Skip to main content

Full text of "USPTO Patents Application 09848616"

See other formats


Document AP3 
Appl.No. 09/848,616 



WORLD INTELLfeQWMi- PROPERTY ORGANIZATION 
Jnternational Bureau 




PCT 

INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) 



(51) International Patent Classification 6 : 

C12N 15/86, 9/12, C07K 14/18, A61K 
48/00, A01K 67/027, C12N 5/10, 7/04 



Al 



(11) International Publication Number: WO 99/50432 

(43) International Publication Date: 7 October 1999 (07.10.99) 



(21) International Application Number: PCT/IB99/00523 

(22) International Filing Date: 25 March 1999 (25.03.99) 



(30) Priority Data: 

60/079,562 



27 March 1998 (27.03.98) 



US 



(71) Applicant (for all designated States except US): CYTOS 
, BIOTECHNOLOGY AG [CH/CH]; Einsteinstrasse, 
CH-8093 Zurich (CH). 

(71)(72) Applicants and Inventors: RENNER, Wolfgang, A. 
[CH/CH]; Weinbergstrasse 64, CH-8006 Zurich (CH). 
NIEBA, Lars [DE/CH]; Gottfried-Keller Strasse 63B, 
CH-^8400 Winterthur (CH). BOORSMA, Marco [NI7NL]; 
Telemannstraat lOd, NL-8915 CB Leeu Warden (NL). 



(81) Designated States: AE, AL, AM, AT, AU, AZ, BA, BB, BG, 
BR, BY, CA, CH, CN, CU, CZ, DE, DK, EE, ES, FI t GB, 
GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP, KE, KG, 
KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MD, MG, MK, 
MN, MW, MX, NO, NZ, PL, PT, RO. RU, SD, SE, SG, SI, 
SK, SL, TJ, TM, TR, TT, UA, UG, US, UZ, VN f YU, ZA, 
ZW, ARIPO patent (GH, GM, KE, LS, MW, SD, SL, SZ, 
UG, ZW), Eurasian patent (AM, AZ, BY, KG, KZ, MD, 
RU, TJ, TM), European patent (AT, BE, CH, CY, DE, DK, 
ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), OAPI 
patent (BF, BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR, 
NE, SN, TD, TG). 



Published 

With international search report. 

Before the expiration of the time limit for amending the 
claims and to be republished in the event of the receipt of 
amendments. 



(54) Title: INDUCIBLE ALPHA VIRAL GENE EXPRESSION SYSTEM 



fSVFftV 

OM (1) — 



XSPI HSP2 HSP3 HSM 



IRMSUTONOr 



j (2) IRAKSttfTON 



w 



(-) fcu (S) 

(♦) (in 

u% UNA 



-1?' 



(7) KPUCAllQN OUT 
AT IW TTUPWMWE 



) ftPUOUJON 



CJOX 



JC2 



-CO. MA 



KAMSUllON 
2nd Off 



(«0 



IRWSUUOI 
Of 2nd CRT 

crt Ana 



(U) ' ttt - jgrarM - 



(12) 



(57) Abstract 



The present invention provides novel expression vectors which permit tight regulation of gene expression in eucaryotic cells. More 
specifically, the invention provides DNA vectors comprising nucleotide sequences that are transcribed to form RNA molecules which are 
then replicated by a temperature-sensitive replicase to form additional RNA molecules. The RNA molecules produced by replication 
contain a nucleotide sequence which may be translated to produce a protein of interest or which encode one or more untranslated RNA 
molecules. Also provided are methods for producing heterologous proteins and untranslated RNA molecules. Further provided are methods 
for administering heterologous proteins and untranslated RNA molecules to individuals. In addition, pharmaceutical compositions are 
provided comprising the DNA and RNA molecules of the invention and a pharmaceutical^ acceptable carrier. 



FOR THE PURPOSES OF INFORMATION ONLY 
Codes used to identify States party to the PCT on the front pages of pamphlets publishing international applications under the PCT. 



AL 


Albania 


RS 


Spain 


LS 


Lesotho 


SI 


Slovenia 


AM 


Armenia 


FI 


Finland 


LT 


Lithuania 


SK 


Slovakia 


AT 


Austria 


FR 


France 


LU 


Luxembourg 


SN 


Senegal 


AU 


Australia 


GA 


Gabon 


LV 


Latvia 


sz 


Swaziland 


AZ 


Azerbaijan 


GB 


United Kingdom 


MC 


Monaco 


TD 


Chad 


DA 


Bosnia and Herzegovina 


GE 


Georgia 


MD 


Republic of Moldova 


TG 


Togo 


BB 


Barbados 


GH 


Ghana 


MG 


Madagascar 


TJ 


Tajikistan 


BE 


Belgium 


GN 


Guinea 


MK 


The former Yugoslav 


TM 


Turkmenistan 


BF 


Burkina Faso 


GR 


Greece 




Republic of Macedonia 


TR 


Turkey 


BG 


Bulgaria 


HU 


Hungary 


ML 


Mali 


TT 


Trinidad and Tobago 


BJ 


Benin 


IE 


Ireland 


MN 


Mongolia 


UA 


Ukraine 


BR 


Brazil 


IL 


Israel 


MR 


Mauritania 


UG 


Uganda 


BY 


Belarus 


IS 


Iceland 


MW 


Malawi 


US 


United States of America 


CA 


Canada 


IT 


Italy 


MX 


Mexico 


UZ 


Uzbekistan 


CF 


Central African Republic 


JP 


Japan 


NE 


Niger 


VN 


Viet Nam 


CG 


Congo 


KE 


Kenya 


NL 


Netherlands 


YU 


Yugoslavia 


CH 


Switzerland 


KG 


Kyrgyzstan 


NO 


Norway 


ZW 


Zimbabwe 


CI 


Cdte d*Ivoire 


KP 


Democratic People's 


NZ 


New Zealand 






CM 


Cameroon 




Republic of Korea 


PL 


Poland 






CN 


China 


KR 


Republic of Korea 


PT 


Portugal 






cu 


Cuba 


KZ 


Kazakstan 


RO 


Romania 






cz 


Czech Republic 


IX 


Saint Lucia 


RU 


Russian Federation 






DE 


Germany 


LI 


Liechtenstein 


SD 


Sudan 






DK 


Denmark 


LK 


Sri Lanka 


SE 


Sweden 






KR 


Estonia 


LR 


Liberia 


SG 


Singapore 







WO 99/50432 



PCT/IB99/00523 



-1- 

INDUCIBLE ALPHAVIRAL GENE EXPRESSION SYSTEM 
Background of the Invention 

Field of the Invention 

The present invention relates to novel expression vectors which permit 
tight regulation of gene expression in eucaryotic cells. The invention also relates 
to methods for producing proteins and RNA molecules and methods for 
administering proteins and RNA molecules to a plant or animal. 

Related Art 

The ability to precisely control the expression of genes introduced into 
animal or human cells, or in whole organisms, will enable significant progress in 
many areas of biology and medicine. For instance, methods that allow the 
intentional manipulation of gene expression will facilitate the analysis of genes 
whose expression cannot be tolerated constitutively or at a certain stage of 
development. These methods will also be valuable for clinical applications such 
as gene therapy, where the expression of a therapeutic gene must be regulated in 
accordance with the needs of the patient. 

To be of broad benefit, gene regulation techniques must allow for rapid, 
robust, precise and reversible induction of gene activity. As reviewed in Sacz. E. 
et ai. (Curr. Opin. Bioiechnoi <Y:608-616 (1997)). an ideal system should fulfill 
the following requirements: 

1 . Specificity — The system must be indifferent to endogenous factors and 
activated only by exogenous stimuli. 

2. Non-interference - The components of the system should not affect 
unintended cellular pathways. 

3. Inducibility - In the inactive state, the basal activity of the system should 
be minimal, while in the active state high levels of gene expression should 
be rapidly inducible. 



CONFIRMATION COFY 



WO 99/50432 



PCT/1B99/00523 



-2- 

4. Bioavailability of the inducer - Inducing stimuli should rapidly penetrate 
to the site of interest. 

5. Reversibility - Inducing stimuli should clear swiftly to allow the system 
to rapidly return to the inactive state. 

Early methods for controlling gene expression in mammals were based on 
endogenous elements, such as cytokine response elements or heat-shock proteins. 
Due to a high level of basal expression in the uninduced state, and pleiotropic 
effects brought about by general inducing agents, these systems lacked the 
specificity required to regulate genes in mammalian cells and organisms. 

More advance schemes have sought to avoid these problems by 
constructing switching mechanisms that rely on non-mammalian elements. The 
fundamental principle of these systems is based on the existence of a small 
molecule (the inducer) that modifies the activity of a synthetic transcription factor 
which regulates the expression of the target gene through a heterologous 
promoter. Increased specificity is achieved by selecting inducers that do not 
affect mammalian physiology, and by assembling chimeric transactivators with 
minimal homology to natural transcription factors which do not interact with 
endogenous mammalian promoters. 

The most common system currently in use for the regulation of gene 
expression is the tetracycline-based system { Gossen and Bujard. Proc. Natl. Acad 
Sci. USA 89:5541 ( 1 992)). This system is based on the continuous expression of 
a fusion protein where the tetracycline repressor protein (tetR) is converted into 
an activator by fusion to the transcriptional activation domain of the VP 16 
protein. In the absence of tetracycline, this chimeric tetracycline transfcetivator 
(tTA) activates gene expression through binding to a multimer of the natural tetR 
binding site (tetO) placed upstream of a minimal promoter. In the presence of 
tetracycline, the tTA undergoes a conformational change that prevents it from 
binding to the tetO site, thereby arresting expression of the target gene. Because 
of its significant advantages over the existing approaches, the tTA system is 
highly useful for inducible gene expression and this system has been successfully 
used for the production of a number of proteins i Wimmel et al.. Oncogene 9:995 
(1994):Fruhm//.. EMBOJ. 75:3236(1994): Yuei al. J. Virol. ~0A530 ( 1 996)). 



WO 99/50432 



PCT/IB99/00523 



However, serious problems resulting from the toxicity of the tTA protein 
have been reported with the tTA system, and several cell types have been shown 
to be unable to tolerate expression of the tTA protein (Schocket et aL. Proc. Nail. 
Acad ScL USA 92:6522 (1995); Howe et at.. J. Biol. Chem. 23: 14 168 (1995): 
Schocket and Schatz. Proc. Natl. Acad ScL USA 93:5173 (1996): Bohl et aL 
Nat. Med. 5:299 ( 1 997)). While the toxicity of tTA in cultured cells encumbers 
the establishment of stable clones with proper tetracycline regulation, this tTA 
toxicity is a more significant problem in gene therapy and may prevent the use of 
the tTA system in gene therapy altogether. 

A further problem of the tTA system is its notable degree of basal 
expression. Basal expression can result from the activation of the reporter 
constructs in the absence of bound transactivator, and/or the inability of 
tetracycline to completely quell tTA transactivation. High basal expression limits 
the inducibility of the system, and prevents the conductance of experiments with 
highly toxic proteins (Furth et aL Proc. Natl. Acad. Sci. USA 97:9302 (1994); 
Hennighausen et aL J. Cell. Biochem. 59:463 (1995) Kistner et aL Proc. Natl 
Acad. ScL USA 93:10933 (1996); Hoffmann et at. , Nucleic Acids Res. 25:1078 
(1997)). 

In the case of stable clones or transgenic animals, some of this basal 
expression can be attributed to interference from chromosomal regions into which 
the foreign DNA integrates. While all inducible systems are equally susceptible 
to integration effects, it is possible that the basal activity of the tTA system is due 
to the fact that this system requires the constant presence of tetracycline to 
efficiently suppress transcription, something that may not always be attainable, 
particularly in vivo. Basal expression and the requirement that tetracycline be 
present to suppress gene expression are reasons why the tTA system is not used 
in gene therapy. 

Two gene control systems based on components of mammalian steroid 
hormone receptors are known (Saez. E. ct aL Curr. Opin. Biotechnol. 5:608-6 1 6 
(1997)). Both combine a truncated form of the progesterone receptor hormone- 
binding domain with the yeast GAL4 DNA-binding moiety, and the 
transactivation domain of VP 16 protein. The mutated progesterone receptor 



WO 99/50432 



PCT/IB99/00523 



-4- 

moiety fails to bind progesterone, but it retains the ability to bind the 
progesterone and glucocorticoid antagonist mifepristone (RU486). such that, in 
the presence of RU486. the fusion protein (called GVLP or TAXI) activates 
transcription through a multimer of the GAL4 DNA binding site placed upstream 
of a minimal promoter. 

An important advantage of the systems described immediately above is 
that they appear to have more favorable kinetics than tetracycline approaches 
because lipophilic hormones are quickly metabolized and have short half-lives in 
vivo. Further, such hormones may also penetrate less accessible tissues more 
efficiently than tetracycline. However, the main disadvantage of the hormone 
receptor systems is their very high level of basal expression. In transient and 
stable transfections of various cell types, a high level a basal activity dampens the 
inducibility of theses approaches, resulting in induction ratios that are rarely over 
20-fold (Wang et aL, Proc. Natl. Acad Sci. USA 97:8180 (1994); Mangelsdorf 
et aL Cell 55:835 (1995); Wang et aL Nat. Biotech. 75:239 (1997)). 

Another approach to regulating gene expression relies on a method of 
inducing protein dimerization derived from studies on the mechanism of action 
of immunosuppressive agents (Saez. E. etal, Curr. Opin. Biotechnol 5:608-616 
(1997)). Using a synthetic homodimer of FK506, a general strategy was devised 
to bring together any two peptides simply by endowing them with the domain of 
FKBP12 to which FK506 binds. Since immunosuppressive drugs, such as 
cyclosporin A or rapamycin must be used in this approach, the in vivo application 
of this protein dimerization approach is very limited. 

AH of the above mentioned strategies regulate expression by controlling 
the level of transcription of mRNA. Since this mRNA transcription mechanism 
is always influenced to some extent by the chromosomal region into which the 
foreign DNA is inserted, precise regulation fails due to the lack of control over 
the integration mechanism. Although techniques are available for the 
site-specific insertion of DNA by homologous recombination, insertion 
frequencies are far too low to allow this strategy to succeed for gene therapy on 
a general basis. 



WO 99/50432 



PCT/IB99/00523 



-5- 

Another gene expression system is based on alphaviruses (Lundstrom. K., 
Curr. Opin. Biotechnol. 5:578-582 (1997)). Several members of the alphavirus 
family, Sindbis ( Xiong, C. et aL. Science 243: 1188-1191(1 989): Schlesinger, S.. 
Trends Biotechnol. 77:18-22 (1993)), SFV (Liljestrom. P. & Garoff. H M 
Bio/Technology- 9:1356-1361 (1991)) and others (Davis. N.L. et aL, Virology 
17T.\ 89-204 ( 1 989)), have received considerable attention for the use as virus- 
based expression vectors for a variety of different proteins (Lundstrom, K., Curr. 
Opin. Biotechnol. 5:578-582 (1997); Liljestrom. P.. Curr. Opin. Biotechnol. 
5:495-500(1994)). 

Alphaviruses are positive stranded RNA viruses which replicate their 
genomic RNA entirely in the cytoplasm of the infected cell and without a DNA 
intermediate (Strauss, J. and Strauss, E., Microbiol. Rev. 55:491-562 (1994)). 
The concept that alphaviruses can be developed as expression vectors was first 
established nearly ten years ago (Xiong, C. et al. . Science 243 : 1 1 88- 1 1 9 1 ( 1 989)). 
Since then, several improvements have made the use of these RNA replicons as 
expression vectors more practical (Lundstrom, K.. Curr. Opin. Biotechnol. 5:578- 
582(1997)). 

DNA vectors have been developed for both Sindbis (Herweijer, H. et aL. 
Hum. Gene Ther. 6:1495-1501 (1995): Dubensky. T.W. et aL. J. Virol. 70:508- 
519(1 996)) and SFV (Berglund, P. et aL. Trends Biotechnol. 77:130-134(1 996)). 
Eukaryotic promoters are introduced in these vectors upstream from the 
alphavirus replicase gene (consisting of the four non-structural protein genes 
(nsPl-4)) which are translated as one or two polyproteins which are then 
proteolytically cleaved (Strauss, J. and Strauss. E.. Microbiol. Rev. 55:491-562 
( 1 994)). DNA is transcribed to RNA from the recombinant eukaryotic promoter 
in the nucleus and transported to the cytoplasm, where the replicase catalyzes the 
replication of the alphavirus RNA molecule as during normal replication of the 
alphavirus RNA molecule (Strauss, J. and Strauss. E.. Microbiol. Rev. 55:491- 
562 (1994)). Only transient expression of heterologous sequences has been 
possible until recently due to the cytopathogeniciiy of the alphavirus replicase 
(Lundstrom. K.. Curr. Opin. Biotechnol. 5:578-582 f 1 997)). 



WO 99/50432 



PCT/IB99/00523 



-6- 

About 20 years ago Weiss et al. (Weiss. B. et al. J, Virol. JJ:463-474 
( 1 980)) established a persistently infected culture of BHK cells. The mutation 
responsible for this phenotype has been recently identified (Dryga, S.A. et al. 
Virology 225:74-83 (1997)). Another mutation allowing the regulation of the 
mRNA transcription via temperature shifts was identified by Burge and 
Pfefferkorn (Burge, B.W. & Pfefferkorn. E.R. ? Virology 50:203-214 ( 1 966)) and 
described in more detail by Xiong et al. (Xiong, C. et aL Science 243: 1 1 88-1 1 91 
(1989)). 

Vectors containing alphaviral sequences have been developed which show 
promise for use in DN A immunizations (Hariharan,M.e/ al J. Virol. 72:950-958 
(1998)), ribozyme expression (Smith S. et aL 1 Virol. 77:9713-9721 (1997)), 
and in vivo expression of heterologous proteins in mammalian tissues 
(Altman-Hamamdzic S. et aLGene Ther. 7:815-822 (1997)). 

Summary of the Invention 

1 5 The present invention provides compositions and methods for regulated 

expression of proteins or untranslated RN A molecules in recombinant host cells. 
More specifically, the present invention provides polynucleotides and methods 
which allow precise regulation of the amount of specific RNA molecules 
produced in stably transfected recombinant host cells. This precise regulation 

20 results from the use of a temperature-sensitive RNA-dependent RNA polymerase 

(i.e., a replicase) which only replicates RNA molecules, to form new RNA 
molecules, at permissive temperatures. 

In one general aspect, the DNA expression vectors of the invention 
comprise a 5' promoter which is capable of initiating transcription in vivo, 5' 

25 and/or 3' sequences enabling replication of the RNA molecule ( exacting 

sequence elements), and a subgenomic promoter 5' to the gene of interest, as well 
as a sequence of interest which is translatable only after one or more 
RNA-dependent RNA replication events. These RNA-dependent RNA 
replication events are catalyzed by a reculatable RNA-dependent RNA 



5 



10 



WO 99/50432 



PCT/IB99/00523 



-7- 

polymerase which may be encoded by the same mRN A molecule that is produced 
by transcription of the DNA vector or by a different mRN A molecule. 

In another aspect, the invention provides DNA molecules comprising 
polynucleotides which encode RNA molecules comprising (a) at least one 
ds-acting sequence element, (b) a first open reading frame having a nucleotide 
sequence encoding a non-cytopathic, temperature-sensitive RNA-dependent RNA 
polymerase, and (c) at least one second nucleotide sequence which encodes one 
of the following: 

(i) a second open reading frame encoding a protein, or portion thereof, 
wherein the second open reading frame is in a translatable format after one or 
more RNA-dependent RNA replication events; 

(ii) a sequence complementary to all or part of the second open reading 
frame of (i); and 

(iii) a sequence encoding an untranslated RNA molecule (e.g., an 
antisense RNA molecule, tRNA molecule, rRNA molecule, or ribozyme), or 
complement thereof. 

The invention further provides single- and multiple-vector systems for 
expressing a second nucleotide sequence described above. In a single-vector 
system, sequences encoding the first open reading frame and the second 
nucleotide sequence are present on the same nucleic acid molecule. In a 
multiple-vector system, sequences encoding the first open reading frame, or 
sub-portions thereof, and the second nucleotide sequence are present on one or 
more separate nucleic acid molecules. 

When sequences encoding the first and second open reading frame are 
present cither on the same nucleic acid molecule or in the same vector (/.<?.. in a 
single-vector system), a region will be present 5' to the second open reading frame 
which inhibits translation of this open reading frame. 

The temperature-sensitive replicase may be "cold" or "hot" sensitive and 
thus will only efficiently catalyze RNA-dependent RNA replication at 
temperatures either above or below the restrictive temperature. In one 
embodiment, the DNA molecules of the invention encode an RNA-dependent 



WO 99/50432 



PCT/IB99/00523 



-8- 

RNA polymerase that has replicase activity at temperatures below 34 °C and has 
low or undetectable replicase activity at temperatures of 34°C and above. 

Further provided are RNA transcription products of the DNA molecules 
of the invention and alphaviral particles containing packaged RNA molecules of 
the invention. When packaged RNA molecules are produced, the second open 
reading frame may encode one or more proteins required for such packaging (e. g. . 
Sindbis structural proteins). 

In another aspect, the nucleic acid molecules of the invention encode one 
or more cytokine, lymphokine. tumor necrosis factor, interferon, toxic protein, 
prodrug converting enzyme, or other protein. 

In yet another aspect, the nucleic acid molecules of the invention encode 
an untranslated RNA molecule, such as an antisense RNA molecule, tRNA 
molecule, rRN A molecule, or ribozyme. 

The invention also provides methods for making recombinant host cells 
comprising introducing nucleic acid molecules of the invention into host cells. 
Further provided are recombinant host cells produced by the introduction of 
nucleic acid molecules of the invention. In one embodiment, some or all of these 
recombinant host cells contain one or more DNA molecules of the invention 
which are stably maintained. 

The invention further provides the pCYTts vector of SEQ ID NO:l. as 
well as isolated nucleic acid molecules comprising polynucleotides having the 
nucleotide sequence of SEQ ID NO:l. 

The present invention also provides methods for producing proteins and 
untranslated RNA molecules in recombinant host cells comprising growing host 
cells under suitable culture conditions, introducing nucleic acid molecules of the 
invention into host cells, and recovering the proteins or untranslated RNA 
molecules produced by the recombinant host cells. 

Methods are also provided for the regulated expression of heterologous 
polypeptides, including cytokines, lymphokines. tumor necrosis factors, 
interferons, toxic proteins, and prodrug converting enzymes. 

Further provided are proteins and untranslated RNA molecules produced 
by the methods of the invention. 



WO 99/50432 



PCT/1B99/00523 



-9- 

The invention also provides methods for regulating the expression of 
heterologous proteins in recombinant host cells comprising growing host cells 
under suitable culture conditions, introducing nucleic acid molecules ot" the 
invention into the host cells, and changing the temperature of the host cell culture 
from either a permissive temperature to a restrictive temperature or a restrictive 
temperature to a permissive temperature. In one embodiment, the nucleic acid 
molecules of the invention are introduced into prokaryotic or eukaryotic host cells 
which are then cultured in vitro. In related embodiments, these host cells are 
cultured in a serum-free or protein-free medium. 

Additionally provided are methods for producing proteins in recombinant 
host cells comprising growing host cells under suitable culture conditions, 
infecting said host cells with alphaviral particles containing RNA molecules of 
the invention, and recovering the protein. 

Also provided are methods for the introduction and expression of nucleic 
acid molecules of the invention in recombinant host cells within an individual. 
When these recombinant host cells are intended to express polypeptide or 
untranslated RNA sequences in an individual, the nucleic acid molecules of the 
present invention may be introduced into host cells either in vivo or ex vivo. 
When the nucleic acid molecules are introduced into host cells ex vivo, the 
recombinant host cells can either be administered to the individual from which 
they were obtained or to a different individual. In certain embodiments, the host 
cells are mammalian keratinocytes. epithelial cells, or fibroblasts which are 
reintroduced into the same mammal from which they were obtained. 

The invention further provides methods for regulating the expression of 
proteins or untranslated RNA molecules in individuals comprising administering 
nucleic acid molecules of the invention to individuals and changing the 
temperature of at least a portion of these individuals from either a permissive 
temperature to a restrictive temperature or a restrictive temperature to a 
permissive temperature. 

The invention also provides methods for administering proteins and 
untranslated RNA molecules to individuals comprising administering nucleic acid 
molecules of the invention to individuals and changing the temperature of at least 



WO 99/50432 



PCT/IB99/00523 



-10- 

a portion of the .individuals from a restrictive temperature to a permissive 
temperature. 

The invention additionally provides methods for regulating the expression 
of proteins and untranslated RNA molecules in individuals comprising 
5 administering recombinant host cells of the invention to these individuals and 

changing the temperature of at least a portion of these individuals from either a 
permissive temperature to a restrictive temperature or a restrictive temperature to 
a permissive temperature. 

In one embodiment, the host cells are obtained from the same individual 
1 0 into which the recombinant host cells are administered. In another embodiment, 

the recombinant host cells are keratinocytes. 

The present invention also provides pharmaceutical compositions 
comprising nucleic acid molecules of the invention and a pharmaceutically 
acceptable carrier. 

1 5 The present invention further provides genetically engineered, non-human 

animals which contain nucleic acid molecules of the invention in at least some of 
their cells. Also provided are genetically engineered, non-human animals which 
contain DNA molecules of the invention stably integrated into the genome of 
some or all the animal's cells. The invention also provides methods for producing 

20 genetically engineered, non-human animals comprising introducing cells 

containing nucleic acid molecules of the invention into these animals, introducing 
nucleic acid molecules of the invention into the cells of these animals in vivo, or 
introducing DNA molecules of the invention into germ line cells to produce 
transgenic animals containing the sequence of interest in their somatic and germ 

25 line cells. 

Brief Description of the Figures 

FIG. 1. The DNA of pCYTts (1) is inserted into the nucleus. The 
eukaryotic promoter (solid horizontal arrow) drives transcription (2) into mRNA 
(3). Translation (4) of the first open reading frame (ORF) of the mRNA results 
30 in the production of a temperature-sensitive replicase (M-replicase protein) (5). 



WO 99/50432 



PCT/IB99/00523 



-11- 

The second open ORP encoding the gene of interest is not accessible to 
ribosomes. Thus no translation (6) of the gene of interest occurs. At low 
temperature the /s-replicase catalyzes replication (7) of the mRNA (3) into full- 
length (-) strand RN A (8). The /.v-replicase also catalyzes subsequent replications 
(9. 10) into full-length (+) strand RNA (1 1) and subgenomic RNA (12). The 
subgenomic RNA (12) is then translated (13) into the protein of interest (not 
shown). The combination of amplification and qualitative change of the RNA 
results in unprecedented tightness and regulatability of the expression of the gene 
of interest. 

Abbreviations in FIG. 1 are as follows: Rous Sarcoma Virus promoter 
( RS V pr.), c/s-acting sequence elements (CSE), non-structural proteins 1 -4 (nsP 1 , 
nsP2. nsP3, nsP4), gene of interest (G.O.L), and subgenomic promoter (S.G.) 

FIG. 2 is a schematic representation of the pCYTts vector. The pC YTts 
vector contains, in addition to the elements shown in FIG. 1. an ampicillin 
resistance marker for selection in bacterial cells and a ColEl sequence which 
directs high copy number bacterial amplification. The pCYTts vector was 
prepared as described in Example 1 . 

FIG. 3A-3D shows the complete cDNA sequence of pCYTts (SEQ ID 

NO:l). 

FIG. 4A-4B. GFP (FIG. 4A) and SEAP (FIG. 4B) production at different 
temperatures. Cells stably transfected with pCYTtsGFP or pCYTtsSEAP were 
grown for 48 hours at the indicated temperatures (closed diamonds and open 
squares). Two independent experiments are shown in each of FIG. 4A and FIG. 
4B. GFP fluorescence (FIG. 4A) was determined ias described in Example 2. 
SEAP activity (FIG. 4B) was determined colorimetrically as described in 
Example 3. The maximal protein expression was determined for both proteins 
to be 29°C. The activities of the proteins were calculated relative to the maximal 
value at 29°C. 

FIG. 5A-5B. Time course of GFP (FIG. 5A) and SEAP (FIG. SB) 
production in BHK cells stably transfected with pCYTtsGFP (FIG. 5A) and 
pCYTtsSEAP (FIG. 5B) at 30°C. GFP production was measured by 
spectrofluorophotometry and quantified in fluorescence units per 10" cells, as 



WO 99/50432 



PCT/IB99/00523 



-12- 

described in Example 2. SEAP production per 10 6 cells was determined as 
described in Example 3 by measuring enzymatic activity using 
p-nitrophenylphosphate as a substrate. The amount of SEAP produced after 80 
hours. was estimated to be over 10 7 molecules per cell. 

FIG. 6A-6B. The start of GFP (FIG. 6A) or SEAP (FIG. 6B) mRNA 
transcription in a mixed population of BHK cells stably transfected with 
pCYTtsGFP or pC YTtsSEAP was determined by measuring the amount of GFP 
or SEAP produced (see Examples 2 and 3). Cells were incubated for 2, 4, 6, 8 
and 1 0 hours at 29°C (black boxes), and then crown for another 24 hours at 37°C 
(open boxes). 

FIG. 7A-7B. These figures show the results of the experiments obtained 
using stable pCYTtsGFP transfected -BHK ceils which were transiently 
transfected with a plasmid coding for the structural proteins of Sindbis virus. The 
conditions of the experiments were as follows: (I) incubation phase of transfected 
BHK cells at 29°C or 37°C for 48 hours; (II) the supernatant of the cells was put 
onto a new BHK cell layer and the cells were shifted to the indicated 
temperatures; (III) incubation at either 29°C or 37°C of the new BHK cell layer 
for 6 hours: and (IV) washing of the cells and final incubation at 29°C or 37°C 
for 48 hours. Infection events were visualized by the expression of the marker 
gene GFP as described in Example 2. FIG. 7A shows the result of two separate 
experiments performed as described above. Fluorescence indicates GFP 
expression, whereas no fluorescence indicates no detectable GFP expression. 
FIG. 7B shows the results of four separate experiments performed as described 
above. The + and - symbols indicate whether GFP expression was detected. 

FIG. 8A-8B. Western blot of p-interferon (p-INF) (FIG. 8A) and 
erythropoietin (EPO) (FIG. 8B) expressed in the pC YTts system. FIG. 8A shows 
in lane 1 marker, lane 2 positive control, lane 3 supernatant of P-INF expressing 
cells following incubation at 37°C for 3 days, lane 4 supernatant of P-INF 
expressing BHK cells (transient transfection) following incubation at 29°C for 
3 days, lane 5 supernatant of GFP expressing BHK cells, lane 6 marker, lane 7 
supernatant of P-INF expressing BHK cells (mixed population) following 
incubation at 29 C C for 3 days, and lane 8 marker. FIG. 8B shows in lane 1 



WO 99/50432 



PCT/IB99/00523 



-13- 

marker. lane 2 supernatant of EPO expressing cells (transient transfection) 
following incubation at 29°C for 5 days. lane 3 supernatant of EPO expressing 
cells following incubation at 37°C for 5 days, lane 4 supernatant of GFP 
expressing BHK cells, and lane 5 marker. 

FIG. 9 shows a Western Blot of EPO. The samples in each lane are as 
follows: lane 1 EPO standard; lane 2 supernatant of stably pCYTts504-Epo 
transfected cells at 37°C for 4 days; lane 3 supernatant of stably pC YTts504-Epo 
transfected cells at 29°C for 4 days; lane 4 marker. 

FIG. 10 shows a dot blot of EPO. Spot + shows EPO standard, spots 2 
and 1 0 supernatant of BHK cells (2), spot 3 GFP expressing BHK cells incubated 
at 30°C spot 4 1 C4 cells incubated at 37°C. spot 8 supernatant of the BHK cells 
infected with CYTts504Epo RNA containing viral particles incubated at 37 °C 
after 2 days, spot 9 supernatant of BHK cell infected with CYTts504Epo RNA 
containing viral particles incubated at 30°C for 2 days. 

FIG. 1 1 shows an overview of one embodiment of the invention. This 
embodiment is directed to the production of recombinant human EPO using host 
cell infected with packaged RNA replicons produced by baby hamster kidney 
(BHK) cell line 1C4/4. This BHK cell line was produced as described below in 
Example 6. 

FIG. 12 shows a flow chart of one embodiment of the invention. 
According to the process described in this figure. RNA replicons are produced by 
the stable EPO-packaging BHK cell line 1C4/4 and isolated from the culture 
medium. Wild-type BHK cells, which may be cultured in either serum- or 
protein-free culture media, are then infected with the replicons. The protein 
produced by the infected cells is then purified by conventional processes. The 
process outlined in this figure can be readily scaled up for production of large 
quantities of human EPO or other proteins. 



WO 99/50432 



PCT/IB99/00523 



-14- 

Detailed Description of the Preferred Embodiments 

The present invention is directed to improved expression vectors that are 
regulatable and non-cytopathic. as well as methods for using these vectors to 
produce proteins and RNA molecules of interest. 

The invention provides polynucleotides and methods which allow the 
precise regulation of the amount of specific RNA molecules produced in host 
cells. This precise regulation results from the use of a temperature-sensitive 
RNA-dependent RNA polymerase which will only replicate RNA molecules, to 
form additional RNA molecules, at permissive temperatures. 

The invention is further directed to inducible gene expression systems 
employing alphavirus DNA vectors to create stable cell lines carrying genes 
encoding a non-cytopathic. temperature-sensitive, viral non-structural replicase 
protein. For example, the activity of the temperature-sensitive replicase used in 
the Examples, set out below, is switched on by reducing the temperature of the 
transfected cells from a temperature of 37° C to a temperature lower than 34 °C. 
Host cell expression at 37°C is below the level of detection and the induction 
profile is independent of the chromosomal integration site. 

Definitions 

The following definitions are provided to clarify the subject matter which 
the inventors consider to be the present invention. 

As used herein, the term "alphavirus" refers to any of the RNA viruses 
included within the genus Alphavirus. Descriptions of the members of this genus 
are contained in Strauss and Strauss. Microbiol. Rev., 55:491-562 (1994). 
Examples of alphaviruses include Aura virus. Bebaru virus. Cabassou virus. 
Chikungunya virus. Easter equine encephalomyelitis virus. Fort morgan virus. 
Getah virus. Kyzylagach virus. Mayoaro virus. Middleburg virus. Mucambo 
virus. Ndumu virus. Pixuna virus. Tonate virus. Triniti virus. Una virus. Western 
equine encephalomyelitis virus. Whataroa virus. Sindbis virus (SIN). Semliki 
forest virus (SFV). Venezuelan equine encephalomyelitis virus (VEE). and Ross 
River virus. 



WO 99/50432 



PCT/IB99/00523 



-15- 

As used herein, when the term "purified" is used in reference to a 
molecule, it means that the concentration of the molecule being purified has been 
increased relative to molecules associated with it in its natural environment. 
Naturally associated molecules include proteins, nucleic acids, lipids and sugars 
but generally do not include water, buffers, and reagents added to maintain the 
integrity or facilitate the purification of the molecule being purified. For 
example, even if mRNA is diluted with an aqueous solvent during oligo dT 
column chromatography. mRNA molecules are purified by this chromatography 
if naturally associated nucleic acids and other biological molecules do not bind 
to the column and are separated from the subject mRNA molecules. 

As used herein, when the term "isolated" is used in reference to a 
molecule, the term means that the molecule has been removed from its native 
environment. For example, a polynucleotide or a polypeptide naturally present 
in a living animal is not "isolated," but the same polynucleotide or polypeptide 
separated from the coexisting materials of its natural state is "isolated." Further, 
recombinant DN A molecules contained in a vector are considered isolated for the 
purposes of the present invention. Isolated RNA molecules include in vivo or in 
vitro RNA replication products of DNA and RNA molecules. Isolated nucleic 
acid molecules further include synthetically produced molecules. Additionally, 
vector molecules contained in recombinant host cells are also isolated. Thus, not 
all "isolated" molecules need be "purified." 

As used herein, the phrase "low or undetectable." when used in reference 
to gene expression level, refers to a level of expression which is either 
significantly lower than that seen when the gene is maximally induced (e.g., at 
least five fold lower) or is not readily detectable by the methods used in the 
following examples section. 

As used herein, the phrase "individual" refers to multicellular organisms 
and includes both plants and animals. Preferred multicellular organisms are 
animals, more preferred are vertebrates, even more preferred are mammals, and 
most preferred are humans. 

As used herein, the phrase "as-acting" sequence refers to nucleic acid 
sequences to which a replicase binds to catalyze the RNA-dependent replication 



WO 99/50432 



PCT/IB99/00523 



-16- 

of RNA molecules. These replication events result in the replication of the full- 
length and partial RNA molecules and. thus, the alpahvirus subgenomic promoter 
is also a "c/j-acting" sequence. O.v-acting sequences may be located at or near 
the 5' end. 3' end. or both ends of a nucleic acid molecule, as well as internally. 

5 As used herein, the phrase "RNA-Dependent RNA polymerase" refers to 

a polymerase which catalyzes the production of an RNA molecule from another 
RNA molecule. This term is used herein synonymously with the term "replicase." 

As used herein, the phrase "non-infective packaged RNA molecules" 
refers to packaged RNA molecules which will essentially undergo only one round 

10 of host cell infection and are not pathogenic. These molecules are thus 

"infective" but only for a single infectious entry into a host cell and are not 
capable of reproducing to form additional infectious particles. 

As used herein, the term "transcription" refers to the production of RNA 
molecules from QNA templates catalyzed by RNA polymerases. 

15 As used herein, the phrase "RNA-dependent RNA replication event" 

refers to processes which result in the formation of an RNA molecule using an 
RNA molecule as a template. 

As used herein, the term "vector" refers to an agent (eg., a plasmid or 
virus) used to transmit genetic material to a host cell. A vector may be composed 

20 of either DN A or RNA. 

As used herein, the term "heterologous sequence" refers to a second 
nucleotide sequence present in a vector of the invention. The term "heterologous 
sequence" also refers to any amino acid or RNA sequence encoded by a 
heterologous DNA sequence contained in a vector of the invention. Heterologous 

25 nucleotide sequences can encode proteins or RNA molecules normally expressed 

in the cell type in which they arc present or molecules not normally expressed 
therein (e.g.. Sindbis structural proteins). 

As used herein, the phrase "untranslated RNA" refers to an RNA sequence 
or molecule which does not encode an open reading frame or encodes an open 

30 reading frame, or portion thereof, but in a format in which an amino acid 

sequence will not be produced (e.g. . no initiation codon is present). Examples of 
such molecules are tRN A molecules. rRN A molecules, and ribozymes. Antisense 



WO 99/50432 



PCT/IB99/00523 



-17- 

RNA may be untranslated but. in some instances {see Example 1 1), antisense 
sequences can be convened to a translatable sense strand from which a 
polypeptide is produced. 

As used herein the phrase "gene therapy" refers to the transfer of 
heterologous genetic information into cells for the therapeutic treatment of 
diseases or disorders. The heterologous nucleotide sequence is transferred into 
a cell and is expressed to produce a polypeptide or untranslated RNA molecule. 

As used herein, the phrase "temperature-sensitive" refers to an enzyme 
which readily catalyzes a reaction at one temperature but catalyzes the same 
reaction slowly or not at all at another temperature. An example of a 
temperature-sensitive enzyme is the replicase protein encoded by the pCYTts 
vector, which has readily detectable replicase activity at temperatures below 34°C 
and has low or undetectable activity at 37°C. 

As used herein, the phrase "permissive temperature" refers to temperatures 
at which an enzyme has relatively high levels of catalytic activity. 

As used herein, the phrase "restrictive temperature" refers to temperatures 
at which an enzyme has low or undetectable levels of catalytic activity. Both 
"hot" and "cold" sensitive mutants are known and. thus, a restrictive temperature 
may be higher or lower than a permissive temperature. 

As used herein, the term "recombinant host cell" refers to a host cell into 
which one ore more nucleic acid molecules of the invention have been 
introduced. 

When the terms "one," "a." or "an" are used in this disclosure, they mean 
"at least one" or "one or more." unless otherwise indicated. 

Alphaviral Vectors of the Invention 

The DNA vectors of the present invention arc constitutively transcribed 
in host cells to produce mRNA molecules having two open reading frames. 
These open reading frames, which may or may not be produced from the same 
nucleic acid molecule, encode a temperature-sensitive replicase and a 
heterologous gene of interest. The first open reading frame is translated to 
produce a temperature-dependent RN A-dependent RNA polymerase. The second 



WO 99/50432 



PCT/IB99/00523 



-18- 

open reading frame, encoding all or pari of one or more polypeptides of interest, 
is not translated until after at least one RNA-dependent RNA replication event. 

The DN A expression vectors comprise a 5' promoter which is capable of 
initiating synthesis of RNA in vivo. 5' and/or 3' sequences enabling replication of 
the RNA molecule (5' and 3' cis acting sequence elements), as well as a sequence 
of interest which is translatable only after at least one replication event. 
Replication is catalyzed by a regulatable RNA-dependent RNA polymerase which 
is encoded alternatively on the same or on a different mRNA molecule. The 
sequence of interest may be encoded in sense, plus (+) orientation downstream 
of a viral RNA promoter. Translation of the coding sequence of the gene of 
interest is inhibited by a 5' sequence which, in the case of the single-vector 
system, will generally be the replicase sequence. In the multiple- vector system, 
a 5' sequence can inhibit translation by having one or more short open reading 
frames with associated stop codons which lead to the detachment of ribosomes. 
Similarly, any sequence which inhibits the traveling or binding of ribosomes to 
the sequence of interest can be used as a 5* sequence which inhibits translation 
(Voet and Voet, Biochemistry. John Wiley & Sons, Inc. (1990)). 

Another method for preventing translation of nucleotide sequences in 
most biological systems involves the insertion of the sequence in an antisense 
direction. This method of inhibiting translation is based on the principle that 
translation will generally only occur after the replication of this minus (-) strand 
RNA into a plus strand having an open reading frame in a sense orientation. The 
translated sense strand is formed by RNA replication and serves as a template for 
ribosomes and protein synthesis. As shown in Example 1 1 . production of amino 
acid sequences can occur even when the gene of interest is inserted into the DNA 
molecule in an orientation which will result in the formation of antisense RNA 
sequence 3 f to the subgenomic promoter. Thus, the second open reading frame 
may also comprise a sequence complementary to all or part of the second open 
reading frame described above and expression of the encoded amino acid 
sequence will still occur. When the production of an untranslated antisense RNA 
sequence is desired, the RNA molecule can be designed so that it will not serve 
as a template for protein synthesis. For example, the RNA can be designed so 



WO 99/50432 PCT/IB99/00523 



-19- 

that an initiation codon is not present. 

Untranslated antisense RNA molecules can be used to inhibit translation 
of mRN A expressed in recombinant host cells. The use of antisense nucleic acid 
molecules to regulate gene expression is known in the art (see. e.g., Kawamata. 
5 H. et aL. Br. J. Cancer 77:71-78 (1998); Bechler. K.. Biochem. Biophys. Res. 

Commun. 2-/7:193-199 (1997); UrakamL S. et aL. Biochem. Biophys. Res. 
Commun, 277:24-30 (1997)) and the use of the present vectors to deliver such 
molecules to host cells is within the scope of the invention. 

In addition, instead of a second open reading frame, RNA molecules 

10 directly produced by transcription of a DNA sequence of the invention may 

encode RNA sequences which are neither translated nor present in an antisense 
orientation. Examples of such untranslated RNA molecules include tRNA 
molecules. rRN A molecules, and ribozymes. A considerable number of ribozyme 
sequences with defined catalytic activities are known in the art (see, e.g. , Brown, 

15 J., Nucleic Acids Res. 26:353-354 (1998); Xie, Y. et aL. Proc. Natl. Acad Sci. 

USA 97:13777-13781 (1997); Lavrovsky. YetaL. Biochem. Mol. Med 62:1 1-22 
(1997); Chapman. K. and Szostak, J., Chem. Biol. 2:325-333 (1995)). Further, 
ribozymes have been used to "knockout" the expression of a specific gene in 
eucaryotic cells as part of a ribozyme-mediated. message deletion strategy (Xie. 

20 Y. et aL. Proc. Natl. Acad. Sci. USA 94: 13777- 13781 (1997)). Additionally, 

alphaviral replicons have been used to express a functional ribozyme in 
mammalian cells (Smith S.et aL. J. Virol. 77:9713-9721 (1997)). Theregulated 
expression of such ribozymes, and other untranslated RNA molecules, is thus 
within the scope of the present invention. 

25 The invention is exemplified by the schematic diagram shown in FIG. 1 . 

These embodiments of the invention are directed to DNA vectors which are 
transcribed to produce a mRN A molecule having two open reading frames, which 
encode a replicase and a gene of interest. The DNA vectors contain a promoter 
sequence which drives transcription of these vectors to produce mRN A molecules 

30 having coding sequences of both open reading frames. The mRNA sequences of 

the first open reading frame are translated to produce a replicase required for the 
expression of the RNA sequences of the second open reading frame. The second 



WO 99/50432 



PCT/IB99/00523 



-20- 

open reading frame encodes one or more proteins of interest. 

Further, once the first mRNA molecule has been transcribed from the 
DNA vector, additional RNA-dependent RNA replication events can occur to 
amplify the first mRNA sequence and to produce RNA molecules with strand 
polarity which is the opposite of the first mRNA sequence. 

As shown in FIG. 1 . sections (7)-(8), ( 1 0), and ( 1 2)-( 1 3 ). the second open 
reading frame of a DNA molecules of the invention will only be expressed after 
partial replication of a full-length RNA molecule. This partial replication of the 
full-length RNA molecules is driven by a promoter sequence composed of RNA 
(e.g., an alphaviral subgenomic promoter sequence). 

While the gene of interest may be encoded by the same RNA molecule as 
the replicase protein, this gene may also be encoded by a separate RNA molecule. 
Thus, the invention further provides both single- and multiple-vectors systems for 
expressing a gene of interest. 

In a single-vector system of the invention, sequences encoding the first 
open reading frame and the second nucleotide sequence are components of the 
same nucleic acid molecule. Thus, all of the components required for regulated 
expression of the gene of interest are contained in a single nucleic acid molecule 
(i.e., DNA or RNA). 

In a multiple-vector system of the invention, sequences encoding the first 
open reading frame, or sub-portions thereof, and the second nucleotide sequence 
are components of different nucleic acid molecules. These multiple-vector 
systems thus may comprise two or more nucleic acid molecules. For example, 
nsP2, nsP4, and the gene of interest can each be encoded by different DNA 
vectors. Further, one or more of these DNA vectors can be designed to stably 
integrate into the host cell genome. When expression of a gene of interest is 
desired in a cell type containing one or more stably integrated DNA molecules of 
the invention, expression of the gene of interest will require the introduction of 
nucleic acid molecules (DNA or RNA) encoding the components of the system 
into the cells not present in the integrated molecule(s). 

While any functional promoter can be used to drive the transcription of 
mRNA from the DNA vector, the promoter is preferably a constitutive RNA 



WO 99/50432 



PCT/IB99/00523 



-21- 

polymerase II promoter (e.g., Rous Sarcoma Virus (RSV), cytomegalovirus 
(CMV). simian virus 40 (SV40). myeloproliferative sarcoma virus (MPSV), 
glucocorticoid, metallothionein. Herpes simplex virus thymidine kinase 
(HSVTK). human immuno deficiency (HIV), mouse mammary tumor virus 
5 (MMTV), human polyomavirus BK (BKV), or Moloney murine leukemia virus 

(MuLV) promoter). Additional promoters suitable for use in the practice of the 
present invention are known in the art (see. e.g., Lee, A. et ai, Moi Cells. 
7:495-501 (1997); Artuc, M. et aL Exp. Dermatol. 7:317-321 (1995)). 

The vector will generally also contain selection markers for cloning and 

10 amplification of the vector sequences in procaryotic and eucaryotic organisms. 

The pCYTts vector, for example, contains an ampicillin resistance marker for 
positive selection in bacterial host cells and an E. coli origin of replication (i.e., 
ColEl). A considerable number of sequences encoding additional selection 
markers and origins of replication are known in the art (see, e.g., Sambrook. J. et 

15 ai. eds.. Molecular Cloning. A Laboratory Manual, 2nd. edition. Cold 

Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989); Ausubel, F. 
et ai, eds.. Current Protocols in Molecular Biology, John R Wiley & 
Sons. Inc. (1997)). 

The replicase protein coding sequences, the 5' and 3' c/5-acting sequences 

20 (when present), and the junction sequences containing the subgenomic promoter 

will normally be derived from a virus, preferably from an alphavirus. most 
preferably from Sindbis virus. 

When using alphavirus replicase proteins, in most instances, it is desirable 
to convert the cytopathic phenotype of the replicase protein to a non-cytopathic 

25 phenotype. Preferred mutations which confer such a phenotype are in the nsp2 

gene {e.g.. the proline residue at position 726 is replaced with a serine residue). 
Mutations are known in the art which render the replicase protein non-cytopathic 
(Weiss et ai. J. Virol. J3:463-474 (1980): Dryga et ai. Virology 22«S: 74-83 
( 1997)). These mutations may be introduced by a number of means, including 

30 site directed mutagenesis. 

As noted above, when a non-cytopathic Sindbis virus replicase is used in 
the practice of the invention, a mutation may be introduced in the nsp2 gene. One 



WO 99/50432 



PCT/IB99/00523 



-22- 

such mutation results from the exchange of the proline residue at position 726 to 
another of the 20 natural occurring amino acids, such as a serine (abbreviated as 
"Pro 726 Ser"). Alternatively, any other mutation rendering the replicase 
molecule non-cytopathic is within the scope of the invention. The creation and 
5 the identification of mutations which render the Sindbis replicase non-cytopathic 

are described in more detail elsewhere (Weiss et al . J. Virol 53:463-474 ( 1 980); 
Dryga et al. Virology 225:74-83 (1997); patent application WO 97/38087). 
Further, methods for inducing such mutations are known in the art (see, e.g., 
Sambrook, J. et al . eds.. Molecular Cloning, A Laboratory Manual, 2nd 

1 0 edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1 989); 

AusubeL F. et al, eds.. Current Protocols in Molecular Biology, John H. 
Wiley & Sons, Inc. (1997)). 

Temperature sensitivity (ts) may be conferred, for example, by the 
introduction of a mutation in the nsp4 gene of the replicase. Preferably, 

15 mutations which confer a temperature-sensitive phenotype upon replicase 

activities are in a protein in complementation group F (Lemm et al, J. Virol 
64:3001-301 1 (1990)). For example, a temperature-sensitive phenotype may be 
conferred by changing Gly 1 53 of nsp4 to Glu. Additionally, any other mutation 
which renders replicase activity temperature-sensitive can be used in the practice 

20 of the invention. Methods for creating and identifying new temperature-sensitive 

mutants are described by Pfefferkorn (Burge and Pfefferkorn, Virol 
i0:204-2 13(1 966): Burge and Pfefferkorn, Virol 30:2 14-223 (1966)). Further, 
any method useful for producing and identifying ts mutants which allow for the 
temperature-sensitive regulation of replicase activity can be employed to generate 

25 and isolate such mutants. 

While most temperature-sensitive mutants arc"hot" sensitive, "cold" 
sensitive ones are also known (see, e.g., Schwer. B. et al. Nucleic Acids Res. 
26:803-809 (1998). Mathe. E. et al. ./. Cell Sci. 7/7:887-896 (1998). Doedens. 
J. et al. J. Virol "7:9054-9064 (1997). Patterson. B. et al. 1 Biol Chem. 

30 272:2761 2-276 17(1 997)). The temperature-sensitive replicase may be "cold" or 

"hot" sensitive and thus will catalyze RNA replication only at temperatures either 
above or below restrictive temperatures. In one embodiment. RNA replication 



WO 99/50432 



PCT/IB99/00523 



-23- 

occurs at detectable levels only at temperatures lower than 34 °C. In a related 
embodiment, the pC YTts vector, or variant thereof, is used to express an inserted 
gene of interest with expression being induced by reducing the temperature of 
cells containing the vector from 37°C to a temperature lower than about 34°C. 
5 As shown in FIG. 4A-4B, permissive temperatures for the replicase encoded by 

the pCYTts vector are below about 34°C. Further, expression of the gene of 
interest increases when the temperature is increased from about 24 °C until a 
maximal expression level is reached at about 29°C. Additionally, expression of 
the gene of interest increases as the temperature decreases from about 34 °C. 

1 0 Thus, permissive temperatures for the replicase activity encoded by the pC YTts 

vector are below 34°C, and include temperatures below 24°C, as well as 24°C. 
25°C, 26°C, 27°C, 28°C, 29°C. 30°C 31 °C. 32°C, and 33°C and intervening 
fractional temperatures up to about 34 °C. 

In contrast to all previously known regulatable DN A expression systems, 

15 the basal level of expression in recombinant host cells containing the pCYTSts 

vector in the inactive state at 37 °C is below the level of detection using standard 
methods (e.g., those used in the following examples). This low level of 
expression is apparent from the data presented in FIG. 4A-4B, FIG. 8A-8B. FIG. 
9. and FIG. 10. Further, the temperature-dependent induction profile of gene 

20 expression appears to be independent of the chromosomal integration site and 

copy number. 

In another embodiment, the sequence of interest and non-cytopathic, 
regulatable replicase (e.g., nsp2 carrying the Pro 726 Ser mutation and nsp4 
carrying the Gly 1 53 Glu mutation) are encoded by two separate DNA vectors. 

25 In such an instance, the DNA vector carrying the sequence of interest carries both 

cry-acting sequences and a 5' region which inhibits translation of the sequence of 
interest. The non-cytopathic. regulatable replicase gene can also be encoded by 
a DNA molecule which is different than the one carrying the sequence of interest. 
Replication and translation of the sequence of interest in this multi-vectors system 

30 is regulatable by temperature as in the one vector system. 

The vectors of the invention can be also used to regulate the expression 
of more than one gene of interest. For example, recombinant host cells can be 



WO 99/50432 



PCT/1B99/00523 



-24- 

transfected with more than one nucleic acid molecule of the invention wherein 
one nucleic acid molecule encodes both the replicase and a polypeptide of interest 
and additional nucleic acid molecules could encode additional polypeptides of 
interest. Similarly, when mutations conferring non-cytopathiciry and temperature 
5 sensitivity are both used, genes encoding polypeptides having suitable mutations 

(e.g.. Pro 726 Ser in nsp2 and Gly 153 GIu in nsp4) may be on separate nucleic 
acid molecules. Additional variations would be apparent to those skilled in the 
art. 

As shown in Example 1 1 , the sequence of interest can also be inserted in 

10 an antisense direction downstream from a functional promoter (e.g., the 

myeloproliferative sarcoma virus (MPS V) promoter). This construct is converted 
to a plus (+) strand with sense polarity as shown by the production of the protein 
of interest. These data demonstrate that antisense DNA fragments can be used 
with the present invention to express functional polypeptides, or subportions 

1 5 thereof. These data further indicate that the 5' and 3' CSEs may not be necessary 

for viral transcription when antisense DNA is used as a template for transcription. 

The DNA molecules of the invention can also contain packaging signals 
which direct the packaging of RNA molecules into viral particles. These RNA 
molecules can be packaged in the presence of wild-type virus or defective helper 

20 virus RNA. A significant improvement was made with the development of 

defective helper RNA molecules (Bredenbeek. P. et al.. J. Virol. 67:6439-6446 
(1993)). These RNA molecules contain m-acting sequences, required for 
replication of the full-length transcription product, and subgenomic RNA 
promoter sequences which drive the expression of the structural protein genes. 

25 For example, in cells containing both RNA molecules with packaging signals and 

the defective helper virus RNA. alphaviral non-structural proteins allow for 
replication and amplification of the defective helper virus RNA sequences which 
are translated to produce virion structural proteins. Since the helper virus RNA 
lacks packaging signals, these molecules are not packaged into assembled virions. 

30 Thus, virion particles produced in this way contain essentially only RNA 

sequences encoding the gene of interest and. generally, other sequences required 
for temperature-sensitive regulation of gene expression. These non-infective 



WO 99/50432 



PCT/IB99/00523 



-25- 

packaged RNA molecules do not contain sequences encoding virion structural 
proteins and. thus, undergo only one round of host cell infection and are not 
pathogenic. 

Non-infective packaged RNA molecules can be used to infect a culture 
of suitable host cells simply by addition of the particles to culture medium 
containing these cells. The preparation of non-infective alpahviral particles is 
described in a number of sources, including "Sindbis Expression System", 
Version C, (Invitrogen Catalog No. K750-1). 

One application of this system is directed to the temperature-dependent 
production of non-infective, packaged RNA molecules. These packaged RNA 
molecules may be produced by a number of means including using recombinant 
host cells containing two different DNA molecules (e.g., a DNA molecule of the 
invention and a DNA molecule encoding a helper virus RNA sequence). For 
example, one of these DNA molecules will encode an RNA molecule which 
contains packaging signal sequences, sequences encoding a non-cytopathic, 
temperature-sensitive replicase. and the gene of interest. The other DNA 
molecule will contain sequences encoding alphaviral structural proteins 
downstream from an alphavirus subgenomic promoter. Using such a system, 
viral particles containing only RNA molecules with packaging signals will be 
produced at permissive temperatures in recombinant host cells. This is so 
because alphaviral structural proteins will only be produced at a permissive 
temperature. Additional variations of the above would be apparent to one skilled 
in the art. 

A wide variety of nucleotide sequences of interest can be expressed by the 
gene expression system of the invention. These sequences include, but are not 
limited to. sequences encoding lymphokines. cytokines, toxins, enzymes, prodrug 
converting enzymes, antigens which stimulate immune responses, single chain 
antibodies, proteins which stimulate or inhibit immune responses, tumor necrosis 
factors, and various proteins with therapeutic applications (e.g.. growth hormones 
and regulatory factors). 

As demonstrated in Example 5. heterologous sequences expressed by the 
vectors of the invention can also encode erythropoietin (EPO). EPO is a 



WO 99/50432 



PCT/IB99/00523 



-26- 

glycoprotein which belongs to the cytokine family and induces terminal 
erythrocyte development. This protein also regulates red blood cell production. 

Heterologous sequences can also encode a cytokine or lymphokine (e.g., 
p-interferon). Hematopoiesis is regulated by lymphokines and cytokines which 
stimulate the proliferation and/or differentiation of various hemopoietic cells. 
Representative examples of cytokines and lymphokines include interleukin-1 (IL- 
1), interleukin-2 (IL-2), interleukin-3 (IL-3). interleukin-4 (IL-4), interleukin-5 
(IL-5). interleukin-6 (IL-6), interieukin-7 (IL-7), interleukin-8 (1L-8), 
interleukin-9(IL-9)Jnterleukin-10(IL-10), interleukin-1 1 (IL-1 1), interleukin-1 2 
(1L-12), interleukin-1 3 (IL-1 3), interleukin-1 4 (IL-I4), interleukin-1 5 (IL-15), 
interleukin-1 6 (IL-1 6), interleukin-1 7 (IL-1 7), granulocyte colony stimulating 
factor (G-CSF), granulocyte-macrophage colony stimulating factor (GM-CSF), 
macrophage colony stimulating factor (M-CSF), and interferons. 

Heterologous sequences can also encode secreted enzymes (e.g., secreted 
alkaline phosphatase), cytoplasmic enzymes (e.g., green fluorescent protein), or 
any number of other proteins with therapeutic applications (e.g., human insulin, 
human coagulation Factor VIII). 

The vectors of the invention can also be used to express heterologous 
sequence encoding cytotoxic polypeptides. Cytotoxic polypeptides act to directly 
or indirectly inhibit cellular growth or metabolism. Representative examples of 
toxins include Shigella toxin, ricin. Diphtheria toxin. Cholera toxin. 
Pseudomonas exotoxin A, and Herpes simplex virus thymidine kinase (HSVTK). 
Within other embodiments of this invention, the heterologous sequence encodes 
a prodrug converting enzyme. A prodrug converting enzyme activates a 
compound with little or no cytotoxicity into a toxic product. Representative 
example are HSVTK, alkaline phosphatase, guanine phosphoribosyl transferase, 
and penicillin-V amidase. Examples of both cytotoxic polypeptides and prodrug 
converting enzymes are discussed in numerous sources including 
PCT/US97/0601 0. EP 0716148. and WO 96/1 7072. 

Nucleotide sequences which may be used with the vectors of the invention 
include untranslated RNA molecules, such as antisense sequences. RNase P 
targeted sequences which induce gene down-regulation, and ribozymes. Smith 



WO 99/50432 



PCT/IB99/00523 



-27- 

S. et al. (J. Virol. ^7:9713-9721 (1997)) describes alphaviral vectors used to 
express ribozyme sequences. 

The nucleic acid molecules of the invention can also be used to express 
virtually any protein, including ones which have not as yet been identified but arc 
encoded by nucleotide sequences contained in. for example. cDNA libraries or 
host cell chromosomes. Example of such proteins include secreted proteins and 
proteins from various cellular compartments. Heterologous sequences expressed 
by the vectors of the invention can encode proteins and RNA molecules from 
non-human species (e.g.. other mammals, plants, fungi, bacteria or viruses). 
These heterologous sequence may further encodes viral membrane proteins (e.g., 
HIV gpl60) or viral polyproteins (e.g., Sindbis structural proteins). 

Sequences of the above described proteins may be readily obtained from 
a variety of sources, including for example the American Type Culture Collection 
(ATCC, Rockville, MD). Alternatively, cDNA sequences which encode the 
above-mentioned heterologous sequences may be obtained from cells which 
express such sequences. Methods for isolating both genomic and cDNA 
sequences encoding genes of interest are well known in the art (see, e.g., Celis, 
J., ed.. Cell Biology, Academic Press, 2 nd edition. (1998): Sambrook, J. et ai, 
eds.. Molecular Cloning. A Laboratory Manual. 2nd. edition. Cold Spring 
Harbor Laboratory Press. Cold Spring Harbor. N.Y. (1989): Ausubel, F. et ai, 
eds. ? CurrentProtocols in Molecular Biology. John H. Wiley & Sons, Inc. 
(1997)). For example. mRNA can be isolated from a cell which expresses a 
sequence of interest, after which the sequence of interest is reverse transcribed 
with reverse transcriptase using oligo dT primers, random primers, specific 
primers, or combinations of each. The cDNA sequences may then be amplified 
by PCR using heat stable proof-reading polymerases. Alternatively, synthetic 
DNA sequences may be constructed and expressed with the vectors of the 
invention. 

Nucleotide sequences may be added to the vectors of the invention which 
result in the production of a fusion protein. For example, such sequences can 
encode amino acids sequences which are fused to a protein encoded by a gene of 
interest and confer one or more functional characteristics upon the expression 



WO 99/50432 



PCT/IB99/00523 



-28- 

product. These amino acid sequences include sequences which will target the 
gene product for export from the cell (e.g., a secretory sequence) or to a 
subcellular compartment (e.g.. the nucleus). Such amino acid sequences further 
include sequences which facilitate purification (e.g., a six His "tag"). Depending 
on the amino acid sequence and the function imparted by the fused sequence, the 
added amino acid sequences may or may not be cleaved from the translation 
product. 

Fusion proteins also include proteins which have domains or regions 
derived from various different proteins. Examples of such a fusion protein are 
those containing domain II of Pseudomonas exotoxin, a domain or amino acid 
sequence which has binding affinity for a cell surface receptor associated with a 
particular cell type, and another amino acid sequence with a preselected 
biological activity. Domain II of Pseudomonas exotoxin will translocate across 
cell membranes. Using this system, fusion proteins can be designed which will 
bind to specific cells types, will translocate across the cytoplasmic membranes of 
these cells, and will catalyze predetermined intracellular biological reactions. A 
system of this type is described in Pastan et ai, U.S. Patent No. 5.705,163. 
Methods for identifying amino acid sequences which bind to specific cell types 
are described in Wu ? A.. Nature Biotech. 7^:429-431 (1996). 

The vectors of the invention can also contain genetic elements which 
confer additional functional characteristics such as selection markers, sequences 
which result in high copy number host cell amplification, and sequences which 
allow for chromosomal integration of vector sequences. 

Markers for the selection of prokaryotic and eukaryotic ceils containing 
vectors the present invention are well known in the art and include tetracycline, 
ampicillin. neomycin, and kanamycin resistance. DNA molecules containing 
such sequences are available from numerous sources including Stratagene (11011 
North Torrey Pines Road. La Jolla. CA 92037. USA) and Promega (2800 Woods 
Hollow Road. Madison. WI 5371 1. USA). Nucleotide sequences which result in 
high copy number amplification are also known in the an and include the ColE 1 
sequence contained in the pCYTts vector. 



WO 99/50432 



PCT/IB99/00523 



-29- 

Recombinant Host Cells 

A variety of different recombinant host cells can be produced which 
contain the vectors of the invention. Alphaviruses are known to have a wide host 
range. Sindbis virus, for example, infects cultured mammalian, reptilian, and 
amphibian cells, as well as some insect cells (Clark, H.. J. Nati Cancer Inst. 
57:645 (1973); Leake. C, J. Gen. Virol. 35:335 (1977); Stollar, V. in The 
Toga viruses, R.W. Schlesinger, Ed., Academic Press, (1980), pp.583-621). 
Thus, numerous recombinant host cells can be used in the practice of the 
invention. BHK. COS, Vero, HeLa and CHO cells are particularly suitable for 
the production of heterologous proteins because they have the potential to 
glycosylate heterologous proteins in a manner similar to human cells (Watson. E. 
et al. t Glycobiology V:227, (1994)) and can be selected (Zang, M. et ai, 
Bio/Technology 75:389 (1995)) or genetically engineered (Renner W. et aL, 
Biotech. Bioeng. •/ 7/476 (1995); LeeK. etai Biotech. Bioeng 50:336 (1996)) to 
grow in serum-free medium, as well as in suspension. 

When recombinant host cells capable of expressing a gene of interest are 
intended to be inserted into an individual, these cells will generally be from either 
another individual of the same genus and species or the same individual into 
which the cells will be inserted. Cells may be obtained from an individual by any 
number of means including surgical means and tissue biopsy. 

Introduction of the polynucleotide vectors into host cells can be effected 
by methods described in standard laboratory manuals (see, e.g., Sambrook. J. et 
ai. eds.. Molecular Cloning. A Laboratory Manual. 2nd. edition, Cold 
Spring Harbor Laboratory Press, Cold Spring Harbor. N.Y. (1989), Chapter 9; 
Ausubel. F. et aL. cds.. Current Protocols in Molecular Biology. John H. 
Wiley & Sons. inc. (1997), Chapter 16). including methods such as 
electroporaiion. DEAE-dextran mediated transfection, transfection. 
microinjection, cationic lipid-mediated transfection. electroporation. transduction, 
scrape loading, ballistic introduction, and infection. Methods for the introduction 
of exogenous DNA sequences into host cells are discussed in Feigner. P. et ai. 
U.S. Patent No. 5.580.859. 

Non-infective packaged RNA sequences can also be used to infect host 



WO 99/50432 



PCT/IB99/00523 



-30- 

cells. These packaged RNA sequences can be introduced to host cells by adding 
them to the culture medium. 

As noted supra, the vectors of the invention may also contain genetic 
elements which allow for chromosomal integration of vector sequences. Such 
elements are useful for the stable maintenance of heterologous sequences and 
include sequences which confer both site-specific and site-independent 
integration. Site-specific integration (e.g., homologous integration) and site- 
independent integration, sometimes referred to as "random integration" can be 
used to introduce heterologous sequences of interest into eucaryotic 
chromosomes. Descriptions and methods for inserting genetic material into 
eucaryotic chromosomes are available from numerous sources including 
Sambrook, i.et a/., eds. (Molecular Cloning, A Laboratory Manual, 2nd. 
edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y. (1 989)). 

Production of Polypeptides and RNA Molecules 

The vectors and recombinant host cells of the invention may be used for 
the production of polypeptides and RNA molecules. Thus, the invention provides 
methods for the regulated expression of polypeptides or RNA molecules in host 
cells, comprising the step of introducing nucleic acid sequences of the present 
invention into host cells and regulating the temperature to either repress or induce 
the production of RNA molecules encoding sequences of interest. 

Recombinant host cells which express a gene of interest will generally 
either express this gene in individuals (described in more detail infra) or in in 
vitro cultures. 

When mammalian cells are used as recombinant host cells for the 
production of polypeptides and RNA molecules, these cells will generally be 
grown in tissue culture. Methods for growing cells in culture are well known in 
the art (see. e.g., Celis. J., cd.. Cell Biology, Academic Press. 2 nd edition, 
(1998); Sambrook. J. et ai. eds.. Molecular Cloning. A Laboratory 
Manual, 2nd. edition. Cold Spring Harbor Laboratory Press. Cold Spring 
Harbor. N.Y. (1989); Ausubel. F. et aL eds.. Current Protocols in 
Molecular Biology. John H. Wiley & Sons. Inc. (1997); Freshney. R.. 



I 



WO 99/50432 



PCT/IB99/00523 



-31- 

Culture of Animal Cells, Alan R. Liss, Inc. ( 1 983)). 

The selection of a host cell suited for a particular application will vary 

with a number of factors including the polypeptide or RNA molecule which is 

expressed. For example, when a glycoprotein is produced, it is generally 
5 desirable to express this protein in a cell type which will glycosylate the protein 

in a manner similar to that of the native protein. 

In one aspect, the present invention provides methods for producing 

polypeptides and RNA molecules comprising introducing nucleic acid molecules 

of the invention into recombinant host cells and incubating these cells at a 
10 permissive temperature. In a related aspect, the invention provides purified 

polypeptides and RNA molecules produced according to the methods of the 

present invention. 

Depending on the molecule which is expressed, the molecule may be 
obtained either from the culture supernatant or by lysing the recombinant host 

1 5 cells. When the expression product is a protein, it will often be possible to obtain 

the expression product from the culture supernatant. This will be so even when 
the protein does not have a naturally associated secretory signal. Codons 
encoding such a signal can be added to the vector sequences of the invention and 
will result in the expression of a fusion protein which will be secreted from the 

20 recombinant host cell. Nucleotide sequences encoding such leader sequences are 

known in the art and are publically available (see, e.g. , pPbac and pMbac vectors, 
Stratageke 1997/1998 Catalog, Catalog #21 1503 and #21 1504, Stratagene, 
11011 North Torrey Pines Road, La Jolla. CA 92037, USA). 

Host cells may also be infected with packaged or unpackaged RNA 

25 molecules which have either been transcribed from the DNA molecules of the 

invention or replicated from such transcribed molecules. Further, these host cells 
may be infected at a restrictive temperature and then later shifted to a permissive 
one to activate expression of the gene of interest. The gene product of interest 
may then be recovered and purified by any suitable means. 

30 The protein expressed from the gene of interest can be recovered and 

purified from recombinant cell cultures by methods known in the art including 
ammonium sulfate precipitation, anion or cation exchange chromatography. 



WO 99/50432 



PCIYIB99/00523 



-32- 

phosphocellulose chromatography, hydrophobic interaction chromatography, 
affinity chromatography, hydroxy lapatite chromatography, and high performance 
liquid chromatography. Methods for purifying proteins are described in 
numerous sources (see, e.g.. Celis. J., ed., CELL BIOLOGY, Academic Press, 2 nd 
edition. (1998)). 

Methods for purifying RNA molecules are also known in the art (see, e.g. , 
Celis, J., ed., Cell Biology, Academic Press, 2 nd edition, (1998)). These 
methods include phenol/chloroform extraction, digestion with DNAses followed 
by precipitation of the undigested RNA molecules, and column chromatography 
(e.g., oligo dT column chromatography). Further, RNA molecules can be 
separated from other cellular material using the single-step guanidinium- 
thiocyanate-phenol-chloroform method described in Chomczynski and Sacchi, 
Anal. Biochem. 762.156-159(1987). 

A number of different bioprocess parameters can be varied in order to 
increase the amount of expression product produced during the cell culture 
process. The conditions under which the host cells are grown (e.g., medium 
composition, pH, oxygen concentration, agitation, and, for the case of 
anchorage-dependent cells, the surface provided and the carrier of that surface) 
prior to exposure to the nucleic acid molecules of the invention or induction of 
gene expression influence both the cell density achieved at a given time and the 
physiological state of the cells. These culture conditions will thus affect the 
expected cellular response to vector exposure or the induction signal (e.g., 
shifting to a permissive temperature). Further, the cell culture process-conditions 
mentioned above can be varied to maximize the production of expression product 
and, often, the characteristics (e.g., glycosylation pattern) of that expression 
product. 

The overall cell culture process employing nucleic acid molecules of the 
invention for the production of expression product can be implemented in a 
variety of bioreactor configurations (e.g.. stirred-tank. perfused, membrane 
enclosed, encapsulated cell, fluidized bed. and air-lift reactors) and scales (from 
laboratory T-flasks to thousands of liters), chosen to accommodate the 
requirements of the host cell line utilized (e.g., anchorage dependency. 0 : 



WO 99/50432 



PCT/IB99/00523 



-33- 

concentrations). to maximize the production of expression product, and to 
facilitate subsequent recovery and purification of expression product. 

The invention is also directed to the production of proteins or RNA 
molecules of interest using mammalian cells grown in serum-free or protein-free 

5 culture media. For example, by long-term culture under conditions restricting 

serum access or selecting for suspension growth, CHO cell lines are selected 
which are able to grow in serum-free medium and/or in suspension (Zang. M et 
aL Bio/Technology 75:389(1995)). Further, by genetic modification of CHO Kl 
cells, a modified cell line designated CHO Kl xycE was obtained which grows 

1 0 as suspended single cells in protein-free culture media (Renner W. et al. . Biotech. 

Bioeng. 47:416 (1995)). CHO mutants (e.g., LEC10 cells) have also been 
isolated which produce glycoproteins having different glycosy lation patterns than 
those produced in parental CHO cells (Stanley, P., Glycobiology 2:99 (1992)). 
Alternatively, CHO cells capable of synthesize glycoproteins with 

15 correspondingly modified oligosaccharides may be obtained by genetically 

modifications which alter the activities of enzymes involved in oligosaccharide 
biosynthesis (Minch et al % Biotechnoi Prog. 77:348 (1995)). 

Further, a number of different bioprocess parameters can be varied in 
order to alter the glycosylation pattern of polypeptide products produced by the 

20 recombinant host cells of the invention. These factors include medium 

composition, pH. oxygen concentration, lack or presence of agitation, and. for the 
case of anchorage-dependent cells, the surface provided. Thus, the glycosylation 
pattern of glycoproteins may be altered by choosing the host cell in which these 
proteins are expressed in and the conditions under which the recombinant host 

25 cells are grown. 

As explained below, polypeptides and RNA molecules of interest may 
also be produce in genetically engineered, non-human animals. 

Gene Therapy 

The vectors of the invention are also useful for gene therapy. When the 
30 vectors of the present invention are introduced into cells for gene therapy, the 

methods and vectors used will generally provide for the stable transfer of vector 



I 



WO 99/50432 



PCT/IB99/00523 



-34- 

sequences to the recombinant host cells. In such cases, vector sequences will be 
maintained in the host cell and will be transferred to cellular progeny. For 
example, the inclusion of long terminal repeats of retroviruses in gene transfer 
vectors has been found to confer stable maintenance of vectors sequences in 

5 recombinant host celts (Peng, L. et at. J. Surg. Res. 69: 1 93- 1 98 ( 1 997); Qing, K. 

etal.,J. Virol. 77:5663-5667(1997)). Thus, chromosomal integration of vector 
sequences is one mechanism by which such sequences can be stably maintained 
in recombinant host cells. These sequence can integrate into host cell 
chromosomes either without regard to chromosomal location or at one or more 

1 0 specific chromosomal loci (e.g. , homologous recombination). These recombinant 

host cells may then be cultured in vitro or introduced into an individual. 

The invention provides methods for expressing a sequence of interest in 
an individual to produce a polypeptide or RNA of interest comprising introducing 
nucleic acid molecules of the invention into host cells of the individual and 

15 regulating the temperature of the recombinant host cells. For example, vectors 

of the invention which express a "hot" sensitive replicase and contain a sequence 
encoding a polypeptide or RNA of interest can be introduced into human 
keratinocytes, epithelial cells, or fibroblasts in vitro and then reintroduced into a 
human subject. In such an instance, expression of the polypeptide or RNA of 

20 interest occurs when the temperature of tissues containing these cells is lowered 

to a permissive temperature. 

The present invention also provides methods for administering 
polypeptides or RNA molecules to individuals in need thereof comprising 
introducing nucleic acid molecules of the invention into host cells, introducing 

25 the resulting recombinant host cells into these individuals, and inducing 

expression of the polypeptides or RNA molecules of interest. Similarly, host 
cells nucleic acid molecules of the invention can be introduced into host cells of 
an individual in vivo. 

Induction of gene expression in individuals occurs by changing the 

30 temperature from a restrictive one to a permissive one. When the individual 

undergoing gene therapy is a human, and it is desirable for expression of the gene 
of interest to be activated only at specific times. 37°C will normally be a 



WO 99/50432 



PCT/IB99/00523 



-35- 

restrictive temperature and gene induction will result from raising or lowering the 
temperature to a permissive one. In a similar fashion, when it is desirable for 
expression of the gene of interest to be inactivated only at specific times, 37°C 
will normally be a permissive temperature and gene inactivation will result from 

5 raising or lowering the temperature to a restrictive one. 

The recombinant host cells introduced into an individual may be of any 
cell type that will at least be temporarily maintained in the individual or any cell 
type that will be maintained and at least temporarily retain and express nucleotide 
sequences of the invention. When the individual into which the recombinant host 

10 cells are introduced is a human, the host cells may be of any type which may be 

implanted in an area where the temperature may be altered between a permissive 
and a restrictive one by external means. For example, the recombinant host cells 
may be keratinocytes, epithelial cells, or fibroblasts which have been removed 
from an individual, transfected with a vector of the present invention, and 

15 reimplanted in an area near the surface where the skin temperature normally 

remains at or close to 37°C (e.g. , an axilla). In such an instance, gene expression 
can be activated by altering the temperature of tissues containing the recombinant 
keratinocytes or fibroblasts to a permissive one (e.g., by placing an ice pack or 
peltier element over the location containing the recombinant host cells). Thus. 

20 the induction of expression of the gene of interest requires that the temperature 

of only a portion of the individuals body (e.g., axilla, arm. leg, hand, foot, neck 
region, etc.) be changed from a restrictive one to a permissive one. 

Recombinant host cells may also be implanted in mammals at locations 
below surface, cutaneous tissues. One advantage to introducing recombinant host 

25 cells in such regions is derived from the temperatures of these tissues being more 

stably maintained than with surface, cutaneous tissues and, thus, gene expression 
is less likely to be activated by factors such as changes in climatic conditions. 
While the locations of suitable regions will vary with a number of factors, 
including the individual and the individual's normal body temperature, suitable 

30 tissues will generally include skin, nervous, and muscle tissues. 

In another aspect, the invention provides methods for administering a 
polypeptide or RNA molecule to an individual in need thereof comprising the in 



WO 99/50432 



PCT/IB99/00523 



-36- 

vivo introduction of nucleic acid molecules of the invention into host cells of the 
individual and inducing expression of heterologous polypeptides or RNA 
molecules encoded by these nucleic acid molecules. Methods for the in vivo 
introduction of alphaviral vectors to mammals tissues are described in 
5 Altman-Hamamdzic S. et al (Gene Ther. 7:815-822 (1997)). 

In a further aspect, methods are provided for administering a polypeptide 
or RNA molecule to an individual in need thereof by introducing RNA molecules 
to the cells of the individual. These RNA molecules may be obtained by a variety 
of methods including in vitro transcription and recombinant host cell expression. 

1 0 The RNA molecules may be introduced into cells of the individual either in vitro 

or in vivo. Methods for the introducing RNA sequences into host cells of 
individuals are described in Feigner, P. et aL U.S. Patent No. 5,580,859. 

The invention also provides non-infective, packaged RNA molecules 
encoding a temperature sensitive replicase useful as gene therapy vectors. These 

1 5 vectors have the advantages of being non-infectious, non-integrating, and express 

the gene of interest in a temperature-sensitive manner. Vectors of this type are 
useful for a variety of applications where a single administration of the gene 
product of interest is desired (e.g., vaccine administration). 

The nucleic acid molecules of the invention are useful for the regulated 

20 expression of stably integrated heterologous sequences in individuals. In one 

application, kcratinocytes or fibroblasts of a human individual afflicted with 
diabetes are removed by tissue biopsy. DNA molecules of the invention 
containing a sequence of interest encoding human insulin are introduced and 
stably integrated into these cells in vitro. These recombinant host cells are 

25 reimplanted in a location near the surface where body temperature is relatively 

stably maintained (e.g., an axilla). Prior to meal time, or some other time when 
insulin production is desired, the individual places an ice pack or a peltier 
element for a specified period of time over the location containing the 
recombinant host cells to induce expression of the heterologous insulin coding 

30 sequences. Further, a warm item may used by the individual to raise the 

temperature to a permissive one when a cold sensitive replicase is used. 

The actual temperature of the item which is placed in contact with the skin 



WO 99/50432 



PCT/IB99/00523 



-37- 

will vary with the type of temperature-sensitive mutation used, the individual, the 
location of the recombinant host ceils, the level of gene expression desired, and 
other factors. 

Genetically Engineered, Non-Human Animals 

Genetically engineered animals are currently used for the production of 
heterologous proteins (see, e.g., Jeng, S. et aL, J. Dairy Set 50:3167-3175 

(1997) ; Limonta J. etai. Immunotechnology 7:107-1 13 (1995)). These proteins 
are often harvested from bodily fluids such as blood, milk and urine (Meade, H. 
etaL Nat Biotechnol 16:2 1 -22 ( 1 998); Kerr, D. etai, Nat Biotechnoi 76:75-79 

(1998) ). 

The present invention also provides genetically engineered, non-human 
animal comprising cells which contain nucleic acid molecules of the present 
invention. These animals will generally have one or more DNA molecules of the 
invention stably integrated into their somatic and germ line cells. A number of 
methods are known in the art for producing animals having DNA molecules of 
the invention in their germ line cells (see, e.g., Hew, C. et al. % U.S. Patent No. 
5,545,808; Jolicoeur, P., U.S. Patent No. 5,574,206; Mintz, B., U.S. Patent No. 
5,550,316; Wagner. T. et at. U.S. Patent No. 4,873,191). For example, DNA 
molecules can be introduced by microinjection into a fertilized, mammalian 
oocyte between the one-cell and eight-cell stage of embryological development. 
These oocytes are then implanted in a suitable female to produce founder animals 
which will stably transmit the heterologous transgene through the germ line to the 
next generation. Southern blot analysis is generally used to determine whether 
the genome of any particular individual carries the heterologous DNA sequence. 

The genetically engineered animals may also contain nucleic acid 
molecules of the invention exclusively in somatic cells. Host cells containing 
these molecules may be implanted into the animal or nucleic acid molecules may 
be introduced into host cells of the animal in vivo. 

Expression of the gene of interest in the cells of a genetically engineered 
animal may be induced by altering the body temperature of all or part of the 
animal from a restrictive one to a permissive one. Thus, the choice of the animal 



WO 99/50432 



PCT/IB99/00523 



-38- 

used will vary with a number of factors, including the restrictive and permissive 
temperatures of the replicase employed, the normal body temperature of the 
animal to be genetically engineered, and the gene of interest. These animals may 
be either warm-blooded or cold-blooded. For example. Hew, C. et al (U.S. 
Patent No. 5.545,808) describes the production of transgenic fish which express 
nucleotide sequences linked to an "anti-freeze" gene promoter. Expression of a 
sequence of interest in such an animal containing a nucleic acid molecule of the 
invention can be regulated by changing the water temperature the fish is kept in 
between restrictive and permissive temperatures. 

When a warm-blooded animal contains a nucleic acid molecule of the 
present invention, the normal body temperature of the animal may be either a 
restrictive one or a permissive one. Further, in many instances expression of the 
gene of interest will either be induced or repressed in only a portion of the animal 
at any one time. For example, when the normal body temperature of a 
warm-blooded animal is a restrictive temperature and the temperature sensitive 
replicase is "hot" sensitive, the animal may be kept under conditions in which its 
extremities (e.g., feet, arms legs, etc.) or surface tissues are lowered to a 
permissive one. 

When a warm-blooded animal having cells which contain a nucleic acid 
molecule of the invention has a normal body temperature which is a permissive 
one. the gene of interest will generally be expressed in cells in internal regions of 
the animal. Such animals will be particularly useful for expressing the gene of 
interest in mammary gland and urothelial tissues. Kerr, D. ei al (Nat. Bioiechnoi 
7(5:75-79 (1998)), for example, describe the production of transgenic animals 
which express a foreign gene in the cells of their urothelium. These animals 
excrete the foreign gene product in their urine. Thus, the product of the gene of 
interest is readily collectable from such animals. Similarly, expression of the 
gene of interest in mammary gland tissues can result in the gene product being 
excreted into the animal's milk. 

The present invention thus further provides genetically engineered, non- 
human animals which contain nucleic acid molecules of the invention in at least 
some of their cells. Also provided are genetically engineered, non-human 



WO 99/50432 



PCT/IB99/00523 



-39- 

animals which contain DNA molecules of the invention stably integrated into the 
genome of some or all the animal's cells. The invention also provides methods 
for producing genetically engineered, non-human animals comprising introducing 
cells containing nucleic acid molecules of the invention into these animals, 
introducing nucleic acid molecules of the invention into the cells of these animals 
in vivo, or introducing DNA molecules of the invention into germ line cells to 
produce transgenic animals containing the sequence of interest in their somatic 
and germ line cells. 

Pharmaceutical Compositions 

The invention further provides pharmaceutical compositions, comprising 
polynucleotides of the invention in solution with a physiologically acceptable 
carrier and in a therapeutically effective amount. The administration of these 
pharmaceutical compositions may, for example, result in expression of a 
polypeptide in tissues of an animal which is immunogenic and intended to 
function as a vaccination. Similarly, the sequence of interest may encode 
polypeptides or RN A molecules required for the treatment of an active affliction. 
The administration of a pharmaceutical composition of the invention will thus be 
intended to have a therapeutic effect in these instances. 

The nucleic acid molecules and recombinant host cells of the invention 
will normally be administered to an individual in a pharmacologically acceptable 
carrier. A composition is said to be "pharmacologically acceptable" if its 
administration can be tolerated by a recipient individual. Further, the 
composition of the invention will be administered in a "therapeutically effective 
amount" (i.e., an amount that produces a desired physiological effect). 

As would be understood by one of ordinary skill in the art. when the DNA 
molecules or recombinant host cells of the invention are administered to an 
individual, they may be in a composition which contains salts, buffers, adjuvants, 
or other substances which are desirable for improving the efficacy of the 
composition. Examples of materials suitable for use in preparing pharmaceutical 
compositions are provided in numerous sources including REMINGTON'S 
Pharmaceutical Sciences (Osol. A. ed.. Mack Publishing Co.. (1980)). 

The therapeutic compositions of the present invention can be administered 



WO 99/50432 



PCT/IB99/00523 



-40- 

by various art known means but will normally be administered by injection, 
infusion or other suitable physical methods. The compositions may alternatively 
be administered intramuscularly, intravenously, or subcutaneously . Components 
of compositions for administration include sterile aqueous (e.g., physiological 
saline) or non-aqueous solutions and suspensions. Examples of non-aqueous 
solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive 
oil, and injectable organic esters such as ethyl oleate. Carriers or occlusive 
dressings can be used to increase skin permeability and enhance antigen absorp- 
tion. 

When recombinant host cells are administered to an individual, the 
number of cells or nucleic acid molecules required to provide a therapeutically 
effective amount will vary with such factors as the individual's condition, the 
proteins or RNA molecules intended to be expressed, and the size of the 
individual. 

Examples 

The following enzymes and reagents were used in the experiments 
described in the examples which follow: Pwo polymerase, dNTPs and restriction 
enzymes were obtained from Boehringer Mannheim (9115 Hague Road, 
Indianapolis, IN 46250). T4 DNA ligase, fetal calf serum (FCS), bacto-tryptone 
and yeast extract was obtained from Gibco BRL (P.O. Box 68, Grand Island, NY, 
14072, USA). Bsp\20 I was obtained from MBI Fermentas. Inc. (300 Pearl St. 
Buffalo. NY, 14202, USA). XL-1 Blue competent cells were obtained from 
Stratagene (1 101 1 North Torrey Pines Road. La Jolla, CA. 92037, USA). DNA 
purification kits and Taq polymerase were obtained from QIAGEN. Inc., (9259 
Eton Avenue, Chatsworth, C A. 91311. USA). HP- 1 medium was obtained from 
Cell Culture Technologies (Glattbrugg. Switzerland). All standard chemicals 
were obtained from Fluka (980 South 2 nd St., Ronkonkoma. NY. 1 1 779. USA), 
Sigma Chemical Co. (P.O. Box 14508. St. Louis, MO 63178. USA). Aldrich 
(1001 West St. Paul Ave. Milwaukee. WI. 53233. USA) and all cell culture 
materials were obtained from Becton Dickinson & Co. (1 Becton Drive. Franklin 



WO 99/50432 



PCT/IB99/00523 



-41- 

Lakes, NJ. 07417. USA). 

Example 1 
Construction of the pCYTts vector system: 

Manipulations and sequencing of DNA were carried out by standard 
procedures. The mutations in nsP2 were introduced by PCR using the following 
oligonucleotides: 

oligo-nsp2 1 : S'-AACATTGAAATCGATATTACAGGGG (SEQ ID NO:2), 
oligo-nsp2 2: 5'-CGGGTTATGGTCGACCGGGC (SEQ IDNO:3), 
oligo-nsp2 3: 5'-GTGCCCTCCCCTGAGTTTAAACAATTCAGGGCCGA 

ACGCG (SEQ ID NO:4), and 
oligo-nsp2 4: 5'-GAATTGTTTAAACTCAGGAGGCACCCTCGTGG (SEQ ID 
NO: 5), the single restriction sites used for first analysis and subsequent cloning 
(DraL Cla\ and Sail) are underlined. PCR reactions were performed using either 
oligo-nsp2 1 (SEQ ID NO:2) and oligo-nsp2 3 (SEQ ID NO:4) or oligo-nsp2 2 
(SEQ ID NO:3) and oligo-nsp2 4 (SEQ ID NO:5). 100 pmol of each oligo was 
used and 5 ng of the template DNA (pSinRep5: Xiong, C. et a!., Science 
243\\ 188-1 191 (1989)) was used in the 100 u\ reaction mixture, containing 4 
units of Taq or Pwo polymerase, 0.1 mM dNTPs and 1 .5 mM MgSO„. All DNA 
concentrations were determined photometrically using the GeneQuant apparatus 
(Pharmacia Biotech Inc., 800 Centennial Ave., Piscataway, NJ. 08854). The 
polymerase was added directly before starting the PCR reaction (starting point 
was 95°C). The temperature cycles were as follows: 95 °C for 2 minutes, 
followed by 5 cycles of 95°C (45 seconds). 58°C (30 seconds), 72°C (90 
seconds) and followed by 25 cycles of 95 °C (45 seconds), 68 °C (30 seconds), 
72 °C (90 seconds). 

The two PCR fragment were purified using Qia spin PCR kit (QIAGER 
Inc.. 9259 Eton Avenue. Chatsworth. CA. 91311) and finally digested in an 
appropriate buffer using 20 units of Sal\ and DraL respectively 20 units of Cla\ 
and DraL The digestion was performed for 12 hours at 37°C. The DNA 



WO 99/50432 



PCT/1B99/00523 



-42- 

fragments were gel-purified (Gene-Clean; Bio 101 Inc., 1 070 Joshua Way, Vista, 
CA, 92083, USA) and finally ligated into ClallSaR digested and gel-purified 
SinRepS vector (Xiong, C. a aL Science 243:1 188-1 191 (1989). The correct 
sequence of the obtained vector was checked by DNA sequencing of the whole 
nsP2 gene. 

The mutations in nsP4 were also introduced by PCR using the following 
oligonucleotides: 

oligo-nsp4 1: S'-GGTAGACGAGACAGTCGCATGCCTGGATAC (SEQ ID 
NO:6), 

oligo-nsp4 2: 5'-GTATCCAGGCATGCGACTGTCTCGTCTACC (SEQ ID 
NO:7), 

oligo-nsp4 3 : 5'-CAGACCGGTTAACGCCATAGCG TCG (SEQ ID NO:8), and 
o!igo-nsp4 4: S'-CTCTATTACTAGTATGGACAGTTGG (SEQ ID NO:9), the 
singular restriction sites used for the first analysis and the final cloning step (Sphl, 
Hpal and Spel) are underlined. Two PCR reactions were carried out as described 
above using either oligo-nsp4 1 (SEQ ID NO:6) and oligo-nsp4 3 (SEQ ID NO:8) 
or oligo-nsp4 2 (SEQ ID NO:7) and oligo-nsp4 4 (SEQ ID NO:9). 

Both PCR products were gel-purified and then used in assembly PCR to 
amplify the whole nsP4 gene. For the assembly PCR, 50 pmol of the outer 
primers (3 and 4) and about 1 0 ng of each PCR fragment was used. The reaction 
volume was 100 pl 9 containing 4 units of Taq or Pwo polymerase, 0.1 mM 
dNTPs and 1 .5 mM MgS04 . The PCR conditions were as followed: 

Ninety-five °C for 2 minutes, followed by 5 cycles of 92 °C (45 seconds), 
58°C (30 seconds), 72°C ( 120 seconds) and followed by 25 cycles of 92°C (45 
seconds), 64 °C (30 seconds). 72 °C (120 seconds). 

The obtained PCR fragment was purified as described above and the 
eluate was digested with 20 units of Spel and Hpal in an appropriate buffer. The 
fragment was gel-purified and ligated into gel-purified Spel/ Hpal restricted 
SinRepS vector. The correct sequence of the obtained vector was checked by 
DNA sequencing. 

Over night digestion of SinRep5-nsP4mut and SinRep5-nsp2mut with 
Spell Hpal and gel purification of the nsp4 fragment and sinRep-nsp2mut vector. 



WO 99/50432 



PCT/IB99/00523 



-43- 

The nsp4mut fragment was ligated into the SinRep5-nsp2mut vector. The final 
step was cloning the nsp gene into the 987/SinRep5 vector (Bredenbeek, P. et al . 
J. Virol 67:6439-6446 (1993)) using Clal and Hpal as restriction endonucleases. 
the resulting vector was named pCYTts (FIG. 2 and FIG. 3A-3D (SEQ ID 
NO:l)). 

pCYTts constructs: Five different genes were cloned into the pCYTts 
vector. Green fluorescent protein (GFP), secreted alkaline phosphatase (SEAP), 
p-interferon (p-INF), erythropoietin (EPO). and HIV gpi60. 

Example 2 

Regulated expression of GFP in transient and stable expression 

The pCYTts system was successfully used to express cytoplasmic 
proteins, as an example we used the green fluorescent protein (GFP) of the 
jellyfish Aequorea victoria (Crameri et aL Nat. Biotech. 7-/:315-319 (1996)). 
GFP is ligated into pCYTts via Xbal and Bsp\20 1 (Fermentas). Clones with the 
correct insert were identified by restriction digest. The GFP expression was 
tested in both, transient and stable expression. 

Transient transfection in BHK 2 1 cells was carried out using the CaP0 4 
precipitation transfection protocol: 6 iug of plasmid DNA (pCYTts GFP) in 30 
//l H.O was mixed with 30 tA of an 1 M CaCU solution. After addition of 60 
/xl phosphate buffer (50 mM HEPES, 280 mM NaCl, 1 .5 mM Na : HP0 4 , pH 7.05) 
the solution was vortexed for 5 seconds, followed by an incubation at room 
temperature for 25 seconds. The solution was immediately added to 2 ml HP-1 
medium containing 2% FCS (2% FCS medium). The medium of a 80% 
confluent BHK21 cell culture in a 6-well plate was then replaced by the DNA 
containing medium. After an incubation for 5 hours at 37°C in a CO : incubator, 
the DNA containing medium was replaced by 2 ml of 1 5% glycerol in 2% FCS 
medium. The glycerol containing medium was removed after a 30 second 
incubation phase and the cells were washed with 5 ml of HP-1 medium 
containing 10% FCS. Finally 2 ml of fresh HP-1 medium containing 10% FCS 



WO 99/50432 



PCT/IB99/00523 



-44- 

was added. 

After transient transfection of BHK cells with pC YTtsGFP. the expression 
was tested at 37°C. No expression of GFP was detected using the methods 
described below. GFP was produced when the temperature was shifted down to 
29 °C. The GFP expressing cells survived for at least 5 days. 

Stable transfection in BHK2 1 cells. The stable transfection is carried out 
essentially as described for the transient transfection, except, for the stable 
transfection linearized plasmid DNA was used. Twenty of pC YTtsGFP was 
incubated with 30 units of Nael in an appropriate buffer for at least 4 hours at 
37°C. The reaction was stopped by phenol/chloroform extraction, followed by 
an isopropanol precipitation of the linearized DNA. The restriction reaction was 
checked by gel electrophoresis using a 0.8% agarose gel, stained with ethidium 
bromide. For the transfection 5.4 /ig of linearized pCYTtsGFP was mixed with 
0.6 ^g of circular pSVtrpB (selection plasmid) in 30 p\ H 2 0. Followed by the 
procedure described for transient transfection. 

Stably transfected cells were selected and grown in selection medium 
(HP-1 medium, without tryptophane, supplemented with 300 a*M indole and 5% 
dialyzed FCS) at 37 °C in a CO : incubator. When the mixed population had 
grown to confluency. the culture was divided into two parts and both parts were 
cultured for an additional 1 2 hours at 37 °C. One part of the cells was then shifted 
to 30 °C to induce the expression of the gene of interest. The other part was kept 
at37°C. 

Detection of gene expression 

Green fluorescent protein can be easily detected in a spectrofluorometer, 
due to its strong fluorescence. This is seen when GFP is located in the cytoplasm 
of the cell. GFP production was detected by fluorescence microscopy and 
quantified by whole cell spectrofluorophotometry (Spectrofluorophotometer, 
Shimadzu RF-5001PC). Detached cells were washed with 5 ml PBS (per liter: 
0. 1 32 g CaCl : *2H : 0: 0.20 g KC1: 0.20 g KH : P0 4 ; 0. 1 0 g MgCl : *6H : 0; 8 g NaCl; 
1.15 g Na : HP0 4 ; pH 7.2) and resuspended in 1 ml PBS. The excitation 



WO 99/50432 



PCT/IB99/00523 



-45- 

wavelength was 397 run and the emission wavelength was 5 1 0 nm. To carry out 
the measurements in a linear range for fluorescence detection, the cells were 
diluted to obtain a fluorescence between 0.05 and 1 .0 emission units. 

To determine the optimal induction temperature, cultures of mixed 
populations of stable transfected cells were incubated for 48 hours at different 
temperatures in selection medium without FCS. Expression was induced when 
cultures were shifted to 34°C or lower. The highest expression was detected at 
29°C (FIG. 4A). When stable transfected cells were induced at 30°C for 4 hours 
and subsequently grown at 37°C for 24 hours, green cells could be observed by 
fluorescence microscopy. This clearly showed that the expression of the gene of 
interest starts after 4 hours of induction (FIG. 6A). 

Time dependence 

The kinetics of the system were determined by photometrically at different 
time points after induction. GFP expression was detected as described above. 
Ten hours after induction a clear expression of GFP is detectable at 29°C (FIG. 
5 A). When shifting the ceils back to 37°C after induction, new mRNA 
production should be blocked, however, the translation of the protein of interest 
should occur with a higher expression level. The cells were shifted after 4. 6. 8 
or 10 hours after induction back to 37°C 24 hours later the expression of GFP 
was detected as described above (FIG. 6A). Thus, transcription starts shortly 
after induction. 

Long term stability of the cell line 

To determine the long term expression of the gene of interest, stably 
transfected cells were cultured for at least 8 weeks at 37°C. The expression of 
GFP was tested by shifting the cells to 29°C. No difference was observed in the 
expression level of GFP between cells used directly after stable transfection and 
cells cultured for at least 4 weeks. 



WO 99/50432 



PCT/1B99/00523 



-46- 
Example 3 

Regulated expression of SEAP in transient and stable expression 

The pCYTts system was successfully used to express secreted proteins, 
as an example we used the secreted alkaline phosphatase (SEAP) of human origin 
(CLONTECH Laboratories, Inc., 1020 East Meadow Circle. Palo Alto, CA, 
94303, USA). The SEAP coding sequence is ligated into pCYTts v'mXbal and 
Stul. Clones with the correct insert were identified by restriction digest. SEAP 
expression was tested for both transient and stable expression. 

Transient transfection in BHK21 cells was carried out using the CaP0 4 
co-precipitation transfection protocol as described in Example 2. 

Stable transfection in BHK21 cells 

The stable transfection was carried out essentially as described for 
transient transfection, except that linearized plasmid DN A was used. Twenty ixg 
of pCYTtsSEAP was incubated with 30 units of Mlu\ in an appropriate buffer for 
at least 4 hours at 37°C. 10 ptg of pSVneo was digested with 30 units of Seal for 
at least 4 hours at 37 °C. Both reactions were stopped by phenol/chloroform 
extraction, followed by an isopropanol precipitation of the linearized DNA. The 
restriction reactions were checked by gel electrophoresis using a 0.8 % agarose 
gel, stained with ethidium bromide. For the transfection 5.88 jug of linearized 
pCYTtsSEAP is mixed with 0.12 of linearized pSVneo (selection plasmid) in 
30 ^1 H 3 0. Followed by the procedure described for the transient transfection. 

Detection of gene expression 

Transient and stable transfected cells containing pCYTtsSEAP were tested 
for SEAP expression after 3 days of induction by dot blotting. 2.5 ^1 of cell 
culture supernatant was spotted on a nitrocellulose membrane. After drying the 
membrane for 10 minutes at room temperature, the development reaction was 



WO 99/50432 



PCT/IB99/00523 



-47- 

carried out using alkaline phosphatase detection reagents (1 0 ml AP buffer (100 
mM Tris/HCl, 1 00 mM NaCl. pH 9.5) with 50 y\ NBT solution (7.7% Nitro Blue 
Tetrazolium (Sigma) in 70% dimethylformamide) and 37 ^1 of X-Phosphate 
solution (5 % of 5-bromo-4-chloro-3-indolyl phosphate in dimethylformamide). 

The SEAP activity was quantified in an colorimetric enzymatic activity 
test. 500 //l of culture supernatant containing SEAP was incubated at 65 °C for 
5 minutes, and finally centrifuged (20,000g; 20 seconds). To determine the SEAP 
activity 400 jal of the centrifuged supernatant were mixed with 500 of 2 x 
SEAP buffer (20 mM L-homoarginine, 2 M diethanolamine, and 1 mM 
MgCl 2 »6H 2 0, pH 9.8) in a cuvette. The SEAP activity was followed in a 
spectrophotometer at 405 nm. after adding 100 ^1 nitrophenylphosphate (120 
mM) (Sigma 1 04, Sigma) to the sample. The absorbance was measured every 30 
second over a time period of 1 0 minutes. The obtained values at different time 
points were plotted versus the time and a plot with a linear slope was obtained. 

In the mixed population the amount of SEAP molecules produced per cell 
was estimated to be around 1 0 7 molecules per cell. To get a stable expression of 
SEAP, cloned cells were automatically sorted in a cell sorter and finally analyzed 
for SEAP activity. About one out of 20 clones showed SEAP expression. The 
SEAP expression was estimated to be one order of magnitude higher than in the 
mixed population. 

Highest SEAP expression was detected at 29 °C (FIG. 4B). SEAP activity 
could be detected 15 hours after induction at 29°C (FIG. 5B). However, 
expression of SEAP started much earlier, as shown in FIG 6B. The SEAP 
expressing cells were shifted after 4. 6, 8 or 10 hours of induction back to 37°C, 
24 hours later the expression of SEAP was detected as described above. SEAP 
expression could be detected as early as 6 hours after induction (FIG. 6B). Thus 
the SEAP expression also started shortly after induction. 



WO 99/50432 



PCT/IB99/00523 



-48- 
Example 4 

Regulated expression of fi-INF in transient and stable expression 

A P-interferon gene of human origin was used to demonstrate that the 
pCYTts system can be used to express antiviral, secreted proteins. P-interferon 
has antiviral activity and interferes with RNA replication. pCYTts systems 
tightly regulate the expression of genes even when these genes encode proteins 
which interfere with RNA replication. 

The gene encoding p-interferon was generated as described in Prodromou, 
C. and Pearl. L. (Protein Eng. 5:827-829 (1992)). Primers were generated using 
the human P-interferon nucleotide sequences disclosed in GenBank reports 
V00534, J002 1 8, K006 1 6 S and M 1 1 029. The p-interferon cDNA was ligated into 
pCYTts after restriction with Xba\ and Bsp 1 201 . Expression of P-interferon was 
tested in transient and stable expression systems. 

Transient and stable (mixed population) expression of P-INF was 
determined by Western-blotting. 0.5 ml of culture medium was 
methanol/chloroform precipitated and the pellet was resuspended in SDS-PAGE 
sample buffer. Samples were heated for 5 minutes at 95 °C before being applied 
to 15% acrylamide gels. After SDS-PAGE. proteins were transferred to Protan 
nitrocellulose membranes (Schleicher & Schuell. Inc., 10 Optical Ave., Keene. 
NH 0343 1 . USA). The membrane was blocked with 1 % bovine albumin (Sigma) 
in TBS ( 1 OxTBS per liter: 87.7 g NaCL 66. 1 g Trizma hydrochloride (Sigma) and 
9.7 g Trizma base (Sigma), pH 7.4) for 1 hour at room temperature, followed by 
an incubation with a mouse anti-human p-INF antibody (0.2 Mg/ml, Research 
Diagnostics Inc.. USA) for 1 hour. The blot was washed 3 times for 10 minutes 
with TBS containing 0.05% Tween20 (TBS-T). and incubated for 1 hour with a 
horseradish peroxidase-anti-mouse IgG conjugate (0.1 Mg/ml, Amersham Life 
Science. England). After washing 2 times for 1 0 minutes with TBS-T and 2 times 
for 10 minutes with TBS, the development was carried using the ECL kit 
(Amersham). 

Samples for the blot were taken after 3 or 5 days incubation at 29 C C. 



WO 99/50432 



PCT/IB99/00523 



-49- 

Another part of the culture was kept at 37°C and a sample was taken after 5 days. 
FIG. 8A shows that p-INF is produced after 3 days at 29 °C whereas incubation 
at 37 °C yields no detectable P-INF production. 

Example 5 

Regulated expression of EPO in transient expression 

The pCYTts system was successfully used to express pharmaceutical^ 
relevant, secreted proteins. As an example of such expression, we used a gene 
of human origin encoding erythropoietin (EPO). This gene was generated by 
PCR as described in Example 4. Primers were generated using the human EPO 
nucleotide sequences disclosed in GenBank report X02158. The gene encoding 
EPO was ligated into pCYTts following restriction with Xba\ and £spl20L 
(Fermentas). Clones with the correct insert were identified by restriction digest. 
EPO expression was tested in both transient and stable expression systems. 

BHK21 cells were transiently transfected according to the CaP0 4 
co-precipitation protocol, as described in Example 2. 

EPO production was determined by western blotting, as described in 
Example 4. The detection was carried out by incubating the nitrocellulose 
membrane with 2 fug rabbit anti-human EPO antibody (Research Diagnostics 
Inc.) in lOmlTBS-Tfor 1 hour, followed by 3 washes, each for 10 minutes, with 
TBS-T. Finally, the nitrocellulose membrane was incubated for 1 hour with 
alkaline phosphatase conjugated anti-rabbit IgG (Jackson ImmunoResearch 
Laboratories, Inc.) diluted 1:5000 in TBS-T. After washing 2 times for 10 
minutes with TBS-T and 2 times for 10 minutes with TBS. the blot was 
developed by alkaline phosphatase staining as described in Example 3. 
Transiently transfected cells induced for 4 days at 29°C produced detectable 
amounts of EPO (FIG. 8B). 



WO 99/50432 



PCT7IB99/00523 



-50- 

Example 6 

Regulated expression of EPO in stable expression 

In the pCYTts504EPO expression vector, the human erythropoietin 
(EPO) coding sequence (including its natural leader peptide for secretion into the 
5 growth medium) was fused in frame to the sequence coding for the Sindbis virus 

capsid protein (C-protein). The rationale of this construct was to include the 
translational enhancer located within the C-protein coding region that has been 
shown to lead to a 10- to 20-fold increased expression level compared to 
constructs lacking this enhancer (Frolov et ai. Proc. Natl Acad ScL USA 
10 93:11371-1 1377 (1996)). The fusion gene is expressed from the subgenomic 

promoter of expression vector pC YTts. Upon co-translational release of the EPO 
precursor from the fusion protein, catalyzed by the autoproteolytic activity of the 
C-protein, EPO is directed to the secretory pathway by its N-terminal leader 
peptide. 

15 For stable transfection, a 3:1 ratio of pCYTts504EPO (linearized by 

restriction cleavage with Mwl) and the neomycin resistance-conferring plasmid 
987BBneo (Bredenbeek et a/., J Virol. 67:6439-6446 (1993) (linearized by 
restriction cleavage with Seal) were introduced into BHK21 cells using the 
calcium phosphate co-precipitation protocol described in Example 2. After 1 

20 week incubation at 37°C under selective conditions (HP- 1 medium supplemented 

with. 1 0% FCS and 200 [ig/ml G4 1 8 (neomycin)), single colonies were separated 
and further propagated under the same conditions. 

To screen for EPO-secreting clones, cells were grown in 12-well plates 
at 37°C to 80% confluency and incubated at 30°C for further 4 days. Three jil 

25 of each culture supernatant were analyzed for secreted EPO by Dot Blot analysis 

using an anti-EPO rabbit IgG and an ami rabbit IgG-alkaline phosphatase 
conjugate. Among 27 clones investigated, one EPO-secreting clone was 
identified. A rough concentration of 2.5 mg EPO per liter of supernatant was 
estimated using an EPO EL1SA Kit (Boehringer Mannheim). The identity of the 

30 secreted protein was further confirmed by Western Blot analysis. For that 



WO 99/50432 



PCT/IB99/00523 



-51- 

purpose. cells were grown to 80% confluency at 37°C in a T-75 cell culture flask 
with 30 [xl HP-1 medium (without FCS) supplemented with G418 (200 \xg/ml) 
and then incubated at 30°C for further 4 days. Twenty nl of the culture 
supernatant were separated on a 15% SDS polyacrylamide gel and blotted onto 
5 a nitrocellulose membrane. Using an anti-EPO rabbit IgG/anti-rabbit IgG- 

alkaline phosphatase conjugate system, a single protein was specifically detected, 
that showed the same electrophoretic mobility as an authentic EPO sample from 
a different source (apparent M f about 29 kDa) (FIG. 9). The resulting cell line 
was named 1C4. 

10 Example 7 

Production of Sindbis Virus particles containing EPO RNA 

One |^g of RNase-free vector (pDH-EB; Bredenbeek el ai. t J. Virol 
J 7:6439-6446 ( 1 993)) was linearized by EcoRl digestion. Subsequently in vitro 
transcription was carried out using the SP6 in vitro transcription kit 

15 (InvitroscripCAP by Invitrogen, Invitrogen BV, NV Leek, Netherlands). The 

resulting S'-capped mRNA was analyzed on reducing agarose-gels. 

Five \ig of in vitro transcribed mRNA were electroporated into 1 C4 cell 
line (Example 6) according to Invitrogen's manual (Sindbis Expression system, 
Invitrogen BV. Netherlands). After 10 hours incubation at 37°C the FCS 

20 containing medium was exchanged by HP- 1 medium without FCS. followed by 

an additional incubation at 30°C for 72 hours. The supernatant was passaged to 
a BHK 21 cell layer, incubated for 2 hours at 4°C and finally discharged. The 
cells were washed 4 times with HP- 1 buffer and incubated for 24 hours at 30°C. 
Three fal of the culture supernatant were analyzed for secreted EPO by Dot Blot 

25 analysis using an anti-EPO rabbit IgG and an ami rabbit IgG-alkaline 

phosphatase conjugate (FIG. 10). 



WO 99/50432 



PCT/IB99/00523 



-52- 
Example 8 



Regulated expression of gp!60 in transient expression 



The pCYTts system was used to express gp!60, the HIV envelope 
protein. The gpl60 gene was amplified from pAbT4674 (ATCC 40829) and 
cloned in pCYTts via Xbal and Bsp 120L. BHK21 cells were transiently 
transfected using lipofectamine (Life Technologies, BaseL Switzerland). 0.8 jig 
pCYTts gpl60 DNA in 150 jal Dulbecco's Modified Eagle medium (DMEM, 
Life Technologies. Basel. Switzerland) was mixed with 150 ^1 DMEM 
containing 2.5 jil lipofectamine. The solution was incubated at room temperature 
for 15 minutes and added to a 80% confluent BHK cell layer in a 24-welI plate. 
After incubation for 5 hours at 37 °C in a C0 2 incubator, the cells were washed 
and incubated for another 12 hours at 37°C. Cells were split and one part was 
incubated at 29°C and one part was incubated at 37°C for 5 days. Cells were 
harvested and lysed in SDS-PAGE sample buffer. Samples were heated for 5 
minutes at 95°C and applied to a 8% acrylamide gel. gpl60 expression was 
analyzed by Western blotting as described in Example 4. The nitrocellulose 
membrane was incubated with rabbit anti-human gpl60 antibody (kindly 
provided by Dr. Schawaller, Diamed AG. Switzerland), diluted 1 :3000 in 10 ml 
TBS-T for 1 hour and subsequently washed three times for 10 minutes with 
TBS-T. Then the membrane was incubated for 1 hour with alkaline phosphatase 
conjugated goat anti-rabbit IgG (Jackson ImmunoResearch Laboratories, Inc.) 
diluted 1:5000 in 10 ml TBS-T. The membrane was washed two times with 
TBS-T for 10 minutes and two times for 10 minutes with TBS. Development 
was carried out as described in Example 3. Transiently transfected cells 
produced detectable amounts of gpl60 (data not shown). 



WO 99/50432 



PCT/IB99/00523 



-53- 
Example 9 

Regulated expression of GFP in human foreskin fibroblasts 

The pCYTts system was used to express green fluorescent protein in 
human foreskin fibroblasts. Cells were transfected using lipofectamine as 
described in Example 8. Twelve hours post-transfection one part of the cells was 
incubated at 37°C, the other part was incubated at 29°C. After 48 hours bright 
green cells were observed by fluorescence microscopy in the cultures incubated 
at 29°C. whereas at 37°C no GFP expression was detected. 

Example 10 
A multivector system with the insert in sense direction 

The regulatable vector system of the invention was used for the 
production of non-cytopathic viral particles. As the gene of interest we chose the 
structural proteins of Sindbis virus and as a marker protein we chose GFP. The 
cells were stably transfected with pCYTtsGFP. as described in Example 2. The 
stable transfected cells were transiently transfected with a defective helper 
construct (pDHBB; Bredenbeek et aL J. Virol. 1 1 :6439-6446 (1993)), carrying 
the Sindbis virus structural proteins according to the protocol described in 
Example 2. 

Transfected cells were grown overnight at 37°C. The cells were then 
shifted to 29°C to induce viral gene expression. The viral particles formed 
contain packaged pCYTtsGFP RNA sequences, and GFP is expressed when the 
packaged viral particles infect new target cells. To perform the new infection, 
the medium was collected and centrifuged ( 1 800 rpm; 3 minutes) after 4 days of 
expression. The supernatant was placed on 80% confluent BHK cell layers and 
incubated for 4 hours at 29°C After the incubation phase the medium was 
discharged and the cells were washed 3 times with 5 ml HP-1 medium followed 
by incubation at 29°C for an additional 24 hours. Finally, the expression level 



WO 99/50432 



PCT/IB99/00523 



-54- 

of the marker gene GFP was measured by fluorescence spectroscopy, as 
described in Example 2. 

About 10% of the BHK cells initially produced GFP and after an 
additional 24 hours of incubation at 29°C all cells of the expressed GFP. The 
conditioned medium of these cells was again harvested, centrifiiged and placed 
onto a 80% confluent layer of BHK cells. After 48 hours of incubation at 29 °C, 
1 00% of these cells were found to express GFP. 

As a control, the transfected cells were grown for 5 days at 37 °C after 
which conditioned medium was collected and centrifuged ( 1 800 rpm r 3 minutes). 
The supernatant was placed onto an 80% confluent BHK cell layer. After 8 
hours of incubation at 29°C. the medium removed and the cells were washed 3 
times with 5 ml HP-1 medium and incubated at 29°C for additional 24 hours. 
Finally, the expression level of GFP is determined. No GFP expressing cells 
could be detected (FIGs. 7A and 7B). 

Example 11 

A multivector system with insert in antisense direction 

As a model system we tested the regulatable system with the production 
of viral particles. As the gene of interest we choose the structural proteins of 
Sindbis virus and as a marker protein we chose GFP. The cells were stably 
transfected with pCYTtsGFP, as described in Example 2. 

The antisense helper vector was constructed as follows: 

The structural proteins were obtained by digesting the pDHBB vector 
(Bredenbeek, P. et aL J- Virol. 67:6439-6446 (1993)) with EcoRl and BamHl 
The fragment was purified by gel electrophoresis and cloned into EcoRb 'BamHl 
digested pMPSVHE vector ( Artelt. P. et aL. Gene 68:2 13-219(1 988)). Since the 
EcoRl and BamHl restriction sites are in opposite orientations in these vectors, 
the structural protein fragment was cloned in an antisense orientation into 
pMPSVHE. The resulting vector was named pMPSVanti-DHBB. 

The stable transfected cells were transiently transfected with 



WO 99/50432 



PCT/IB99/00523 



-55- 

pMPSVanti-DHBB as described in Example 10. Transfected cells were grown 
overnight at 37°C. The cells were then shifted to 29°C to induce viral gene 
expression. After 4 days of induction, the conditioned medium was collected and 
centrifuged (1800 rpm; 3 minutes). The supernatant was placed on 80% 
confluent BHK cell layers and was incubated for 4 hours at 29°C. After the 
incubation phase the medium was discharged and the cells were washed 3 times 
with 5 ml HP-1 medium and incubated at 29 °C for additional 24 hours. Finally, 
the expression level of the marker gene GFP was measured by fluorescence 
spectroscopy, as described in Example 2. 

About 1 % of the BHK cells initial ly produced GFP and after an additional 
120 hours incubation at 29°C 30% of the cells express GFP. Thus, even 
antisense DN A fragments can be used within this invention to produce functional 
proteins. 

Conclusions 

The expression system described in the preceding examples fulfills nearly 
all of the criteria for an ideal inducible gene expression system as described in 
Saez. E. et ai t (Curr. Opin. Biotechnol 8:608-616 ( 1997)). This system is very 
specific in that it is only switched on when the temperature is shifted to below 
34°C. The basal expression, as shown in several experiments, is not detectable 
with the standard detection methods used in the preceding examples. Even with 
the very sensitive system of viral infection (FIG. 7A-7B and FIG. 9) no basal 
expression at 37°C could be detected. This shows the high degree of regulatory 
stringency, because a functional replicase molecule would initiate an 
autocatalytic cycle of RNA replication and transcription which would result in 
a high expression level of the protein of interest. 

Further as shown in FIG. 6A-6B, gene expression starts rapidly after 
induction and stops quickly after the temperature is shifted back to a restrictive 
one. There is no problem with the bioavailability of the inducer, because 
temperature shifts to 29°C rapidly disseminate and are non-toxic. Once a 
restrictive temperature has been reached, the duration of gene expression is only 



WO 99/50432 



PCT/IB99/00523 



-56- 

dependent on the stability of the mRN A encoding the protein or RNA of interest. 

Compared with the tetracycline system, the system described in the 
preceding examples has the advantages that there is no detectable basal 
expression and the bioavailability of a temperature shift is much less harmful 

5 than the antibiotic tetracycline or the expression of the tTA protein. A further 

advantage of the herein described regulatable DN A vector system is that only one 
vector need be introduced into a host cell, because all relevant proteins needed 
for the expression and regulation can be encoded by this one vector. This is in 
contrast with the tetracycline system where two vectors must be transfected into 

10 the cells (Gossen. M. & Bujard. H., Proc. Natl Acad Sci. USA 59:5547-5551 

((1992)). 

As already noted, the turning off of the pCYTts system is dependent on 
the stability of the replicase and the mRNA encoding the protein of interest. It 
has been shown that the half-life of the replicase is one half hour after expression 

15 (DeGroote/a/., Proc. Natl Acad Sci. USA 55:8967-8971 (1991)). The mRNA 

stability is therefore the limiting factor which determines how rapidly the system 
is switched off. SEAP mRNA. for example, was translated for about 1 0 hours 
after shifting to restrictive temperature (FIG. 6A-6B). This high stability has also 
been found for CAT mRNA (Xiong, C. et aL Science 243:1 188-1 191 (1989)), 

20 suggesting that mRNA derived from the Sindbis virus is very stable regardless 

of the protein encoded by this mRNA. 

The system was tested in mixed population to prove that the expression 
system is independent of the site of integration and the copy number, as shown 
in FIG. 4A-4B and FIG. 5A-5B. 

25 In conclusion, the pCYTts temperature regulatable gene expression 

system described in the preceding examples has significant advantages over the 
commonly used regulatable systems. Due to its very low level of basal 
expression, this system can be used for the expression of host toxic proteins, as 
shown with the expression of the HIV envelope protein gp!60. which so far has 

30 been a difficult task with previous in vitro gene expression systems. Since the 

present system has also tested for the long term expression and the reinducibility, 
it is useful for gene therapy. Its potential use for gene therapy has been shown 



WO 99/50432 



PCT/IB99/00523 



-57- 

in the transient expression of GFP in human skin cells, which are easy accessible 
for temperature regulation. 

It will be clear that the invention may be practiced otherwise than as 
particularly described in the foregoing description and examples. 

Numerous modifications and variations of the present invention are 
possible in light of the above teachings and. therefore, are within the scope of the 
appended claims. 

The entire disclosure of all publications (including patents, patent 
applications, journal articles, laboratory manuals, books, or other documents) 
cited herein are hereby incorporated by reference. 



WO 99/50432 



PCT/IB99/00S23 



-58- 

What Is Claimed Is: 

1 . A DN A molecule comprising a polynucleotide which encodes an 
RNA molecule, said RNA molecule comprising: 

(a) at least one exacting sequence element, 

(b) a first open reading frame having a nucleotide sequence 
encoding a non-cytopathic, temperature-sensitive RNA-dependent RNA 
polymerase, and 

(c) at least one second nucleotide sequence selected from the 
group consisting of: 

(i) a second open reading frame encoding a protein, 
or portion thereof, wherein said second open reading frame is in a translatable 
format after one or more RNA-dependent RNA replication events; 

(ii) a sequence complementary to all or part of the 
second open reading frame of (i); and 

(iii) a sequence encoding an untranslated RNA 
molecule, or complement thereof. 

2. A DNA molecule of claim 1 , wherein the RNA-dependent RNA 
polymerase is of viral origin. 

3. A DNA molecule of claim 1. wherein the RNA-dependent RNA 
polymerase is of alphaviral origin. 

4. A DNA molecule of claim 1 which encodes an RNA-dependent 
RNA polymerase that has replicase activity at temperatures below 34 °C and low 
or undetectable replicase activity at 34 °C and above. 

5. A DNA molecule of claim 1. wherein the second open reading 
frame of l(c)(i) encodes a cytokine, lymphokine. tumor necrosis factor, 
interferon, toxic protein, prodrug converting enzyme, or other protein. 



WO 99/50432 



PCT/IB99/00523 



-59- 

6. A DNA molecule of claim 1. wherein the second open reading 
frame of l(c)(i) encodes human erythropoietin or human P-interferon. 

7. A DNA molecule of claim 1, wherein the second nucleotide 
sequence of l(c)(ii) or l(c)(iii) encodes an untranslated RNA molecule selected 
from the group consisting of an antisense RNA molecule, tRN A molecule. rRNA 
molecule, ribozyme. 

8. A method of making a recombinant host cell comprising 
introducing a DNA molecule of claim 1 into a host cell. 

9. An in vitro cell culture comprising a recombinant host cell 
produced by the method of claim 8. 

10. An in vitro cell culture comprising a recombinant host cell 
comprising a DNA molecule of claim 1 . 

11. The cell culture of claim 10, wherein some or all of the DNA 
sequences of a DNA molecule of claim 1 are stably maintained in said host cell. 

12. An RNA molecule transcribed from a DNA molecule of claim 1 . 

13. An alphaviral particle containing an RNA molecule of claim 12. 

14. An in vitro cell culture comprising a recombinant host cell 
comprising an RNA molecule of claim 12. 

15. An isolated nucleic acid molecule comprising a polynucleotide 
having the nucleotide sequence of SEQ ID NO: 1 . 



WO 99/50432 



PCT/IB99/00523 



-60- 

1 6. A method for producing a protein or untranslated RNA molecule 
in a recombinant host cell comprising: 

(a) growing host cells under suitable culture conditions; 

(b) introducing at least one DN A molecule of claim 1 into said 

host cells; and 

(c) recovering said protein or untranslated RNA molecule. 

1 7. A method for producing a protein or untranslated RNA molecule 
in a recombinant host cell comprising: 

(a) growing host cells under suitable culture conditions; 

(b) introducing at least one RNA molecule of claim 12 into 
said host cells; and 

(c) recovering said protein or untranslated RNA molecule. 

18. The method of claim 1 7, wherein the protein is erythropoietin. 

19. The method of claim 1 7. wherein said RNA is packaged into an 
alphaviral particle. 

20. A method for producing alphaviral particles containing an RNA 
molecule of claim 12 comprising: 

(a) growing host cells under suitable culture conditions; 

(b) introducing into said host cells at least one DNA molecule 
of claim 1 having one or more open reading frames which encode alphaviral 
structural proteins; and 

(c) recovering said alphaviral particles. 

21. A method for producing a protein in a recombinant host cell 
comprising: 

(a) growing host cells under suitable culture conditions; 

( b) infecting said host ceils with alphaviral particles produced 



WO 99/50432 



PCT/IB99/00523 



-61- 

by the method of claim 20: and 

(c) recovering said protein. 

22. The method of claim 21. wherein said protein is erythropoietin. 

23. A method for regulating the expression of a protein or 
5 untranslated RNA molecule in a recombinant host cell comprising: 

(a) growing host cells under suitable culture conditions; 

(b) introducing at least one DNA molecule of claim 1 into said 

host cells; and 

(c) changing the temperature of the host cell culture from: 
10 (i) a permissive temperature to a restrictive 

temperature, or 

(ii) a restrictive temperature to a permissive 

temperature. 

24. A method for regulating the expression of a protein or 
1 5 untranslated RNA molecule in a recombinant host cell comprising: 

(a) growing host cells under suitable culture conditions; 

(b) introducing at least one RNA molecule of claim 12 into 
said host cells: and 

(c) changing the temperature of the host cell culture from: 
20 (i) a permissive temperature to a restrictive 

temperature, or 

(ii) a restrictive temperature to a permissive 

temperature. 

25. A method for regulating the expression of a protein or 
25 untranslated RNA molecule in an individual comprising: 

(a) administering at least one DNA molecule of claim 1 to 
said individual: and 

(b) changing the temperature of at least a portion of said 



WO 99/50432 



PCT/IB99/00523 



individual from: 



temperature, or 



temperature. 



-62- 



(i) a permissive temperature to a restrictive 



(ii) a restrictive temperature to a permissive 



10 



15 



26. A method for regulating the expression of a protein or 
untranslated RNA molecule in an individual comprising: 

(a) administering at least one RNA molecule of claim 12 to 
said individual; and 

(b) changing the temperature of at least a portion of said 
individual from: 

(i) a permissive temperature to a restrictive 

temperature, or 

(ii) a restrictive temperature to a permissive 

temperature. 



27. The method of claim 26 wherein said individual is a human. 



28. A method for regulating the expression of a protein or 
untranslated RNA molecule in an individual comprising: 

(a) administering a recombinant host cell comprising at least 
20 one DNA molecule of claim 1 to said individual; and 

(b) changing the temperature of at least a portion of said 
individual from: 

(i) a permissive temperature to a restrictive 

temperature, or 

25 (ii) a restrictive temperature to a permissive 

temperature. 



WO 99/50432 



PCT/IB99/00523 



-63- 

29. The method of claim 28. wherein said recombinant host cells are 
obtained from the same individual into which said host cells are administered. 

30. The method of claim 29. wherein said recombinant host cells are 
keratinocytes. epithelial cells, or fibroblasts. 

3 1 . The method of claim 28. wherein said individual is a human. 

32. A pharmaceutical composition comprising at least one DNA 
molecule of claim 1 and a pharmaceutically acceptable carrier. 

33. A pharmaceutical composition comprising at least one RNA 
molecule of claim 12 and a pharmaceutically acceptable carrier. 

34. A pharmaceutical composition comprising at least one alpahviral 
particle of claim 1 3 and a pharmaceutically acceptable carrier. 

35. A genetically engineered, non-human animal having host cells 
containing at least one DNA molecule of claim 1 . 

36. The animal of claim 35. wherein the DNA molecule is stably 
integrated into the host cell genome. 

37. A genetically engineered, non-human animal having host cells 
containing at least one RNA molecule of claim 12. 

38. A DNA vector system comprising one or more polynucleotides 
which encode RNA molecules, said RNA molecules comprising: 

(a) at least one c/s-acting sequence element. 

(b) a first open reading frame having a nucleotide sequence 
encoding a non-cytopathic. temperature-sensitive RNA-dependent RNA 
polymerase, and 



WO 99/50432 



PCT/IB99/00523 



-64- 

(c) at least one second nucleotide sequence selected from the 
group consisting of: 

(i) a second open reading frame encoding a protein, 
or portion thereof, wherein said second open reading frame is in a translatable 
format after one or more RNA-dependent RNA replication events; 

(ii) a sequence complementary to all or part of the 
second open reading frame of (i); and 

(iii) a sequence encoding an untranslated RNA 
molecule, or complement thereof. 

39. A DNA vector system of claim 38. wherein the RNA-dependent 
RNA polymerase is of viral origin. 

40. A DNA vector system of claim 38, wherein the RNA-dependent 
RNA polymerase is of alphaviral origin. 

41. A DNA vector system of claim 38 which encodes an 
RNA-dependent RNA polymerase that has replicase activity at temperatures 
below 34°C and low or undetectable replicase activity at 34°C and above. 

42. A DNA vector system of claim 38, wherein the second open 
reading frame of l(c)(i) encodes a cytokine, lymphokine, tumor necrosis factor, 
interferon, toxic protein, prodrug converting enzyme, or other protein. 

43. A DNA vector system of claim 38. wherein the second open 
reading frame of l(c)(i) encodes human erythropoietin or human P-interfcron. 

44. A DNA vector system of claim 38. wherein the second nucleotide 
sequence of l(c)(ii) or l(c)(iii) encodes an untranslated RNA molecule selected 
from the group consisting of an antisense RNA molecule. tRN A molecule. rRN A 
molecule, ribozyme. 



WO 99/50432 



PCT/IB99/00523 



-65- 

45. A method of making a recombinant host cell comprising 
introducing at least one polynucleotide of claim 38 into a host cell. 

46. An in vitro cell culture comprising a recombinant host cell 
produced by the method of claim 45. 

5 47. An in vitro cell culture comprising a recombinant host cell 

comprising at least one polynucleotide of claim 38. 

48. The cell culture of claim 47, wherein some or all of the 
polynucleotide sequences of claim 38 are stably maintained in said host cell. 

49. A composition comprising one or more RNA molecules 
1 0 transcribed from one or more polynucleotides of the vector system of claim 38. 

50. An alphaviral particle containing at least one RNA molecule of 
claim 49. 

51. An in vitro cell culture comprising a recombinant host cell 
comprising at least one RNA molecule of claim 49. 

52. A method for producing a protein or untranslated RNA molecule 
in a recombinant host cell comprising: 

(a) growing host cells under suitable culture conditions; 

(b) introducing at least one polynucleotide of claim 38 into 
said host cells: and 

(c) recovering said protein or untranslated RNA molecule. 

53. A method for producing a protein or untranslated RNA molecule 
in a recombinant host cell comprising: 

(a) growing host cells under suitable culture conditions: 

(b) introducing at least one RNA molecule of claim 49 into 



15 



20 



WO 99/50432 



PCT/IB99/00523 



-66- 

said host cells; and 

(c) recovering said protein or untranslated RNA molecule. 

54. The method of claim 53, wherein the protein is erythropoietin. 

55. The method of claim 53. wherein said RNA is packaged into an 
alphaviral particle. 

56. A method for producing alphaviral particles containing an RNA 
molecule of claim 50 comprising: 

(a) growing host cells under suitable culture conditions; 

(b) introducing into said host cells at least one polynucleotide 
of claim 38 having one or more open reading frames which encode alphaviral 
structural proteins; and 

(c) recovering said alphaviral particles. 

57. A method for producing a protein in a recombinant host cell 
comprising: 

(a) growing host cells under suitable culture conditions; 

(b) infecting said host cells with alphaviral particles produced 
by the method of claim 56; and 

(c) recovering said protein. 

58. The method of claim 57. wherein said protein is erythropoietin. 

59. A method for regulating the expression of a protein or 
untranslated RNA molecule in a recombinant host cell comprising: 

(a) growing host cells under suitable culture conditions; 

(b) introducing at least one polynucleotide of claim 38 into 
said host cells; and 

(c) changing the temperature of the host cell culture from: 
(i) a permissive temperature to a restrictive 



WO 99/50432 



PCT/IB99/00523 



-67- 

temperature. or 

(ii) a restrictive temperature to a permissive 

temperature. 

60. A method for regulating the expression of a protein or 
5 untranslated RNA molecule in a recombinant host cell comprising: 

(a) growing host cells under suitable culture conditions; 

(b) introducing at least one RNA molecule of claim 49 into 
said host cells; and 

(c) changing the temperature of the host cell culture from: 
10 (i) a permissive temperature to a restrictive 

temperature, or 

(ii) a restrictive temperature to a permissive 

temperature. 

61. A method for regulating the expression of a protein or 
15 untranslated RNA molecule in an individual comprising: 

(a) administering at least one polynucleotide of claim 38 to 
said individual: and 

(b) changing the temperature of at least a portion of said 
individual from: 

20 (i) a permissive temperature to a restrictive 

temperature, or 

(ii) a restrictive temperature to a permissive 

temperature. 

62. A method for regulating the expression of a protein or 
25 untranslated RNA molecule in an individual comprising: 

(a) administering at least one RNA molecule of claim 49 to 
said individual: and 

(b) changing the temperature of at least a portion of said 
individual from: 



WO 99/50432 



PCT/1B99/00523 



-68- 

(i) a permissive temperature to a restrictive 

temperature, or 

(ii) a restrictive temperature to a permissive 

temperature. 

63. The method of claim 62, wherein said individual is a human. 

64. A method for regulating the expression of a protein or 
untranslated RNA molecule in an individual comprising: 

(a) administering a recombinant host cell comprising at least 
one polynucleotide of claim 38 to said individual; and 

(b) changing the temperature of at least a portion of said 
individual from: 

(i) a permissive temperature to a restrictive 

temperature, or 

(ii) a restrictive temperature to a permissive 

temperature. 

65. The method of claim 64, wherein said recombinant host cells are 
obtained from the same individual into which said host cells are administered. 

66. The method of claim 65, wherein said recombinant host cells are 
keratinocytes, epithelial cells, or fibroblasts. 

67. The method of claim 64, wherein said individual is a human. 

68. A pharmaceutical composition comprising at least one 
polynucleotide of claim 38 and a pharmaceutically acceptable carrier. 

69. A pharmaceutical composition comprising at least one RNA 
molecule of claim 49 and a pharmaceutically acceptable carrier. 



WO 99/50432 



PCT/1B99/00523 



-69- 

70. A pharmaceutical composition comprising at least one alphaviral 
particle of claim 50 and a pharmaceutical ly acceptable carrier. 

71. A genetically engineered, non-human animal having host cells 
containing at least one polynucleotide of claim 38. 

72. The animal of claim 71. wherein the polynucleotide is stably 
integrated into the host cell genome. 

73. A genetically engineered, non-human animal having host cells 
containing at least one RNA molecule of claim 49. 

74. A composition comprising one or more RNA molecules, said 
RNA molecules comprising: 

(a) at least one exacting sequence element, 

(b) a first open reading frame having a nucleotide sequence 
encoding a non-cytopathic, temperature-sensitive RNA-dependent RNA 
polymerase, and 

(c) at least one second nucleotide sequence selected from the 
group consisting of: 

(i) a second open reading frame encoding a protein, 
or portion thereof, wherein said second open reading frame is in a translatable 
format after one or more RNA-dependent RNA replication events; 

(ii) a sequence complementary to all or part of the 
second open reading frame of (i); and 

(iii) a sequence encoding an untranslated RNA 
molecule, or complement thereof. 



WO 99/50432 



PCT/IB99/00523 



1/17 




Substitute Sheet (Rule 26) 



WO 99/50432 



PCT/1B99/00523 



2/17 




Substitute Sheet (Rule 26) 



WO 99/50432 



PCT/1B99/00523 



3/17 

CTGACGC6CCCTGTAGCGGC6CATTAAGC6CGGCGGGTGTGGTGGTTACGCGCAGCGT6ACC6CTACACTTGCCAGCGCC 

CTAGCGCCCGCTCCTTTCGCTTrCTTCCCnCCTTTCTCGCCACGnCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGG 

GCTCCCTTTAGGGTTCCGATnAGTGCTnACGG 

GGCCATCGCCCTGATAGACGGTTTnCGCCCTnG 

GGMCMCACTCMCCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCT^ 

TGAGCTGATHMCAAAMTTTMCGCGMTTTTMCAAMTAnMCGCnACMTnCCA 

CMCTGnGGGMGGGCGATCGGTGCGGGCCTCTTCGCTAnACGCCAGCTGGCGAMGGGGGATGTGCTGCAAGGCGAT 

TMGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAgcgcgc aatta accc tc acta a 

agggaacaaaagctggctagtgGATCCAGTCTTATGCAATACTCTTGTAGTCTTGCAACATGGTAACGATGAGTTAGCAA 

CATGCCnACMGIGAGAGAAAAAGCACCGTGCATGCCGAnGGTGGAAGTAAGGTGGTACGATCGTGCCTTATTAGGMG 

GCMCAGACGGGTCTGACATGGATTGGACGMCCACTGAATTCCGCATTGCAGAGATATTGTATTTAAGTGCCCTACCTc 

gataccgTCGAGAnGACGGCGTAGTACACACTATTGAATCAAACAGCCGACCAATTGCACTACCATCACAATGGAGAAG 

CCAGTAGTAMCGTAGACGTAGACCCCCAGAGTCCGTHGTC^ 

AGCACAGCAGGTCACTCCAMTGACCATGCTMTGCCAGAGCATTnCGCATCTGGCCAGTAAACTAATCGAGCTGGAGG 
TTCCTACCACAGCGACGATCTTGGACATAGGCAGCGCACCGGCTCGTAGMTGTTTTCCGAGCACCAGTATCATTGTGTC 
TGCCCCATGCGTAGTCCAGMGACCCGGACCGCATGATGAMTACGCCAGTAMCTGGCGGAAAAAGCGTGCAAGATTAC 
AMCAAGMCTTGCATGAGMGATTAAGGATCTCCGGACCGTACTTGATACGCCGGATGCTGAAACACCATCGCTCTGCT 
TTCACAACGATGTTACCTGCAACATGCGTGCCGAATATTCCGTCATGCAGGACGTGTATATCAACGCTCCCGGAACTATC 
TATCATCAGGCTATGAMGGCGTGCGGACCCTGTACTGGAnGGCTTCGACACCACCCAGTTCATGTTCTCGGCTATGGC 
AGGTTCGTACCCTGCGTACMCACCMCTGGGCCGACGAGAAAGTCCTTGMGCGCGTMCATCGGACTTTGCAGCACAA 
AGCTGAGTGMGGTAGGACAGGAAMTTGTCGATMTGAGGMGAAGGAGTTGMGCCCGGGTCGCGGGTnATTTCTCC 
GTAGGATCGACACTnATCCAGMCACAGAGCCAGCTTGCAGAGCTGGCATCTTCCATCGGTGnC(^CnGMTGGAAA 
GCAGTCGTACACnGCCGCTGTGATACAGTGGTGAGTTGCGAAGGCTACGTAGTGMGAAAATCACCATCAGTCCCGGGA 
TCACGGGAGAMCCGTGGGATACGCGGTTACACACMTAGCGAGGGCTTCTTGCTATGCAAAGTTACTGACACAGTAAAA 
GGAGAACGGGTATCGTTCCCTGTGTGCACGTACATCCCGGCCACCATATGCGATCAGATGACTGGTATAATGGCCACGGA 
TATATCACCTGACGATGCACAAAAACnCTGGnGGGCTCMCCAGCGMnGTCATTMCGGTAGGACTMCAGGAACA 
CCMCACCATGCAAMnACCTTCTGCCGATCATAGCACAAGGGnCAGCAMTGGGCTMGGAGCGCAAGGATGATCTT 
GATMCGAGAAMTGCTGGGTACTAGAGMCGCAAGCnACGTATGGCTGCnGTGGGCGTTTCGCACTAAGAAAGTACA 
nCGTTTTATCGCCCACCTGGMCGCAGACCTGCGT^ 

GGACGACCTCTTTGCCCATGTCGCTGAGGCAGAMTTGAMCTGGCAnGCMCCAAAGAAGGAGGAAAAACTGCTGCAG 

GTCTCGGAGGMTTAGTCATGGAGGCCMGGCTGCTTTTGAGGATGCTCAGGAGGAAGCCAGAGCGGAGAAGCTCCGAGA 

AGCACTTCCACCATTAGTGGCAGACAAAGGCATCGAGGCAGCCGCAGAAGTTGTCTGCGAAGTGGAGGGGCTCCAGGCGG 

ACATCGGAGCAGCATTAGTTGAAACCCCGCGCGGTCACGTAAGGATAATACCTCAAGCAAATGACCGTATGATCGGACAG 

TATATCGTTGTCTCGCCAAACTCTGTGCTGAAGAATGCCAAACTCGCACCAGCGCACCCGCTAGCAGATCAGGTTAAGAT 

CATAACACACTCCGGAAGATCAGGAAGGTACGCGGTCGAACCATACGACGCTAAAGTACTGATGCCAGCAGGAGGTGCCG 

TACCATGGCCAGMnCCTAGCACTGAGTGAGAGCGCC^CGnAGTGTACAACGAAAGAGAGTTTGTGMCCGCAAACTA 

TACCACATTGCCATGCATGGCCCCGCCAAGAATACAGAAGAGGAGCAGTACAAGGTTACAAAGGCAGAGCTTGCAGAAAC 

AGAGTACGTGTnGACGTGGAI^GMGCGnGCGTTAAGAAGGAAGAAGCCTCAGGTCTGGTCCTCTCGGGAGAACTGA 

CCAACCCTCCCTATCATGAGCTAGCTCTGGAGGGACTGAAGACCCGACCTGCGGTCCCGTACAAGGTCGAAACAATAGGA 

GTGATAGGCACACCGGGGTCGGGCMGTCAGCTAnATCMGTCMCTGTCACGGCACGAGATCTTGTTACCAGCGGAAA 

GAM(5AAMnGTCGCGAMnGAGGCCGACGTGCTAAGACTGAGGGGTATGCAGAnACGTCGAAGACAGTA^ 

nATGCTCMCGGATGCCACAAAGCCGTAGAAGTGCTGTACGTTGACG^CGnCGCGTGCCACGCAGGAGCACTACn 

GCCTTGATTGCTATCGTCAGGCCCCGCAAGAAGGTAGTACTATGCGGAGACCCCATGCAATGCGGATTCTTCAACATGAT 

GCMCTAMGGTACATnCMTCACCCTGAAAAAGACATATGCACCAAGACATTCTACAAGTATATCTCCCGGCGTTGCA 

FIG.3A 



SUBSTITUTE SHEET (RULE 26) 



WO 99/50432 



PCT/IB99/00523 



4/17 

CACAGCCAGTTACAGCTATT6TATCGACACTGCATTACGATGGAAAGATGAAAACCACGAACCCGTGCAAGAAGAACATT 

GAAATCGATAnACAGGGGCCACAMGCCGMGCCAGGGGATATCATCCTGACATGTTTCCGCGGGTGGGTTAAGCAATT 

GCAAATCGACTATCCCGGACATGAAGTAATGACAGCCGCGGCCTCACAAGGGCTAACCAGAAAAGGAGTGTATGCCGTCC 

GGCAAAAAGTCAATGAAAACCCACTGTACGCGATCACATCAGAGCATGTGAACGTGTTGCTCACCCGCACTGAGGACAGG 

CTAGTGTGGAAMCCnGCAGGGCGACCCATGGATTMGCAGCCCACTMCATACCTAMGGAAACTTTCAGGCTACTAT 

AGAGGACTGGGMGCTGMCACMGGGMTMTTGCTGCAATAAACAGCCCCACTCCCCGTGCCAATCCGTTCAGCTGCA 

AGACCMCGTnGCTGGGCGAMGCAnGGMCCGATACTAGCCACGGCCGGTATCGTACTTACCGGTTGCC AGTGG AGC 

GMCTGnCCCACAGTTTGCGGATGACAMCCACATTCGGC^TTTACGCCTTAGACGTMTTTGCATTM 

CATGGACTTGACMGCGGACTGTTTTCTAAACAGAGCATCCCACTAACGTACCATCCCGCCGATTCAGCGAGGCCGGTAG 

CTCAnGGGACMCAGCCCAGGMCCCGCAAGTATGGGTACGATCACGCCAnGCCGCCGMCTCTCCCGTAGATTTCCG 

GTGTTCCAGCTAGCTGGGMGGGCACACMCTTGATnGCAGACGGGGAGMCCAGAGTTATCTCTGCACAGCATAACCT 

GGTCCCGGTGMCCGCMTCnCCTCACGCCnAGTCCCCGAGTACMGGAGMGCAACCCGGCCCGGTCAAAAAATTCT 

TGMCCAGnCAMCACCACTCAGTACnGTGGTATCAGAGGAAAAAATTGAAGCTCCCCGTAAGAGAATCGAATGGATC 

GCCCCGAnGGCATAGCCGGTGCAGATMGMCTACMCCTGGCTTTCGGGTTTCCGCCGCAGGCACGGTACGACCTGGT 

GnCATCMCATTGGMCTAMTACAGAMCCACCACTTTCAGCAGTGCGMGACCATGCGGCGACCTTAAAMCCCTTT 

CGCGTTCGGCCCTgaattgTTtAaacTcaggaggcacCCTCGTGGTGAAGTCCTATGGCTACGCCGACCGCAACAGTGAG 

GACGTAGTCACCGCTCTTGCCAGAMGTTTGTCAGGGTGTCTGCAGCGAGACCAGATTGTGTCTCAAGCAATACAGAAAT 

GTACCTGATTnCCGACMCTAGACMCAGCCGTACACGGCMnCACCCCGCACCATCTGAATTGCGTGATTTCGTCCG 

TGTATGAGGGTACAAGAGATGGAGTTGGAGCCGCGCCGTCATACCGCACCAAAAGGGAGAATATTGCTGACTGTCAAGAG 

GAAGCAGTTGTCAACGCAGCCAATCCGCTGGGTAGACCAGGCGAAGGAGTCTGCCGTGCCATCTATAAACGTTGGCCGAC 

CAGTTnACCGATTCAGCCACGGAGACAGGCACCGCAAGAATGACTGTGTGCCTAGGAAAGAAAGTGATCCACGCGGTCG 

GCCCTGATnCCGGMGCACCCAGMGCAGMGCCnGAAATTGCTACAAAACGCCTACCATGCAGTGGCAGACTTAGTA 

MTGMCATMCATCMGTCTGTCGCCATTCCACTGCTATCTACAGGCATnACGCAGCCGGAAMGACCGCCTTGAAGT 

ATCACnMCTGCnGACAACCGCGCTAGACAGAACTGACGCGGACGTAACCATCTATTGCCTGGATAAGAAGTGGAAGG 

AMGMTCGACGCGGCACTCCMCTTAAGGAGTCTGTAACAGAGCTGAAGGATGAAGATATGGAGATCGACGATGAGTTA 

GTATGGATtCATCCAGACAGnGCTTGMGGGMGAMGGGATTCAGTACTACAAMGGAAMTTGTATTCGTACTTCGA 

AGGCACCAAATTCCATCAAGCAGCAAMGACATGGCGGAGATAMGGTCCTGTTCCCTAATGACCAGGAAAGTAATGAAC 

AACTGTGTGCCTACATATTGGGTGAGACCATGGAAGCAATCCGCGAAAAGTGCCCGGTCGACCATAACCCGTCGTCTAGC 

CCGCCCAAAACGTTGCCGTGCCTTTGCATGTATGCCATGACGCCAGAMGGGTCCACAGACTTAGMGCMTMCGTCAA 

AGMGTTACAGTATGCTCCTCCACCCCCCnCCTMGCACAAMTTAAGAATGTTCAGAAGGTTCAGTGCACGAAAGTAG 

TCCTGTTTAATCCGCACACTCCCGCATTCGTTCCCGCCCGTAAGTACATAGAAGTGCCAGAACAGCCTACCGCTCCTCCT 

GCACAGGCCGAGGAGGCCCCCGAAGTTGTAGCGACACCGTCACCATCTACAGCTGATAACACCTCGCTTGATGTCACAGA 

CATCTCACTGGATATGGATGACAGTAGCGMGGCTCACTTTTTTCGAGCTTTAGCGGATCGGACAACTCTATTACTAGTA 

TGGACAGTTGGTCGTCAGGACCTAGTTCACTAGAGATAGTAGACCGAAGGCAGGTGGTGGTGGCTGACGTTCATGCCGTC 

CAAGAGCCTGCCCCTATTCCACCGCCAAGGCTAAAGAAGATGGCCCGCCTGGCAGCGGCAAGAAAAGAGCCCACTCCACC 

GGCAAGCAATAGCTCTGAGTCCCTCCACCTCTCnnGGTGGGGTATCCATGTCCCTCGGATCAATTTTCGACGGAGAGA 

CGGCCCGCCAGGCAGCGGTACMCCCCTGGCMCAGGCCCCACGGATGTGCCTATGTCTnCGGATCGTTTTCCGACGGA 

GAGAnGATGAGCTGAGCCGCAGAGTMCTGAGTCCGAACCCGTCCTGTTTGGATCATTTGAACCGGGCGAAGTGAACTC 

AATTATATCGTCCCGATCAGCCGTATCTTTTCCACTACGCAAGCAGAGACGTAGACGCAGGAGCAGGAGGACTGAATACT 

GACTMCCGGGGTAGGTGGGTACATATTnCGACGGACACAGGCCCTGGGCACnGCAAAAGAAGTCCGTTCTGCAGAAC 

CAGCTTACAGAACCGACCTTGGAGCGCAATGTCCTGGAAAGAATTCATGCCCCGGTGCTCGACACGTCGAAAGAGGAACA 

ACTCAAACTCAGGTACCAGATGATGCCCACCGAAGCCAACAAAAGTAGGTACCAGTCTCGTAAAGTAGAAAATCAGAAAG 

CCATAACCACTGAGCGACTACTGTCAGGACTACGACTGTATAACTCTGCCACAGATCAGCCAGAATGCTATAAGATCACC 

TATCCGAMCCATTGTACTCCAGTAGCGTACCGGCGAACTACTCCGATCCACAGTTCGCTGTAGCTGTCTGTAACAACTA 

FIG. 3B 

SUBSTITUTE SHEET (RULE 26) 



WO 99/50432 



PCT/IB99/00S23 



5/17 

TCTGCATGAGMCTATCCGACAGTAGCATCTTATCAGATTACTGACGAGTACGATGCTTACTTGGATATGGTAGACGaGA 
CAGTCGCaTGCCTGGATACTGCAACCTTCTGCCCCGCTAAGCTTAGAAGTTACCCGAAAAAACATGAGTATAGAGCCCCG 
AATATCCGCAGTGCGGnCCATCAGCGATGCAGMCACGCTACAAMTGTGCTCAnGCCGCMCTAAAAGAMTTGCAA 
CGTCACGCAGATGCGTGMCTGCCMCACTGGACTCAGCGACAnCMTGTCGMTGCTTTCGAAAATATGCATGTAATG 
ACGAGTATTGGGAGGAGnCGCTCGGMGCCMnAGGAnACCACTGAGTTTGTCACCGCATATGTAGCTAGACTGAAA 
GGCCCTAAGGCCGCCGCACTATnGCAMGACGTATMTnGGTCCCAnGCMGMGTGCCTATGGATAGATTCGTCAT 
GGACATGAAA/GAGMET^ 

CAGMCCCCTGGCGACTGCnACTTATGCGGGATTCACCGGGMTTAGTGCGTAGGCTTACGGCCGTCTTGCTTCCAAAC. 
AnCACACGCTTTTTGACATGTCGGCGGAGGATTTTGATGCMTWTAGCAGMCACn 

GGAGACGGATATCGCATCATTCGACAAAAGCCAAGACGACGCTATGGCGTTAACCGGTCTGATGATCTTGGAGGACCTGG 
GTGTGGATCAACCACTACTCGACTTGATCGAGTGCGCCTTTGGAGAAATATCATCCACCCATCTACCTACGGGTACTCGT 
TTTAAATTCGGGGCGATGiATGAMTCCGGMTGTTC^ 

CAGAGTACTAGMGAGCGGCnAAAACGTCCAGATGTGCAGCGTTCATTGGCGACGACAACATCATACATGGAGTAGTAT 
CTGACAMGAAATGGCTGAGAGGTGCGCCACCTGGCTCAACATGGAGGTTAAGATCATCGACGCAGTCATCGGTGAGAGA 
CCACCnACnCTGCGGCGGATnATCnGCAAGAnCGGnACTTCCACAGCGTGCCGCGTGGCGGATCCCCTGAAAAG 
GCTGTnMGTTGGGTAAACCGCTCCCAGCCGACGACGAGCAAGACGAAGACAGAAGACGCGCTCTGCTAGATGAAACAA 
AGGCGTGGTnAGAGTAGGTATMCAGGCACTTTAGCAGTGGCCGTGACGACCCGGTATGAGGTAGACMTATTACACCT 
GTCCTACTGG(^TT(^GMCTTnGCCCAGAGC^ 

TGGTCCTAAATAGTCAGCATAGTACATTTCATCTGACTAATACTACAACACCACCACCtctagaCGCGTAGAtctcacgt 

gagcatgcaggccttgggCCCAATGATCCGACCAGCAAAACTCGATGTACTTCCGAGGAACTGATGTGCATAATGCATCA 

GGCTGGTACATTAGATCCCCGCTTACCGCGGGCAATATAGCAACACTAAAAACTCGATGTACTTCCGAGGAAGCGCAGTG 

CATMTGCTGCGCAGTGnGCCACATMCCACTATAnMCCATnATCTAGCGGACGCCAAAMCTCMTGTATTTCTG 

AGGAAGCGTGGTGCATMTGCCACGCAGCGTCTG^^ 

MCAmCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAMGGG^ 

GmCAMTAMGCMTAGCATCACAMTnCACAMTAAAGCATTTTITrCACTGCAm 

CTCATCAATGTATCTTATCATGTCTGGATCCGTCGAGACGCGTccaattcgccctatagtgagtcgtattacgcgcgcTT 

GGCGTMTCATGGTCXTAGCTGTTTCCTGTGTGA^ 

TAAAGTGTAAAGCCTGGGGTGCCTMTGAGTGAGCTMCTCACATTMTTGCGnGCGCTCACTGCCCGCTTTCCAGTCG 
GGAMCCTGTCGTGCCAGCTGCATTMTGMTCGGCCMCGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGC 
TTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGT 
TATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCC 
GCGnGCTGGCGTTTnCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAA 
CCCGACAGGACTATAMGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTA 
CCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCAATGCTCACGCTGTAGGTATCTCAGTTCGGTG 
TAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCG 
TCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATG 
TAGGCGGTGCTACAGAGTTCnGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGC GCTCTG 
CTGMGCCAGnACCnCGGAAAMGAGTTGGTAGCTCnGATCCGGCAMCAMCCACCGCTGGTAGCGGTGGTTTTTr 
TGTTTGCMGCAGCAGAnACGCGCAGAAAAAMGGATCTCMGMGATCCTnGATCTTTTCTACGGGGTCTGACGCTC 
AGT(^CGAAAACTCACGnM(^GATmGGTCATGAGAnATCAAAMGGATCnCACCTAGATCCTmAMnM 
AMTGMGTTTTAMTCMTCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACC 
TATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCT 
TACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCA 
GCCGGMGGGCCGAGCGCAGMGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAG 

FIG.3C 



SUBSTITUTE SHEET (RULE 26) 



WO 99/50432 PCT/1 B99/00523 



6/17 

AGTAAGTAGnCGCCAGnAATAGTTTGCGCAACGnGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTG 

GTATGGCTTCATTCAGCTCCGGTTCCCMCGATCMGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGC 

TCCTTCGGTCCTCCGATCGnGTCAGAAGTAAGnGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTC 

TCnACTGTCATGCCATCCGTMGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGC 

GGCGACCGAGnGCTCnGCCCGGCGTCMTACGGGATMTACCGCGCCACATAGCAGMCTTTAAAAGTGCTCATCATT 

GGAAMCGTTCTTCGGGGCGAAMCTCTCMGGATCnACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACC 

CMCTGATCTTCAGCATCTmACmCACCAGCGmCTGGGTGAGCAAAMCAGGMGGCAAMTC 

GAATMGGGCGACACGGAMTGnGMTACTCATACTCnCCTTTTTCMTAnATTGMGCATnATCAG^ 

CTCATGAGCGGATACATATTTGMTGTATnAGAAAAATAMCAMTAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCC 

AC 

FIG. 3D 



SUBSTITUTE SHEET (RULE 26) 



WO 99/50432 



PCT/IB99/00523 



7/17 




25 30 35 40 
TEMPERATURE (°C) 



FIG.4A 




T 

25 30 35 
TEMPERATURE (°C) 



FIG.4B 



40 



Substitute Sheet (Rule 26) 



WO 99/50432 



PCT/IB99/00523 



8/17 




0 10 20 30 40 50 60 70 80 
TIME (h) 



FIG.5A 




TIME (h) 

FIG.5B 



Substitute Sheet (Rule 26) 



WO 99/50432 



PCT/IB99/00523 



9/17 



CO 



CO 
UJ 

a: 
o 



4.0 



3.0 " 



2.0 " 



1.0 



0.0 



— 1 1 f 

4 6 8 10 

TIME (h) 



FIG.6A 



z" 4.0 -i 



in 

^ 3.0 



2.0 - 



§ 1-0 

CO 



0.0 



1 1 r 

4 6 8 10 

TIME (h) 



FIG.6B 



Substitute Sheet (Rule 26) 



WO 99/50432 



PCT/IB99/00523 



10/17 



'/// V ^ 



\\ STRUCTURAL PROTEINS^ 




PRODUCTION OF RECOMBINANT 

jp| 




29°C 



INFECTION OF TARGET CELLS 



PRODUCTION CELL 



I 

29°C 



FLUORESCENCE 



NO FLUORESCENCE 



FIG.7A 



Substitute Sheet (Rule 26) 



WO 99/50432 



PCT/IB99/00523 



11/17 



37 



O 

o 



i 



29 



III III 



IV 



FIG.7B 



Substitute Sheet (Rule 26) 



WO 99/50432 



12/17 



PCT/IB99/00523 



1 2 3 4 5 6 7 8 




FIG.8A 



Substitute Sheet (Rule 26) 



WO 99/50432 PCT/IB99/00523 



13/17 



FIG.8B 



Substitute Sheet (Rule 26) 



WO 99/50432 



14/17 



PCT7IB99/00523 



12 3 4 




FIG. 9 



Substitute Sheet (Rule 26) 



WO 99/50432 PCT/IB99/00523 



15/17 



^ 

',. ) 



it. & 

*2T 




FIG. 10 



Substitute Sheet (Rule 26) 



WO 99/50432 



PCT/1B99/00523 



16/17 




Substitute Sheet (Rule 26) 



WO 99/50432 



17/17 



PCT/1B99/00523 




GO 



O CD OC hi 




to 

o 
o 
Z3 



I 



.•/.*•>; v. 



i-J : *.:V-i"*TV*» : > 





Substitute Sheet (Rule 26) 



WO 99/50432 PCT/IB99/00523 



SEQUENCE LISTING 



<110> Cytos Biotechnology AG 
Renner, Wolfgang A. 
Nieba, Lars 
Boorsma, Marco 



<120> Inducible Alphaviral Gene Expression System 



<130> 1700.002PC01 



<140> 
<141> 



<150> US 60/079, 562 
<151> 1998-03-27 



<160> 9 



<170> Patentln Ver. 2.0 



<210> 1 
<211> 11282 
<212> DNA 

<213> Artificial Sequence 



<220> 

<223> Description of Artificial Sequence : cDNA 



<400> 1 

ctgacgcgcc ctgtagcggc gcattaagcg 
ccgctacact tgccagcgcc ctagcgcccg 
ccacgttcgc cggctttccc cgtcaagctc 
ttagtgcttt acggcacctc gaccccaaaa 
ggccatcgcc ctgatagacg gtttttcgcc 
gtggactctt gttccaaact ggaacaacac 
tataagggat tttgccgatt tcggcctatt 
ttaacgcgaa ttttaacaaa atattaacgc 
caactgttgg gaagggcgat cggtgcgggc 
gggatgtgct gcaaggcgat taagttgggt 
taaaacgacg gccagtgagc gcgcaattaa 
tggatccagt cttatgcaat actcttgtag 
catgccttac aaggagagaa aaagcaccgt 
gatcgtgcct tattaggaag gcaacagacg 
ttccgcattg cagagatatt gtatttaagt 
cgtagtacac actattgaat caaacagccg 
ccagtagtaa acgtagacgt agacccccag 
ttcccgcaat ttgaggtagt agcacagcag 
gcattttcgc atctggccag taaactaatc 
ttggacatag gcagcgcacc ggctcgtaga 
tgccccatgc gtagtccaga agacccggac 
gaaaaagcgt gcaagattac aaacaagaac 



cggcgggtgt ggtggttacg cgcagcgtga 60 
ctcctttcgc tttcttccct tcctttctcg 120 
taaatcgggg gctcccttta gggttccgat 180 
aacttgatta gggtgatggt tcacgtagtg 240 
ctttgacgtt ggagtccacg ttctttaata 300 
tcaaccctat ctcggtctat tcttttgatt 360 
ggttaaaaaa tgagctgatt taacaaaaat 420 
ttacaatttc cattcgccat tcaggctgcg 480 
ctcttcgcta ttacgccagc tggcgaaagg 540 
aacgccaggg ttttcccagt cacgacgttg 600 
ccctcactaa agggaacaaa agctggctag 660 
tcttgcaaca tggtaacgat gagttagcaa 720 
gcatgccgat tggtggaagt aaggtggtac 780 
ggtctgacat ggattggacg aaccactgaa 840 
gccctacctc gataccgtcg agattgacgg 900 
accaattgca ctaccatcac aatggagaag 960 
agtccgtttg tcgtgcaact gcaaaaaagc 1020 
gtcactccaa atgaccatgc taatgccaga 1080 
gagctggagg ttcctaccac agcgacgatc 1140 
atgttttccg agcaccagta tcattgtgtc 1200 
cgcatgatga aatacgccag taaactggcg 1260 
ttgcatgaga agattaagga tctccggacc 1320 



WO 99/50432 



PCT/IB99/00523 



gtacttgata cgccggatgc tgaaacacca 
aacatgcgtg ccgaatattc cgtcatgcag 
tatcatcagg ctatgaaagg cgtgcggacc 
ttcatgttct cggctatggc aggttcgtac 
aaagtccttg aagcgcgtaa catcggactt 
ggaaaattgt cgataatgag gaagaaggag 
gtaggatcga cactttatcc agaacacaga 
gtgttccact tgaatggaaa gcagtcgtac 
gaaggctacg tagtgaagaa aatcaccatc 
tacgcggtta cacacaatag cgagggcttc 
ggagaacggg tatcgttccc tgtgtgcacg 
actggtataa tggccacgga tatatcacct 
aaccagcgaa ttgtcattaa cggtaggact 
cttctgccga tcatagcaca agggttcagc 
gataacgaga aaatgctggg tactagagaa 
tttcgcacta agaaagtaca ttcgttttat 
gtcccagcct cttttagcgc ttttcccatg 
tcgctgaggc agaaattgaa actggcattg 
gtctcggagg aattagtcat ggaggccaag 
agagcggaga agctccgaga agcacttcca 
gccgcagaag ttgtctgcga agtggagggg 
gaaaccccgc gcggtcacgt aaggataata 
tatatcgttg tctcgccaaa ctctgtgctg 
ctagcagatc aggttaagat cataacacac 
ccatacgacg ctaaagtact gatgccagca 
gcactgagtg agagcgccac gttagtgtac 
taccacattg ccatgcatgg ccccgccaag 
aaggcagagc ttgcagaaac agagtacgtg 
aaggaagaag cctcaggtct ggtcctctcg 
ctagctctgg agggactgaa gacccgacct 
gtgataggca caccggggtc gggcaagtca 
gatcttgtta ccagcggaaa gaaagaaaat 
ctgaggggta tgcagattac gtcgaagaca 
aaagccgtag aagtgctgta cgttgacgaa 
gccttgattg ctatcgtcag gccccgcaag 
tgcggattct tcaacatgat gcaactaaag 
tgcaccaaga cattctacaa gtatatctcc 
gtatcgacac tgcattacga tggaaagatg 
gaaatcgata ttacaggggc cacaaagccg 
cgcgggtggg ttaagcaatt gcaaatcgac 
gcctcacaag ggctaaccag aaaaggagtg 
ccactgtacg cgatcacatc agagcatgtg 
ctagtgtgga aaaccttgca gggcgaccca 
ggaaactttc aggctactat agaggactgg 
ataaacagcc ccactccccg tgccaatccg 
aaagcattgg aaccgatact agccacggcc 
gaactgttcc cacagtttgc ggatgacaaa 
atttgcatta agtttttcgg catggacttg 
ccactaacgt accatcccgc cgattcagcg 
ggaacccgca agtatgggta cgatcacgcc 
gtgttccagc tagctgggaa gggcacacaa 
atctctgcac agcataacct ggtcccggtg 



-2- 

tcgctctgct ttcacaacga tgttacctgc 1380 
gacgtgtata tcaacgctcc cggaactatc 1440 
ctgtactgga ttggcttcga caccacccag 1500 
cctgcgtaca acaccaactg ggccgacgag 1560 
tgcagcacaa agctgagtga aggtaggaca 1620 
ttgaagcccg ggtcgcgggt ttatttctcc 1680 
gccagcttgc agagctggca tcttccatcg 1740 
acttgccgct gtgatacagt ggtgagttgc 1800 
agtcccggga tcacgggaga aaccgtggga 1860 
ttgctatgca aagttactga cacagtaaaa 1920 
tacatcccgg ccaccatatg cgatcagatg 1980 
gacgatgcac aaaaacttct ggttgggctc 2040 
aacaggaaca ccaacaccat gcaaaattac 2100 
aaatgggcta aggagcgcaa ggatgatctt 2160 
cgcaagctta cgtatggctg cttgtgggcg 2220 
cgcccacctg gaacgcagac ctgcgtaaaa 2280 
tcgtccgtat ggacgacctc tttgcccatg 2340 
caaccaaaga aggaggaaaa actgctgcag 2400 
gctgcttttg aggatgctca ggaggaagcc 24 60 
ccattagtgg cagacaaagg catcgaggca 2520 
ctccaggcgg acatcggagc agcattagtt 2580 
cctcaagcaa atgaccgtat gatcggacag 2640 
aagaatgcca aactcgcacc agcgcacccg 2700 
tccggaagat caggaaggta cgcggtcgaa 2760 
ggaggtgccg taccatggcc agaattccta 2820 
aacgaaagag agtttgtgaa ccgcaaacta 2880 
aatacagaag aggagcagta caaggttaca 2940 
tttgacgtgg acaagaagcg ttgcgttaag 3000 
ggagaactga ccaaccctcc ctatcatgag 3060 
gcggtcccgt acaaggtcga aacaatagga 3120 
gctattatca agtcaactgt cacggcacga 3180 
tgtcgcgaaa ttgaggccga cgtgctaaga 3240 
gtagattcgg ttatgctcaa cggatgccac 3300 
gcgttcgcgt gccacgcagg agcactactt 3360 
aaggtagtac tatgcggaga ccccatgcaa 3420 
gtacatttca atcaccctga aaaagacata 3480 
cggcgttgca cacagccagt tacagctatt 3540 
aaaaccacga acccgtgcaa gaagaacatt 3600 
aagccagggg atatcatcct gacatgtttc 3660 
tatcccggac atgaagtaat gacagccgcg 3720 
tatgccgtcc ggcaaaaagt caatgaaaac 3780 
aacgtgttgc tcacccgcac tgaggacagg 3840 
tggattaagc agcccactaa catacctaaa 3900 
gaagctgaac acaagggaat aattgctgca 3960 
ttcagctgca agaccaacgt ttgctgggcg 4020 
ggtatcgtac ttaccggttg ccagtggagc 4080 
ccacattcgg ccatttacgc cttagacgta 4140 
acaagcggac tgttttctaa acagagcatc 4200 
aggccggtag ctcattggga caacagccca 4260 
attgccgccg aactctcccg tagatttccg 4320 
cttgatttgc agacggggag aaccagagtt 4380 
aaccgcaatc ttcctcacgc cttagtcccc 4440 



WO 99/50432 



PCT/IB99/00523 



gagtacaagg agaagcaacc cggcccggtc 
tcagtacttg tggtatcaga ggaaaaaatt 
gccccgattg gcatagccgg tgcagataag 
caggcacggt acgacctggt gttcatcaac 
cagcagtgcg aagaccatgc ggcgacctta 
ttaaactcag gaggcaccct cgtggtgaag 
gacgtagtca ccgctcttgc cagaaagttt 
gtctcaagca atacagaaat gtacctgatt 
caattcaccc cgcaccatct gaattgcgtg 
ggagttggag ccgcgccgtc ataccgcacc 
gaagcagttg tcaacgcagc caatccgctg 
atctataaac gttggccgac cagttttacc 
atgactgtgt gcctaggaaa gaaagtgatc 
ccagaagcag aagccttgaa attgctacaa 
aatgaacata acatcaagtc tgtcgccatt 
ggaaaagacc gccttgaagt atcacttaac 
gcggacgtaa ccatctattg cctggataag 
caacttaagg agtctgtaac agagctgaag 
gtatggattc atccagacag ttgcttgaag 
aaattgtatt cgtacttcga aggcaccaaa 
ataaaggtcc tgttccctaa tgaccaggaa 
ggtgagacca tggaagcaat ccgcgaaaag 
ccgcccaaaa cgttgccgtg cctttgcatg 
cttagaagca ataacgtcaa agaagttaca 
aaaattaaga atgttcagaa ggttcagtgc 
cccgcattcg ttcccgcccg taagtacata 
gcacaggccg aggaggcccc cgaagttgta 
acctcgcttg atgtcacaga catctcactg 
ttttcgagct ttagcggatc ggacaactct 
cctagttcac tagagatagt agaccgaagg 
caagagcctg cccctattcc accgccaagg 
agaaaagagc ccactccacc ggcaagcaat 
ggggtatcca tgtccctcgg atcaattttc 
caacccctgg caacaggccc cacggatgtg 
gagattgatg agctgagccg cagagtaact 
gaaccgggcg aagtgaactc aattatatcg 
aagcagagac gtagacgcag gagcaggagg 
tacatatttt cgacggacac aggccctggg 
cagcttacag aaccgacctt ggagcgcaat 
gacacgtcga aagaggaaca actcaaactc 
aaaagtaggt accagtctcg taaagtagaa 
ctgtcaggac tacgactgta taactctgcc 
tatccgaaac cattgtactc cagtagcgta 
gtagctgtct gtaacaacta tctgcatgag 
actgacgagt acgatgctta cttggatatg 
gcaaccttct gccccgctaa gcttagaagt 
aatatccgca gtgcggttcc atcagcgatg 
gcaactaaaa gaaattgcaa cgtcacgcag 
acattcaatg tcgaatgctt tcgaaaatat 
gctcggaagc caattaggat taccactgag 
ggccctaagg ccgccgcact atttgcaaag 
cctatggata gattcgtcat ggacatgaaa 



aaaaaattct tgaaccagtt caaacaccac 4500 
gaagctcccc gtaagagaat cgaatggatc 4560 
aactacaacc tggctttcgg gtttccgccg 4 620 
attggaacta aatacagaaa ccaccacttt 4680 
aaaacccttt cgcgttcggc cctgaattgt 4740 
tcctatggct acgccgaccg caacagtgag 4800 
gtcagggtgt ctgcagcgag accagattgt 4860 
ttccgacaac tagacaacag ccgtacacgg 4920 
atttcgtccg tgtatgaggg tacaagagat 4 980 
aaaagggaga atattgctga ctgtcaagag 5040 
ggtagaccag gcgaaggagt ctgccgtgcc 5100 
gattcagcca cggagacagg caccgcaaga 5160 
cacgcggtcg gccctgattt ccggaagcac 5220 
aacgcctacc atgcagtggc agacttagta 5280 
ccactgctat ctacaggcat ttacgcagcc 5340 
tgcttgacaa ccgcgctaga cagaactgac 5400 
aagtggaagg aaagaatcga cgcggcactc 54 60 
gatgaagata tggagatcga cgatgagtta 5520 
ggaagaaagg gattcagtac tacaaaagga 5580 
ttccatcaag cagcaaaaga catggcggag 5640 
agtaatgaac aactgtgtgc ctacatattg 5700 
tgcccggtcg accataaccc gtcgtctagc 5760 
tatgccatga cgccagaaag ggtccacaga 5820 
gtatgctcct ccacccccct tcctaagcac 5880 
acgaaagtag tcctgtttaa tccgcacact 5940 
gaagtgccag aacagcctac cgctcctcct 6000 
gcgacaccgt caccatctac agctgataac 6060 
gatatggatg acagtagcga aggctcactt 6120 
attactagta tggacagttg gtcgtcagga 6180 
caggtggtgg tggctgacgt tcatgccgtc 6240 
ctaaagaaga tggcccgcct ggcagcggca 6300 
agctctgagt ccctccacct ctcttttggt 6360 
gacggagaga cggcccgcca ggcagcggta 6420 
cctatgtctt tcggatcgtt ttccgacgga 6480 
gagtccgaac ccgtcctgtt tggatcattt 6540 
tcccgatcag ccgtatcttt tccactacgc 6600 
actgaatact gactaaccgg ggtaggtggg 6660 
cacttgcaaa agaagtccgt tctgcagaac 6720 
gtcctggaaa gaattcatgc cccggtgctc 6780 
aggtaccaga tgatgcccac cgaagccaac 6840 
aatcagaaag ccataaccac tgagcgacta 6900 
acagatcagc cagaatgcta taagatcacc 6960 
ccggcgaact actccgatcc acagttcgct 7020 
aactatccga cagtagcatc ttatcagatt 7080 
gtagacgaga cagtcgcatg cctggatact 7140 
tacccgaaaa aacatgagta tagagccccg 7200 
cagaacacgc tacaaaatgt gctcattgcc 7260 
atgcgtgaac tgccaacact ggactcagcg 7320 
gcatgtaatg acgagtattg ggaggagttc 7380 
tttgtcaccg catatgtagc tagactgaaa 7440 
acgtataatt tggtcccatt gcaagaagtg 7500 
agagacgtga aagttacacc aggcacgaaa 7560 



1 



WO 99/50432 



PCT/IB99/00523 



cacacagaag aaagaccgaa agtacaagtg 
tacttatgcg ggattcaccg ggaattagtg 
attcacacgc tttttgacat gtcggcggag 
aagcaaggcg acccggtact ggagacggat 
gctatggcgt taaccggtct gatgatcttg 
gacttgatcg agtgcgcctt tggagaaata 
tttaaattcg gggcgatgat gaaatccgga 
ttgaatgtcg ttatcgccag cagagtacta 
gcgttcattg gcgacgacaa catcatacat 
aggtgcgcca cctggctcaa catggaggtt 
ccaccttact tctgcggcgg atttatcttg 
gtggcggatc ccctgaaaag gctgtttaag 
caagacgaag acagaagacg cgctctgcta 
ataacaggca ctttagcagt ggccgtgacg 
gtcctactgg cattgagaac ttttgcccag 
gaaataaagc atctctacgg tggtcctaaa 
tactacaaca ccaccacctc tagacgcgta 
caatgatccg accagcaaaa ctcgatgtac 
ggctggtaca ttagatcccc gcttaccgcg 
acttccgagg aagcgcagtg cataatgctg 
ccatttatct agcggacgcc aaaaactcaa 
ccacgcagcg tctgcataac ttttattatt 
aacatttcaa aaaaaaaaaa aaaaaaaaaa 
gtttattgca gcttataatg gttacaaata 
agcatttttt tcactgcatt ctagttgtgg 
tgtctggatc cgtcgagacg cgtccaattc 
ggcgtaatca tggtcatagc tgtttcctgt 
caacatacga gccggaagca taaagtgtaa 
cacattaatt gcgttgcgct cactgcccgc 
gcattaatga atcggccaac gcgcggggag 
ttcctcgctc actgactcgc tgcgctcggt 
ctcaaaggcg gtaatacggt tatccacaga 
agcaaaaggc cagcaaaagg ccaggaaccg 
taggctccgc ccccctgacg agcatcacaa 
cccgacagga ctataaagat accaggcgtt 
tgttccgacc ctgccgctta ccggatacct 
gctttctcaa tgctcacgct gtaggtatct 
gggctgtgtg cacgaacccc ccgttcagcc 
tcttgagtcc aacccggtaa gacacgactt 
gattagcaga gcgaggtatg taggcggtgc 
cggctacact agaaggacag tatttggtat 
aaaaagagtt ggtagctctt gatccggcaa 
tgtttgcaag cagcagatta cgcgcagaaa 
ttctacgggg tctgacgctc agtggaacga 
attatcaaaa aggatcttca cctagatcct 
ctaaagtata tatgagtaaa cttggtctga 
tatctcagcg atctgtctat ttcgttcatc 
aactacgata cgggagggct taccatctgg 
acgctcaccg gctccagatt tatcagcaat 
aagtggtcct gcaactttat ccgcctccat 
agtaagtagt tcgccagtta atagtttgcg 
ggtgtcacgc tcgtcgtttg gtatggcttc 



-4- 

atacaagccg cagaacccct ggcgactgct 7620 
cgtaggctta cggccgtctt gcttccaaac 7680 
gattttgatg caatcatagc agaacacttc 7740 
atcgcatcat tcgacaaaag ccaagacgac 7800 
gaggacctgg gtgtggatca accactactc 7860 
tcatccaccc atctacctac gggtactcgt 7920 
atgttcctca cactttttgt caacacagtt 7980 
gaagagcggc ttaaaacgtc cagatgtgca 8040 
ggagtagtat ctgacaaaga aatggctgag 8100 
aagatcatcg acgcagtcat cggtgagaga 8160 
caagattcgg ttacttccac agcgtgccgc 8220 
ttgggtaaac cgctcccagc cgacgacgag 8280 
gatgaaacaa aggcgtggtt tagagtaggt 834 0 
acccggtatg aggtagacaa tattacacct 8400 
agcaaaagag cattccaagc catcagaggg 8460 
tagtcagcat agtacatttc atctgactaa 8520 
gatctcacgt gagcatgcag gccttgggcc 8580 
ttccgaggaa ctgatgtgca taatgcatca 8640 
ggcaatatag caacactaaa aactcgatgt 8700 
cgcagtgttg ccacataacc actatattaa 8760 
tgtatttctg aggaagcgtg gtgcataatg 8820 
tcttttatta atcaacaaaa ttttgttttt 8880 
aaaaaaaaaa aaaaagggaa ttcccaactt 8940 
aagcaatagc atcacaaatt tcacaaataa 9000 
tttgtccaaa ctcatcaatg tatcttatca 9060 
gccctatagt gagtcgtatt acgcgcgctt 9120 
gtgaaattgt tatccgctca caattccaca 9180 
agcctggggt gcctaatgag tgagctaact 9240 
tttccagtcg ggaaacctgt cgtgccagct 9300 
aggcggtttg cgtattgggc gctcttccgc 9360 
cgttcggctg cggcgagcgg tatcagctca 9420 
atcaggggat aacgcaggaa agaacatgtg 9480 
taaaaaggcc gcgttgctgg cgtttttcca 9540 
aaatcgacgc tcaagtcaga ggtggcgaaa 9600 
tccccctgga agctccctcg tgcgctctcc 9660 
gtccgccttt ctcccttcgg gaagcgtggc 9720 
cagttcggtg taggtcgttc gctccaagct 9780 
cgaccgctgc gccttatccg gtaactatcg 9840 
atcgccactg gcagcagcca ctggtaacag 9900 
tacagagttc ttgaagtggt ggcctaacta 9960 
ctgcgctctg ctgaagccag ttaccttcgg 10020 
acaaaccacc gctggtagcg gtggtttttt 10080 
aaaaggatct caagaagatc ctttgatctt 10140 
aaactcacgt taagggattt tggtcatgag 10200 
tttaaattaa aaatgaagtt ttaaatcaat 10260 
cagttaccaa tgcttaatca gtgaggcacc 10320 
catagttgcc tgactccccg tcgtgtagat 10380 
ccccagtgct gcaatgatac cgcgagaccc 10440 
aaaccagcca gccggaaggg ccgagcgcag 10500 
ccagtctatt aattgttgcc gggaagctag 10560 
caacgttgtt gccattgcta caggcatcgt 10620 
attcagctcc ggttcccaac gatcaaggcg 10680 



WO 99/50432 



PCT/IB99/00523 



-5- 

agttacatga tcccccatgt tgtgcaaaaa agcggttagc tccttcggtc ctccgatcgt 10740 
tgtcagaagt aagttggccg cagtgttatc actcatggtt atggcagcac tgcataattc 10800 
tcttactgtc atgccatccg taagatgctt ttctgtgact ggtgagtact caaccaagtc 10860 
attctgagaa tagtgtatgc ggcgaccgag ttgctcttgc ccggcgtcaa tacgggataa 10920 
taccgcgcca catagcagaa ctttaaaagt gctcatcatt ggaaaacgtt cttcggggcg 10980 
aaaactctca aggatcttac cgctgttgag atccagttcg atgtaaccca ctcgtgcacc 11040 
caactgatct tcagcatctt ttactttcac cagcgtttct gggtgagcaa aaacaggaag 11100 
gcaaaatgcc gcaaaaaagg gaataagggc gacacggaaa tgttgaatac tcatactctt 11160 
cctttttcaa tattattgaa gcatttatca gggttattgt ctcatgagcg gatacatatt 11220 
tgaatgtatt tagaaaaata aacaaatagg ggttccgcgc acatttcccc gaaaagtgcc 11280 



<210> 2 
<211> 25 
<212> DNA 

<213> Artificial Sequence 
<220> 

<223> Description of Artificial Sequence : primer 
<400> 2 

aacattgaaa tcgatattac agggg 

<210> 3 
<211> 20 
<212> DNA 

<213> Artificial Sequence 
<220> 

<223> Description of Artificial Sequence : primer 
<400> 3 

cgggttatgg tcgaccgggc 

<210> 4 
<211> 40 
<212> DNA 

<213> Artificial Sequence 
<220> 

<223> Description of Artificial Sequence : primer 
<400> 4 

gtgccctccc ctgagtttaa acaattcagg gccgaacgcg 

<210> 5 
<211> 32 
<212> DNA 

<213> Artificial Sequence 
<220> 

<223> Description of Artificial Sequence : primer 



WO 99/50432 



-6- 



<400> 5 

gaattgttta aactcaggag gcaccctcgt gg 

<210> 6 
<211> 30 
<212> DNA 

<213> Artificial Sequence 
<220> 

<223> Description of Artificial Sequence : primer 
<400> 6 

ggtagacgag acagtcgcat gcctggatac 

<210> 7 
<211> 30 
<212> DNA 

<213> Artificial Sequence 
<220> 

<223> Description of Artificial Sequence : primer 
<400> 7 

gtatccaggc atgcgactgt ctcgtctacc 

<210> 8 

<211> 25 

<212> DNA 

<213> Artificial Sequence 
<220> 

<223> Description of Artificial Sequence .-primer 

<400> 8 

cagaccggtt aacgccatag cgtcg 

<210> 9 
<211> 25 
<212> DNA 

<213> Artificial Sequence 
<220> 

<223> Description of Artificial Sequence : primer 
<400> 9 

ctctattact agtatggaca gttgg 



INTERNATIONAL SEARCH REPORT 


1, lationoi Application No 




PCT/IB 99/00523 



A. CLASSIFICATION OF SUBJECT MATTER , _ . ^ . A „ 

IPC 6 C12N15/86 C12N9/12 C07K14/18 A61K48/00 A01K67/027 
C12N5/10 C12N7/04 



According to International Patent Classification (IPC) or to both national classification and IPC 

B. FIELDS SEARCHED 

Minimum documentation searched (classification system followed by classification symbols* 

IPC 6 C12N C07K 



Documentation searched other than minimum documentation to the extent that such documents are included in the fields searched 



Electronic data base consulted during the international search (name of data base and, where practical, search terms used) 



s 



C. DOCUMENTS CONSIDERED TO BE RELEVANT 



Category * 


Citation of document, with indication, where appropnate, of the relevant passages 


Relevant to claim No. 


A 


US 5 217 879 A (HUANG HENRY V ET AL) 


l 




8 June 1993 (1993-06-08) 






the whole document 




A 


STRAUSS, J.H. & STRAUSS, E.G.: "The 


l 




Alphaviruses: gene expression, 






replication, and evolution" 






MICROBIOLOGICAL REVIEWS, 






vol. 58, no. 3, September 1994 (1994-09), 






pages 491-562, XP002108834 






cited in the application 






page 498, column 2 - page 499, column 2, 






paragraph 3; figure 4 






page 509 . column 2, paragraph 2 - page 






517, column 2; figures 14,17 






page 525, column 1, paragraph 5 - page 






526, column 2, paragraph 3; figure 23 






-/-- 





Further documents are listed in the continuation of box C 



ID 



Patent family members are listed in annex. 



* Special categories of cited documents : 

'A" document defining the general state of the art which is not 

considered to be of particular relevance 
"E" earlier document but published on or after the international 

filing date 

"L" document which may throw doubts on priority claim(s) or 
which is cited to establish the publication date of another 
citation or other special reason (as specified) 

"O" document referring to an oral disclosure, use. exhibition or 
other means 

■p" document published prior to the international filing date but 
later than the priority date claimed 



"T" later document published after the international filing date 
or prionty date and not in conflict with the application but 
cited to understand the principle or theory underlying the 
invention 

"X" document of particular relevance: the claimed invention 
cannot be considered novel or cannot be considered to 
involve an inventive step when the document is taken alone 

"Y" document ot particular relevance: the claimed invention 

cannot be considered to involve an inventive step when the 
document is combined with one or more other such docu- 
ments, such combination being obvious to a person skilled 
in the art. 

**&" document member ot the 3ame patent family 



Date of the actual completion of the intern attonai search 

12 July 1999 


Date of mailing of the international search report 

27/07/1999 


Name and mailing address of the ISA 

European Patent Office. P B. 5818 Patentlaan2 
NL - 2280 HV Rijswijk 
Tel. (+31-70) 340-2040. Tx. 31 651 eoo ni, 
Fax: (+31-70) 340-3016 


Authorized officer 

Chambonnet, F 



Fotm PCT/ISA/210 ( second thoot) (Juiy 1002) 



page 1 of 3 



INTERNATIONAL SEARCH REPORT 



I. lational Application No 

PCT/IB 99/00523 



C(Contlnuatlon) DOCUMENTS CONSIDERED TO BE RELEVANT 


Category - 


Citation 61 document, with indication, who re appropriate, of the relevant passages 


Relevant to claim No. 


A 


SUOPANKI, J. ET AL.: "Regulation of 


1 




Alphavirus 26S mRNA transcription by 






rpnllrasp eomnonent NSP2" 






.milRNAI OF GENERAL VIROLOGY 






vol 7Q no ? February 1998 (1998-02) 






naaes 309-319 XP002108835 






SOCTFTY FOR GFNERAL MICROBIOLOGY 






RFAHTNG GR 






loon. UUct 101/ 






Lilt: InlltJ 1 C UUL.UIHCIIL 




A 


CUTRfltffi V %. ^TRAIK^ .1 H * " Rpniil at i on 
onlKnMI, T. a olrtnUoo, O.n.. i\eyu r ai* i lmi 


1 




of Sindbis Virus RNA replication : 






uncleaved P123 and nsP4 function in 






mi nus-s trana kna synLnesis, wriereab 






cieavea prouucts Troin ruj art i tqu 1 1 eu 






tor eTTicient p ius sxranci hinh bynLncai^ 






1HHRWAI OF VTROI OGY 
UUUKNHL Ur VlKULUUi., 






VOI. OO, no. o, Plarcn lyyH \ LyyH l/j;, 






pages io/h iood, Aruutiuooou 






T r AM cnrTCTV COR MTrRHRTni O^V IK 
1LAIN oUOlclY rUK niLKUD lULUui uo 






tne wno i e aocumeriL 




A 


DE, I. ET AL. : "Sindbis Virus 


1 




RNA-negative mutants that fail to convert 






Trom minus stranG to pi us btranu 






syntnesis. roie ut liic ubrc prutem 






JOURNAL OF VIROLOGY. , 






vol. 70, no. 5, May 1996 (1996-05), pages 






t/UD ArUUtlUOOJ/ 






tuc AMFRTPAN SOfTFTY FOR MICROBIOLOGY US 






IOOW. \J\JCC 3JOA 






LilC WIIU 1 c UULUWCllL 




A 
M 


lie c aqi oriQ a fUMAWf; HFMRY V FT Al ) 
Uo 3 U3I JU? n V nUMIXu nt |i(r\ T V C. 1 ML. t 


1 














A 


YOUKER, D.R. & SAWICKI S. G.: "Negative 


1 




strand RNA synthesis by 






temperature-sensitive mutants of Mouse 






Hepatitis Virus" 






ADVANCES IN EXPERIMENTAL* MEDECINE AND 






BIOLOGY, 






vol. 98, no. 440, 1998, pages 221-226, 






XP002108838 






the whole document 






— / 





Form PCT.'!SW210 (continuation of *acond sh*«t) (July 1992) 



page 2 of 3 



INTERNATIONAL SEARCH REPORT 



Ir. .ationai Application No 

PCT/IB 99/00523 



C.(Contlnuatlon) DOCUMENTS CONSIDERED TO BE RELEVANT 



Category J Citation ot document, with indtcatioawhere appropriate, of the rewvant passages 



Relevant to claim No. 



P.A 



P.A 



DIC0MM0, D. P. & BREMNER R. : "Rapid, high 
level protein production using ONA-based 
Semliki Forest virus vectors" 
JOURNAL OF BIOLOGICAL CHEMISTRY 
(MICROFILMS), 
vol. 273, no. 29, 

17 July 1998 (1998-07-17), pages 
18060-18066, XP002108839 

MD US 

the whole document 

WO 94 17813 A (PARAVAX INC ; GRIEVE ROBERT 
B (US); XI0NG CHENG (US)) 

18 August 1994 (1994-08-18) 
the whole document 

WO 98 36779 A (JOHNSTON ROBERT E ;UNIV 
NORTH CAROLINA (US); DAVIS NANCY L (US); 
S) 27 August 1998 (1998-08-27) 
page 11, line 5 - line 29 
page 23, line 22 - line 23; claims 



Form PCT/lSA/210 (continuation ot cocona cncot) (July 1002) 



page 3 of 3 



INTERNATIONAL SEARCH REPORT 



niernaoonat application No. 

PCT/IB 99/00523 



B x I Obs rvatlons where certain claims were found unsearchable (Continuatl n of Item 1 of first sheet) 

This internaaonai Search Report has not been established tn respect of certain claims under Article I7(2){a| lor the following reasons: 

1. | X | Claims Nos.: 

because they relate to subiect matter not required to be searched by this Authonty. namely: 

Remark: Although claims 25 to 31, 61 to 67 and partially claims 8 and 45 
as far as concerning in vivo gene therapy methods, are directed to 
a method of treatment of the human/animal body, the search has been 
carried out and based on the alleged effects of the compound/composition. 

2. (~n Claims Nos.: 

because they relate to parts of the International Application that do not comply with the prescribed requirements to such 
an extent that no meaningful International Search can be earned out. specifically: 



3. | j Claims Nos.: 

because they are dependent claims and are not drafted m accordance with the second and third sentences of Rule 6.4(a). 

Box II Observations where unity of invention is lacking (Continuation of item 2 of first sheet) 

This International Searching Authonty found multiple inventions in this internaaonai application, as follows: 



1 . I I As all required additional search fees were timely paid by the applicant, this International Search Repon covers all 
' — ' searchable claims. 



2. | j As all searchable claims could be searched without effort justifying an additional fee. this Authority did not invite payment 
of any additional fee. 



3. | : As only some of the required additional search lees were timely paid bv the applicant, this International Search Report 
' — ' covers only those claims for which fees were paid, specifically claims Nos.: 



4. I No required additional search fees were timely paid by the applicant. Consequently, this international Search Report is 
restricted to the invention first mentioned in the claims: it is covered by claims Nos.: 



Remark on Protest i I The additional search fees were accompanied bv the applicant's protest. 

! i No protest accompanied the oavment of aaainonai search fees. 



Form PCT.ISA/210 (continuation of first sheet d)) (July 1998) 



INTERNATIONAL SEARCH REPORT 

Information on patent family members 



In uional Application No 

PCT/IB 99/00523 



Patent document 
cited in search report 



Publication 
date 



Patent family 
members) 



Publication 
date 



US 5217879 



08-06-1993 



NONE 



US 5091309 


A 


25-02-1992 


NONE 








WO 9417813 


A 


18-08-1994 


AU 


6172194 


A 


29-08-1994 








US 


5766602 


A 


16-06-1998 


WO 9836779 


A 


27-08-1998 


US 


5811407 


A 


22-09-1998 








AU 


6168298 


A 


09-09-1998 



Form PCT.1SA/2I0 <p*leni famfly enn«x> (July \W2)