGC CTG 
MATGSRTSLLLAFGLLCL 



15 



30 



35 



61/21 EC047III 91/31 

CCC TGG CTT CAA GAG GGC AGC GCT TGC GGT GGT CTG ACC GAC ACC CTG CAG GCG GAA ACC 
PWLQEGSACGGLTDTLQAET 

121/41 151/51 

GAC CAG GTG GAA GAC GAA AAA TCC GCG CTG CAA ACC GAA ATC GCG AAC CTG CTG AAA GAA 
DQVEDEKSALQTE I A N L L K E 



BNSDOCia <WO 0032227A2_L> 



WO 00/32227 



PCT/IB99/0I925 



-51- 

181/51 211/71 NotI 

AAA GAA AAG CTG GAG TTC ATC CTG GCG GCA CAC GGT GGT TGC GGT GGT TCT GCG GCC GC T 

K EKLEFILAAHGGCGGSAAA 

241/81 StuI Hindlll 

939 tgt ggs aqq cct aaq ctt (SEQ ID NO:29) 

(goi) (SEQIDNO:30) 
Construction of expression vectors pA VI -pA V6 

The following oligonucleotides have been synthesized for construction of 
expression vectors pAVl - pAV6: 
FOS-FOR1: 

CCTGGGTGGGGGCGGCCGCTTGTGGTGGTTGCGGTGGTCTGACC (SEQ 
IDNO:31); 

FOS-FOR2: 

GGTGGGAATTCAGGAGGTAAAAAGATATCGGGTGTGGGGCGGCC 
(SEQ ID NO:32); 

FOS-FOR3: 

GGTGGGAATTCAGGAGGTAAAAAACGATGGCTTGCGGTGGTCTGACC 
(SEQ ID NO:33); 

FOS-FOR4: 

GCTTGCGGTGGTCTGACC (SEQ ID NO:34); 
FOS-REVl: 

CCACCAAGCTTAGCAACCACCGTGTGC (SEQ ID NO:35); 
FOS-REV2: 

CCACCAAGCTTGATATCCCCACACCCAGCGGCCGCAGAACCACCGC 
AACCACCG (SEQ ID NO:36); 

FOS-REV3: 

CCACCAAGCTTAGGCCTCCCAGACCCAGCGGC (SEQ ID NO:37); 
OmpA-FORl: 

GGTGGGAATTCAGGAGGTAAAAAACGATG (SEQ ID NO:38); 
hGH-FORl: 



WO 00/32227 



PCT/IB99/01925 



-52- 

GGTGGGAATTCAGGCCTATGGCTACAGGCTCC (SEQ ID NO:39); and 
hGH-FOR2: 

GGTGGGAATTCATGGCTACAGGCTCCC (SEQ ID NO:40). 

For the construction of vector pAV2 3 the regions coding for the OmpA 
signal sequence and the FOS domain were amplified from the ompA-FOS-hGH 
fusion gene in vector pKK223-3 (see Example 5) using the primer pair 
OmpA-FORl/ FOS-REV2. The PCR product was digested with EcoRI/Hindlll 
and ligated into the same sites of vector pKK223-3 (Pharmacia). 

For the construction of vector pAVl, the FOS coding region was 
amplified from the ompA-FOS-hGH fusion gene in vector pKK223-3 (see 
Example 5) using the primer pair FOS-FOR 1 / FOS-REV 1 . The PCR product was 
digested with Hindlll and ligated into Stul/Hindlll digested vector pAV2. 

For the construction of vector pAV3, the region coding for the FOS 
domain was amplified from vector pAVl using the primer pair 
FOS-FOR2/FOS-REV 1 . The PCR product was digested with EcoRI/Hindlll and 
ligated into the same sites of the vector pKK223-3 (Pharmacia). 

For the construction of vector pAV4, the region coding for the FOS 
domain was amplified from the ompA-FOS-hGH fusion gene in vector 
pKK223-3 (see Example 5) using the primer pair FOS-FOR3/FOS-REV2. The 
PCR product was digested with EcoRI/Hindlll and ligated into the same sites of 
the vector pKK223-3 (Pharmacia). 

For the construction of vector pA V5, the region coding for the hGH signal 
sequence is amplified from the hGHkFOS'-hGH fusion gene in vector pSINrepS 
(see Example 7) using the primer pair hGH-FOR 1 /hGHREV 1 . The PCR product 
is digested with EcoRI/NotI and ligated into the same sites of the vector pAVl . 
The resulting cassette encoding the hGH signal sequence and the FOS domain is 
then isolated by EcoRI/Hindlll digestion and cloned into vector pMPSVEH 
(Artelt et al, Gene 65:213-219 (1988)) digested with the same enzymes. 



BNSDOCID: <WO 0002227A2_I_> 



WO 00/32227 



PCT/IB99/01925 



-53- 

For the construction of vector pA V6, the FOS coding region is amplified 
from vector pAV2 using the primer pair FOS-FOR4/FOSKEV3. The PCR 
product is digested with HindlH and cloned into Eco47III/HindIII cleaved vector 
pAV5. The entire cassette encoding the hGH signal sequence and the FOS 
domain is then reamplified from the resulting vector using the primer pair 
hGH-FOR2/FOSREV3, cleaved with EcoRJ/Hindlll and ligated into vector 
pMPSVEH (Artelt et al y Gene 65:213-219 (1988)) cleaved with the same 
enzymes. 

Example 7: 

Construction ofFOS-hGH with human (hGH) signal sequence 
For eukaryotic expression of the FOS-hGH fusion protein, the 
OmpA-FOS-hGH fusion gene was isolated from pBluescript::OmpA-FOS'-hGH 
(see Example 4) by digestion with Xbal/Bsp 1 201 and cloned into vector pSINrepS 
(Invitrogen) cleaved with the same enzymes. The hGH signal sequence was 
synthesized by PCR (reaction mix: 50 pmol of each primer, dATP, dGTP, dTTP, 
dCTP (200 [iM each), 2.5 U Taq DNA polymerase (Qiagen), 50 \xl total volume 
in the buffer supplied by the manufacturer; amplification: 92 °C for 30 seconds, 
55 °C for 30 seconds, 72 °C for 30 seconds, 30 cycles) using the overlapping 
oligonucleotides Sig-hGH-FOR 

(GGGTCTAGAATGGCTACAGGCTCCCGGACGTCCCTGCTCCTGGCTT 
TTG G CCTG CTCTG) (SEQ ID NO:41) and Sig-hGH-REV 

(CGCAGGCCTCGGCACTGCCCTCTTGAAGCCAGGGCAGGCAGAGCA 
GGCCAAAAGCCAG) (SEQ ID NO:42). The PCR product was purified using 
the QiaExII Kit, digested with Stul/Xbal and ligated into vector 
pSINrep5::OmpA-FOS-hGH cleaved with the same enzymes. 



0032227A2_t_> 



WO 00/32227 



PCI7IB99/01925 



-54- 

Example 8: 
Eukaryotic expression of FOS-hGH 

RNase-free vector (1 .0 ^ig) (pSINrep5::OmpA-FOS-hGH) and 1 .0 |ig of 
DHEB (Bredenbeek et ah, J. Virol 67:6429-6446 (1993)) were linerarized by 
Seal restriction digest. Subsequently, in vitro transcription was carried out using 
an SP6 in vitro transcription kit (InvitroscripCAP by InvitroGen, Invitrogen BV, 
NV Leek, Netherlands). The resulting 5 '-capped mRNA was analyzed on 
reducing agarose-gel. 

In vitro, transcribed mRNA 5 fig was electroporated into BHK 21 cells 
(ATCC; CCL10) according to Invitrogen's manual (Sindbis Expression system, 
Invitrogen BV, Netherlands). After 10 hours incubation at 37°C the FCS 
containing medium was exchanged by HP-1 medium without FCS, followed by 
an additional incubation at 37°C for 10 hours. The supernatant was harvested 
and analyzed by dot-blot analysis for production of FOS-hgh. 

Culture media (2.5 \x\) was spotted on a nitrocellulose membrane and 
dried for 1 0 minutes at room temperature. The membrane was blocked with 1 % 
bovine albumin (Sigma) in TBS (lOxTBS per liter: 87.7 g NaCI, 66. lg Trizma 
hydrochloride (Sigma) and 9.7 g Trizma base (Sigma), pH 7.4) for 1 hour at room 
temperature, followed by an incubation with 2 *ig rabbit anti-human hGH 
antibody (Sigma) in 10 ml TBS-T (TBS with 0.05% Tween20) for 1 hour. The 
blot was washed 3 times for 10 minutes with TBS-T and incubated for 1 hour 
with alkaline phosphatase conjugated anti-rabbit IgG (Jackson ImmunoResearch 
Laboratories, Inc.) diluted 1:5000 in TBS-T. After washing 2 times for 10 
minutes with TBS-T and 2 times for 10 minutes with TBS, the blot was 
developed by AP staining as described in Example 2. Results are shown in 
Figure 3. 



WO 00/32227 



PCT/IB99/0I925 



-55- 



Example 9: 

Construction ofFOS-PLA (N- and C-terminal) 
The following gene is constructed by chemical gene synthesis coding for 
a catalytically inactive variant (Forster et al, J. Allergy Clin. Immunol. 95: 
1229-1235 (1995)) of bee venom phospholipase A 2 (PLA). 

31/11 

ATC ATC TAC CCA GGT ACT CTG TGG TGT GGT CAC GGC AAC AAA TCT TCT GGT CCG AAC GAA 
II YPGT LWCGHGNKSSGPNE 

61 ' 21 91/31 

CTC GGC CGC TTT AAA CAC ACC GAC GCA TGC TGT CGC ACC CAG GAC ATG TGT CCG GAC GTC 
LGRFKHTD ACCRTQD MCPDV 

121/41 151/51 

ATG TCT GCT GGT GAA TCT AAA CAC GGG TTA ACT AAC ACC GCT TCT CAC ACG CGT CTC AGC 
MSAGESKHGLTNTAS HTRLS 

15 181/61 



10 



25 



30 



35 



TGC GAC TGC GAC GAC AAA TTC TAC GAC TGC CTT AAG AAC TCC GCC GAT ACC ATC TCT TCT 
CDCDDKFYDCLKNSADT I S S 

241/81 271/91 

TAC TTC GTT GGT AAA ATG TAT TTC AAC CTG ATC GAT ACC AAA TGT TAC AAA CTG GAA CAC 
YFVGKMYFNLIDTKCYKIjEH 

301/101 331/111 

CCG GTA ACC GGC TGC GGC GAA CGT ACC GAA GGT CGC TGC CTG CAC TAC ACC GTT GAC AAA 
PVTGCGERTEGRCLHYTVDK 

361/121 391/131 

TCT AAA CCG AAA GTT TAC CAG TGG TTC GAC CTG CGC AAA TAC (SEQ ID NO:43) 

skpkvy « w pdlrky (SEQIDNO:44) 

For fusion of PLA to the N-teiminus of the FOS dimerization domain, the 
region is amplified using the oligonucleotides PLA-FOR1 
(CCATCATCTACCCAGGTAC) (SEQ ID NO:45) and PLA-REV1 
(CCCACACCCAGCGGCCGCGTATTTGCGCAGGTCG) (SEQ ID NO:46). 
The PCR product is cleaved with NotI and ligated into vector pAVl previously 
cleaved with the restriction enzymes Stul/Notl. For fusion of PLA to the 
C-terminus of the FOS dimerization domain, the region is amplified using the 
oligonucleotides PLA-FOR2 

(CGGTGGTTCTGCGGCCGCTATCATCTACCCAGGTAC) (SEQ ID NO:47) 
and PLA-REV2 (TT AGTATTTG CGC AG GTCG) (SEQ ID NO:47). The PCR 



3NSDOCID: <WO 0032227 A2J_> 



WO 00/32227 



PCT/IB99/01925 



-56- 

product is cleaved with NotI and ligated into vector pAV2 previously cleaved 
with the restriction enzymes Notl/EcoRV. 

Example 10: 

Construction of FOS-Ovalbumin fusion gene (N- and C-terminal) 
For cloning of the ovalbumin coding sequence, mRNA from chicken 
oviduct tissue is prepared using the QuickPrep™ Micro mRNA Purification Kit 
(Pharmacia) according to manufacturer instructions. Using the Superscript™ 
One-step RT PCR Kit (Gibco BRL), a cDNA encoding the mature part of 
ovalbumin (corresponding to nucleotides 68- 1 222 of the mRNA (McReynolds et 
al. 9 Nature 275:723-728 (1978)) is synthesized using the primers Ova-FORl 
(CCGGCTCCATCGGTGCAG) (SEQ ID NO:49) and Ova-REVl 
(ACCACCAGAAGCGGCCGCAGGGGAAACACATCTGCC) (SEQ ID 
NO:50). The PCR product is digested with NotI and cloned into StuI/NotI 
digested vector pAVl for expression of the fusion protein with the FOS 
dimerization domain at the C terminus. For production of a fusion protein with 
the FOS dimerization domain at the N terminus, the Ovalbumin coding region is 
amplified from the constructed vector (pA V 1 : :Ova) using the primers Ova-FOR2 
(CGGTGGTTCTGCGGCCGCTGGCTCCATCGGTGCAG) (SEQ ID NO:51) 
and Ova-REV2 (TTAAGGGGAAACACATCTGCC) (SEQ ID NO:52). The 
PCR product is digested with NotI and cloned into the Notl/EcoRV digested 
vector pAV2. Cloned fragments are verified by DNA sequence analysis. 

Example 11 

Production and purification ofFOS-PLA and 
FOS ovalbumin fusion proteins 

For cytoplasmic production of FOS fusion proteins, an appropriate E. coli 

strain was transformed with the vectors pA V3 : :PLA, pAV4 : :PLA, pAV3 : :Ova or 

pAV4::Ova. The culture was incubated in rich medium in the presence of 

ampicillin at 37°C with shaking. At an optical density (550nm) of 1 , 1 mM IPTG 

was added and incubation was continued for another 5 hours. The cells were 



WO 00/32227 



PCT/IB99/0I925 



-57- 



harvested by centrifugation, resuspended in an appropriate buffer (e.g. tris-HCl , 
pH 7.2, 150 mM NaCl) containing DNase, RNase and Iysozyme, and disrupted 
by passage through a french pressure cell. After centrifugation (Sorvall RC-5C, 
SS34 rotor, 15000 rpm, 10 min, 4°C), the pellet was resuspended in 25 ml 
inclusion body wash buffer (20 mM tris-HCl, 23% sucrose, 0.5% Triton X-100, 
1 mM EDTA, pH8) at 4°C and recentrifiiged as described above. This procedure 
was repeated until the supernatant after centrifugation was essentially clear. 
Inclusion bodies were resuspended in 20 ml solubilization buffer (5.5 M 
guanidinium hydrochloride, 25 mM tris-HCl, pH 7.5) at room temperature and 
insoluble material was removed by centrifugation and subsequent passage of the 
supernatant through a sterile filter (0.45 (am). The protein solution was kept at 
4 °C for at least 1 0 hours in the presence of 1 0 mM EDTA and 1 00 mM DTT and 
then dialyzed three times against 10 volumes of 5.5 M guanidinium 
hydrochloride, 25 mM tris-HCl, 1 0 mM EDTA, pH 6. The solution was dialyzed 
twice against 5 liters of 2 M urea, 4 mM EDTA, 0. 1 M NH 4 C1, 20 mM sodium 
borate (pH 8.3) in the presence of an appropriate redox shuffle (oxidized 
glutathione/reduced glutathione; cystine/cysteine). The refolded protein was then 
applied to an ion exchange chromatography. The protein was stored in an 
appropriate buffer with a pH above 7 in the presence of 2-10 mM DTT to keep 
the cysteine residues flanking the FOS domain in a reduced form. Prior to 
coupling of the protein with the alphavirus particles, DTT was removed by 
passage of the protein solution through a Sephadex G-25 gel filtration column. 

Example 12: 
Constructions of gpl40-FOS 

The gp]40 gene (Swiss-Prot:P03375) without the internal protease 

cleavage site was amplified by PCR from the original plasmid pAbT4674 (ATCC 

40829) containing the full length gpl60 gene using the following 

oligonucleotides: 



JNSDOCID; <WO 0032227A2_1_> 



WO 00/32227 



PCT/IB99/01925 



-58- 

HIV-1: 

5'-ACTAGTCTAGAatgagagtgaaggagaaatatc-3' (SEQ ID NO:53); 
HIV-end: 

5'-TAGCATGCTAGCACCGAAtttatctaattccaataattcttg-3' (SEQ IDNO:54); 
HIV-Cleav: 

5 '-gtagcacccaccaaggcaaagCTGA A AGCTACCC AGCTCG AG AAACTGgca-3 ' 

(SEQ ID NO:55);and 

HIV-Cleav2: 

5 '-caaagctcctattcccactgcCAGTTTCTCG AGCTGGGTAGCTTTC AG-3 ' (SEQ ID 
NO:56). 

For PCR I, 100 pmol of oligo HIV-1 and HIV-CIeav2 and 5 ng of the 
template DNA were used in the 75 jil reaction mixture (4 units of Taq or Pwo 
polymerase, 0.1 mM dNTPs and 1 .5 mM MgS0 4 ). PCR cycling was done in the 
following manner: 30 cycles with an annealing temperature of 60°C and an 
elongation time of 2 minutes at 72°C. 

For PCR II, 100 pmol of oligo HIV-end and HIV-Cleav and 5 ng of the 
template DNA were used in the 75 ^1 reaction mixture, (4 units of Taq or Pwo 
polymerase, 0. 1 mM dNTPs and 1 .5 mM MgSOJ. PCR cycling was done in the 
following manner: 30 cycles with an annealing temperature of 60 °C and an 
elongation time of 50 seconds at 72 °C. 

Both PCR fragments were purified, isolated and used in an assembly PCR 
reaction. For the assembly PCR reaction, 100 pmol of oligo HIV-1 and HIV-end 
and 2 ng of each PCR fragment (PCRI and PCR II) were used in the 75 nl (4 units 
of Taq or Pwo polymerase, 0.1 mM dNTPs and 1 .5 mM MgS0 4 ) r PCR cycling 
was done in the following manner: 30 cycles with an annealing temperature of 
60°C and an elongation time of 2.5 minutes at 72°C. The assembly PCR product 
was digested Xbal and Nhel. The FOS amphiphatic helix was fused in frame to 
the C-terminal end of gp-140. 



WO 00/32227 



PCT/IB99/01925 



-59- 



The DNA sequence coding for the FOS amphiphatic helix domain was 
PCR-ampIified from vector pJuFo (Crameri & Suter Gene 1 37: 69 (1993)) using 
the oligonucleotides: 
FOS-HIV: 

5 5 '-ttcggtgctagcggtggcTGCGGTGGTCTGACCG AC-3 ' (SEQ ID NO:57); and 

FO?-Apa: 

5'-gatgctgggcccttaaccGCAACCACCGTGTGCCGCC-3' (SEQ IDNO:58). 

For the PCR reaction, 100 pmol of each oligo and 5 ng of the template 
DNA was used in the 75 ^1 reaction mixture (4 units of Taq or Pwo polymerase, 

10 0.1 mM dNTPs and 1 .5 mM MgS0 4 ). Temperature cycling was done as follows: 

95 °C for 2 minutes, followed by 5 cycles of 95 °C (45 seconds), 60°C (30 
seconds), 72 °C (25 seconds) and followed by 25 cycles of 95 °C (45 seconds), 
68 ° C (30 seconds), 72 ° C (20 seconds). The obtained PCR fragment was digested 
with Nhel and Bsp 1 20L. 

1 5 The final expression vector for GP 1 40-FOS was obtained in a 3 fragment 

ligation of both PCR fragments into pSinRepS. The resultant vector 
pSinRep5-GP14O-F0S was evaluated by restriction analysis and DNA 
sequencing. 

GP 1 40-FOS was also cloned into pCYTts via Xbal and Bspl 20L to obtain 
20 a stable, inducible GP140-FOS expressing cell line. 

Example 13: 

Expression ofGPUOFOS using pSinRep5-GP140FOS 
RNase-free vector ( 1 .0 fig) (pSinRep5-GP 1 40-FOS) and 1 .0 *ig of DHEB 
(Bredenbeek et al t J. Virol 67:6439-6446 (1993)) were linearized by restriction 
25 digestion. Subsequently, in vitro transcription was carried out using an SP6 in 

vitro transcription kit (InvitroscripCAP by InvitroGen, Invitrogen BV, NV Leek, 
Netherlands). The resulting 5'-capped mRNA was analyzed on a reducing 
agarose-gel. 

In vitro transcribed mRNA (5 jig) was electroporated into BHK 21 cells 
30 (ATCC: CCL1 0) according to Invitrogen's manual (Sindbis Expression System, 



JNSDOCID: <WO 0032227A2J_> 



WO 00/32227 



PCT/1B99/0I925 



-60- 

Invitrogen BV, Netherlands). After 10 hours incubation at 37°C, the FCS 
containing medium was exchanged by HP-1 medium without FCS, followed by 
an additional incubation at 37 °C for 10 hours. The supernatant was harvested 
and analyzed by Western blot analysis for production of soluble GP140-FOS 
exactly as described in Example 2. 

Example 14: 

Expression ofGPUOFOS using pCYTts-GP140FOS 
pCYT-GPHO-FOiS 20 \xg was linearized by restriction digestion. The 
reaction was stopped by phenol/chloroform extraction, followed by an 
isopropanol precipitation of the linearized DNA. The restriction digestion was 
evaluated by agarose gel eletrophoresis. For the transfection, 5.4 jig of linearized 
pCYTtsGP140-FOS was mixed with 0.6 jig of linearized pSV2Neo in 30 ^1 H 2 0 
and 30 \x\ of 1 M CaCl 2 solution was added. After addition of 60 |al phosphate 
buffer (50 mM HEPES, 280 mM NaCl, 1 .5 mM Na 2 HP0 4 , pH 7.05), the solution 
was vortexed for 5 seconds, followed by an incubation at room temperature for 
25 seconds. The solution was immediately added to 2 ml HP-1 medium 
containing 2% FCS (2% FCS medium). The medium of an 80% confluent 
BHK21 cell culture (6-well plate) was then replaced by the DNA containing 
medium. After an incubation for 5 hours at 37 °C in a CO : incubator, the DNA 
containing medium was removed and replaced by 2 ml of 15% glycerol in 2% 
FCS medium. The glycerol containing medium was removed after a 30 second 
incubation phase, and the cells were washed by rinsing with 5 ml of HP-1 
medium containing 10% FCS. Finally 2 ml of fresh HP-1 medium containing 
10% FCS was added. 

Stably transfected cells were selected and grown in selection medium 
(HP-1 medium supplemented with G4 1 8) at 37 °C in a CO. incubator. When the 
mixed population was grown to confluency, the culture was split to two dishes, 
followed by a 12 h growth period at 37 °C. One dish of the cells was shifted to 
30°C to induce the expression of soluble GP14O-F0S. The other dish was kept 
at 37°C. 



.O032227 A2J_> 



WO 00/32227 



-61- 



PCT/IB99/01925 



The expression of soluble GP140-FOS was determined by Western blot 
analysis. Culture media (0.5 ml) was methanol/chloroform precipitated, and the 
pellet was resuspended in SDS-PAGE sample buffer. Samples were heated for 
5 minutes at 95 °C before being applied to a 15% acrylamide gel. After 
SDS-PAGE, proteins were transferred to Protan nitrocellulose membranes 
(Schleicher & Schuell, Germany) as described by Bass and Yang, in Creighton, 
T.E., ed., Protein Function: A Practical Approach, 2nd Edn., 1RL Press, Oxford 
(1 997), pp. 29-55. The membrane was blocked with 1 % bovine albumin (Sigma) 
in TBS (lOxTBS per liter: 87.7 gNaCl, 66. lgTrizma hydrochloride (Sigma) and 
9.7 g Trizma base (Sigma), pH 7.4) for 1 hour at room temperature, followed by 
an incubation with an anti-GP140 or GP-160 antibody for 1 hour. The blot was 
washed 3 times for 10 minutes with TBS-T (TBS with 0.05% Tween20), and 
incubated for 1 hour with an alkaline-phosphatase-anti- 
mouse/rabbit/monkey /human IgG conjugate. After washing 2 times for 10 
minutes with TBS-T and 2 times for 10 minutes with TBS, the development 
reaction was carried out using alkaline phosphatase detection reagents (1 0 ml AP 
buffer ( 1 00 mM Tris/HCl, 1 00 mM NaCl, pH 9.5) with 50^1 NBT solution (7.7% 
Nitro Blue Tetrazolium (Sigma) in 70% dimethylformamide) and 37 ^1 of 
X-Phosphate solution (5% of 5-bromo-4-chloro-3-indolyl phosphate in 
dimethylformamide). 

Example 15: 
Production and purification of GP140FOS 

An anti-gpl 20 antibody was covalently coupled to aNHS/EDC activated 
dextran and packed into a chromatography column. The supernatant, containing 
GP140FO5 is loaded onto the column and after sufficient washing, GP14OF0S 
was eluted using 0.1 M HC1. The eluate was directly neutralized during 
collection using 1 M Tris pH 7.2 in the collection tubes. 

Disulfide bond formation might occur during purification, therefore the 
collected sample is treated with 10 mM DTT in 10 mM Tris pH 7.5 for 2 hours 
at 25°C. 



WO 00/32227 



PCT/IB99/01925 



-62- 

DTT is remove by subsequent dialysis against 1 0 mM Mes; 80 mM NaCI 
pH 6.0. Finally GP140FOS is mixed with alphavirus particles containing the 
JUN leucine zipper in E2 as described in Example 16. 

Example 16: 
Preparation of the Alpha Vaccine Particles 
Viral particles {see Examples 2 and 3) were concentrated using Millipore 
Ultrafree Centrifugal Filter Devices with a molecular weight cut-off of 100 kD 
according to the protocol supplied by the manufacturer. Alternatively, viral 
particles were concentrated by sucrose gradient centriftigation as described in the 
instruction manual of the Sindbis Expression System (Invitrogen, San Diego, 
California). The pH of the virus suspension was adjusted to 7.5 and viral 
particles were incubated in the presence of 2-10 mM DTT for several hours. 
Viral particles were purified from contaminating protein on a Sephacryl S-300 
column (Pharmacia) (viral particles elute with the void volume) in an appropriate 
buffer. 

Purified virus particles were incubated with at least 240 fold molar excess 
of FaS-antigen fusion protein in an appropriate buffer (pH 7.5-8.5) in the 
presence of a redox shuffle (oxidized glutathione/reduced glutathione; 
cystine/cysteine) for at least 1 0 hours at 4 °C. After concentration of the particles 
using a Millipore Ultrafree Centrifugal Filter Device with a molecular weight 
cut-off of 100 kD, the mixture was passed through a Sephacryl S-300 gel 
filtration column (Pharmacia). Viral particles were eluted with the void volume. 

Example 1 7 

Fusion of JUN amphipathic helix to the amino terminus ofHBcAg(l-J44) 

The JUN helix was fused to the amino terminus of the HBcAg amino acid 
sequence 1 to 1 44 (JUN-HBcAg construct). For construction of the JUN-HBcAg 
DNA sequence, the sequences encoding the JUN helix and HBcAg(l -1 44) were 
amplified separately by PCR. The JUN sequence was amplified from the pJuFo 



0032227A2_I_> 



WO 00/32227 



PCT/1B99/0192S 



-63- 

plasmid using primers EcoRI-JUN(s) and JUN-SacII(as). The EcoRI-JUN(s) 
primer introduced an EcoRI site followed by a start ATG codon. The JUN- 
SacII(as) primer introduced a linker encoding the amino acid sequence GAAGS. 
The HBcAg (1 -1 44) sequence was amplified from the pEco63 plasmid (obtained 
from ATCC No. 31518) using primers JUN-HBcAg(s) and 
HBcAg(l - 1 44)Hind(as). JUN-HBcAg(s) contained a sequence corresponding to 
the 3' end of the sequence encoding the JUN helix followed by a sequence 
encoding the GAAGS linker and the 5' end of the HBcAg sequence. HBcAg(l- 
144)Hind(as) introduces a stop codon and a HindUI site after codon 144 of the 
HBcAg gene. For the PCR reactions, 100 pmol of each oligo and 50 ng of the 
template DNAs were used in the 50 ul reaction mixtures with 2 units of Pwo 
polymerase, 0. 1 mM dNTPs and 2 raM MgS0 4 . For both reactions, temperature 
cycling was carried out as follows: 94 °C for 2 minutes; and 30 cycles of 94 °C (1 
minute), 50 °C ( 1 minute), 72 °C (2 minutes). 

Primer sequences: 

EcoRI-JUN(s): 

(5'-CCGGAATTCATGTGCGGTGGTCGGATCGCCCGG-3') (SEQ ID 
NO:61); 

JUN-SacII(as): 

(5 ' -GTCGCTACCCGCGGCTCCGCAACCAACGTGGTTCATGAC-3 ') (SEQ 
ID NO:62); 

JUN-HBcAg(s): 

(5 -GTTGGTTGCGGAGCCGCGGGTAGCG ACATTG ACCCTTATA A AG AATTTGG-3 ') 
(SEQ ID NO:63); 



0032227A2_I_> 



WO 00/32227 



PCT/IB99/01925 



-64- 

HBcAg(]-144)Hind(as): 

(5'-CGCGTCCCAAGCTTCTACGGAAGCGTTGATAGGATAGG-3') (SEQ 
ID NO:64). 

Fusion of the two PCR fragments was performed by PCR using primers 
EcoRI- JUN(s) and HBcAg(I-144)Hind(as). 1 00 pmol of each oligo was used with 
lOOng of the purified PCR fragments in a 50 ^il reaction mixture containing 2 
units of Pwo polymerase, 0.1 mM dNTPs and 2 mM MgS0 4 . PCR cycling 
conditions were: 94°C for 2 minutes; and 35 cycles of 94°C (1 minute), 50°C 
(1 minute), 72 °C (2 minutes). The final PCR product was analyzed by agarose 
gel electrophoresis, purified and digested for 16 hours in an appropriate buffer 
with EcoRI and Hindlll restriction enzymes. The digested DNA fragment was 
ligated into EcoRI/Hindlll-digested pKK vector to generate pKK-JUN-HBcAg 
expression vector. Insertion of the PCR product was analyzed by EcoRJ/HindlH 
restriction analysis and by DNA sequencing of the insert. 

Example 18 

Fusion of JUN ampltipathic helix to the carboxy terminus ofHBcAg(]-144) 
The JUN helix was fused to the carboxy terminus of the HBcAg amino 
acid sequence 1 to 1 44 (HBcAg-JUN construct). For construction of the HBcAg- 
JUN DNA sequence, the sequences encoding the JUN helix and HBcAg(l-144) 
were amplified separately by PCR. The JUN sequence was amplified from the 
pJuFo plasmid with primers SacII-JUN(s) and JUN-Hindlll(as). SacII-JUN(s) 
introduced a linker encoding amino acids LA AG. This sequence also contains a 
SacII site. JUN-Hindlll(as) introduced a stop codon (TAA) followed by a Hindlll 
site. The HBcAg(l -144) DNA sequence was amplified from the pEco63 plasmid 
using primers EcoRI-HBcAg(s) and HBcAg(l-144)-JUN(as). EcoRJ-HBcAg(s) 
introduced an EcoRI site prior to the Start ATG of the HBcAg coding sequence. 
HBcAg(l-144)-JUN(as) introduces a sequence encoding the peptide linker 
(LAAG), which also contains a SacII site. For the PCR reactions, 100 pmol of 



WO 00/32227 



PCT/IB99/0192S 



-65- 

each oligo and 50 ng of the template DNAs were used in the 50 ul reaction 
mixtures with 2 units of Pwo polymerase, 0.1 mM dNTPs and 2 mM MgSCv 
Temperature cycling was carried out as follows: 94 °C for 2 minutes; and 30 
cycles of 94°C (1 minute), 50°C (1 minute), 72°C (2 minutes). 

Primer sequences 
SacII-JUN(s): 

(5'-CTAGCCGCGGGTTGCGGTGGTCGGATCGCCCGG-3') (SEQ ID 
NO:65); 

JUN-Hindlll(as): 

(5'-CGCGTCCCAAGCTTTTAGCAACCAACGTGGTTCATGAC -3') (SEQ 
ID NO:66); 

EcoRJ-HBcAg(s): 

(5 '-CCGGAATTCATGGACATTGACCCTTATAAAG-3 ') (SEQ ID NO:67); 
and 

HBcAg-JUN(as): 

(5'-CCGACCACCGCAACCCGCGGCTAGCGGAAGCGTTGATAGGATAGG-3') 
(SEQ ID NO:68). 

Fusion of the two PCR fragments was performed by PCR using primers 
EcoRI-HBcAg(s) and JUN-Hindlll(as). For the PCR fusion, 100 pmol of each 
oligo was used with lOOng of the purified PCR fragments in a 50 ul reaction 
mixture containing 2 units of Pwo polymerase, 0.1 mM dNTPs and 2 mM 
MgS0 4 . PCR cycling conditions were: 94°C for 2 minutes; and 35 cycles of 
94 °C (1 minute), 50°C ( 1 minute), 72 °C (2 minutes). The final PCR product was 
analyzed by agarose gel electrophoresis, and digested for 16 hours in an 



0032227 A2_l_> 



WO 00/32227 



PCT/IB99/01925 



-66- 



appropriate buffer with EcoRJ and Hindlll restriction enzymes. The DNA 
fragment was gel purified and ligated into EcoRI/Hindlll-digested pKK vector to 
generate pKK-HBcAg-JUN expression vector. Insertion of the PCR product was 
analyzed by EcoRI/Hindlll restriction analysis and by DNA sequencing of the 
5 insert. 

Example 19 

Insertion of JUN amphipathic helix into the c/el epitope of HBcAg(l-144) 

The c/el epitope (residues 72 to 88) of HBcAg is known to be located in 
the tip region on the surface of the hepatitis B virus capsid. A part of this region 

10 (residues 76 to 82) of the protein was genetically replaced by the JUN helix to 

provide an attachment site for antigens (HBcAg-JUNIns construct). The HBcAg- 
JUNIns DNA sequence was generated by PCRs: The JUN helix sequence and 
two sequences encoding HBcAg fragments (amino acid residues 1 to 75 and 83 
to 144) were amplified separately by PCR. The JUN sequence was amplified 

15 from the pJuFo plasmid with primers BamHI-JUN(s) and JUN-SacII(as). 

BamHI-JUN(s) introduced a linker sequence encoding the peptide sequence 
GSGGG that also contains a BamHI site. JUN-SacII(as) introduced a sequence 
encoding the peptide linker GAAGS followed by a sequence complementary to 
the 3' end of the JUN coding sequence. The HBcAg(l-75) DNA sequence was 

20 amplified from the pEco63 plasmid using primers EcoRIHBcAg(s) and 

HBcAg75-JUN(as). EcoRIHBcAg(s) introduced an EcoRI site followed by a 
sequence corresponding to the 5' end of the HBcAg sequence. HBcAg75- 
JUN(as) introduced a linker encoding the peptide GSGGG after amino acid 75 of 
HBcAg followed by a sequence complementary to the 5 ' end of the sequence 

25 encoding the JUN helix. The HBcAg (83-144) fragment was amplified using 

primers JUN-HBcAg83(s) and HBcAg(l-144)Hind(as). JUN-HBcAg83(s) 
contained a sequence corresponding to the 3 ' end of the JUN-encoding sequence 
followed by a linker encoding the peptide, GAAGS and a sequence corresponding 
to the 5' end of the sequence encoding HBcAg (83-1 44). HBcAg(l-144)Hind(as) 



BNSDOCIO. <WO 0032227A2 I > 



WO 00/32227 



PCT/IB99/01925 



-67- 

introduced a stop codon and a Hindi]] site after codon 144 of the HBcAg gene. 
For the PCR reactions, 1 00 pmol of each oligo and 50 ng of the template DNAs 
were used in the 50 jxl reaction mixtures (2 units of Pwo polymerase, 0.1 mM 
dNTPs and 2 mM MgS0 4 ). Temperature cycling was performed as follows: 
94°C for 2 minutes; and 35 cycles of 94°C (1 minute), 50°C (1 minute), 72°C 
(2 minutes). 

Primer sequences: 

BamHI-JUN(s): 

(5 '-CTAATGGATCCGGTGGGGGCTGCGGTGGTCGGATCGCCCGGCTCGAG-3 ') 
(SEQIDNO:69); 

JUN-SacII(as): 

(5 '-GTCGCTACCCGCGGCTCCGC AACCAACGTGGTTCATGAC-3 ') (SEQ 
IDNO:70); 

EcoRIHBcAg(s): 

(5'- CCGGAATTCATGGACATTGACCCTTATAAAG-3 ') (SEQ ID NO:71); 
HBcAg75-JUN (as): 

(5'-CCGACCACCGCAGCCCCCACCGGATCCATTAGTACCCACCCAGGTAGC-3') 
(SEQIDNO:72); 

JUN-HBcAg83(s): 

(5'-GTTGGTTGCGGAGCCGCGGGTAGCGACCTAGTAGTCAGTTATGTC-3') 
(SEQ ID NO:73); and 



. 0032227 A2J_> 



WO 00/32227 



PCT/IB99/01925 



-68- 

HBcAg(l-144)Hind(as): 

(5'-CGCGTCCCAAGCTTCTACGGAAGCGTTGATAGGATAGG-3') (SEQ 
ID NO:74). 

Fusion of the three PCR fragments was performed as follows. First, the 
5 fragment encoding HBcAg 1-75 was fused with the sequence encoding JUN by 

PCR using primers EcoRIHBcAg(s) and JUN-SacII(as). Second, the product 
obtained was fused with the HBcAg(83-144) fragment by PCR using primers 
EcoRI HBcAg(s) and HBcAg Hindlll(as). For PCR fusions, 100 pmol of each 
oligo was used with 100 ng of the purified PCR fragments in a 50 \il reaction 

10 mixture containing 2 units of Pwo polymerase, 0.1 mM dNTPs and 2 mM 

MgS0 4 . The same PCR cycles were used as for generation of the individual 
fragments. The final PCR product was digested for 16 hours in an appropriate 
buffer with EcoRI and Hiridlll restriction enzymes. The DNA fragment was 
ligated into EcoRI/Hindlll-digested pKK vector, yielding the pKK-HBcAg- 

15 JUNIns vector. Insertion of the PCR product was analyzed by EcoRI/Hindlll 

restriction analysis and by DNA sequencing of the insert. 

Example 20 

Fusion of the JUN amphipathic helix to the carboxy terminus of the 
measles virus nucleocapsid (N) protein 

20 The JUN helix was fused to the carboxy terminus of the truncated measles 

virus N protein fragment comprising amino acid residues 1 to 473 (N473-JUN 
construct). For construction of the DNA sequence encoding N473-JUN the 
sequence encoding the JUN helix and the sequence encoding N473-JUN were 
amplified separately by PCR. The JUN sequence was amplified from the pJuFo 

25 plasmid with primers SacII-JUN(s) and JUN-Hindlll(as). SacII-JUN(s) 

introduced a sequence encoding peptide linker LAAG. This sequence also 
contained a SacII site. The JUN-Hindlll(as) anti-sense primer introduced a stop 
codon (TAA) followed by a Hindlll site. The N (1-473) sequence was amplified 
from the pSC-N plasmid containing the complete measles virus N protein coding 



BNSDOCID; <WO 00Q2227A2 \ > 



WO 00/32227 



PCT/IB99/01925 



-69- 

sequence (obtained from M. Billeter, Zurich) using primers EcoRJ-Nmea(s) and 
Nmea-JUN(as). EcoRI-N(mea)(s) introduced an EcoR] site prior to the Start 
ATG of the N coding sequence. N(mea)-JUN(as) was complementary to the 3' 
end of the N( 1-473) coding sequence followed by a sequence complementary to 
5 the coding sequence for the peptide linker (LAAG). For the PCR reactions, 1 00 

pmol of each oligo and 50 ng of the template DNAs were used in the 50 ul 
reaction mixtures with 2 units of Pwo polymerase, 0.1 mM dNTPs and 2 mM 
MgSOv Temperature cycling was performed as follows: 94 °C for 2 minutes; and 
35 cycles of 94 °C (1 minute), 55°C (1 minute), 72°C (2 minutes). 

1 0 Primer sequences: 

SacII-JUN(s): 

(5 '-CTAGCCGCGGGTTGCGGTGGTCGGATCGCCCGG-3 ') (SEQ ID 
NO:75); 

JUN-Hindlll(as): 

1 5 (5 '-CGCGTCCCAAGCTTTTAGCAACCAACGTGGTTCATGAC -3 ') (SEQ 

ID NO:76); 

EcoRJ-Nmea(s): 

(5 '-CCGGAATTCATGGCCACACTTTTAAGGAGC-3 ') (SEQ IDNO:77); and 
Nmea-JUN(as): 

10 (5 '-CGCGTCCCAAGCTTTTAGCAACCAACGTGGTTCATGAC-3 ') (SEQ ID 

NO:78). 

Fusion of the two PCR fragments was performed in a further PCR using 
primers EcoRI-Nmea(s) and Nmea-JUN(as). For the PCR fusion, 100 pmol of 
each oligo was used with 100 ng of the purified PCR fragments in a 50 ul 



1NSDOCIO: <WO_003a227A2_l_> 



WO 00/32227 



PCT/IB99/01925 



-70- 

reaction mixture containing 2 units of Pwo polymerase, 0J mM dNTPs and 2 
mM MgS0 4 . Temperature cycling was performed as follows: 94 °C for 2 
minutes; and 35 cycles of 94°C (1 minute), 50°C (1 minute), 72°C (2 minutes). 
The PCR product was digested for 1 6 hours in an appropriate buffer with EcoRI 
5 and Hindlll restriction enzymes. The DNA fragment was gel purified and ligated 

into EcoRI/HindlH-digested pKK vector, yielding the pKK-N473~JUN plasmid. 
Insertion of the PCR product was analyzed by EcoRJ/Hindlll restriction analysis 
and by DNA sequencing of the insert. 

Example 21 

1 0 Expression and partial purification of HBcA g-JUN 

E. coli strain XL-1 blue was transformed with pKK-HBcAg-JUN. 1 ml 
of an overnight culture of bacteria was used to innoculate 1 00 ml of LB medium 
containing 100 jig/ml ampicillin. This culture was grown for 4 hours at 37°C 
until an OD at 600 nm of approximately 0.8 was reached. Induction of the 

15 synthesis of HBcAg-JUN was performed by addition of IPTG to a final 

concentration of 1 mM. After induction, bacteria were further shaken at 37°C for 
1 6 hours. Bacteria were harvested by centrifiigation at 5000 x g for 1 5 minutes. 
The pellet was frozen at -20°C. The pellet was thawed and resuspended in 
bacteria lysis buffer (10 mM Na 2 HP0 4 , pH 7.0, 30 mM NaCl, 0.25% Tween-20, 

20 1 0 mM EDTA, 1 0 mM DTT) supplemented with 200 fig/ml ly sosyme and 1 0 ^1 

of Benzonase (Merck). Cells were incubated for 30 minutes at room temperature 
and disrupted using a French pressure cell. Triton X-l 00 was added to the lysate 
to a final concentration of 0.2%, and the lysate was incubated for 30 minutes on 
ice and shaken occasionally. Figure 4 shows HBcAg-JUN protein expression in 

25 E. coli upon induction with IPTG. E, coli cells harboring pKK-HBcAg-JUN 

expression plasmid or a control plasmid were used for induction of HBcAg-JUN 
expression with IPTG. Prior to the addition of IPTG, a sample was removed from 
the bacteria culture carrying the pKK-HBcAg-JUN plasmid (lane 3) and from a 
culture carrying the control plasmid (lane 1). Sixteen hours after addition of 



BNSDOC1D: <WO 0032227A2_t_> 



WO 00/32227 



PCT/IB99/01925 



-71- 

IPTG, samples were again removed from the culture containing pKK-HBcAg- 
JUN (lane 4) and from the control culture (lane 2). Protein expression was 
monitored by SDS-PAGE followed by Coomassie staining. 

The lysate was then centrifuged for 30 minutes at 12,000 x g in order to 
remove insoluble cell debris. The supernatant and the pellet were analyzed by 
Western blotting using a monoclonal antibody against HBcAg (YVS1841, 
purchased from Accurate Chemical and Scientific Corp., Westbury, NY, USA), 
indicating that a significant amount of HBcAg-JUN protein was soluble (Fig. 5). 
Briefly, lysates from E. coli cells expressing HBcAg-JUN and from control cells 
were centrifuged at 14,000 x g for 30 minutes. Supernatant (= soluble fraction) 
and pellet (= insoluble fraction) were separated and diluted with SDS sample 
buffer to equal volumes. Samples were analyzed by SDS-PAGE followed by 
Western blotting with anti-HBcAg monoclonal antibody YVS 1841. Lane 1: 
soluble fraction, control cells; lane 2: insoluble fraction, control cells; lane 3: 
soluble fraction, cells expressing HBcAg-JUN; lane 4: insoluble fraction, cells 
expressing HbcAg-JUN. 

The cleared cell lysate was used for step-gradient centrifugation using a 
sucrose step gradient consisting of a 4 ml 65% sucrose solution overlaid with 3 
ml 15% sucrose solution followed by 4 ml of bacterial lysate. The sample was 
centrifuged for 3 hrs with 1 00,000 x gat 4 °C. After centrifugation, 1 ml fractions 
from the top of the gradient were collected and analyzed by SDS-PAGE followed 
by Coomassie staining. (Fig. 6). Lane 1: total E. coli lysate prior to 
centrifugation. Lane 1 and 2: fractions 1 and 2 from the top of the gradient. 
Lane 4 to 7: fractions 5 to 8 (15% sucrose). The HBcAg-JUN protein was 
detected by Coomassie staining. 

The HBcAg-JUN protein was enriched at the interface between 15 and 
65% sucrose indicating that it had formed a capsid particle. Most of the bacterial 
proteins remained in the sucrose-free upper layer of the gradient, therefore step- 
gradient centrifugation of the HBcAg-JUN particles led both to enrichment and 
to a partial purification of the particles. 



WO 00/32227 



PCT/IB99/01925 



-72- 
Example 22 

Covalent Coupling of hGH-FOS to HBcAg-JUN 
In order to demonstrate binding of a protein to HBcAg-JUN particles, we 
chose human growth hormone (hGH) fused with its carboxy terminus to the FOS 
helix as a model protein (hGH-FOS). HBcAg-JUN particles were mixed with 
partially purified hGH-FOS and incubated for 4 hours at 4°C to allow binding of 
the proteins. The mixture was then dialyzed overnight against a 3000-fold 
volume of dialysis buffer (1 50 mM NaCl, 1 0 mM Tris-HCl solution, pH 8.0) in 
order to remove DTT present in both the HBcAg-JUN solution and the hGH-FOS 
solution and thereby allow covalent coupling of the proteins through the 
establishment of disulphide bonds. As controls, the HBcAg-JUN and the hGH- 
FOS solutions were also dialyzed against dialysis buffer. Samples from all three 
dialyzed protein solutions were analyzed by SDS-PAGE under non-reducing 
conditions. Coupling of hGH-FOS to HBcAg-JUN was detected in an anti-hGH 
immunoblot (Fig. 7). hGH-FOS bound to HBcAg-JUN should migrate with an 
apparent molecular mass of approximately 53 kDa, while unbound hGH-FOS 
migrates with an apparent molecular mass of 3 1 kDa. The dialysate was analyzed 
by SDS-PAGE in the absence of reducing agent (lane 3) and in the presence of 
reducing agent (lane 2) and detected by Coomassie staining. As a control, hGH- 
FOS that had not been mixed with capsid particles was also loaded on the gel in 
the presence of reducing agent (lane 1). 

A shift of hGH-FOS to a molecular mass of approximately 53 kDa was 
observed in the presence of HBcAg-JUN capsid protein, suggesting that efficient 
binding of hGH-FOS to HBcAg-JUN had taken place. 

Example 23 

Insertion of a peptide containing a Lysine residue into the 
c/eJ epitope ofHBcAg(l-149) 
The c/el epitope (residues 72 to 88) of HBcAg is located in the tip region 
on the surface of the hepatitis B virus capsid (HBcAg). A part of this region 



WO 00/32227 



PCT/IB99/01925 



-73- 

(Proline 79 and Alanine 80) was genetically replaced by the peptide Gly-Gly-Lys- 
Gly-Gly (HBcAg-Lys construct). The introduced Lysine residue contains a 
reactive amino group in its side chain that can be used for intermolecular 
chemical crosslinking of HBcAg particles with any antigen containing a free 
Cysteine group. 

The HBcAg-Lys DNA sequence was generated by PCRs: The two 
fragments encoding HBcAg fragments (amino acid residues 1 to 78 and 81 to 
149) were amplified separately by PCR. The primers used for these PCRs also 
introduced a DNA sequence encoding the Gly-Gly-Lys-Gly-Gly peptide. The 
HBcAg (1 to 78) fragment was amplified from pEco63 using primers 
EcoRIHBcAg(s) and Lys-HBcAg(as). The HBcAg (81 to 149) fragment was 
amplified from pEco63 using primers Lys-HBcAg(s) and HBcAg(l- 
149)Hind(as). Primers Lys-HBcAg(as) and Lys-HBcAg(s) introduced 
complementary DNA sequences at the ends of the two PCR products allowing 
fusion of the two PCR products in a subsequent assembly PCR. The assembled 
fragments were amplified by PCR using primers EcoRIHBcAg(s) and HbcAg(l - 
149)Hind(as). 

For the PCRs, 100 pmol of each oligo and 50 ng of the template DNAs 
were used in the 50 p.1 reaction mixtures with 2 units of Pwo polymerase, 0. 1 mM 
dNTPs and 2 mM MgS04. For both reactions , temperature cycling was carried 
out as follows: 94°C for 2 minutes; 30 cycles of 94°C (1 minute), 50°C (1 
minute), 72 °C (2 minutes). 

Primer sequences: 

EcoRIHBcAg(s): 

(5'-CCGGAATTCATGGACATTGACCCTTATAAAG-3 ; ) (SEQ ID NO:79); 



Lys-HBcAg(as): 

(5 ? -CCTAGAGCCACCTTTGCCACCATCTTCTAAATTAGTACCCACCCAG 



WO 00/32227 



PCT/IB99/01925 



-74- 

GTAGC-3') (SEQ ID NO:80); 
Lys-HBcAg(s): 

(5'-GAAGATGGTGGCAAAGGTGGCTCTAGGGACCTAGTAGTCAGTTAT 
GTC -3') (SEQ ID NO:81); 

HBcAg( 1 - 1 49)Hind(as): 

(S^CGCGTCCCAAGCTTCTAAACAACAGTAGTCTCCGGAAG-a ') (SEQ 
ID NO:82). 

For fusion of the two PCR fragments by PCR 100 pmol of primers 
EcoRIHBcAg(s) and HBcAg(l-149)Hind(as) were used with 100 ng of the two 
purified PCR fragments in a 50 jil reaction mixture containing 2 units of Pwo 
polymerase, 0.1 mM dNTPs and 2 mM MgS0 4 . PCR cycling conditions were: 
94°C for 2 minutes; 30 cycles of 94°C (1 minute), 50°C (1 minute), 72°C (2 
minutes). The assembled PCR product was analyzed by agarose gel 
electrophoresis, purified and digested for 19 hours in an appropriate buffer with 
EcoRI and HindlH restriction enzymes. The digested DNA fragment was li gated 
into EcoRI/Hindlll-digested pKK vector to generate pKK-HBc Ag-Lys expression 
vector. Insertion of the PCR product into the vector was analyzed by 
EcoRI/Hindlll restriction analysis and DNA sequencing of the insert. 

Example 24 

Expression and partial purification of HBcAg-Lys 
E. coli strain XL-1 blue was transformed with pKK-HBcAg-Lys. 1 ml of 
an overnight culture of bacteria was used to innoculate 1 00 ml of LB medium 
containing 100 ng/ml ampicillin. This culture was grown for 4 hours at 37°C 
until an OD at 600 nm of approximately 0.8 was reached. Induction of the 
synthesis of HBcAg-Lys was performed by addition of IPTG to a final 
concentration of 1 mM. After induction, bacteria were further shaken at 37°C for 



WO 00/32227 



PCT/IB99/01925 



-75- 

16 hours. Bacteria were harvested by centrifugation at 5000 x g for 1 5 minutes. 
The pellet was frozen at -20°C. The pellet was thawed and resuspended in 
bacteria lysis buffer (10 mM Na 2 HP0 4 , pH 7.0, 30 mM NaCI, 0.25% Tween-20, 
1 0 mM EDTA, 1 0 mM DTT) supplemented with 200 ug/ml lysosyme and 1 0 ul 
of Benzonase (Merck). Cells were incubated for 30 minutes at room temperature 
and disrupted using a French pressure cell. Triton X- 1 00 was added to the lysate 
to a final concentration of 0.2%, and the lysate was incubated for 30 minutes on 
ice and shaken occasionally. R coli cells harboring pKK-HBcAg-Lys expression 
plasmid or a control plasmid were used for induction of HBcAg-Lys expression 
with IPTG. Prior to the addition of IPTG, a sample was removed from the 
bacteria culture carrying the pKK-HBcAg-Lys plasmid and from a culture 
carrying the control plasmid. Sixteen hours after addition of IPTG, samples were 
again removed from the culture containing pKK-HBcAg-Lys and from the control 
culture. Protein expression was monitored by SDS-PAGE followed by 
Coomassie staining. 

The lysate was then centrifuged for 30 minutes at 12,000 x g in order to 
remove insoluble cell debris. The supernatant and the pellet were analyzed by 
Western blotting using a monoclonal antibody against HBcAg (YVS1841, 
purchased from Accurate Chemical and Scientific Corp., Westbury, NY, USA), 
indicating that a significant amount of HBcAg-Lys protein was soluble. Briefly, 
lysates from R coli cells expressing HBcAg-Lys and from control cells were 
centrifuged at 14,000 x g for 30 minutes. Supernatant (= soluble fraction) and 
pellet (= insoluble fraction) were separated and diluted with SDS sample buffer 
to equal volumes. Samples were analyzed by SDS-PAGE followed by Western 
blotting with anti-HBcAg monoclonal antibody YVS 1841. 

The cleared cell lysate was used for step-gradient centrifugation using a 
sucrose step gradient consisting of a 4 ml 65% sucrose solution overlaid with 3 
ml 15% sucrose solution followed by 4 ml of bacterial lysate. The sample was 
centrifuged for 3 hrs with 1 00,000 x g at 4 °C. After centrifugation, 1 ml fractions 
from the top of the gradient were collected and analyzed by SDS-PAGE followed 



WO 00/32227 



PCT/IB99/01925 



-76- 

by Coomassie staining. The HBcAg-Lys protein was detected by Coomassie 
staining. 

The HBcAg-Lys protein was enriched at the interface between 15 and 
65% sucrose indicating that it had formed a capsid particle. Most of the bacterial 
proteins remained in the sucrose-free upper layer of the gradient, therefore step- 
gradient centrifugation of the HBcAg-Lys particles led both to enrichment and to 
a partial purification of the particles. 

Example 25 

Chemical coupling of FLA G peptide to HBcAg-Lys 
using the heterobifunctional crosslinker SPDP 

Synthetic FLAG peptide with a Cysteine residue at its amino terminus 
(amino acid sequence CGGDYKDDDDK) was coupled chemically to purified 
HBcAg-Lys particles in order to elicit an immune response against the FLAG 
peptide. 600 jil of a 95% pure solution of HBcAg-Lys particles (2 mg/ml) were 
incubated for 30 minutes at room temperature with the heterobifunctional 
crosslinker N-Succinimidyl 3-(2-pyridyldithio) propionate (SPDP) (0.5 mM). 
After completion of the reaction, the mixture was dialysed overnight against 1 
liter of 50 mM Phosphate buffer (pH 7.2) with 150 mM NaCl to remove free 
SPDP. Then 500 ^1 of derivatized HBcAg-Lys capsid (2 mg/ml) were mixed with 
0.1 mM FLAG peptide (containing an amino-terminal cysteine) in the presence 
of 1 0 mM EDTA to prevent metal-catalyzed sufhydryl oxidation. The reaction 
was monitored through the increase of the optical density of the solution at 343 
nm due to the release of pyridine-2-thione from SPDP upon reaction with the free 
cysteine of the peptide. The reaction of derivatised Lys residues with the peptide 
was complete after approximately 30 minutes. 

The FLAG decorated particles were injected into mice. 



0032227 A2_l_> 



WO 00/32227 



PCT/1B99/01925 



-77- 



Example 26 
Construction of pMPSV-gpl40cys 

The g P 140 gene was amplified by PCR from pCytTSgp!40FOS using 
oligos gpl40CysEcoRl and SallgpMO. For the PCRs, 100 pmol of each oligo 
and 50 ng of the template DNAs were used in the 50 ul reaction mixtures with 2 
units of Pwo polymerase, 0.1 mM dNTPs and 2 mM MgS04. For both reactions 
, temperature cycling was carried out as follows: 94°C for 2 minutes; 30 cycles 
of 94°C (0.5 minutes), 55°C (0.5 minutes), 72°C (2 minutes). 

The PCR product was purified using QiaEXII kit, digested with 
Sall/EcoRJ and ligated into vector pMPSVHE cleaved with the same enzymes. 

Oligo sequences: 
Gpl40CysEcoRI: 

5'-GCCGAATTCCTAGCAGCTAGCACCGAATTTATCTAA-3' (SEQ ID 
NO:83); 

SallgpMO 

5'- GGTTAAGTCG ACATGAGAGTGAAGG AGAAATAT-3 ' (SEQ IDNO:84). 

Example 27 
Expression ofpMPSVgpUOCys 
pMPSVgpHOCys (20 ug) was linearized by restriction digestion. The 
reaction was stopped by phenol/chloroform extraction, followed by an 
isopropanol precipitation of the linearized DNA. The restriction digestion was 
evaluated by agarose gel eletrophoresis. For the transfection, 5.4 ug of linearized 
pMPSVgpl40-Cys was mixed with 0.6 ug of linearized pSV2Neo in 30 ul H 2 0 
and 30 ul of 1 M CaCI, solution was added. After addition of 60 ul phosphate 
buffer (50 mM HEPES, 280 mM NaCl, 1 .5 mM Na, HP0 4 , pH 7.05), the solution 
was vortexed for 5 seconds, followed by an incubation at room temperature for 



WO 00/32227 



PCT/IB99/01925 



-78- 



25 seconds. The solution was immediately added to 2 ml HP-1 medium 
containing 2% FCS (2% FCS medium). The medium of an 80% confluent 
BHK21 cell culture (6-well plate) was then replaced by the DNA containing 
medium. After an incubation for 5 hours at 37°C in a C0 2 incubator, the DNA 
containing medium was removed and replaced by 2 ml of 15% glycerol in 2% 
FCS medium. The glycerol containing medium was removed after a 30 second 
incubation phase, and the cells were washed by rinsing with 5 ml of HP-1 
medium containing 10% FCS. Finally 2 ml of fresh HP-1 medium containing 
10% FCS was added. 

Stably transfected cells were selected and grown in selection medium 
(HP-1 medium supplemented with G41 8) at 37°C in a C0 2 incubator. When the 
mixed population was grown to confluency, the culture was split to two dishes, 
followed by a 12 h growth period at 37°C. One dish of the cells was shifted to 
30°C to induce the expression of soluble GP140-FOS. The other dish was kept 
at37°C. 

The expression of soluble GP140-Cy.y was determined by Western blot 
analysis. Culture media (0.5 ml) was methanol/chloroform precipitated, and the 
pellet was resuspended in SDS-PAGE sample buffer. Samples were heated for 
5 minutes at 95°C before being applied to a 15% acrylamide gel. After 
SDS-PAGE, proteins were transferred to Protan nitrocellulose membranes 
(Schleicher & Schuell, Germany) as described by Bass and Yang, in Creighton, 
T.E., ed., Protein Function; A Practical Approach, 2nd Edn., IRL Press, Oxford 
(1 997), pp. 29-55. The membrane was blocked with 1 % bovine albumin (Sigma) 
in TBS (1 OxTBS per liter: 87.7 g NaCl, 66. 1 g Trizma hydrochloride (Sigma) and 
9.7 g Trizma base (Sigma), pH 7,4) for 1 hour at room temperature, followed by 
an incubation with an anti-GP140 or GP-160 antibody for 1 hour. The blot was 
washed 3 times for 10 minutes with TBS-T (TBS with 0.05% Tween20), and 
incubated for 1 hour with an alkaline-phosphatase-anti- 
mouse/rabbit/monkey /human IgG conjugate. After washing 2 times for 10 
minutes with TBS-T and 2 times for 10 minutes with TBS, the development 



WO 00/32227 



PCT/IB99/0192S 



-79- 

reaction was carried out using alkaline phosphatase detection reagents (10 ml AP 
buffer (1 00 mM Tris/HCI, 1 00 mM NaCl, pH 9.5) with 50 ul NBT solution (7.7% 
Nitro Blue Tetrazolium (Sigma) in 70% dimethylformamide) and 37 ul of 
X-Phosphate solution (5% of 5-bromo-4-chloro-3-indolyl phosphate in 
dimethylformamide). 

Example 28 
Purification of gpl40Cys 

An anti-gpl 20 antibody was covalently coupled to a NHS/EDC activated 
dextran and packed into a chromatography column. The supernatant, containing 
GP 1 40Cys is loaded onto the column and after sufficient washing, GP 1 AQCys was 
eluted using 0.1 M HC1. The eluate was directly neutralized during collection 
using 1 M Tris pH 7.2 in the collection tubes. 

Disulfide bond formation might occur during purification, therefore the 
collected sample is treated with 10 mM DTT in 10 mM Tris pH 7.5 for 2 hours 
at 25 °C. 

DTT is remove by subsequent dialysis against 1 0 mM Mes; 80 mM NaCl 
pH 6.0. Finally GP140Cy.y is mixed with alphavirus particles containing the JUN 
residue in E2 as described in Example 1 6. 

Example 29 
Construction of PLA2-Cys 

The PLA2 gene was amplified by PCR from pAV3PLAfos using oligos 
EcoRIPLA and PLA-Cys-hind. For the PCRs, 1 00 pmol of each oligo and 50 ng 
of the template DNAs were used in the 50 ul reaction mixtures with 2 units of 
Pwo polymerase, 0.1 mM dNTPs and 2 mM MgS04. For both reactions , 
temperature cycling was carried out as follows: 94 °C for 2 minutes; 30 cycles of 
94 °C (0.5 minutes), 55 °C (0.5 minutes), 72 °C (2 minutes). 

The PCR product was purified using QiaEXII kit, digested with 
EcoRI/HinDIII and ligated into vector pAV3 cleaved with the same enzymes. 



WO 00/32227 



PCT/IB99/01925 



-80- 

Oligos 
EcoRIPLA: 

5'-TAACCGAATTCAGGAGGTAAAAAGATATGG-3' (SEQ IDNO:85) 
PLACys-hind: 

5'-GAAGTAAAGCTTTTAACCACCGCAACCACCAGAAG-3' (SEQ ID 
NO:86). 

Example 30 
Expression and purification of PLA-cys 
For cytoplasmic production of Cys tagged proteins. E. coli XL- 1 -Blue 
strain was transformed with the vectors pAV3::PLA and pPLA-Cys. The culture 
was incubated in rich medium in the presence of ampicillin at 37 °C with shaking. 
At an optical density (550iim) of, 1 mM IPTG was added and incubation was 
continued for another 5 hours. The cells were harvested by centrifugation, 
resuspended in an appropriate buffer (e.g. Tris-HCl, pH 7.2, 150 mM NaCl) 
containing DNase, RNase and lysozyme, and disrupted by passage through a 
french pressure cell. After centrifiigation (Sorvall RC-5C, SS34 rotor, 
15000 rpm, 10 min 7 4°C), the pellet was resuspended in 25 ml inclusion body 
wash buffer (20 mM tris-HCl, 23% sucrose, 0.5% Triton X-100, 1 mM EDTA, 
pH8) at 4°C and recentrifuged as described above. This procedure was repeated 
until the supernatant after centrifugation was essentially clear. Inclusion bodies 
were resuspended in 20 ml solubilization buffer (5.5 M guanidinium 
hydrochloride, 25 mM tris-HCl, pH 7.5) at room temperature and insoluble 
material was removed by centrifugation and subsequent passage of the 
supernatant through a sterile filter (0.45 urn). The protein solution was kept at 
4 °C for at least 1 0 hours in the presence of 1 0 mM EDTA and 1 00 mM DTT and 
then dialyzed three times against 10 volumes of 5.5 M guanidinium 
hydrochloride, 25 mM tris-HCl, 1 0 mM EDTA, pH 6. The solution was dialyzed 
twice against 51 2 M urea, 4 mM EDTA, 0.1 M NH 4 C1, 20 mM sodium borate 



WO 00/32227 



PCT/IB99/01925 



-81- 

(pH 8.3) in the presence of an appropriate redox shuffle (oxidized 
glutathione/reduced glutathione; cystine/cysteine). The refolded protein was then 
applied to an ion exchange chromatography. The protein was stored in an 
appropriate buffer with a pH above 7 in the presence of 2-10 mM DTT to keep 
the cysteine residues in a reduced form. Prior to coupling of the protein with the 
alphavirus particles, DTT was removed by passage of the protein solution through 
a Sephadex G-25 gel filtration column. 



WSOOCID: <WO 0032227A2 I > 



WO 00/32227 



PCT/IB99/01925 



-82- 



What Is Claimed Is: 



A composition comprising: 

a) a non-naturally occurring molecular scaffold comprising: 
(i) a core particle selected from the group consisting 



of: 



(1 ) a core particle of non-natural origin; and 

(2) a core particle of natural origin; and 

(ii) an organizer comprising at least one first 

attachment site, 

1 0 wherein said organizer is connected to said core particle by at least one 

covalent bond; and 

b) an antigen or antigenic determinant with at least one 
second attachment site, said second attachment site being selected from the group 
consisting of: 

15 (i) an attachment site not naturally occurring with said 

antigen or antigenic determinant; and 

(ii) an attachment site naturally occurring with said 
antigen or antigenic determinant, 

wherein said second attachment site is capable of association through at 
20 least one non-peptide bond to said first attachment site; and 

wherein said antigen or antigenic determinant and said scaffold interact through 
said association to form an ordered and repetitive antigen array. 

2. The composition of Claim 1 , wherein: 

a) said core particle is selected from the group consisting of: 
25 (i) a virus 

(ii) a virus-like particle; 

(iii) a bacteriophage; 

(iv) a viral capsid particle; and 



BNSDOCID: <WO 0O32227A2_l_> 



WO 00/32227 



PCT/IB99/01925 



-83- 



b) 
c) 

thereof. 

3. The composition of Claim 2, wherein said first and/or said second 
attachment sites comprise: 



a) 


an antigen and an antibody or antibody fragment thereto; 


b) 


biotin and avidin; 


c) 


strepavidin and biotin; 


d) 


a receptor and its ligand; 


e) 


a ligand-binding protein and its ligand; 


f) 


interacting leucine zipper polypeptides; 


g) 


an amino group and a chemical group reactive thereto; 


h) 


a carboxyl group and a chemical group reactive thereto; 


i) 


a sulfhydryl group and a chemical group reactive thereto; 


j) 


a combination thereof. 



4. The composition of Claim 3, wherein said second attachment site 
does not naturally occur with said antigen or antigenic determinant. 

5. The composition of Claim 2, where in said core particle is a 
recombinant alphavirus. 

6. The composition of Claim 5, wherein said recombinant alphavirus 
is Sindbis virus and said first attachment site and said second attachment site each 
comprise an interacting leucine zipper polypeptide. 



(v) a recombinant form of (i), (ii) r (iii) or (iv); and 
said organizer is a polypeptide or residue thereof; and 
said second attachment site is a polypeptide or residue 



WO 00/32227 



PCT/IB99/01925 



-84- 



7. The composition of Claim 6. wherein said first attachment site and 
said second attachment site are the JUN and/or FOS leucine zipper polypeptides. 

8. The composition of Claim 2, wherein said core particle is a virus- 
like particle. 

9. The composition of Claim 8, wherein said first attachment site is 
an amino group and said second attachment site is a sulfhydryl group. 

1 0. The composition of Claim 8, wherein said virus-like particle is a 
hepatitis B virus capsid protein. 

1 1 . The composition of Claim 10, wherein said first attachment site 
and said second attachment site each comprise an interacting leucine zipper 
polypeptide. 

12. The composition of Claim 1 1 , wherein said first attachment site 
is the JUN polypeptide and said second attachment site is the FOS polypeptide. 

13. The composition of Claim 10, wherein said first attachment site 
is a lysine residue and said second attachment site is a cysteine residue. 

14. The composition of Claim 8, wherein said virus-like particle is 
a Measles virus capsid protein. 

15. The composition of Claim 14, wherein said first attachment site 
and said second attachment site e<ich comprise an interacting leucine zipper 
polypeptide. 



WO 00/32227 



PCT/IB99/01925 



-85- 



1 6. The composition of Claim 1 5, wherein said first attachment site 
and said second attachment site are the JUN and/or FOS leucine zipper 
polypeptides. 

1 7. The composition of Claim 2, wherein said core particle is selected 
5 from the group consisting of: 

a) recombinant proteins of Rotavirus, 

b) recombinant proteins of Norwalk virus, 

c) recombinant proteins of Alphavirus, 

d) recombinant proteins of Foot and Mouth Disease virus, 
10 e ) recombinant proteins of Retrovirus, 

f) recombinant proteins of Hepatitis B virus, 

g) recombinant proteins of Tobacco mosaic virus, 

h) recombinant proteins of Flock House Virus, and 

i) recombinant proteins of human Papilomavirus. 

15 1 8 * The composition of Claim 1 7, wherein the first attachment site and 

the second attachment site each comprise an interacting leucine zipper 
polypeptide. 

1 9. The composition of Claim 1 7, wherein said first attachment site 
is an amino group and said second attachment site is sulfhydryl group. 



20 



20. The composition of Claim 1 , where in said core particle is of non- 
natural origin. 



21. The composition of Claim 20, wherein said core particle is 
selected from the group consisting of: 

a) synthetic polymer, 
2 ^ b) a lipid micelle, and 



INSDOCIO <WO OG32227A2_l_> 



WO 00/32227 PCT/IB99/0I925 

-86- 

c) a metal. 

22. The composition of Claim 21, wherein said first attachment site 
and said second attachment site each comprise an interacting leucine zipper 
polypeptide. 

5 23. The comppsition of Claim 22, wherein said first attachment site . 

and said second attachment site are the JUN and/or FOS leucine zipper 
polypeptides. 

24. The composition of Claim 1 , wherein said antigen i s selected from 
the group consisting of: 

10 a) proteins suited to induce an immune response against 

cancer cells, 

b) proteins suited to induce an immune response against 
infectious diseases, 

c) proteins suited to induce an immune response against 

15 allergens, and 

d) proteins suited to induce an immune response in farm 

animals. 

25. The composition of Claim 24, wherein said antigen is: 
a) a recombinant protein of HIV, 

20 b) a recombinant protein of Influenza virus, 

c) a recombinant protein of Hepatitis C virus, 

d) a recombinant protein of Toxoplasma, 

e) a recombinant protein of Plasmodium falciparum, 

f) a recombinant protein of Plasmodium vivax, 
25 g) a recombinant protein of Plasmodium ovale, 

h) a recombinant protein of Plasmodium malariae, 



BNSDOGia <WO 0032227A2_I_> 



WO 00/32227 



PCT/IB99/01925 



-87- 



0 


a recombinant protein of breast cancer cells, 


J) 


a recombinant protein of kidney cancer cells, 


k) 


a recombinant protein of prostate cancer cells, 


1) 


a recombinant protein of skin cancer cells, 


m) 


a recombinant protein of brain cancer cells, 


n) 


a recombinant protein of leukemia cells, 


o) 


a recombinant profiling, 


P) 


a recombinant protein of bee sting allergy, 


q) 


a recombinant protein of nut allergy, 


r) 


a recombinant protein of food allergies, or 


s) 


a recombinant protein of asthma, or 


t) 


a recombinant protein of Chlamydia. 



15 



26. The composition of Claim 24, wherein the first attachment site and 
the second attachment site each comprise an interacting leucine zipper 
polypeptide. 



20 



25 



27. A process for producing a non-naturally occurring, ordered and 
repetitive antigen array comprising: 

a) providing a non-naturally occurring molecular scaffold 

comprising: 

(i) a core particle selected from the group consisting 

of: 

(1) a core particle of non-natural origin; and 

(2) a core particle of natural origin; and 

(ii) an organizer comprising at least one first 

attachment site, 

wherein said organizer is connected to said core particle by at least one 
covalent bond; and 



NSDOCID: <WO_0032227A2_I_> 



WO 00/32227 



PCT/IB99/01925 



-88- 

b) providing an antigen or antigenic determinant with at least 
one second attachment site, said second attachment site being selected from the 
group consisting of: 

(i) an attachment site not naturally occurring with said 
antigen or antigenic determinant; and 

(ii) an attachment site naturally occurring with said 
antigen or antigenic determinant, 

wherein said second attachment site is capable of association 
through at least one non-peptide bond to said first attachment site; and 

c) combining said non-naturally occurring molecular scaffold 
and said antigen or antigenic determinant, 

wherein said antigen or antigenic determinant and said scaffold interact through 
said association to form an ordered and repetitive antigen array. 

28. The process of Claim 27, wherein 

a) said core particle is selected from the group consisting of: 

(i) a virus 

(ii) a virus-like particle; 

(iii) a bacteriophage; 

(iv) a viral capsid particle; and 

(v) a recombinant form of (i), (ii), (iii) or (iv); and 

b) said organizer is a polypeptide or residue thereof; and 

c) said second attachment site is a polypeptide or residue 

thereof. 

29. The process of Claim 28, wherein said first and/or said second 
attachment sites comprise: 

a) an antigen and an antibody or antibody fragment thereto; 

b) biotin and avidin; 

c) strepavidin and biotin; 



WO 00/32227 PCT/IB99/01925 

-89- 

d) a receptor and its ligand; 

e) N a Hgand-binding protein and its ligand; 

f) interacting leucine zipper polypeptides; 

g) an amino group and a chemical group reactive thereto; 
5 h) a carboxyl group and a chemical group reactive thereto; 

i) a sulfhydryl group and a chemical group reactive thereto; 

or 

j) a combination thereof. 

30. The process of Claim 29, wherein said second attachment site 
10 does not naturally occur with said antigen or antigenic determinant. 

3 1 . An isolated recombinant alphavirus comprising in its genome: 

a) a deletion of RNA packaging signal sequences; and 

b) a non-naturally occurring insertion of the JUN leucine 
zipper protein domain nucleic acid sequence in frame with said alphavirus' E2 

1 5 envelope protein nucleic acid sequence. 

32. A host cell comprising the recombinant alphavirus of Claim 3 1 . 

33. A method of medical treatment comprising administering to a 
subject the composition of Claim 1 . 

34. A pharmaceutical composition comprising: 
20 a) the composition of Claim 1 ; and 

b) an acceptable pharmaceutical carrier. 

35. A method of immunization comprising administering to a subject 
a composition comprising: 

a) a non-naturally occurring molecular scaffold comprising: 



3NSDOCID: <WO 0O32227A2J_> 



WO 00/32227 PCT/IB99/0I925 

-90- 

(i) a core particle selected from the group consisting 

of: 

(1) a core particle of non-natural origin; and 

(2) a core particle of natural origin; and 

5 (ii) an organizer comprising at least one first 

attachment site, 

wherein at least one said organizer is connected to said core particle by at 
least one covalent bond; and 

b) an antigen or antigenic determinant with at least one 
1 0 second attachment site, said second attachment site being selected from the group 

consisting of: 

(i) an attachment site not natural ly occurring with said 
antigen or antigenic determinant; and 

(ii) an attachment site naturally occurring with said 
1 5 antigen or antigenic determinant, 

wherein said second attachment site is capable of association through at 
least one non-peptide bond to said first attachment site; and 
wherein said antigen or antigenic determinant and said scaffold interact through 
said association to form an ordered and repetitive antigen array. 

20 36. The method of Claim 35, wherein said immunization produces an 

immune response. 

37. The method of Claim 35, wherein said immunization produces a 
humoral immune response. 

38. The method of Claim 35, wherein said immunization produces a 
25 cellular immune response. 



BNSDOCID: <WO 0032227A2 I > 



WO 00/32227 



PCT/IB99/01925 



-91- 



39. The method of Claim 35, wherein said immunization produces a 
humoral immune response and a cellular immune response. 

40. The method of Claim 35, wherein said immunization produces a 
protective response. 

5 41 . A vaccine composition comprising: 

a) a non-naturally occurring molecular scaffold comprising: 

(i) a core particle selected from the group consisting 

of: 

(1) a core particle of non-natural origin; and 
10 (2) a core particle of natural origin; and 

(ii) an organizer comprising at least one first 

attachment site, 

wherein at least one said organizer is connected to said core particle by at 
least one covalent bond; and 
15 b) an antigen or antigenic determinant with at least one 

second attachment site, said second attachment site being selected from the group 
consisting of: 

(i) an attachment site not naturally occurring with said 
antigen or antigenic determinant; and 
20 (ii) an attachment site naturally occurring with said 

antigen or antigenic determinant, 

wherein said second attachment site is capable of association through at 
least one non-peptide bond to said first attachment site; and 
wherein said antigen or antigenic determinant and said scaffold interact through 
25 said association to form an ordered and repetitive antigen array. 

42. The vaccine composition of Claim 41 further comprising an 
adjuvant. 



3NSDOC1D: <WO 0032227A2_I_> 



WO 00/32227 



PCT/IB99/01925 



-92- 



43. The vaccine composition of Claim 4 1 , wherein: 

a) said core particle is selected from the group consisting of: 

(i) a virus 

(ii) a virus-like particle; 
5 (iii) a bacteriophage; 

(iv) a viral capsid particle; and 

(v) a recombinant form of (i), (ii) 5 (iii) or (iv); and 

b) said organizer is a polypeptide or residue thereof; and 

c) said second attachment site is a polypeptide or residue 

10 thereof. 



44. The vaccine composition of Claim 43, wherein said first and/or 
said second attachment sites comprise: 





a) 


an antigen and an antibody or antibody fragment thereto; 




b) 


biotin and avidin; 


15 


c) 


strepavidin and biotin; 




d) 


a receptor and its ligand; 




e) 


a ligand-binding protein and its ligand; 




0 


interacting leucine zipper polypeptides; 




g) 


an amino group and a chemical group reactive thereto; 


20 


h) 
i) 


a carboxyl group and a chemical group reactive thereto; 
a sulfhydryl group and a chemical group reactive thereto; 



or 

j) a combination thereof. 



45. The vaccine composition of Claim 43, wherein said core particle 
comprises a virus-like particle. 



BNSDOCID: <WO 0032227 A2_l_> 



WO 00/32227 



PCT/IB99/0I925 



-93- 

46. The vaccine composition of Claim 45, wherein said core particle 
comprises a Hepatitis B virus-like particle. 

47. The vaccine composition of Claim 45, wherein said core particle 
comprises a measles virus-like particle. 

48. The vaccine composition of Claim 43, wherein said core particle 
comprises a virus. 

49. The vaccine composition of Claim 48, wherein said core particle 
comprises the Sindbis virus. 



WO 00/32227 



PCT/1B99/01925 



1/7 

TE1 

positive control 



E2 
JUN 



• "nifties 






« 



.4 



I 

BHK 

cell culture 
(negative control) 



FIG.1 



E2 
(TE) 



SUBSTITUTE SHEET (RULE 26) 



BNSDOCID: <WO 0032227 A2 1 > 



WO 00/32227 



PCT/IB99/01925 



2/7 



CM 



O 
O 

a> 




CO IjJ 



CO 

o 



O 
o 

Q> 

~o 
cn 
a> 



CNI 

So 



CN 



* m 



cm ^ 



SUBSTITUTE SHEET (RULE 26) 



tNSDOCID: <WO 0032227A2_L> 



WO 00/32227 



PCT/IB99/01925 



3/7 




^ c 
8 ° 
2.° 



SUBSTITUTE SHEET (RULE 26) 



BNSDOCIO. <WO 0032227 A2 1 > 



WO 00/32227 



PCT/IB99/01925 




WSOOCID: <WO 0032227 A2_l_> 



SUBSTITUTE SHEET (RULE 28) 



WO 00/32227 



5/7 



PCT/IB99/01925 



12 3 4 




HBcAg-JUN 



FIG. 5 



BNSDOCID: <WO 0032227A2_I_> 



SUBSTTrUTH SHEET (RULE 26) 



WO 00/32227 



PCT/IB99/01925 



6/7 




SUBSTITUTE SHEET (RULE 26) 

BMSDOCIO. <WO_O032227A2_1_> 



WO 00/32227 PCT/1B99/01925 f 

7/7 



1 2 3 




FIG. 7 



BNSDOCID: <WO 0032227A2 I > 



SUBSTITUTE SHEET (RULE 26) 



WORLD INTELLECTUAL PROPERTY ORGANIZATION 
International Bureau 




PCT 

INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) 



(51) International Patent Classification 7 : 
A61K 47/00, C12N 7/01, 5/12 



A3 



(11) International Publication Number: 
(43) Internati nal Publication Date: 



WO 00732227 

8 June 2000 (08.06.00) 



(21) International Application Number: PCT/IB99/01925 

(22) International Filing Date: 30 November 1999 (30. II. 99) 



(30) Priority Data: 
60/110,414 
60/142/788 



30 November 1 998 (30. 1 1 .98) US 
8 July 1999 (08.07.99) US 



(71) Applicant: CYTOS BIOTECHNOLOGY AG [CH/CH]; Wag- 

istrasse 21, CH-8952 Zurich (CH). 

(72) Inventors: RENNER, Wolfgang, A.; Weinbergstrasse 64, 

CH-8006 Zurich (CH). HENNECKE, Frank; Bombachsteig 
16, CH-8049 Zurich (CH). NIEBA, Lars; Gottfried-Keller 
Strasse 63B, CH-8400 Winterthur (CH). BACHMANN, 
Martin; Sternengasse 8, CH-4125 Riehen (CH). 



(81) Designated States: AE, AL, AM, AT, AU, AZ, BA, BB, BG, 
BR, BY, CA, CH, CN, CR, CU, CZ, DE, DK, DM, EE, 
ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP, 
KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MA, 
MD, MG, MK, MN, MW, MX, NO, NZ, PL, PT, RO, RU, 
SD, SE, SG, SI, SK, SL, TJ, TM f TR, TT, TZ, UA, UG, 
UZ, VN, YU, ZA, ZW, ARIPO patent (GH, GM, KE, LS, 
MW, SD, SL, SZ, TZ, UG, ZW), Eurasian patent (AM, AZ, 
BY, KG, KZ, MD, RU, TJ, TM), European patent (AT, BE, 
CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, 
NL, PT, SE), OAPI patent (BF, BJ, CF, CG, CI, CM, GA, 
GN, GW, ML, MR, NE, SN, TD, TG). 

Published 

With international search report. 

(88) Date of publication of the international search report: 

1 2 October 2000 ( 1 2. 1 0.00) 



(54) Title: ORDERED MOLECULAR PRESENTATION OF ANTIGENS, METHOD OF PREPARATION AND USE 



(57) Abstract 



The invention provides compositions and processes for the production of ordered and repetitive antigen or antigenic determinant 
arrays. The compositions of the invention are useful for the production of vaccines for the prevention of infectious diseases, the treatment 
of allergies and the treatment of cancers. Various embodiments of the invention provide for a virus, virus-like particle, viral capsid particle, 
phage or recombinant form thereof coated with any desired antigen in a highly ordered and repetitive fashion as the result of specific 
interactions. In one specific embodiment, a versatile new technology based on a cassette-type system (Alpha Vaccine Technology) allows 
production of antigen coated viral particles. Other specific embodiments allow the production of antigen coated hepatitis B virus-like 
particles or antigen coated Measles virus-like particles. 



y. <WO 0032227A3J_> 



FOR THE PURPOSES OF INFORMATION ONLY 



Codes used to identify States party to the PCT on the front pages of pamphlets publishing international applications under the PCT. 



AL 


Albania 


ES 


Spam 


IS 


Lesotho 


SI 


Slovenia 


AM 


Armenia 


Fl 


Finland 


LT 


Lithuania 


SK 


Slovakia 


AT 


Austria 


FR 


France 


LU 


Luxembourg 


SN 


Senegal 


AU 


Australia 


GA 


Gabon 


LV 


Latvia 


sz 


Swaziland 


AZ 


Azerbaijan 


GB 


United Kingdom 


MC 


Monaco 


TD 


Chad 


BA 


Bosnia and Herzegovina 


GE 


Georgia 


MD 


Republic of Moldova 


TG 


Togo 


BB 


Barbados 


GH 


Ghana 


MG 


Madagascar 


TJ 


Tajikistan 


BE 


Belgium 


GN 


Guinea 


MK 


The former Yugoslav 


TM 


Turkmenistan 


BF 


Burkina Faso 


GR 


Greece 




Republic of Macedonia 


TR 


Turkey 


BG 


Bulgaria 


HU 


Hungary 


ML 


Mali 


TT 


Trinidad and Tobago 


BJ 


Benin 


IE 


Ireland 


MN 


Mongolia 


UA 


Ukraine 


BR 


Brazil 


IL 


Israel 


MR 


Mauritania 


UG 


Uganda 


BY 


Belarus 


IS 


Iceland 


MW 


Malawi 


US 


United States of America 


CA 


Canada 


IT 


Italy 


MX 


Mexico 


uz 


Uzbekistan 


CF 


Central African Republic 


JP 


Japan 


NE 


Niger 


VN 


Viet Nam 


CG 


Congo 


KE 


Kenya 


NL 


Netherlands 


YU 


Yugoslavia 


CH 


Switzerland 


KG 


Kyrgyzstan 


NO 


Norway 


ZW 


Zimbabwe 


a 


Cdte d*l voire 


KP 


Democratic People's 


NZ 


New Zealand 






CM 


Cameroon 




Republic of Korea 


PL 


Poland 






CN 


China 


KR 


Republic of Korea 


PT 


Portugal 






CU 


Cuba 


KZ 


Kazakstan 


RO 


Romania 






CZ 


Czech Republic 


LC 


Saint Lucia 


RU 


Russian Federation 






DE 


Germany 


LI 


Liechtenstein 


SD 


Sudan 






DK 


Denmark 


LK 


Sri Lanka 


SE 


Sweden 






EE 


Estonia 


LR 


Liberia 


SG 


Singapore 







BNSDOCID: <WO 0032227A3_L> 



INTERNATIONAL SEARCH REPORT 



Interna al Application No 

PCT/IB 99/01925 



A. CLASSIFICATION OF SUBJECT MATTER 

IPC 7 A61K47/G0 C12N7/01 



C12N5/12 



According to International Patent Classification (IPC) or to both national classification and IPC 



B. FIELDS SEARCHED 



Minimum documentation searched (classification system followed by classification symbols) 

IPC 7 A61K C12N 



Documentation searched other than minimum documentation to the extent that such documents are included in the fields searched 



Electronic data base consulted during the international search (name of data base and, where practical, search terms used) 



C. DOCUMENTS CONSIDERED TO BE RELEVANT 



Category * 



Citation of document, with indication, where appropriate, of the relevant passages 



Relevant to claim No. 



ESPOSITO, GENNARO (1) ET AL: 
"Conformational study of a short pertussis 
toxin T cell epitope incorporated in a 
multiple antigen peptide template by CD 
and two-dimensional NMR: Analysis of the 
structural effects on the activity o 
synthetic immunogens. " 

EUROPEAN JOURNAL OF BIOCHEMISTRY, (1993) 

VOL. 217, NO. 1, PP. 171-187. , 

XP000910191 

the whole document 



1-30, 
34-49 



Further documents axe fisted in the continuation of box C. 



0 



Patent family members are listed in annex. 



• Special categories of cited documents : 

*A" document defining the general state of the art which is not 

considered to be of particular relevance 
"E* earlier document but published on or after the international 

filing date 

"L" document which may throw doubts on priority cIaim(s)or 
which is cited to establish the publication date of another 
citation or other special reason (as specified) 

•O* document referring to an oral disclosure, use, exhibition or 
other means 

"P* document published prior to the international filing date but 
later than the priority date claimed 



T" later document published after the international filing date 
or priority date and not in conflict with the application but 
cited to understand the principle or theory underlying the 
invention 

"X" document of particular relevance; the claimed invention 
cannot be considered novel or cannot be considered to 
involve an inventive step when the document is taken alone 

"Y* document of particular relevance; the claimed invention 

cannot be considered to involve an inventive step when the 
document is combined with one or more other such docu- 
ments, such combination being obvious to a person skilled 
in the art 

" V document member of the same patent family 



Date of the actual completion of the international search 



19 June 2000 



Date dl mailing of the international search report 



2 3- oarj$ 



Name and mailing address of the ISA 

European Patent Office, P.B. 581 B Patentlaan 2 
NL - 2280 HV Rijswijk 
Tel. (+31-70) 340-2040, Tx. 31 651 epo nl, 
Fax: (+31-70)340-3016 



Authorized officer 



Mennessier, T 



Form PCT/rSA/210 (second sheet) (Juty 1992) 



page 1 of 2 



3NSDOCID: <WO 0092227 A3_l_> 



INTERNATIONAL SEARCH REPORT 



C(Continuation) DOCUMENTS CONSIDERED TO BE RELEVANT 



Intern; al Application No 

PCT/IB 99/01925 



Category • 



Citation of document, with indication, where appropriate, of the relevant passages 



BACHMANN H F ET AL: "The influence of 
virus structure on antibody responses and 
virus serotype formation." 
IMMUNOLOGY TODAY, (1996 DEC) 17 (12) 
553-8. REF: 48 , XP004071007 
cited in the application 
the whole document 

WO 94 15585 A (UNIV CALIFORNIA) 
21 July 1994 (1994-07-21) 
page 6 -page 12 

FROLOV, ILYA ET AL: "Alphavirus -based 
expression vectors: Strategies and 
applications" 

PROC. NATL. ACAD. SCI. U. S. A. (1996), 
93(21), 11371-11377 , XPOO091O193 
the whole document 

BOORSMA M ET AL: "A temperature-regulated 
repl icon-based DNA expression system." 
NATURE BIOTECHNOLOGY, (2000 APR) 18 (4) 
429-32. , XPO009 10192 
the whole document 



Relevant to claim No. 



1-30, 
34-49 



1-30, 
34-49 



31-33 



31-33 



Form PCT/tSA/210 (continuation o* second sheet) (July 1992) 



page 2 of 2 



BNSDOCID: <WO 0032227 A3_l_> 



INTERNATIONAL SEARCH REPORT 



lnte...ational application No. 

PCT/IB 99/01925 



Box I Observations where certain claims were found unsearchable (Continuation of item 1 of first sheet) 



This International Search Report has not been established in respect of certain claims under Article I7(2)(a) for the following reasons: 
1 | X I Cla ' ms Nos : 

because they relate to subject matter not required to be searched by this Authority, namely: 

Although claims 35-40 are directed to a method of treatment of the 
human/animal body, the search has been carried out and based on the alleged 
effects of the composition. 



□ 



Claims Nos.: 

because they relate to parts of the International Application that do not comply with the prescribed requirements to such 
an extent that no meaningful International Search can be carried out, specifically: 



□ 



Claims Nos.: 

because they are dependent claims and are not drafted in accordance with the second and third sentences of Rule 6.4(a). 



Box II Observations where unity of invention is lacking (Continuation of item 2 of first sheet) 



This International Searching Authority found multiple inventions in this international application, as follows: 



1 . I | As all required additional search fees were timely paid by the applicant, this International Search Report covers all 
' ■ searchable claims. 

2. | | As all searchable claims could be searched without effort justifying an additional fee, this Authority did not invite payment 

of any additional fee. 



3. I | As only some of the required additional search fees were timely paid by the applicant, this International Search Report 
' ' covers only those claims for which fees were paid, specifically claims Nos.: 



4. | | No required additional search fees were timely paid by the applicant. Consequently, this International Search Report is 
restricted to the invention first mentioned in the claims; it is covered by claims Nos.: 



Remark on Protest | | The additional search fees were accompanied by the applicant's protest. 

| [ No protest accompanied the payment of additional search fees. 



Form PCT/ISA/210 (continuation of first sheet (1)) (July 1998) 

NSDOCID: <WO_0032227A3J_> 



INTERNATIONAL SEARCH REPORT 

I, formation on patent family members 



Patent document 
cited "m search report 



Publication 
date 



WO 9415585 



21-07-1994 



Intern; al Application No 

PCT/IB 99/01925 



Patent family 
members) 



Publication 
date 



us 


5334394 


A 


02-08-1994 


AU 


5600994 


A 


15-08-1994 


AU 


5726694 


A 


15-08-1994 


AU 


6955494 


A 


15-08-1994 


CA 


2152379 


A 


21-07-1994 


CA 


2152490 


A 


21-07-1994 


CA 


2153147 


A 


16-03-1999 


EP 


0689421 


A 


03-01-1996 


EP 


0676954 


A 


18-10-1995 


EP 


0676955 


A 


18-10-1995 


JP 


8505788 


T 


25-06-1996 


JP 


8505387 


T 


11-06-1996 


JP 


2875629 


B 


31-03-1999 


JP 


9504265 


T 


28-04-1997 


US 


5306508 


A 


26-04-1994 


US 


5441739 


A 


15-08-1995 


WO 


9415581 


A 


21-07-1994 


WO 


9415586 


A 


21-07-1994 


US 


5460830 A 


24-10-1995 


US 


5462751 


A 


31-10-1995 


US 


5460831 


A 


24-10-1995 


US 


5464634 


A 


07-11-1995 


US 


5639505 


A 


17-06-1997 



Fom> PCT/ISA/210 (pal en) family annex) (July 
BNSOOCID: <WO 0O32227A3 I >