Skip to main content

Full text of "USPTO Patents Application 09848616"

See other formats


This Page Is Inserted by IFW Operations 
and is not a part of the Official Record 



BEST AVAILABLE IMAGES 



Defective images within this document are accurate representations of 
the original documents submitted by the applicant. 

Defects in the images may include (but are not limited to): 



• BLACK BORDERS 

• TEXT CUT OFF AT TOP, BOTTOM OR SIDES 

• FADED TEXT 

• ILLEGfBLE TEXT 

• SKEWED/SLANTED IMAGES 

• COLORED PHOTOS 

• BLACK OR VERY BLACK AND WHITE DARK PHOTOS 

• GRAY SCALE DOCUMENTS 



IMAGES ARE BEST AVAILABLE COPY. 

As rescanning documents mil not correct images, 
please do not report the images to the 
Image Problem Mailbox. 



Document AN3 
Appl.No. 09/848,616 



WORLD INTELLECTUAL PROPERTY" ORGANIZATION 
International Bureau 




PCT 

INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) 



(51) International Patent Classification 6 : 
C12N 15/00 



A2 



(11) International Publication Number: WO 99/07839 

(43) International Publication Date: 18 February 1999 (18.02.99) 



(21) International Application Number: PCT/EP98/05106 

(22) International Filing Date: 5 August 1998 (05.08.98) 



(30) Priority Data: 
97202434.3 



5 August 1997 (05.08.97) 



EP 



(71) Applicant (for all designated States except US): VLAAMS 

INTER UN IVERSITAIR INSTITUUT VOOR BIOTECH- 
NOLOGIE [BE/BE]; Rijvisschestraat 118, bus l f B-9052 
Zwijnaarde (BE). 

(72) Inventors; and 

(75) Inventors/Applicants (for US only): NEIRYNCK, Sabine 
[BE/T3E]; Bokslaarstraat 41 t B-9160 Lokeien (BE). MIN 
JOU f Willy [BE/BE]; Jagersdreef 11, B-9070 Destelbcrgen 
(BE). FIERS, Walter [BE/BE]; Beukendreef 3 t B-9070 
Destelbergen (BE). 

(74) Agent: VAN SOMEREN, Petronella, Francisca, Hendrika, 
Maria; Arnold & Siedsma, Swcelinckplein 1, NL-2517 GK 
The Hague (NL). 



(81) Designated States: AL, AM, AT, AU, AZ, BA, BB, BG t BR, 
BY, CA, CH, CN, CU, CZ, DE, DK, EE, ES, FI. GB, GE, 
GH, GM, HR, HU, ID, IL, IS, JP, KE, KG, KP, KR, KZ, 
LC, LK, LR, LS, LT, LU, LV, MD, MG, MK, MN, MW, 
MX, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, 
17, TM, TR, TT, UA, UG, US, UZ, VN, YU, ZW, ARIPO 
patent (GH, GM, KE, LS, MW, SD, SZ, UG, ZW), Eurasian 
patent (AM, AZ, BY, KG, KZ, MD, RU, 17, TM), European 
patent (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, 
IE, IT, LU, MC, NL, PT, SE), OAPI patent (BF, BJ, CF, 
CG, Q, CM, GA, GN, GW, ML, MR, NE, SN, TO, TG). 



Published 

Without international search report and to be republished 
upon receipt of that report. 



(54) Title: NEW IMMUNOPROTECTIVE INFLUENZA ANTIGEN AND ITS USE IN VACCINATION 



(57) Abstract 



Hie present invention relates to an influenza antigen, comprising a fusion product of at least the extracellular part of a conserved 
influenza membrane protein or a functional fragment thereof and a presenting carrier, which may be a presenting (poly)peptide or a 
non-peptidic structure, such as glycans, peptide mimetics, synthetic polymers. The invention further relates to a vaccine against influenza, 
comprising at least an antigen of the invention, optionally in the presence of one or more excipients. The invention also relates to use of 
the antigen, a method for preparing the antigen and acceptor cells expressing the antigen. 



FOR THE PURPOSES OF INFORMATION ONLY 
Codes used to identify States party to the PCT on the front pages of pamphlets publishing international applications under the PCT. 



AL 


Albania 


ES 


Spain 


LS 


Lesotho 


SI 


Slovenia 


AM 


Armenia 


FI 


Finland 


LT 


Lithuania 


SK 


Slovakia 


AT 


Austria 


FR 


France 


LU 


Luxembourg 


SN 


Senegal 


AU 


Australia 


GA 


Gabon 


LV 


Latvia 


SZ 


Swaziland 


AZ 


Azerbaijan 


GB 


United Kingdom 


MC 


Monaco 


TD 


Chad 


BA 


Bosnia and Herzegovina 


GE 


Georgia 


MD 


Republic of Moldova 


TG 


Togo 


BB 


Barbados 


GH 


Ghana 


MG 


Madagascar 


TJ 


Tajikistan 


BE 


Belgium 


GN 


Guinea 


MK 


The former Yugoslav 


TM 


Turkmenistan 


BF 


Burkina Faso 


GR 


Greece 




Republic of Macedonia 


TR 


Turkey 


BG 


Bulgaria 


HU 


Hungary 


ML 


Mali 


TT 


Trinidad and Tobago 


BJ 


Benin 


IE 


Ireland 


MN 


Mongolia 


UA 


Ukraine 


BR 


Brazil 


IL 


Israel 


MR 


Mauritania 


UC 


Uganda 


BY 


Belarus 


IS 


Iceland 


MW 


Malawi 


US 


United States of America 


CA 


Canada 


IT 


Italy 


MX 


Mexico 


uz 


Uzbekistan 


CF 


Central African Republic 


JP 


Japan 


NE 


Niger 


VN 


Viet Nam 


CG 


Congo 


KE 


Kenya 


NL 


Netherlands 


YU 


Yugoslavia 


CII 


Switzerland 


KG 


Kyrgyzstan 


NO 


Norway 


zw 


Zimbabwe 


CI 


C6te d'lvoire 


KP 


Democratic People's 


NZ 


New Zealand 






CM 


Cameroon 




Repub^c of Korea 
Republic' of Korea 


PL 


Poland 






CN 


China 


KR 


PT 


Portugal 






CU 


Cuba 


KZ 


KazaksUn 


RO 


Romania 






CZ 


Czech Republic 


LC 


Saint Lucia 


RU 


Russian Federation 






DE 


Germany 


LI 


Liechtenstein 


SD 


Sudan 






DK 


Denmark 


LK 


Sri Lanka 


SE 


Sweden 






EE 


Estonia 


LR 


Liberia 


SG 


Singapore 







WO 99/07839 PCT/EP98/051 06 

NEW IMMUNOPROTECTIVE INFLUENZA ANTIGEN AND 
ITS USE IN VACCINATION 

The present invention relates to new 
immunoprotective influenza antigens, which are non- 
existent in nature. The invention further relates to the 
use of the antigens for vaccination and to vaccines 
5 containing them, as well as to methods for preparing the 
antigens . 

Influenza is caused by an RNA virus of the 
myxovirus group. Influenza viruses can be classified into 
three types (A, B and C) , based on antigenic differences 

10 in the nucleoprotein and the matrix protein. Type A and B 
influenza viruses each contain 8 RNA segments, while type 
C only has 7 RNA segments. Influenza A is most important 
and is very pathogenic for man, as well as for animals, 
for example pigs and horses. Type B influenza causes 

15 disease in humans. Influenza C is less severe and has 
been isolated from humans and pigs. The virus is 
transmitted through the air, mainly in droplets expelled 
during coughing and sneezing. The influenza viruses cause 
an infection of the respiratory tract, that is usually 

20 accompanied with coughing, high fever and myalgia. 

Although an influenza infection does not often lead to 
the death of the infected individual, the morbidity can 
be severe. As a consequence thereof influenza epidemics 
may lead to substantial economic loss. Furthermore, 

25 influenza infection can be more dangerous for certain 

groups of individuals, such as those having suffered from 
a heart attack, CARA patients or the elderly. A vaccine 
against influenza is therefore highly desirable. 

The influenza A virus contains in its membrane 

3 0 two highly immunogenic, but very variable proteins, the 
hemagglutinin and the neuraminidase. Due to the 
variability of these two proteins a broad spectrum, long 
lasting vaccine against influenza A has so far not been 
developed. The influenza vaccine commonly used, has to be 

35 adapted almost every year to follow the antigenic drift 
of the virus. In these circumstances the vaccine can 
protect about 80% of the immunized persons. When more 



WO 99/07839 PCT/EP98/05106 

2 

drastic changes occur in the virus, known as antigenic 
shift, the vaccine is no longer protective. 

It is therefore the object of the present 
invention to provide a new immunoprotective antigen for 
5 use in vaccines which is not based on the rapidly 
changing hemagglutinin and/or neuraminidase and which 
therefore lacks the disadvantages of these known antigens 
and vaccines based thereon. 

In the research that led to the present 
10 invention it was found that well conserved membrane 
proteins of influenza other than hemagglutinin and 
neuraminidase can be used for eliciting protection. 
Particularly useful for this approach is the membrane 
protein M2 . 

15 M2 mRNA is encoded by RNA segment 7 of the 

influenza A virus. It is encoded by a spliced mRNA (Lamb 
et al., 1981). Like the hemagglutinin and the 
neuraminidase, the M2 protein is an integral membrane 
protein of the influenza A virus. But the protein is much 

20 smaller, only 97 amino acids long. 24 amino acids at the 
amino terminus are exposed outside the membrane surface, 
19 amino acids span the lipid bilayer, while the 
remaining 54 residues are located on the cytoplasmic side 
of the membrane (Lamb et al . , 1985). 

25 The M2 protein is abundantly expressed at the 

cell surface of influenza A infected cells (Lamb et al., 
1985) . The protein is also found in the membrane of the 
virus particle itself, but in much smaller quantities, 14 
to 68 molecules of M2 per virion (Zebedee and Lamb, 

30 1988) . The M2 protein is posttranslationally modified by 
the addition of a palmitic acid on cysteine at position 
50 (Sugrue et al . , 1990). 

The M2 protein is a homotetramer composed of 
two disulfide- linked dimers, which are held together by 

35 noncovalent interactions (Sugrue and Hay, 1991) . By site- 
directed mutagenesis, Holsinger and Lamb (1991) 
demonstrated that the cysteine residue at position 17 and 
19 are involved in disulfide bridge formation. Only 



WO 99/07839 PCT/EP98/051 06 



3 

cysteine at position 17 is present in all viruses 
analyzed, therefore it seems likely that this is the most 
important residue. In the virus strains where cysteine 19 
is also present, it is not known whether a second 
5 disulfide bridge is formed in the same dimer (already 
linked by Cys 17 - Cys 17) or with the other dimer. 

By aligning the sequences of M2 proteins, 
isolated from different human strains of influenza A 
virus, a striking conservation of the extracellular part 

10 of the M2 protein, became evident (table 1) . Since the 
first human influenza A strain isolated in 1933, A/WS/33 
(H1N1) , until the most recently sequenced virus 
A/Guangdong/3 9/89 (H3N2) , no amino acid change has been 
observed in the extracellular domain of the M2 protein. 

15 Two virus strains do not fit in this conserved pattern, 
A/PR/8/34 (H1N1) , which shows one amino acid change, and 
A/Fort Monmouth/1/47 (H1N1) , which shows three amino acid 
differences. These two strains probably represent side 
branches in the evolutionary tree. 

20 Table 1 gives an overview of the amino acid 

sequences of the extracellular domain of the influenza A 
M2 protein of the virus strains A/WSN/33 (Markushin et 
al. (1988)), A/PR/8/34 (Allen et al . (1980), Winter and 
Fields (1980)), A/WS/33, A/Fort Warren/l/50, 

25 A/Singapore/1/57 and A/Port Chalmers/l/73 (all described 
by Zebedee and Lamb (1989)), A/Udorn/72 (Lamb and Lai 
(1981)), A/Leningrad/134/57 (Klimov et al . (1992)), A/Ann 
Arbor/6/60 (Cox et al . (1988)), A/Bangkok/1/79 (Ortin et 
al. (1983)), A/New York/83 (Belshe et al . (1988)), A/Fort 

30 Monmouth/1/47 (EMBL U02084) , A/USSR/90/77 (EMBL X53029) 
and A/Guangdong/3 9/89 (EMBL L 18999) . 



WO 99/07839 



PCT/EP98/05106 



4 



.(0 



c 

Q. 
CM 

CD 



CD 

E 
o 
~o 

I— 

ro 

_3 

8 

(0 
t» 

X 
0 

CD 



8 

c 

<D 

O" 

0 
t/> 

■g 
'o 

CO 

o 
c 

E 
< 



CM 



CO 
CM 



CM 
CM 



O 
CM 



CL 




Cl 


O. 


CL 


Cl 


Q 


Q 


CL 


Cl 


CL 


CL 


o. 


Cl 


to 


to 


to 


CO 


CO 


to 


to 


CO 


to 


to 


to 


to 


to 


to 


< 


< 


<C 


< 


< 


< 


<c 


<c 


< 


< 


< 


< 


<. 


<C 








t_ 


l_ 




1_ 




!_ 








u 




CU 


CU 


CU 


cu 


CU 


CU 


<u 


CU 


CU 


cu 


CU 


<u 


cu 


cu 


00 


oo 


OO 


to 


OO 


OO 


OO 


OO 


OO 


OO 




OO 


OO 


OO 




t_ 


t_ 


u 


u 


t- 


t_ 


1_ 


t- 


c_ 


t. 


t_ 


u 




<u 


fU 


cu 


cu 


cu 


<u 


cu 


cu 


cu 


cu 


cu 


cu 


cu 


cu 


to 


LO 


OO 


OO 


OO 


OO 


OO 


OO 


OO 


OO 


OO 


00 


l/> 


OO 


cl 


Q, 


>> 


CL 


Cu 


Ol 


CL 


Cl 


Cl 


CL 


CL 


CL 


O. 


CL 


CO 


to 




1/) 


to 


to 


to 


to 


to 


to 


LO 


to 


to 


CO 








< 






<c 


<c 


<x 


<c 


<c 


< 


< 


< 


c 


c 


c 




c 


c 


c 


c 


c 


c 


c 


c 




e 


to 


to 


to 


to 


to 


to 


to 


to 


to 


to 


to 


to 


to 


to 


< 


< 


< 




< 


< 


< 


< 


< 


< 


< 


< 


< 


< 






to 


to 


CO 






to 


CO 




CO 


CO 


cO 


CO 






>> 


>> 


>» 




>. 


>> 


>> 


>» 


>> 


>» 


>» 


>^ 


CJ 




CJ 














( ) 






) 


C_) 


co 


cn 


C7> 


CD 










o* 






cn 


cn 


cn 




t- 


C_ 












c_ 




t_ 




t_ 




< 


< 


< 


< 


< 


< 


< 


< 


< 


< 


< 


< 


< 


< 






CO 


to 




to 


CO 




CO 


to 


CO 


CO 


to 


CO 






>. 


>> 


>% 


>* 




>> 




>% 


>1 


>> 


>> 


>» 


o 


o 


cj 


o 




CJ 


CJ 


c_> 


c_> 


o 


C-) 


c_> 


O 


c_> 


>> 


>> 


>> 










>> 




^> 


>"> 


^> 






cd 


cd 


CD 


cd 


cd 


cd 


cd 


o 


CD 


CD 


CD 


CD 


CD 


CD 


Cl 


cl 


CL 


CL 














Q_ 


Q_ 


p> 


Cl 


t- 


t_ 


L. 


U 




2" 








u 


c_ 


t_ 


L. 


t_ 


t— 


h- 


t- 


r— 




1— 


t— 


r- 


1— 


1— 


H- 


H- 


1— 


1— 












3 




3 


3 












cd 


cd 


cd 


CD 


CD 


CD 


CD 


CD 


CD 


CD 


CD 


CD 


CD 


CD 


c 


c 


c 


C 


c 


C 


c 


c 


C 


c 


c 


C 


c 


C 


CO 


to 


to 


to 


to 


to 


to 


to 


to 


to 


to 


to 


to 


to 


< 


< 




< 


< 


< 


< 


<c 


<: 


< 


< 


< 


<t 


< 




CD 


cn 


to 


CD 


cn 




Cn 


cn 


a> 


cn 




cn 


cn 


t_ 






>> 






L- 












t_ 




< 


< 


< 




< 


< 


< 


< 


< 


< 




< 


<C 


< 


CD 




CO 


t_ 


CU 


CU 


<U 


cu 


cu 


cu 


CU 


CU 


CU 


cu 








PFh 




r — 


















O 


o 


o 


O 


o 


o 


o 


o 


o 


o 


o 


o 


o 


o 


C_ 


t_ 


l_ 


c 


t_ 


C- 


t_ 


c 


t_ 


l_ 




c 


c 


t_ 


Q_ 


Q_ 


Q_ 


CL. 


a. 


a. 


Q_ 


cu 


CL. 


CL, 


CL. 


a. 


Q_ 


Q_ 


S_ 


C 


S_ 


t_ 


t_ 


c_ 


t- 


i_ 




U 


1_ 


t_ 


t_ 


L_ 



00 


























CD 


CD 




CD 


CD 


CD 


CD 


CD 


CD 


CD 


CD 


CD 


CD 


CD 


CD 




TO 




T3 






ra 


CO 




CO 




ro 




ro 


ro 




> 


> 


>- 


> 




> 


> 


> 


> 


> 


> 


> 




> 




3 


3 


3 


3 


3 


3 


3 


3 


3 


3 


3 


3 


3 


3 


to 


CD 


CD 


CD 


CD 


CD 


CD 


CD 


CD 


CD 


CD 


CD 


CD 


CD 


CD 




L» 


c_ 


L- 


t_ 


t_ 


l_ 


c 


U 


C- 


t_ 


t_ 




t_ 


t_ 


lO 




JZ 






J= 


JC 


JC 


x: 




sz 


sz 


sz 




SI 




I— 


y- 


k- 


t— 


h- 


\— 


(— 


(— 


h- 


\— 


h- 


t— 


1— 


^— 




3 


3 


3 


3 


3 


3 


3 


3 


3 


3 


3 


3 


3 


3 




CU 


CU 


CU 


CU 


CU 


CU 


cu 


CU 


CU 


CU 


CU 


CU 


CU 


cu 




3 


3 


3 


3 


3 


3 


3 


3 


3 


3 


3 


3 


3 


3 




CU 


CU 


CU 


CU 


CU 


CU 


CU 


CU 


CU 


CU 


CU 


CU 


CU 


cu 




t_ 


u 


L_ 


C- 


t_ 


t- 


c 


t- 


C- 


t_ 




L. 


t_ 


l_ 


CM 


cu 


cu 


CU 


O) 


cu 


cu 


cu 


cu 


cu 


cu 


cu 


CU 


CU 


cu 




OO 


OO 


OO 


OO 


OO 


OO 


OO 


OO 


OO 


OO 


OO 


OO 


OO 


OO 



c 
to 

0) 



z 

X 

CO 

co 

z 

0 



z 

X 

a: 
a. 

3 



z 

X 

i 

3 
O 

E 



o 



z 

I P 

0 ? 

1 i 

tf CO 

o to 

li- D 



CN 

z 

CN 
X 

to 

| 
i 

CD 
CO 

c 
CO 
5 



CM 

z 

CM 



in 
co 



T3 



a> 



CM 

Z 

CO 
X 

CM 



O 



CM 

z 

co 
X 

CO 
CD 

E 

(0 



o 

CL 



CM 

z 

co 
X 

O) 



CO 

X 



cn 

00 



CM £2 
Z O) 



i X 

CO OO 



c 

CO 
CD 



>■ 
z 

5 



c 
o 

"D 

cn 
c 

CD 
3 

o 

5 



WO 99/07839 



PCT7EP98/05106 



5 

It was anticipated by the present inventors 
that the conserved character of this type of membrane 
proteins could make them good candidates for vaccine 
development. In principle, the protective capacity of 
5 anti-M2 antibodies is already known. Experimental data 
demonstrated that a monoclonal antibody directed against 
the extracellular part of the M2 protein (14C2) can 
diminish the spread of the virus, although the 
infectivity of the virus in vitro was not reduced 

10 (Zebedee and Lamb, 1988) . Furthermore it was demonstrated 
that passively administered monoclonal antibody (14C2) 
could inhibit viral multiplication in the lungs of mice 
(Treanor et al., 1990). Both approaches rely on the 
administration of anti-M2 antibodies. However, the 

15 passive administration of monoclonal antibodies as a 

means of defense against infection is preferably avoided 
because of the immunogenicity of heterologous 
immunoglobulins which, upon repeated administration, can 
lead to the clearing of the antibodies from the body and 

20 thus to a reduction of the efficacy of the treatment. 
Even homologous antibodies can elicit anti- idiotype 
antibodies. Furthermore, it was found that humans 
infected with the virus do have anti-M2 antibodies but 
these do not protect against infection, (either their 

25 concentration or their nature are not sufficient to 
confer efficacy) . This makes it unlikely that passive 
administration of anti-M2 antibodies is suitable for use 
in humans. It also teaches away from trying to develop 
vaccines for humans based on this antigen. 

30 Recently, protection of mice against an 

infection with homologous or heterologous virus was 
described (Slepushkin et al . , 1995). These authors used a 
formulation of incomplete Freund's adjuvant and a 
membrane extract of Sf9 cells expressing the complete M2 

35 protein for immunizations. However, this approach is also 
not suitable for vaccination of humans because it relies 
on the use of the exceptionally potent Freund's adjuvant 
which is prohibited in humans. 



WO 99/07839 PCT/EP98/051 06 

6 

In summary, use of antibodies for providing 
protection against influenza is preferably to be avoided. 
Moreover, it is unlikely that prophylactic treatment with 
antibodies will be effective in humans. Immunization with 
5 complete M2 protein in humans as described is not 
realistic because it relies on incomplete Freund's 
adjuvant which cannot be used in humans, and is counter- 
indicated in higher animals. 

It is thus the object of the present invention 

10 to provide for an alternative influenza antigen that is 
sufficiently immunoprotective against a broad spectrum of 
influenza strains and is not dependent on Freund's 
adjuvant, such that it can be used in human beings. 

According to the invention it has now been 

15 found that it is possible to prepare such a novel antigen 
that does not exist in nature. For this the extracellular 
part of a conserved influenza membrane protein or a 
functional fragment thereof is fused to a presenting 
carrier, for example a (poly) peptide . The conserved 

20 influenza membrane protein is for example the well 
conserved, extracellular part of the M2 protein. The 
membrane protein is preferably genetically fused to a 
presenting (poly) peptide as the presenting carrier, which 
(poly) peptide stabilizes the extracellular part and 

25 surprisingly potentiates the immunogenicity of the fusion 
product thus obtained. It is thought that the presenting 
(poly) peptide brings the extracellular part into its wild 
type structure, thus presenting the antigen in a form 
that is also found on the virus and on the infected 

30 cells. 

A 'functional fragment of the conserved 
influenza membrane protein 1 is a fragment that is capable 
of eliciting a statistically significant higher 
immunoprotection when administered in an immunoprotective 
3 5 dose to test members of a species than is found in 
control members of the same species not receiving the 
functional fragment . 



WO 99/07839 PCT/EP98/051 06 

7 

In one embodiment of the invention the 23 amino 
acid extracellular part of the M2 protein is fused to the 
amino terminus of the human Hepatitis B virus core 
protein. In this way the wild type structure of the M2 
5 protein in viral particles and on infected cells, where 
the free N-terminus extends in the extracellular 
environment, is mimicked. 

Alternative presenting (poly) peptides are 
multiple C3d domains (Dempsey et al. , 1996), tetanus 
10 toxin fragment C or yeast Ty particles. 'Presenting 

(poly) peptides ' are intended to encompass every stretch 
of amino acid(s) that can present the extracellular part, 
in a substantially wild type form, towards the 
environment . 

15 Alternatively, the presenting carrier can be a 

non-peptidic structure, such as glycans, polyethylene 
glycols, peptide mimetics, synthetic polymers, etc.. 

After expression of the novel antigen in a 
suitable acceptor cell, it can be used either as such 

20 (depending on the acceptor cell) , as part of a membrane 
fragment or in isolated form. 

The term 'presenting carrier 1 is used to 
indicate all types of presenting molecule, both 
(poly) peptides and others. 

25 It will be clear for the person skilled in the 

art that a gene construct, comprising the coding 
information for the antigen and the presenting 
(poly) peptide, can not only be used to prepare the new 
antigen, as described above, but that it can also be 

30 used, optionally in the presence of suitable 

transcription and/or translation regulatory sequences, in 
a DNA vaccine, or in vaccinia based vaccine 
constructions . 

A presenting (poly) peptide can be incorporated 

35 into the fusion product in a single copy or in multiple 
copies. The third complement protein fragment d (C3d) is 
preferably used in more copies, preferably 3 or more. 



WO 99/07839 



PCT/EP98/05106 



8 

In a preferred embodiment of the invention the 
fusion product further may comprise an additional peptide 
at an appropriate internal site (Schodel et al . , 1992) or 
C-terminal (Borisova et al . , 1989). This additional 
5 peptide is intended to further increase the protective 
capacity of the antigen, and may for example be a T 
helper cell epitope or a cytotoxic T cell epitope. 

The antigen of the invention is obtainable by 
preparing a gene construct comprising a coding sequence 

10 for at least the extracellular part of a conserved 
influenza membrane protein or a functional fragment 
thereof and optionally the coding sequence for a 
presenting (poly) peptide operably linked thereto, 
optionally in the presence of suitable transcription 

15 and/or translation and/or secretion regulatory sequences, 
bringing this gene construct in a suitable acceptor cell, 
effecting expression of the gene construct in the 
acceptor cell and optionally isolating the antigen from 
the acceptor cell or its culture medium. 

20 The requirement for transcription and/or 

translation and/or secretion regulatory sequences depends 
on whether the gene is to be integrated into a vector or 
whether integration in the genome of the acceptor cell is 
at a position already providing these signals. 

2 5 The coding sequence for a presenting 

(poly) peptide is only present when the fusion product is 
a fusion between the antigen and a peptidic structure and 
if it is desirable to directly link the two structures in 
the DNA construct. In all other instances, the presenting 

30 carrier may be added to the antigen in a different 
manner . 

The suitable acceptor cell can be selected for 
example, from E. coli , Lactococcus lactis . Lactobacillus 
plantarum, yeast (e.g. Pichia oastoris ) . insect cells 
35 (e.g. Sf9) , mammalian cells (e.g. Vero cells) and the 
like. In the case of L . lactis the antigen need not be 
isolated but the engineered bacteria can be used directly 
for intranasal or oral use. 



WO 99/07839 PCT/EP98/05106 

9 

The invention further relates to vaccines that 
comprise at least the antigen of the invention. This 
antigen can be in isolated form or being part of a 
membrane fragment or being expressed on the acceptor 
5 cell. The antigen of the invention can be used together 
with suitable excipients. The person skilled in the art 
of vaccine design will be capable of selecting suitable 
excipients. Guidance may for example be found in Methods 
in molecular medicine: Vaccine Protocols (1996). Eds. 

10 Robinson, A., Farrar, G.H. and Wiblin, C.N. Humana Press, 
Totowa, New Jersey, USA. 

The antigens of the invention may be used alone 
or in combination with one or more other influenza 
antigens, such as neuraminidase, hemagglutinin or native 

15 M2. 

Furthermore, the invention relates to the use 
of the antigens in the preparation of a vaccine against 
influenza. The vaccines can be direct vaccines, i.e. 
vaccines containing the fusion products or indirect, DNA 

20 vaccines. The latter are vaccines, comprising ' the fusion 
cDNA under the regulation of a eukaryotic promoter that 
can function in the recipient. The actual antigen is then 
produced in the recipient of the vaccine. 

The vaccines of the invention are intended both 

25 for use in humans and in animals, for example pigs and 
horses of which it is known that they are infected by 
influenza A. 

A similar approach as described here for 
preparing novel fusion antigens of influenza A can be 

30 adopted to prepare similar fusion antigens and vaccines 
containing the fusion antigens or DNA encoding the fusion 
antigens for influenza B and C. 

The invention also relates to a method of 
preparing the antigens, comprising the steps of: 

35 a) preparing a gene construct comprising a 

coding sequence for at least the extracellular part of a 
conserved influenza membrane protein or a functional 
fragment thereof and at least one coding sequence for a 



WO 99/07839 PCT/EP98/05106 

10 

presenting (poly) peptide operably linked thereto, 
optionally in the presence of suitable transcription 
and/or translation and/or secretion regulatory sequences, 

b) bringing this gene construct in a suitable 
5 acceptor cell, 

c) effecting expression of the gene construct 
in the acceptor cell, and 

d) optionally isolating the antigen from the 
acceptor cell or its culture medium. 

10 The invention will be further illustrated by 

the following example, that is in no way intended to 
limit the invention. The example describes in detail the 
preparation of fusion proteins of M2 sequence with 
various presenting (poly) peptides and the use thereof in 

15 immunization. Instead of M2 and the presenting carriers 
described here, the skilled person will be capable of 
choosing another conserved influenza membrane protein and 
other presenting carriers. 

In the example reference is made to the 

20 following figures: 

Figure 1 : Construction of pATIPM2ml. 
El and E2 = first and second exon of the influenza M2 
protein, 

M2e = extracellular part of the M2 protein, 
25 M2t = transmembrane part; and 
M2c = cytoplasmic tail. 
Bold line = vector. 

(a) removal of the intron out of the m2 gene, 

(b) introduction of a Bell site between the 

30 extracellular part and the transmembrane domain of 

the M2 protein, 

(c) nucleotide and amino acid sequence of the 
extracellular part of the M2 protein of A/PR/8/34. 

Figure 2 : Construction of pIPM2hB2Mm2s2 . 
35 ori = origin of replication, 

cat = chloramphenicol acetyl transferase, 
bla = S-lactamase, 
lpp = lipoprotein, 



WO 99/07839 PCT/EP98/051 06 

11 

hB2M = human ^-microglobulin, 

ompa-ss = signal sequence of the outer membrane protein A 
of E. coli , 

ssDNA = single -stranded DNA, 
5 M2e = extracellular part of the M2 protein. 

(a) : Construction flow scheme, 

(b) : Details of key sequences. 

Figure 3 : Construction of pPLcIPM2HBcm. 

ori = origin of replication, 
10 cat = chloramphenicol acetyl transferase, 

bla = S-lactamase, 

HBc - hepatitis B core, 

ssDNA = single-stranded DNA, 

M2e = extracellular part of the M2 protein. 
15 (a) : Plasmid construction flow scheme, 

(b) : Sequence around the introduced BamHI restriction , 
site in the hepatitis B core gene, 

(c) : Details of key sequences. 

Figure 4 : Analysis of the soluble fraction, 

2 0 corresponding to 150 /il original culture, of strain 

MC1061 [pcI857] containing the plasmids pPLc245 (control), 
pPLcAl (expression of HBc) or pPLcIPM2HBcm (expression of 
IPM2HBcm) respectively, on a SDS 12.5% PAGE. After the 
electrophoresis the gel was stained with Coomassie 

25 brilliant blue. 

MW = molecular weight marker, 
NI = not induced culture, 
I = induced culture. 

Figure 5 : Analysis of the soluble fraction, 

30 corresponding to 150 fxl original culture, of strain 

MC1061 [pcI857] transformed with pPLc245 (control), pPLcAl 
(expression of HBc) or pPLcIPM2HBcm (expression of 
IPM2HBcm) respectively, as in figure 4. After 
electrophoresis, the relevant proteins were revealed by a 

35 Western blotting experiment. Detection with (A) a 
monoclonal antibody against HBc and (B) a monoclonal 
antibody specific for the extracellular part of the M2 
protein . 



WO 99/07839 



PCT/EP98/05106 



12 

MW = molecular weight marker, 
NI = not induced culture, 
I = induced culture. 

Figure 6 : Sequence of the amino terminus of 
5 the M2 protein compared to the amino terminus of 
IPM2HBcm, as experimentally determined. Sequence of 
A/Udorn/72 (Lamb and Zebedee, 1985) . 

Figure 7 : Soluble fractions of strain 
MC1061 [pcl857] transformed with pPLc245 (control), pPLcA 

10 1 (expression of HBc) or pPLcIPM2HBcm (expression of 
IPM2HBcm) , respectively, analyzed in a native. state by 
means of a dot blot. Detection with (A) a monoclonal 
antibody against HBc and (B) a monoclonal antibody 
specific for the extracellular part of the M2 protein. 

15 NI = not induced culture, 
I = induced culture. 

Figure 8 : Overview of (Al) rectal temperature, 
(A2) weight and (B) survival of the mice vaccinated with 
IPM2HBcm after a lethal challenge with 5 LD_ m.a. 

20 A/PR/8/34. The statistical significance was calculated by 
the Fisher's exact test. Mice immunized with different 
doses of antigen were compared to the control group. The 
following results were obtained: for 50 /xg IPM2HBcm 
p<0.001; for 10 fxg p<0.005 and for the 5 \iq dose p<0.05. 

25 Figure 8C shows the survival of the mice vaccinated 
intraperitoneally with IPM2HBcm, and IM2HBcm, 
respectively, after a lethal challenge with 30 HAU X-47. 
Figure 8D shows the survival of the mice vaccinated 
intranasally with IPM2HBcm, and IM2HBcm, respectively, 

30 after a lethal challenge with 30 HAU X-47. 

Figure 9 : Analysis of the serum samples of the 
four set ups reported in figure 8. The pre-immune serum 
(a) , the serum taken after the first (b) , after the 
second (c) and after the third (d) immunization and the 

35 serum taken after challenge (e) were initially diluted 
1/50. The consecutive dilution steps were 1/3. The 
plotted absorbance is a corrected value obtained as 
described in Results, Analysis of the serum samples. 



WO 99/07839 PCT/EP98/051 06 

13 

Figure 10 : Construction of pPLcIM2HBcm. 
ori = origin of replication, 
cat = chloramphenicol acetyltransf erase, 
bla = £- lactamase, 
5 M2e = extracellular part of the M2 protein, 
HBc = hepatitis B core. 

Figure 11 : Analysis of the soluble fraction, 
containing 5 tig HBc or I(P)M2HBcm (as determined in an 
ELISA (see Materials and methods)), of strain MC1061 

10 [pcI857] containing respectively the plasmids pPLc245 
(control) , pPLcAl (expression of HBc) , pPLcIPM2HBcm 
(expression of the fusion protein IPM2HBcm with the 
extracellular part of the M2 protein derived from 
A/PR/8/34) or pPLcIM2HBcm (expression of IM2HBcm, 

15 containing the more universal M2 sequence) on a SDS 12.5% 
PAGE-gel. 

MW = molecular weight marker, 

NI = not induced, 

I = induced culture. 
20 Figure 12 : Analysis of the soluble fraction, 

containing 2 . 5 /ig HBc or I(P)M2HBcm (as determined in an 

ELISA (see Materials and methods) ) , of strain MC1061 

[pcI857] containing respectively the plasmids pPLc245 

(control) , pPLcAl (expression of HBc) , pPLcIPM2HBcm 
25 (expression of IPM2HBcm) or pPLcIM2HBcm (expression of 

IM2HBcm) on a Western blot (see Materials and methods) . 

Detection with (A) a monoclonal antibody directed against 

HBc and (B) a monoclonal antibody specific for the 

extracellular part of the M2 protein. 
30 MW = molecular weight marker, 

NI = not induced, 

I = induced culture. 

Figure 13 : Overview of the oligonucleotides 

used for PCR amplification of hbc and i(p)m2hbc. 's' or 
35 'a' following the name of the oligonucleotide stands for 

the use of these primers in the sense (s) or anti-sense 

(a) orientation. The boxed sequence indicates the changed 

Leu codons . 



WO 99/07839 



PCT/EP98/05106 



14 

Figure 14 : Overview of the construction of hbc 
and m2hbc fusions in vectors for L. lactis . 
ori = origin of replication for E. coli , 
ori(+) = origin of replication for L. lactis . 
5 ermA and ermM = erythromycin resistance genes, 
PI = L. lactis promoter, 
bla = S-lactamase, 
HBc = hepatitis B core, 

M2e = extracellular part of the M2 protein> 

10 usp4 5-ss = signal sequence of usp45, 
mIL2 = murine interleukin 2 and 
mIL6 = murine interleukin 6. 

Figure 15 : Analysis of the expression of 
Hepatitis B core (HBc) and M2-HBc fusion proteins in a 

15 Western blot. An equivalent of 10 9 L. lactis bacteria of 
strain MG1363 containing respectively pTREXl (control) , 
pTIHBc, pT!HBcIL2, pTlHBcIL6 (expression of HBc alone or 
in combination with mIL2 or mIL6, respectively) , 
pT!PM2HBc, pTlPM2HBcIL2, pTlPM2HBcIL6 (expression of 

20 IPM2HBcm alone or in combination with mIL2 or mIL6, 
respectively), pTlM2HBc, pTlM2HBcIL2, pTlM2HBcIL6 
(expression of IM2HBcm alone or in combination with mIL2 
or mIL6, respectively), was analyzed in a SDS 12.5% PAGE- 
gel. The first antibody, p-anti-HBc (Dako Corporation, 

25 Carpinteria, CA. , USA) was diluted 5000 times. The bound 
antibodies were detected with a 1/2000 dilution of the 
polyclonal anti- rabbit IgG labeled with alkaline 
phosphatase (Southern Biotechnology Associates, 
Birmingham, AL. , USA). I(P)M2HBc stands for either 

30 IPM2HBcm or IM2HBcm. 

MW = molecular weight marker, 
C = control and 

- = expression of the antigen alone. 

Figure 16 : Analysis of the expression of M2- 
35 HBc fusion proteins in a Western blot. An equivalent of 2 
to 3xl0 9 L. lactis bacteria of strain MG1363 containing 
respectively pTIHBc (control), pTlPM2HBc, pTlPM2LHBc 
(expression of IPM2HBcm) , pTlM2HBc, pTlM2LHBc (expression 



WO 99/07839 PCT/EP98/051 06 

15 

of IM2HBcm) , was separated on a SDS 12.5% PAGE -gel . The 
fusion proteins were detected with an IgG fraction of a 
polyclonal mouse anti-M2e antibody (see Materials and 
methods) . The bound antibodies were detected with a 
5 1/2000 dilution of the alkaline phosphatase conjugated 
polyclonal anti-mouse IgG (y-chain specific) (Southern 
Biotechnology Associates, Birmingham, AL. , USA). 
MW= molecular weight marker, 
C = control, 

10 E = leucine codons optimal for use in E. coli . and 
L = leucine codons optimal for use in L. lactis . 
These are the plasmids pTlPM2LHBc and pTlM2LHBc, 
respectively. I(P)M2HBc stands for either IPM2HBcm or 
IM2HBcm. 

15 Figure 17 : Overview of the oligonucleotides 

used for PCR amplification of the extracellular part of 
the M2 protein and C3d. 

's' or 'a 1 following the code name of the oligonucleotide 

stands for the use of these primers in the sense (s) or 
20 anti-sense (a) orientation. The boxed region indicates 

the changed Leu codons. 

Figure 18 : Overview of the construction of 

m2c3d3 fusions in L. lactis . 

ori = origin of replication for E. coli , 
25 ori(+) = origin of replication for L. lactis , 

ermA and ermM = erythromycin resistance genes, 

PI = L. lactis promoter, 

bla = S- lactamase, 

M2e = extracellular part of the M2 protein, 
30 usp45-ss = signal sequence of usp45, 

spaX = anchor sequence derived from Staphylococcus aureus 
protein A, 

C3d = complement protein 3 fragment d, and 
mIL6 = murine interleukin 6. 
3 5 Figure 19 : Overview of the oligonucleotides 

used for PCR amplification of ttfc and m2ttfc. 
's' or 'a' following the name of the oligonucleotide 
stands for the use of these primers in the sense (s) or 



WO 99/07839 PCT/EP98/051 06 

16 

anti- sense (a) orientation. The boxed region indicates 

the changed Leu codons . 

Figure 20 : Overview of the construction of 

m2ttfc in vectors for L . lactis . 
5 ori = origin of replication for E. coli , 

ori(+) = origin of replication for L. lactis . 

ermM and ermpt = erythromycin resistance genes, 

PI = L. lactis promoter, 

bla = &- lactamase, 
10 TTFC = tetanus toxin fragment C, 

M2e = extracellular part of the M2 protein, 

usp45-ss = signal sequence of usp45, 

mIL2 = murine interleukin 2, and 

mIL6 = murine interleukin 6 . 
15 Figure 21 : Analysis of the expression of 

IPM2TTFC fusion protein in a Western blot. An equivalent 

of 10 9 L. lactis bacteria of strain MG13 63 containing 

respectively pTITT (control) , pTlPM2LTT (expression of 

IPM2TT) , pTlPM2LTTIL2 (expression of IPM2TT in 
20 combination with mIL2) or pTlPM2LTTIL6 (expression of 

IPM2TT in combination with mIL6) , was analyzed in a SDS 

10% PAGE -gel . The first antibody, an IgG fraction of a 

polyclonal mouse anti-M2e antibody (see Materials and 

methods) was diluted 2500 times. The bound antibodies 
25 were detected with a 1/2000 dilution of the polyclonal 

anti -mouse IgG labeled with horseradish peroxidase 
(Southern Biotechnology Associates, Birmingham, AL., 

USA) . 30 mg 4 -chloro-l-naphthol (Sigma Chemical Co., St. 

Louis, Mo., USA), was dissolved in 10 ml methanol. 
30 Afterwards 40 ml PBS, pH 7.4 and 150 /xl H 2 0 2 was added. 

MW = molecular weight marker, 

- = expression of the antigen alone, 

mIL2 = expression of the antigen in combination with 
mIL2 , 

35 mIL6 = expression of the antigen in combination with 
mIL6 . 



WO 99/07839 PCT/EP98/05106 

17 

Figure 22 : Primer set used for PCR 
amplification of the secretion signal of the gp67 
baculovirus protein. 

Figure 23 : Primer set used for PCR 
5 amplification of the extracellular part of the M2 protein 
during construction of the sgpM2C3d3 fusion. 

Figure 24 : Construction of the baculovirus 
transfer vector pACsgpM2C3d3 . 
bla = ^-lactamase, 
10 bold grey line = baculovirus homology region, 
C3d = complement protein 3 fragment d, 
M2e = extracellular part of the M2 protein, 
ori = origin of replication, 
phP = baculovirus polyhedrin promoter, and 
15 sgp67 = secretion signal of the gp67 baculovirus protein. 

Figure 25 : Detail of nucleotide and amino acid 
key sequences of the sgpM2C3d3 fusion. 
C3d = complement protein 3 fragment d, 
M2e = extracellular part of the M2 protein, and 
20 sgp67 = secretion signal of the gp67 baculovirus protein. 
Figure 26 : Analysis of recombinant 
AcNPV/sgpM2C3d3 baculovirus by PCR amplification of the 
polyhedrin locus (primers TTTACTGTTTTCGTAACAGTTTTG and 
CAACAACGCACAGAATCTAG) . Control reactions were performed 
25 with the parental transfer vector pACsgpM2C3d3 and with 
wild type AcNPV baculovirus. 
M = DNA size markers. 

Figure 27 : Expression of secreted M2C3d3 by 
Sf 9 insect cells infected with recombinant 
30 AcNPV/ sgpM2C3d3 baculovirus as demonstrated by Western 
analysis (10% PAGE-gel) of harvested supernatant. 
Supernatant from mock infected cells or obtained after 
infection with wild type AcNPV baculovirus are included 
as a control. 
35 MW = molecular weight markers. 

Figure 28 : Overview of the survival of mice 
after a lethal challenge with 5 LD m.a. X47. Mice 



WO 99/07839 



PCI7EP98/05106 



18 



vaccinated with 3x10 fig IM2HBcm are compared with 
passively immunized mice (P) . 



constructs . 
5 RT = reverse transcriptase 

PCMV = cytomegalovirus promoter 

bla = S- lactamase 

npt = neomycin resistance. 



10 on a Western blot. The first antibody (paM2 (see 

Materials and Methods)) was diluted 2000 times. The bound 
anti-M2 antibodies were detected with an alkaline 
phosphatase labelled anti -mouse IgG. 
MW = molecular weight marker 

15 M2 = M2 protein expressed in insect cells 

1 = pCDNA3 

2 = pCIM2 

3 = pCIM2HBcm 

4 = pCIP3M2HBcm. 

20 Figure 31 : Antibody response against the M2 

protein analyzed in an ELISA. 

A. Microti terplates were coated with periplasm 

containing hB2M or IPM2hB2M respectively (see Materials 

and Methods) . . 
25 B. Microtiterplates coated with M2 protein 

expressed in insect cells (see Materials and Methods) . 



Figure 29 



Overview of the DNA vaccination 



Figure 30 : Expression in HEKT cells analyzed 



30 



1 LD, 



so 



The following abbreviations will be used: 
: lethal dose, the viral challenge required 
to kill half of the population of infected 



mice 



35 C3d 



BCIP 



bp 



HAU 



hB2M 



CIP 



DEA 



5 -bromo-4 - chloro- 3 - indolylphosphate 
base pair(s) 

calf intestine phosphatase 
complement protein 3 fragment d 
diethylamine 
hemagglutination units 
human £2 -microglobulin 



WO 99/07839 



PCT/EP98/05106 



19 



HBc 

IM2HBcm 

IPM2hB2Mm 

IPM2HBC 



10 



IPM2HBcm 



IPTG 
m.a. 
15 M2C3d3 

cM2C3d3 
sM2C3d3 
sM2C3d3X 



20 



25 



MES 
MP LA 
NBT 

OmpA-ss 
PGR 

SDS-PAGE 



TDM 
30 phP 
sgp67 



Hepatitis B core protein 

universal influenza A M2 protein fragment 
fused to HBc 

influenza A M2 protein fragment (from 
A/PR/8/34) fused to hB2M 
influenza A M2 protein fragment (from 
A/PR/8/34), fused to HBc, containing four 
additional amino acids between the first 
methionine and the start of the 
extracellular part of the M2 protein 
influenza A M2 protein fragment (from 
A/PR/8/34) fused to HBc 
isopropyl-S-D-thiogalactoside 
mouse adapted 

universal influenza M2 fragment fused to 
three copies of C3d 
cytoplasmic form of M2C3d3 
secreted form of M2C3d3 

form of M2C3d3 covalently attached to the 
cell wall 

2- (N-morpholino) ethanesulphonic acid 

monophosphoryl lipid A 

nitro blue tetrazolium 

signal sequence of the outer membrane 

protein A 

polymerase chain reaction 

sodium dodecylsulf ate polyacrylamide gel 

electrophoresis 

trehalose dicorynomycolate 

baculovirus polyhedrin promoter 

secretion signal of the baculovirus gp67 

protein 



35 EXAMPLE 

INTRODUCTION 

This example demonstrates the preparation of 
various fusion antigens based on the influenza A virus M2 



WO 99/07839 PCT/EP98/05106 

20 

protein. The M2 fragment was fused to the amino terminus 
of various presenting carriers. 



MATERIALS AND METHODS 

5 1 . Bacterial strains and plasmids 

All plasmid constructions, made for expression 
in Escherichia coli . were performed in strain MC 1061 
(hsdR mcrB araD139A (araABC-leu) 7697 AlacX74 galU galK 
rpsL thi (Casadaban and Cohen, 1980) because of high 

10 efficiency of transformation. The first transformation 
after mutagenesis was performed in WK6XmutS (Adac- 
proAB) , galE, strA, mutS : : TnlO/lacI q , ZAM15 , proA + B* ; Zell 
and Fritz, 1987) . Expression studies of human S 2 - 
microglobulin and derivatives were performed in E. coli 

15 strain C3000 (Hfr, sup', thi (A - )). Expression studies of 
the Hepatitis B core protein and derivatives were carried 
out in MC1061 [pcI857] . 

pcI857 was described in Remaut et al., 1983b. A 
derivative of this plasmid pcI857Kl was described in 

20 Steidler et al . , 1994. 

The plasmid p714 (Parker and Wiley, 1989) was a 
kind gift of Dr. K. Parker and the plasmid pPLcAl 
(Nassal, 1988) of Dr. M. Nassal . The plasmid pPLc245 was 
described in Remaut et al . , 1983a. 

25 For the constructions and expressions in 

Lactococcus lac t is strain MG1363 (Gasson, 1983) was used. 
The vector for constitutive expression in L. lactis , 
pTREXl (Wells and Schofield, 1996) was a generous gift 
from Dr. K. Schofield. The plasmid pL2MIL2, for the 

30 expression of interleukin 2, is described in Steidler et 
al . , 1995. An analogous plasmid for the expression of 
interleukin 6, pL2MIL6, is described in Steidler et al . , 
1996. 

The vector pSG5.C3d.YL (Dempsey et al . , 1996) 
35 is a gift from Dr. Fearon. 

The baculovirus transfer vector pACGP67A 
(Pharmingen, San Diego, CA, USA) contains a modified 
segment of the baculovirus genome, including the 



WO 99/07839 PCT/EP98/05106 

21 

polyhedrin promoter followed by the secretion signal 
derived from the gp67 baculovirus protein and a cloning 
site for the insertion of a foreign gene sequence. It is 
constructed to allow integration into the baculovirus 
5 genome (or modified version thereof) by homologous 

recombination. The resulting recombinant baculovirus is 
capable of expressing the gene of interest from the 
polyhedrin promoter as a secreted protein by cleavage of 
the gp67 secretion signal. 

10 

2 . Virus 

Influenza virus A/PR/8/34 (H1N1) was adapted to 
mice by several lung passages. After adaptation, the 
virus was grown in eggs (Kendal et al, 1982) and purified 

15 over a sucrose gradient. The titer [(hemagglutination 
units (HAU) (Hirst, 1941; Kendal et al, 1982)] and the 
lethality in mice were determined. For m. a. A/PR/8/34, 1 
LD 50 corresponded to 10 HAU present in 50 /xl . 

Influenza strain X-47 (H3N2) (Baez et al., 

20 1980) was used in experiments for heterologous challenge. 
This strain was adapted to mice by several lung passages. 

3 . Animals 

Female Balb/c mice were purchased from Charles 
25 River Wiga (Sulzfeld, Germany) . The mice were used at the 
age of 6 to 7 weeks . 

4. Antibodies 

The monoclonal mouse antibody directed to the 
30 Hepatitis B core protein was a kind gift from Dr. Sc. H. 

Claeys (Bloedtransf usiecentrum, Leuven) . 

A mouse monoclonal antibody specific for the 

human ^-microglobulin was purchased from Boehringer 

(Mannheim, Germany) . 
35 Alkaline phosphatase conjugated antibodies 

specific for mouse IgG or mouse IgG (y chain specific) 

were bought from Sigma Chemical Co. (St. Louis, Mo., 

USA) . 



WO 99/07839 



22 



PCT/EP98/05106 



5. Growth media 

E. coli was grown in LB medium (1% tryptone, 
0.5% yeast extract and 0.5% NaCl) unless mentioned 
otherwise. The minimal M9 medium (Miller, 1972), 
5 supplemented with 0.2% casamino acids, was used in 
experiments when the expressed proteins were secreted 
into the growth medium and had to be purified. 

M17 growth medium (Difco Laboratories, Detroit, 
MI, USA)) supplemented with 0.5% glucose (GM 17) was used 
10 for culturing L. lactis . Erythromycin was used at a 
concentration of 5 /xg/ml (medium GM17E) . L. lactis was 
grown at 28 °C without shaking. 

The hybridomas and the myeloma cells were grown 
in RPMI 1640 (Gibco BRL, Bethesda, Md., USA) supplemented 
15 with 10% fetal calf serum, 0.3 mg/ml L-glutamine, 0.4 mM 
sodium pyruvate, 100 u/ml penicillin and 100 ng/ml 
streptomycin. 

Sf 9 insect cells were grown in TCI 00 medium 
(Gibco BRL, Bethesda, MD, USA) supplemented with 10% 
20 fetal calf serum, 100 U/ml penicillin and 100 ng/ml 
streptomycin. 

6. Adjuvants 

For the first immunization Ribi adjuvant (Ribi 
25 Immunochem Research Inc., Hamilton, MT, USA) was used. A 
complete dose of Ribi adjuvant contains 50 fig MPLA 
(monophosphoryl lipid A) , 50 /xg TDM (trehalose 
dicorynomycolate) , 2% squalene and 0.01% Tween 80. 

For the second and third immunization MPLA 
30 (Ribi Immunochem Research Inc., Hamilton, MT, USA) was 
used alone or mixed with an equal quantity of adjuvant 
peptide (Sigma Chemical Co., St. Louis, Mo., USA). 

7. DNA manipulations 

35 Restriction enzymes, DNA polymerases, T4 

polynucleotide kinase and T4 DNA ligase (Boehringer, 
Mannheim, Germany; Gibco BRL, Bethesda, Md. USA, or New 
England Biolabs, Beverly, MA, USA) were used as 



WO 99/07839 



PCT/EP98/05106 



23 

recommended by the manufacturer. For analytical purposes, 
plasmid DNA was extracted according to Birnboim and Doly 
(1979) . For preparative purposes, plasmid DNA was 
isolated according to Kahn et al . (1979). Restriction 
5 fragments of DNA were isolated by the Geneclean method 
according to Vogelstein and Gillespie (1979) and Struhl 
(1985) . The required materials were purchased from Bio 
101 (La Jolla, CA. , USA). For the isolation of plasmid 
DNA out of L. lactis . a pretreatment of the bacteria is 

10 necessary to weaken the cell wall. The bacterial pellet 
was resuspended in 50 /il TE (10 mM Tris-HCl pH 8 - 1 mM 
EDTA) . Afterwards, another 50 fil TE, supplemented with 10 
mg/ml lysozyme (Boehringer, Mannheim, Germany) and 200 
u/ml mutanolysin (Sigma Chemical Co., St. Louis, Mo., 

15 USA) was added. This mixture was incubated for 10 min at 
37°C and then put on ice for 5 min. Further treatments 
were identical to those used for plasmid isolation from 
E. coli. 

For all constructions in L. lactis purified 
20 plasmid DNA (Qiagen, Hilden, Germany) was used. The DNA 
fragments were purified from agarose gels by using Qiaex 
II (Qiagen, Hilden, Germany) . 

8. PCR amplification 

25 All PCR reactions were carried out following a 

basic protocol. In each reaction about 50 ng pure 
template and 50 pmol sense and anti- sense 
oligonucleotides (Life Technologies, Paisley, UK) were 
used. Two units Vent R ® DNA polymerase (New England 

30 Biolabs, Beverly, MA. , USA) were added after heating of 
the samples to 94 °C. The annealing temperature (T a ) was 
set, according to the composition of the primer, at about 
7°C below the melting temperature (TJ . In these PCR 
amplifications the best results were obtained at 60°C. 

3 5 The synthesis of hbc and the fusion genes ipm2hbc and 
im2hbc, was carried out for 45 seconds at 72 °C. The 
synthesis of the sequence, coding for the extracellular 
part of the M2 protein (cm2 and sm2 ) , was left for 20 



WO 99/07839 



PCT/EP98/05106 



24 

seconds at 72 °C. A total of thirty amplification rounds 

were performed. The control reactions did not contain 

oligonucleotides. Three different concentration of MgS0 4 

were used, 2, 3 and 4 mM. The PCR reaction that produced 
5 a significant amount of the expected fragment under the 

most stringent conditions (lowest Mg 2+ concentration and 

highest TJ was used for further cloning. 

The C3d3 fragment was amplified from 

pSG5.C3d.YL with the oligonucleotides C3ds and C3da using 
10 Pwo DNA Polymerase (Boehringer, Mannheim, Germany) . The 

annealing temperature was set at 60°C and the synthesis 

was performed for 2 min at 72 °C. 

Amplification of the baculovirus gp67 secretion 

signal was done with Taq polymerase (Boehringer Mannheim, 
15 Germany) from pACGP67A using the primers GP67s en GP67a. 

A total of 25 cycli were performed with synthesis at 72°C 

for 1 min. 

9. Ligation 

20 The ligations for L. lactis were performed with 

Ready-To-Go™ T4 DNA Ligase (Pharmacia Biotech, Uppsala, 
Sweden) . After incubation for lh at 20°C, the mixture was 
extracted with phenol (Life Technologies, Paisley, UK) 
and chlorof orm/iso-amyl alcohol (24/1). The DNA was 

25 precipitated with see-DNA (Amersham International, 

Buckinghamshire, UK) . The complete resuspended pellet was 
used for electroporation (Wells et a]., 1993). 

10. Protein purification media 

30 All chromatography media were purchased from 

Pharmacia Biotech (Uppsala, Sweden) , except CF11 
cellulose, which was purchased from Whatman International 
Ltd. (Maidstone, UK). 

35 11 . Protein gel 

Protein samples were analyzed by SDS- 
polyacrylamide gel electrophoresis (SDS-PAGE) according 
to Laemmli, 1970. After electrophoresis, the proteins 



WO 99/07839 



PCT/EP98/05106 



25 

were fixed with 10% trichloroacetic acid and stained with 
0.05% Coomassie brilliant blue R-250 in destain. Excess 
dye was removed by incubating the gel in destain (30% 
methanol - 7% acetic acid) . The gel was soaked in 40% 
5 ethanol before it was dried between two sheets of 
permeable cellophane. 

12 . Western blot and dot blot 

For immunological characterization, proteins 

10 were electrophoretically transferred from a SDS-PAGE-gel 
onto a nitrocellulose membrane (pore diameter 0.45 tim, 
Schleicher & Schuell, Dassal, Germany) with a dry 
blotting apparatus (Plexi-labo, Gent, Belgium) . The 
filter was blocked for at least 2h in PBS pH 7.4 (14.5 mM 

15 phosphate buffer pH 7.4 - 150 mM NaCl) with 2.5% skim 
milk powder and 0.1 % Triton X-100 (blocking buffer). 
Incubation with the primary antibody, diluted in blocking 
buffer, was carried out at room temperature for 30 to 60 
min. Excess of unbound antibody was removed by three 

20 washings with blocking buffer. The bound antibodies were 
detected with an alkaline phosphatase conjugated antibody 
of the appropriate specificity. Subsequently, the filter 
was washed two times with PBS pH 7.4 - 0.1% Triton X-100. 
A third washing step was carried out with substrate 

25 buffer (100 mM Tris-HCl pH 9 . 5 - 100 mM NaCl - 5 mM 

MgCl 2 ) . The filter was then incubated in substrate buffer 
with 165 /ig/ml nitro blue tetrazolium (NBT) and 165 /zg/ml 
5-bromo-4-chloro-3-indolylphosphate (BCIP) until a clear 
signal appeared. The blot was finally washed thoroughly 

30 with tap water and dried. 

The dot blot analysis was carried out in a 
similar way as the Western blot, except that the proteins 
were not transferred through electrophoresis, but by 
filtering the samples through a nitrocellulose membrane. 

35 

13. ELISA 

In every ELISA a 0.1 % casein solution was used 
for blocking and for making the dilutions of the 



WO 99/07839 PCT/EP98/05106 

26 

antibodies used. The stock solution of casein (2.5%) was 
prepared as follows: 6.25 g casein powder was dissolved 
in 200 ml 300 mM NaOH by overnight stirring at 37°C. Then 
the pH was adjusted to 7.0 by adding 2N HC1 . The final 
5 volume was brought to 250 ml (Nunc bulletin no. 7, 
December 1989) . Sodium azide (0.02%) was added as a 
preservative . 

Different ELISA's were developed to determine 
the concentration of Hepatitis B core or human £2- 

10 microglobulin fusion proteins. Microtiter plates (type II 
F96 maxisorp Nunc A/S, Roskilde, Denmark) were coated for 
1.5 h at room temperature or overnight at 4°C with a 1/2 
dilution series of samples containing IPM2HBcm or 
IPM2hB2Mm. On the same plate, a 1/2 dilution series of 

15 purified HBc or hB2M, respectively, starting from 2 

/xg/ml, was used as a standard. Between every incubation 
step, the plates were washed twice with tap water and 
once with PBS, pH 7.4 - 0.05% Triton X-100, except that 
after blocking, the plates were not washed. The 

20 microtiter plates were blocked with 0.1% casein solution 
for 2h at room temperature or at 4°C overnight. As 
primary antibody we used mouse ant i- HBc or mouse anti- 
hB2M, respectively. The bound antibodies were detected 
with an alkaline phosphatase labelled ant i -mouse IgG (y 

25 chain specific) antibody. The incubation with antibody 
solution was carried out at room temperature for 1.5 h. 
Finally the microtiter plates were incubated for 1 h with 
substrate buffer (10% diethanolamine - 0 . 5 mM MgCl 2 - 
0.02% NaN 3 pH 9.8) containing 1 mg/ml p-nitrophenyl 

30 phosphate. The absorbance was measured at 405 nm and the 
wave length of 490 nm was used for normalization. 

14. Preparation of polyclonal anti-M2 

All mice, which had been immunized with 
3 5 IPM2HBcm and had survived the lethal challenge with m.a. 
A/PR/8/34 influenza A virus (see results, immunization) 
were anaesthetized with 250 fil 25 mg/ml tribromoethanol 
(injected i.p.) and blood samples were taken by heart 



WO 99/07839 



PCT/EP98/05106 



27 

puncture. The serum was isolated as described 
hereinbelow. The crude serum gave a high background in 
Western blot, therefore an IgG fraction was prepared. The 
crude serum was filtered through a 0.45 fim filter 
5 (Millipore Millex-HV, Millipore, Bedford, MA, USA) and 
diluted 10 times in loading buffer (PBS - 10 mM EDTA, pH 
8) . This mixture was loaded on an equilibrated Protein G 
Sepharose 4 Fast Flow column (<f> = 1 cm, h = 8 cm) , The 
bound IgG molecules were eluted with 100 mM glycine-HCl, 
10 pH 2.7. Fractions of 1 ml were collected in tubes 

containing 50 fxl 1 M Tris-HCl pH 9.5 to bring the pH to 
neutral . 

The quantity of anti-M2 antibodies in the 
pooled peak fractions was 2.6 fxg/ml . This was determined 
15 in an ELISA, comparable to the detection of anti-M2 
antibodies in the serum of immunized mice. Mouse 
monoclonal anti-human £2 -microglobulin (Cymbus 
Bioscience, Southampton, UK) was used as a standard. 

20 15. Serum preparation 

Five blood samples were taken from every mouse: 
the pre-immune serum (a) , the serum taken after the first 
(b) , after the second (c) and after the third (d) 
immunization, and the serum taken after challenge (e) . 
25 This blood was incubated for 30 min at 37°C. The samples 
were then placed on ice for at least 1 hour and 
centrifuged two times 5 min at 16000 g in a 
microcentrifuge. The serum was isolated. 

Equal volumes of sera obtained from different 
3 0 mice were pooled for the analysis of antibody production. 

16. RT-PCR 

Allantoic fluid of A/Ann Arbor/6/60 (215 HAU) 
was incubated in AMV buffer (Boehringer, Mannheim, 
35 Germany) at 65°C for 30 min. 1/20 of this mixture was 
used for the reverse transcriptase (RT) reaction. Too 
this vRNA (genomic viral RNA) mixture 50 /zmol 
oligonucleotide (RT-NTRNA7) , 10 mM DTT and 2.5 mM dNTP 



WO 99/07839 



PCT/EP98/05106 



28 

was added. After an incubation of 10 min at 70°C, 20 
units of AMV reverse transcriptase (Boehringer, Mannheim, 
Germany) and 40 units of RNase inhibitor (Boehringer, 
Mannheim, Germany) were added. The RT reaction was done 
5 at 42 °C for 1 h. 1/3 of this reaction mixture was used 
for the PCR reaction as described earlier. 

17. Transfection and expression 

HEKT cells were put in a 6 well plate at 2xl0 5 
10 cells/well and grown for 24 h. 2 fig pDNA with FuGene TM 6 
Transfection reagent (Boehringer, Mannheim, Germany) was 
added to the cells. 48 h after transfection the cells 
were lysed in 100 /il PBS, pH 7.4 - 5 mM EDTA - 0.5% 
Nonidet P40. The soluble fraction was isolated after 5 
15 min centrif ugation at 10,000 g. The pellet was 
resuspended in 100 fil PBS, pH 7.4. 

18. DNA vaccination 

Plasmid DNA was used at a concentration of 1 
20 fig/ ill. Three intramuscular injections were given at three 
weeks intervals. Serum was taken two weeks after every 
immunization, pooled and analyzed in an ELISA for 
antibody response towards the extracellular part of the 
M2 protein (see Materials and Methods hereinabove) . 

25 

19. ELISA II 

Microtiterplates were coated with 1 /xg/ml M2, expressed 
in Sf9 insect cells (Black et al., 1993a, b) . The 
remainder of the procedure was as described in the 
30 earlier section of Materials and Methods. 

20 . List of plasmids 
20 . 1 E. coli 

pATIPM2ml : plasmid that contains the uninterrupted 
35 m2 gene from A/PR/8/34 

pIPM2hB2Mm2s2 : plasmid for the expression of 
IPM2hB2Mm, with the correct amino terminus of M2 



WO 99/07839 PCT/EP98/05106 

29 

pPLcIPM2HBc : expression plasmid for IPM2HBc, with 
four amino acids between the initiating methionine 
and the amino terminus of M2e 

pPLcIPM2HBcm : expression plasmid for IPM2HBcm, with 
5 the correct amino terminus of M2e. Sequence of M2 is 

derived from A/PR/8/34 

pPLcIM2HBcm : expression plasmid for IM2HBcm, with 
the correct amino terminus of the universal M2 

10 20 . 2 L. lactis 

pTITT : plasmid for the expression of TTFC 
pTlPM2LTT : expression of IPM2TT, with leucine 
codons adapted for L. lactis . Sequence of M2e is 
derived from A/PR/8/34 

15 pTlPM2LTTIL2 : expression of IPM2TT, with adapted 

leucine codons, in combination with mIL2 
pTlPM2LTTIL6 : plasmid for the expression of IPM2TT, 
with adapted leucine codons, in combination with 
mIL6 

20 pTIHBc : plasmid for the expression of HBc 

pTlHBcIL2 : expression of HBc in combination with 
mIL2 

pTlHBcIL6 : expression of HBc in combination with 
mIL6 

25 pTlPM2HBc : plasmid for the expression of IPM2HBcm. 

Sequence of M2e is derived from A/PR/8/34 
pTlPM2HBcIL2 : expression of IPM2HBcm in combination 
with mIL2 

pTlPM2HBcIL6 : expression of IPM2HBcm in combination 
30 with mIL6 

pTlM2HBc : plasmid for the expression of IM2HBcm, 
with the universal sequence for M2e 
pTlM2HBcIL2 : expression of IM2HBcm in combination 
with mIL2 

35 pTlM2HBcIL6 : expression of IM2HBcm in combination 

with mIL6 

pTlPM2LHBc : plasmid for the expression of IPM2HBcm, 
with leucine codons adapted for L. lactis 



WO 99/07839 



PCT/EP98/05106 



pTlPM2LHBcIL2 : expression of IPM2HBcm, with adapted 
leucine codons , in combination with mIL2 
pTlPM2LHBcIL6 : plasmid for the expression of 
IPM2HBC, with adapted leucine codons, in combination 
5 with mIL6 

pTlM2 LHBc : expression of IM2HBcm, with leucine 
codons adapted for L. lactis 

pTlM2LHBcIL2 : expression of IM2HBcm, with adapted 
leucine codons, in combination with mIL2 
10 pTlM2LHBcIIi6 : expression of IM2HBcm, with adapted 

leucine codons, in combination with mIL6 
pTlcM2L : plasmid for the expression of the 
cytoplasmic form of M2e, with leucine codons adapted 
for L. lactis . 

15 pTlcM2LC3d : expression of cM2LC3d, with adapted 

leucine codons 

pTlcM2LC3d3 : expression of cM2LC3d3 (with three 
consecutive C3d domains) , with adapted leucine 
codons 

20 pTlsM2LX : plasmid f or the expression of the 

secreted and anchored form of M2e, with leucine 
codons adapted for L. lactis 

pTlsM2LC3d : expression of sM2LC3d, with adapted 
leucine codons 

25 pTlsM2LC3d3 : expression of sM2LC3d3 (with three 

consecutive C3d domains) , with adapted leucine 
codons 



20.3 

3 0 pUCM2 : plasmid that contains the 

uninterrupted m2 gene from A/Ann Arbor/6/60 
pCDNA3 : basic vector for eukaryotic gene 
expression 

pCIM2 : plasmid used for DNA vaccinations, it 

35 carries the uninterrupted m2 gene from A/Ann 

Arbor/6/60 

pCIM2HBcm : plasmid used for DNA vaccinations, it 
carries im2hbcm 



WO 99/07839 



PCT/EP98/05106 



31 

pCIP3M2HBcxa: plasmid used for DNA vaccinations, it 
contains three times the extracellular domain of the 
M2 protein genetically fused to the Hepatitis B core 
protein. The fusion protein, IP3M2HBcm starts with 
5 the correct amino terminus of M2e. Sequence of M2 is 

derived from A/PR/8/34. 

EXPERIMENTAL SECTION 

1. Construction of pATIPM2m 

10 The RNA segment 7 of the influenza A virus, 

A/PR/8/34 (H1N1) , was cloned by a procedure as described 
for RNA segment 4 in Min Jou et al., 1980. The resulting 
plasmid was named pATIPMA and is commercially available 
(LMBP catalogue 1992, no. 1774). 

15 The mRNA of the M2 protein is not a collinear 

transcript of RNA segment 7. Indeed, an intron of 689 
nucleotides had to be removed (Lamb et al . , 1981). 

In the plasmid pATIPMA, StuI cuts after the 
first nucleotide of the second exon (see figure la) . This 

20 nucleotide was included in the synthetic 

oligonucleotides, that were used to code for the first 
exon. The synthetic first exon, encoding the amino - 
terminus of the mature M2 protein, was designed to 
contain a single stranded GATC overhang at its 5' end. 

25 This allowed us to make the connection to a preceding 
BamHI site in the vector pATIPMA and to replace the 
original first exon. 

Furthermore codon usage was optimized for 
expression in E. coli . 

30 Next, we introduced, by site-directed 

mutagenesis (Stanssens et al., 1989), a Bell site at the 
junction between the extracellular part and the membrane 
anchoring region of the M2 protein (see figure 1 b) . The 
amino acid sequence of the extracellular part was not 

35 changed. The resulting plasmid, pATIPM2ml, carries the 
uninterrupted m2 gene of A/PR/8/34. 



WO 99/07839 



PCT/EP98/05106 



32 

2. Construction of IPM2hB2Mm 

Parker and Wiley (1989) expressed human £2- 
microglobulin in the periplasm of E. coli by making use 
of the plasmid p714. This plasmid contains the coding 
5 region for £2 -microglobulin preceded by the signal 
sequence of the outer membrane protein A of E. coli 
(OmpA-ss) (see figure 2a) . The OmpA signal sequence is 
required for the translocation of the protein, to which 
this sequence is fused, to the periplasm. The signal 

10 sequence is cleaved off after transport. On plasmid p714, 
human £2 -microglobulin is under control of both the 
lipoprotein (lpp) and lacUVB promoter. Addition of 1 mM 
IPTG to a mid-log phase culture leads to the production 
Of £2 -microglobulin. 

15 The coding sequence of the extracellular part 

of the M2 protein, isolated as a BamHI-BclI fragment from 
pATIPM2ml, was inserted between the signal sequence of 
ompA and the human £2 -microglobulin (for details see 
figure 2a) . Due to the construction, there were 9 

20 additional nucleotides between the end of the ompa signal 
sequence and the beginning of the m2 fragment, which had 
to be removed (see figure 2b) . This was done by looping 
out mutagenesis according to Nakamaye and Eckstein, 1986. 
As a result, the plasmid pIPM2hB2Mm2s2 was obtained. 

25 

3. Localization of the IPM2hB2Mm 

A freshly grown preculture of C3000 containing 
p714 or pIPM2hB2Mm2s2 was diluted 1/100 in LB with 
ampicillin. As described above, the hb2m and ipm2hb2mm 

30 genes are under control of the lacUV5 promoter. When the 
cultures reached a density of about 5.5xlO e bacteria/ml, 
they were divided in two and one half of each culture was 
induced with 1 mM IPTG. After 3 h induction, the bacteria 
were harvested and fractionated. The periplasm of the 

35 bacteria was isolated by osmotic shock (Neu and Heppel, 
1965) . The remainder of the bacteria was sonicated (Vibra 
cell, Sonics & Materials Inc., Danbury, Conn., USA) and 
centrifuged for 10 min at 16000 g, to isolate the 



WO 99/07839 



PCT/EP98/05106 



33 

cytoplasm. The different samples were analyzed on a SDS 
15% PAGE -gel . Human B2M and the fusion protein IPM2hB2Mm 
were transported to the periplasm, whereas the 
precursors, still containing the signal sequence, 
5 remained associated with the bacteria. Determination of 
the amino-terminus of the mature IPM2hB2Mm (by courtesy 
of Dr. J. Vandekerckhove) by automated Edman degradation 
on a model 470A gas-phase sequencer coupled to a model 
12 OA on-line phenyl thiohydantoin amino acid analyzer 
10 (Applied Biosystems, Foster City, CA. , USA), demonstrated 
that the OmpA signal sequence was correctly cleaved off. 

4. Purification of IPM2hB2Mm 

The fusion protein IPM2hB2Mm could be expressed 

15 efficiently in the periplasm of E.coli . Whereas 

performing an osmotic shock is a critical procedure, 
especially on large volumes, Steidler et al . (1994) 
previously described an elegant system, based on the 
controlled expression of the Kil protein, to release 

20 periplasmic proteins in the growth medium. 

The kil gene is present on a compatible plasmid 
under the tightly regulated P L promoter, the leftward 
promoter of phage X (Remaut et al, 1981) . The plasmid 
pcI857Kl also carries the temperature sensitive repressor 

25 of the P L promoter, cI857. The fusion protein IPM2hB2Mm is 
synthesized upon induction with 1 mM IPTG and at the end 
of the production phase, the culture is switched from 
28°C to 42°C to induce Kil. 

A fermentation (BioFlo IV fermentor, New 

30 Brunswick Scientific Co., Edison, N.J., USA) was carried 
out using the standard induction procedure described 
above. The culture was centrifuged in a contifuge 17RS 
(Heraeus Instruments, Hanau, Germany) at 11000 g and the 
growth medium was isolated. The sodium chloride 

35 concentration of the growth medium was adjusted to 300 mM 
and buffered with 20 mM MES (2-(N- 

morpholino) ethanesulphonic acid), pH 6.5. This solution 
was loaded on a DEAE Sephacel column (0 = 5 cm, h = 6.5 



WO 99/07839 



PCT/EP98/05106 



34 

cm), equilibrated with 20 mM MES, pH 6 . 5 - 300 mM NaCl . 
Under these conditions IPM2hB2Mm did not bind to the 
matrix. The ammonium sulphate concentration of the flow 
through was brought to 0.8 M with a 3.8 M (NH 4 ) 2 S0 4 
5 solution, pH 7. The mixture was loaded on a Phenyl 

Sepharose column (0=5 cm, h = 17 cm) , equilibrated in 
20 mM Tris-HCl, pH 7.5, 0.8 M (NH 4 ) 2 S0 4 . A decreasing 
ammonium sulphate concentration gradient starting from 
0.8 M and going to 0, did not release the bound fusion 

10 protein. This was achieved by eluting the column with a 
pH gradient from 20 mM Tris-HCl, pH 7 . 5 to 5 mM NaAc, pH 
5.5. The peak fractions were pooled and diluted ten times 
in 20 mM diethylamine (DEA) , pH 8.5. 

The complete mixture was loaded on a Sepharose 

15 Q column {<f> = 0.8 cm, h = 2.3 cm), equilibrated with 20 
mM DEA, pH 8.5. The protein was eluted from the column 
with a salt gradient from 0 to 1 M. The peak fractions 
were pooled and loaded on a Sephacryl S-100 gel 
filtration column (<f> - 1.5 cm, h 47 cm) . Only one peak 

20 with the expected molecular weight of about 15 kDa was 
observed. This purified IPM2hB2Mm was used to immunize 
mice for preparing hybridomas, secreting monoclonal 
antibodies directed against the M2 protein. 

25 5. Production of monoclonal antibodies to the M2 protein 
Balb/c mice were immunized three times with 
2.5 jug purified IPM2hB2Mm. For the first injection a 
complete dose of Ribi adjuvant was used. The second and 
third immunization were performed in the presence of 

30 50 //g MPLA. The injections were given with an interval of 
three weeks. Three days after the last immunization, 
spleen cells were isolated and fused with myeloma cells 
SP2/0-AG14 using standard protocols (Kohler and Milstein, 
1975) . Supernatant s from different immunoglobulin 

35 producing cell clones were tested in EL ISA and Western 
blot for reactivity against the other fusion protein 
IPM2HBcm (described further) . The Hepatitis B core 
protein alone was used as a control to eliminate false 



WO 99/07839 



PCT/EP98/05106 



35 

positive clones. The isotype of the antibody was 
determined (Isostrip, Boehringer, Mannheim, Germany) . Two 
different immunoglobulin subtypes that recognized the 
extracellular part of the M2 protein were obtained, an 
5 IgM and an IgG2a. Especially the IgG2a antibody was used 
in further experiments. 

6. Expression of HBc and IPM2HBcm 

Expression of proteins under control of the P L 

10 promoter was performed by shifting an exponentially 

growing culture from 28°C to 42°C (Remaut et al . , 1981). 
A saturated preculture of MC1061 [pcI857] containing the 
plasmid pPLc245 (control) , pPLcAl (carrying the hbc gene) 
or pPLcIPM2HBcm (containing the fusion gene ipm2hbc ) 

15 respectively, was diluted 1/100 in LB medium (50 /zg/ml 
kanamycin and 100 /xg/ml ampicillin) and grown for about 4 
h at 28 °C under shaking. When the cultures reached a 
density of 4.5xl0 8 to 5.5xl0 8 bacteria/ml, they were 
split, one half was incubated for 4 h at 28°C, the other 

20 half was switched to 42°C. The bacteria were concentrated 
by centrifugation (2 min at 16000 g in a 
microcentrifuge) . 

The culture medium was removed and the bacteria, 
were resuspended in TE buffer (10 mM Tris-HCl - 1 mM 

25 EDTA, pH 7.6). The bacteria were opened by sonication 
(Vibra cell, Sonics & Materials Inc., Danbury, Conn., 
USA) and the bacterial debris were pelleted for 10 min at 
16000 g in a microcentrifuge. The supernatant was 
isolated and the pellet was resuspended in TE buffer. The 

30 samples were analyzed on a SDS 12.5% PAGE-gel, in a 
Western blot and on a dot blot . 

7. Large scale production of IPM2HBcm 

The strain MC1061 [pcI857, pPLcIPM2HBcm] was 
35 grown in a BioFlo IV fermentor (New Brunswick Scientific 
Co., Edison, N.J., USA). When the culture reached a 
density of about 5.5x10 s cells/ml, the temperature was 
increased to 42 °C. After three hours of induction, the 



WO 99/07839 PCT/EP98/05106 

36 

culture was centrifuged in a contifuge 17RS (Heraeus 
Instruments, Hanau, Germany) at 11,000 g. The bacteria 
were collected and resuspended in a volume (in ml) buffer 
(50 mM Tris-HCl pH 8 - 150 mM NaCl - 5% glycerol with one 
5 protease inhibitor cocktail tablet (Complete™; 

Boehringer, Mannheim, Germany) per 25 ml) corresponding 
to two times the weight (in g) of the pelleted bacteria. 
This suspension was treated with 1 mg/ml lysozyme 
(freshly dissolved in 25 mM Tris-HCl, pH 8) for half an 

10 hour on ice. Subsequently, the bacteria were lysed with 
0.2% Triton X-100 in the presence of 25 mM EDTA, pH 8. 
After 30 min incubation on ice, the lysates were 
centrifuged for 1 h in a Sorvall SS-34 rotor (Du Pont 
Company, Wilmington, DE, USA) at 48000 g. The supernatant 

15 was removed and used for purification of IPM2HBcm. 

8. Immunization with IPM2HBcm 

Balb/c mice were injected three times 
intraperitoneally with purified IPM2HBcm in the presence 

20 of adjuvant. Control mice received only PBS buffer, pH 
7.4 and adjuvant. For the first immunization half a dose 
of Ribi adjuvant was used. In the second and third 
injection we used 25 /ig MPLA and 25 /xg MDP. 

Mice were immunized intranasally three times by 

25 applying a light ether anaesthesia, after which 50 
microliter antigen solution in PBS buffer (containing 
either 10 microgram IPM2HBcm or IM2HBcm without any 
adjuvant) is put in the nostril. 

30 9. Expression in L. lactis 

Single colonies from L. lactis strain MG 1363, 
containing the plasmid pTIHBc, pTlPM2HBc or pTlM2HBc, 
respectively, or the derivatives with mIL2 (pTlHBcIL2, 
pTlPM2HBcIL2 and pTlM2HBcIL2) or mIL6 (pTlHBcIL6, 

35 pTlPM2HBcIL6 and pTlM2HBcIL6) , were inoculated in 10 ml 
GM17E each. MG1363 [pTREXl] was used as control. The 
bacteria were grown for about 16 h at 28°C. The cells 
were collected by centrif ugation at 2000 g for 20 min 



WO 99/07839 



PCT/EP98/05106 



37 

(Sorvall 11 RT6000 D) . The growth medium was isolated and 
the bacteria were resuspended in 250 fxl TE. Following 
resuspension, an additional 250 pi TE supplemented with 
10 mg/ml lysozyme and 200 u/ml mutanolysin was added. 
5 This mixture was incubated for 10 min at 37°C and then 
put on ice for 5 min. Then 500 jil Laemmli sample buffer 
(100 mM Tris-HCl pH 6 . 8 - 5% SDS - 1 . 2M S-mercaptoethanol 
- 0.008% bromophenol blue - 16% glycerol) was added and 
the samples were boiled for 5 min. An equivalent of 1 ml 

10 original culture volume, or 10 9 bacteria was analyzed on a 
SDS 12.5% PAGE -gel . The production of mIL2 or mIL6 in the 
culture supernatant was evaluated in a bio-assay based on 
the proliferation of CTLL2-cells (mIL2, Gillis et al., 
1978) or the proliferation of a B-cell hybridoma, 7TD1 

15 (mIL6, Van Snick et al . , 1986). 

10. Passive immunization 

The purified preparation of IM2HBcm particles 
was used to immunize 7 weeks old female Balb/c mice. A 

20 total of 40 mice were immunized with 10 pg IM2HBcm. A 

control group of 4 0 mice only received buffer. A total of 
three injections combined with appropriate adjuvant were 
given at three weeks intervals (see Materials and 
Methods) . Two weeks after the third immunization 28 mice 

25 from each group were bled and serum was isolated (see 
Materials and Methods) . This serum was administered 
intraperitoneally to naive mice 24 h before infection. 
This process is called passive immunization. Twelve mice 
received 800 /il serum from IM2HBcm immunized mice and 

30 another 12 mice received serum from the control group. 
These 24 mice and the remaining 24 immunized mice were 
challenged with 5 LD 50 m.a. X47 three weeks after the 
third immunization. The virus was administered 
intranasally in a total volume of 50 [il after ether 

35 anaesthesia. Morbidity was followed by measuring rectal 
temperature and weight every other day. 



WO 99/07839 PCT/EP98/05106 

38 

11. Constructs for DNA vaccination (Fig. 29) 

The mammalian expression vector, pCDNA3 
(Invitrogen, Leek, The Netherlands) , which carries the 
cytomegalovirus promoter was used to make the different 
5 DNA vaccination vectors. 

The uninterrupted m2 gene was isolated by RT- 
PCR from the influenza A virus A/Ann Arbor/6/60 (see 
Materials and Methods) . The amplified fragment was cut 
with Bglll and Xbal and inserted into the Bglll and Xbal 

10 opened pUC19. This plasmid was called pUCM2 . The sequence 
of the m2 gene was determined and shown to correspond to 
the cold adapted form of the gene. The m2 gene was 
isolated from pUCM2 as a 321 bp EcoRI-Xbal fragment and 
inserted into the EcoRI and Xbal opened pCDNA3 . This 

15 resulted in plasmid pCIM2 . 

Two fusion genes, ip3m2hbcm and im2hbcm, were 
also inserted into pCDNA3 . The im2hbcm gene was amplified 
by PCR from pPLcIM2HBcm. This fragment was cut with Spel 
and phosphorylated with T4 polynucleotide kinase. This 

20 630 bp fragment was inserted in the EcoRV and Xbal opened 
pCDNA3 . The resulting plasmid was called pCIM2HBcm. 

During the construction of pPLcIPM2HBc (see 
figure 3a) plasmids were also obtained with two and three 
inserted M2e fragments. These plasmids were called 

25 pPLcIP2M2HBc and pPLcIP3M2HBc , respectively. The 

jp3m2hbcm gene was amplified by PCR from pPLcIP3M2HBc . 
This fragment was cut with Spel, phosphorylated with T4 
polynucleotide kinase and inserted in the EcoRV and Xbal 
opened pCDNA3 . This plasmid was called pCIP3M2HBcm. 

30 Plasmid DNA was isolated with an EndoFree 

Plasmid Giga kit (Qiagen, Hilden, Germany) . The 
concentration pDNA was determined by spectrophotometric 
analysis. 



35 12. Expression in HEKT cells 

The plasmids pCDNA3, pCIM2 f pCIM2HBcm and 
pCIP3M2HBcm were transfected to HEKT cells (see Materials 



WO 99/07839 PCT/EP98/05106 

. 39 

and Methods) . 48h after transfection the cells were lysed 
and analyzed in a Western blotting experiment. 



13 . Analysis of the serum 
5 Two weeks after every immunization serum 

samples were taken and analyzed in an ELISA. In panel A 
from figure 31 the two vectors, which can express the HBc 
fusion proteins are compared with the control vector. The 
ELISA was performed as described in Materials and Method. 

10 

RESULTS 

1. Construction of IPM2HBcm 

The plasmid pPLcAl (see figure 3a) contains the 
hepatitis b core (hbc) gene under control of the P L 

15 promoter of bacteriophage A (a gift from Dr. Nassal) . The 
346 bp Ncol-Xbal HBc fragment, isolated from pPLcAl, was 
inserted into the Ncol and Xbal opened pMa581, a 
derivative of pMa58. This plasmid was called pMaHBc . At 
the 5' end of the hepatitis B core, directly following 

20 the start codon, we introduced a BamHI site by site- 

directed mutagenesis (Stanssens et al . , 1989), correctly 
positioned in the reading frame of HBc {for details see 
figure 3a and b) . The resulting plasmid was named 
pMaHBcm. The information coding for the extracellular 

25 part of the M2 protein was cloned as a 72 bp BamHI-BclI 
fragment, derived from pATIPM2ml, into the BamHI opened 
pMaHBcm, resulting in the vector pIPM2HBc. The hbc gene 
in the expression vector pPLcAl was then replaced by the 
418 bp Ncol-Xbal m2hbc fragment, creating pPLcIPM2HBc. 

30 Due to the construction, four amino acids extra were 

present between the first methionine and the start of the 
extracellular part of the M2 protein and had to be 
removed (see figure 3c) . This was done by looping out 
mutagenesis (Deng and Nickolov, 1992) . The resulting 

35 plasmid was named pPLcIPM2HBcm (see figure 3a and c) . 



WO 99/07839 PCT/EP98/05106 

40 

2 . Expression of the fusion protein 

The plasmids pPLc245 (control), pPLcAl ( hbc 
gene) and pPLcIPM2HBcm ( ipm2hbc gene) were transformed to 
MC1061 [pcI857] . After culture and induction, the 
5 bacteria were lysed by sonication. The lysates were 

centrifuged and an aliquot of the supernatants was loaded 
on a SDS 12.5% PAGE -gel (see figure 4). The same 
fractions were also analyzed by a Western blot . Two 
different monoclonal antibodies were used : an antibody 

10 specific for the Hepatitis B core protein and a 
monoclonal antibody (IgG2a) directed against the 
extracellular part of the M2 protein. 

The monoclonal antibody against Hepatitis B 
core revealed two different bands (see figure 5A) , one 

15 corresponding to the Hepatitis B core protein and the 
other to the fusion protein. The latter protein has a 
lower mobility, corresponding to the insertion of the 
extracellular domain of the M2 protein. The presence of 
the M2 fragment was confirmed by using the antibody 

20 specific for the extracellular part of the M2 protein 
(see figure 5B) . 

The N- terminal amino acid sequence of IPM2HBcm 
was determined (Dr. J . Vandekerckhove) by automated Edman 
degradation on a model 4 70A gas -phase sequencer coupled 

25 to a model 12 OA on-line phenyl thiohydantoin amino acid 
analyzer (Applied Biosystems, Foster City, CA. , USA). 
This analysis revealed the N-terminal sequence Ser-Leu- 
Leu, which is exactly the same as the amino terminal 
sequence of the M2 protein of the influenza A virus 

30 (figure 6) . The first amino acid, methionine, was removed 
in E. coli . The amino -terminus of the fusion protein thus 
corresponds to that of the wild type M2 protein (table 1; 
Lamb et al. , 1985) . 

Hepatitis B core, also when expressed in E^_ 

3 5 coli, spontaneously associates to form particles, 
indistinguishable from the viral core particles 
circulating in the blood of Hepatitis B infected patients 
(Cohen and Richmond, 1982) . Clarke and co-workers (1987) 



WO 99/07839 



PCT/EP98/05106 



41 

showed that a peptide inserted at the amino terminus of 
the Hepatitis B core protein could be detected at the 
surface of the particle. 

Electron micrographs (Dr. G. Engler) showed 
5 that the IPM2HBcm fusion protein was able to form similar 
particles. To investigate whether the insertion of the 
extracellular part of the M2 protein resulted in the 
surface localization of this fragment, soluble fractions, 
containing HBc or IPM2HBcm, were loaded on a 

10 nitrocellulose membrane in a dot blot. The dot blots were 
treated with a monoclonal antibody directed against HBc 
or against M2 . Figure 7 clearly shows a signal in the 
soluble pPLcIPM2HBcm fraction, when revealed with the 
antibody directed against the M2 protein (panel B) . Since 

15 the soluble fraction is loaded in a native state onto the 
nitrocellulose membrane, we conclude that the epitope is 
located at the surface of the Hepatitis B core particle. 

3. Purification of IPM2HBcm 

20 The bacterial lysates were prepared as 

described in Materials and Methods. The concentration of 
Tris-HCl, pH 8 and NaCl were adjusted to 20 mM and 50 mM 
respectively. This mixture was loaded on a DEAE Sepharose 
column (<f> = 2.5 cm, h = 5.5 cm), equilibrated with 20 mM 

25 Tris-HCl, pH 8-50 mM NaCl . The fusion protein was not 
retained on the column. To the flow through 3.8 M 
(NH 4 ) 2 S0 4 , pH 7, was added to a final concentration of 1.2 
M. This mixture was incubated under stirring in the cold 
room during 16h. The precipitate was removed over a CF11 

30 cellulose column (<f> = 2.5 cm, h = 3.5 cm). The column was 
eluted with PBS, pH 7.4. The eluate of about 50 ml was 
concentrated in a Centiprep 30 (Amicon Corporation, 
Danvers, 111., USA) to 5 ml and loaded on a Sephacryl S- 
300 column {<f> = 2.5 cm, h = 91 cm), which was 

35 equilibrated with PBS, pH 7.4. The peak fractions were 
pooled and the concentration of IPM2HBcm was determined 
in an ELISA, The LPS content was assayed (LAL Coatest® 
Endotoxin purchased from Endosafe Inc., Charleston, SC., 



WO 99/07839 PCT7EP98/051 06 

42 

USA) and was sufficiently low (5 to 9 ng/50 fig IPM2HBcm) 
not to interfere with immunization. 

4. Immunization 
5 The purified preparation of IPM2HBcm particles 

was used to immunize 7 weeks old female Balb/c mice . Four 
different groups of 12 mice were evaluated. The first 
group received 50 fig IPM2HBcm, the second 10 fig, the 
third 5 fig and the fourth a control group, only received 

10 buffer with adjuvant. A total of three injections were 
given with the appropriate adjuvant. The injections were 
administered with three weeks interval. Three weeks after 
the last inoculation, the mice were challenged with 5 LD 50 
m.a. A/PR/8/34. The virus was administered intranasally 

15 in a total volume of 50 fil after ether anaesthesia. 
Morbidity was followed by measuring rectal temperature 
(figure 8 Al) and weight (figure 8 A2) every other day. 

All mice immunized with IPM2HBcm showed a 
significant degree of protection against the following 

20 influenza challenge. Depending on the administered dose, 
9 to 11 mice out of 12 survived the influenza infection, 
versus only 2 out of 11 for the control group (see figure 
8B) . 

2 5 5. Analysis of the serum samples 

One day prior to the first (bleeding a) and two 
weeks after every injection (bleeding b, c and d) blood 
samples were taken. Three weeks after the challenge, when 
the mice had recovered sufficiently from the influenza 

3 0 infection, a last blood sample (e) was taken. The serum 

was analyzed in an EL ISA (see Materials and methods) to 
identify IgG antibodies directed towards the 
extracellular part of the M2 protein. To do so, we made 
use of the other fusion protein, IPM2hB2Mm. One half of 
35 the microtiter plate was coated with human S2- 

microglobulin, the other half was coated with the fusion 
protein IPM2hB2Mm, both as unpurified culture 
supernatant. The concentration of IPM2hB2Mm used was 1 



WO 99/07839 



PCT/EP98/05106 



43 

/ig/ml. The same concentration of total protein was used 
in both set ups. Therefore, the hB2M content of the 
culture supernatant of bacteria expressing hB2M had to be 
adjusted to 1 fig/ml by adding purified hB2M (Sigma 
5 Chemical Co., St. Louis, Mo., USA) . Dilution series (1/3) 
of the different serum samples, starting from 1/50, were 
loaded on the hB2M and IPM2hB2Mm, coated wells. The ELISA 
was further developed as described in Materials and 
methods . 

10 To obtain the value for the specific reactivity 

towards the extracellular part of the M2 protein, the 
absorbance of hB2M at a given dilution was subtracted 
from the absorbance of IPM2hB2Mm of the corresponding 
dilution. Figure 9 clearly demonstrates a high antibody 

15 response to the extracellular part of the M2 protein, in 
the mice which received three injections with the 
vaccine. The titer in the serum was further increased 
after the challenge. 

2 0 6. Construction of IM2HBcm 

It is the aim of the present invention to make 
a universal vaccine against influenza A viruses. In the 
vaccination studies described above, we showed protection 
against the influenza virus from which the original M2 

25 sequence was derived, A/PR/8/34 (homologous protection) . 
The extracellular part of the M2 protein from this virus 
differs from most other viruses sequenced to date, by 
only one amino acid (see table 1) . Therefore, a construct 
was made in which the glycine at position 20 was changed 

30 to aspartic acid. 

To do so we made use of an intermediate vector 
in the construction of pPLcIPM2HBcm, pMaIPM2HBc2 (see 
figure 3a) . The plasmid pMaIPM2HBc2 does not yet contain 
the mutated m2 (deletion of 12 extra nucleotides) 

3 5 fragment, which starts at the first mature codon of the 

M2 protein. Therefore this fragment was isolated from 
pPLcIPM2HBcm by cutting with SgrAI and EcoRI . This 499 bp 
SgrAI-EcoRI fragment was cloned into the SgrAI and EcoRI 



WO 99/07839 



PCT/EP98/05106 



44 

opened vector pMaIPM2HBc2, which resulted in the 
construction of pMaIPM2HBc3 (see figure 10) . 

By site-directed mutagenesis according to Deng 
and Nickoloff (1992) the sequence of the extracellular 
5 part of the M2 protein was changed to the more universal 
M2 sequence (Gly20 -> Asp) . The new plasmid was called 
pIM2HBcm. The sequence was determined on a model 373A 
sequencer (Applied Biosystems, Foster city, CA. , USA) and 
shown to contain the desired mutation. The mutated M2 
10 fragment was isolated from pIM2HBcm as a 4 99 bp SgrAI- 
EcoRI fragment and reintroduced into, the expression 
vector pPLcIPM2HBcm, opened with SgrAI and EcoRI, to 
create pPLcIM2HBcm. 

15 7. Expression of IM2HBcm 

Strain MC1061 [pcI857] containing respectively 
pPLc245, pPLcAl, pPLcIPM2HBcm or pPLcIM2HBcm was cultured 
as described in the Experimental Section. The bacteria 
were collected and opened by sonication. The soluble 

20 fraction was isolated and the concentration of Hepatitis 
B core protein or the derived fusion proteins was 
determined in an ELISA. A soluble fraction containing 5 
fig HBc or I(P)M2HBcm was analyzed on a SDS 12.5% PAGE -gel 
(see figure 11) . The same fractions were also analyzed in 

25 a Western blot (see figure 12) . The proteins of interest 
were detected with an antibody directed against the 
Hepatitis B core protein or with the monoclonal antibody 
specific for the extracellular part of the M2 protein. It 
can be concluded that the new fusion protein, IM2HBcm, is 

30 expressed as efficiently as IPM2HBcm. Moreover the amino 
acid change in the extracellular part of the M2 protein 
(Gly20 --> Asp) has no effect on the binding of the 
monoclonal anti-M2 antibody. 

3 5 8. Immunization against heterologous challenge 

A similar procedure as described in point 4 was 
used to test the efficiency of IPM2HBcm and IM2HBcm to 
protect mice versus heterologous challenge with 



WO 99/07839 



PCT/EP98/05106 



45 

influenza. 10 microgram of IPM2HBcm or IM2HBcm (purified 
in an identical way as IPM2HBcm) was used for 
immunization. The mice were challenged with 30 HAU X-47. 

All mice immunized showed a significant degree 
5 of protection against the heterologous challenge. 8 (in 
case of IPM2HBcm, p<0.05) or 12 (in case of IM2HBcm, 
p<0.0001) mice out of 12 survived the influenza 
infection, versus only 2 out of 11 in the control group 
(figure 8C) . 

10 To test the effect of intranasal 

administration, the same procedure was followed, but 
instead of the intraperitoneal injection, the antigen was 
administered intranasally . Also in this case, the 
protection is evident: 12 (in case of IPM2HBcm, p<0.0001) 

15 or 11 (in case of IM2HBcm, p<0.001) mice out of 12 

survived the influenza infection, versus 2 out of 11 in 
the control group (figure 8D) . 

9. Construction of vectors for the expression of M2-HBc 

20 fusion proteins in L. lactis 

The plasmid pTREXl (Wells and Schofield, 1996) 
was used to express the Hepatitis B core protein and two 
M2-HBC fusion proteins, IPM2HBcm and IM2HBcm, in 
Lactococcus lactis . This plasmid has a constitutive 

25 lactis chromosomal promoter, PI, which is followed by the 
translation initiation region of the E. coli 
bacteriophage T7 gene 10 (Wells and Schofield, 1996) . The 
transcription terminator is derived from T7 RNA 
polymerase . The plasmid pTREXl also carries two genes for 

3 0 resistance to erythromycin. 

The expression plasmid, pTREXl, was cut with 
SphI, leaving a 3 ! CATG extension which was removed with 
Klenow DNA polymerase. The removed nucleotides were 
included in the sense linker for PCR amplification of the 

35 different genes. The linearized vector was then cut with 
BamHI and treated with CIP (calf intestine phosphatase, 
Boehringer, Mannheim, Germany) . 



WO 99/07839 PCT/EP98/05106 

46 

The genes hbc , ipm2hbc and im2hbc were 
amplified by PCR (see Materials and methods) . The anti- 
sense linker (HBca) was identical in all amplifications 
and provided a Spel and a Bell site after the stop codon 
5 (see figure 13) . For the amplification of ipm2hbc and 
im2hbc the same sense oligonucleotide (M2s) could be 
used, since the mutation Gly -> Asp in the extracellular 
part of the M2 protein is located further downstream. 

The amplification of hbc from pPLcAl was only 

10 possible after the vector had been linearized with Seal. 
The amplification reaction that produced a sufficient 
amount of fragment, under the most stringent conditions, 
was used for further cloning. The amplified fragment, 
hbc , ipm2hbc or im2hbc, was cut with Bell, phosphorylated 

15 with T4 polynucleotide kinase and inserted in the SphI 
and BamHI opened pTREXl (see figure 14) . The new plasmids 
were called pTIHBc, pTlPM2HBc (in which the extracellular 
part of the M2 protein is derived from the virus 
A/PR/8/34) and pTlM2HBc (in which the sequence of the 

20 extracellular part of the M2 protein corresponds to the 
type present in nearly all human influenza A viruses 
sequenced to date) , respectively. The sequence of the 
inserted fragment was determined on a model 373A 
sequencer (Applied Biosystems, Foster City, CA., USA) and 

25 shown to be correct. 

In view of using Lactococcus lactis as an 
improved vaccine delivery vehicle, two murine cytokines, 
interleukin 2 (mIL2) and interleukin 6 (mIL6) were 
inserted as second cistrons in the same operon as the 

30 antigen. In that way we could obtain bacteria expressing 
the antigen, e.g. IM2HBcm, together with secreted murine 
interleukin 2 or 6 . To obtain secretion of the 
interleukins into the growth medium, they were fused in 
frame to the lactococcal usp4 5 secretion signal peptide 

35 (van Asseldonk et a]., 1990). The plasmids pTIHBc, 
pTlPM2HBc and pTlM2HBc were cut with Spel and treated 
with CIP. The murine interleukin 2 gene was isolated as a 
572 bp Xbal-Spel fragment from plasmid pL2MIL2 (Steidler 



WO 99/07839 PCT/EP98/051 06 

47 

et al., 1995). This fragment was inserted into the Spel 
opened pTIHBc, pTlPM2HBc and pTlM2HBc giving rise to 
pTlHBcIL2, pTlPM2HBcIL2 and pTlM2HBcIL2 , respectively. 
In an analogous way the murine interleukin 6 gene was 
5 isolated as a 687 bp Xbal-Spel fragment from pL2MIL6 

(Steidler et al. , 1996) and inserted into the Spel opened 
vectors, pTIHBc, pTlPM2HBc and pTlM2HBc, to create 
pTlHBcIL6, pTlPM2HBcIL6 and pTlM2HBcIL6 , respectively. 

10 10. Expression of HBc and M2HBc in L. lactis 

Lactoccoccus lactis strain MG1363 (Gasson, 
1983) containing the plasmids for the expression of the 
antigen alone (pTIHBc, pTlPM2HBc and pTlM2HBc) or in 
combination with mouse interleukin 2 (pTlHBcIL2 

15 pTlPM2HBcIL2 and pTlM2HBcIL2 ) or mouse interleukin 6 

(pTlHBcIL6 # pT!PM2HBcIL6 and pTlM2HBcIL6) were cultured 
as described in Materials and Methods. MG1363 [pTREXl] 
was used as control. 

An equivalent of 10 9 bacteria was analyzed by 

20 SDS 12.5% PAGE. The expression of the Hepatitis B core 
and the M2-HBc fusion proteins were analyzed by Western 
immunoblotting (see figure 15) carried out as described 
in Materials and methods. The expression of IM2HBc in 
MG136 3 [pTlM2HBcIL6] was not as high as in the other 

25 constructs. By screening different colonies a clone could 
be isolated with comparable expression levels. 

The production and secretion of interleukins 
into the growth medium was analyzed in a biological 
assay. The biological activity of mIL2 was assayed by the 

30 proliferation of a T-cell line, CTLL2 (Gillis et al . , 

1978) as compared to a human IL2 standard. The biological 
activity of mIL6 was measured by the proliferation of a 
B-cell hybridoma, 7TD1 (Van Snick et al., 1986). Table 2 
gives an overview of the level of interleukin 2 and 6 per 

35 ml culture medium produced by the different expression 
plasmids. The supernatant of cultures producing mIL6 did 
not lead to proliferation in a mIL2 assay and vice versa. 



WO 99/07839 



PCT/EP98/05106 



48 



Table 2 



Plasmid 


mIL2 production 


mIL6 production 


pTlHBcIL2 

pTlPM2HBcIL2 

pTlM2HBcIL2 


410 ng/ml 
481 ng/ml 
359 ng/ml 




pTlHBcIL6 

pTlPM2HBcIL6 

pTlM2HBcIL6 




1020 ng/ml 
772 ng/ml 
802 ng/ml 



10 11. Adaptation of the coding sequence of M2e to 

expression in L. lactis 

Since the two fusion proteins, IPM2HBcm and 

IM2HBcm could hardly be detected in a Western blot, we 

proceeded to augment the production of these two fusion 
15 proteins by adapting the codon usage of the extracellular 

part of the M2 protein to L. lactis (van de Guchte et 

al . , 1992) . 

At the 5* end of the extracellular part of the 
M2 protein we observed two consecutive leucine codons 

20 (CUG CUG) that were optimal for expression in E coli 
(68%) , but poor for translation in L . lactis (8%, 
percentages described in van de Guchte et al . , 1992). 
Therefore these codons were changed to UUA. The genes for 
ipm2hbc and im2hbc were amplified by PCR from 

25 respectively pPLcIPM2HBcm or pPLcIM2HBcm, with a new 
sense primer, M2Ls, containing the two changed leucine 
codons (see figure 13) . As anti-sense primer we used 
again HBca (see figure 13) . The cloning of the genes was 
analogous as depicted in figure 14. The vectors so 

30 created were called pTlPM2LHBc and pTlM2LHBc. 

The expression level of the mutated M2HBc 
proteins, compared to the original fusion proteins, was 
analyzed in a Western blot (see figure 16) . The 
expression level of the M2HBc fusion proteins with the L 

3 5 lactis adapted leucine codons, was indeed much higher. It 



WO 99/07839 PCT/EP98/05106 

49 

is concluded that the adaptation of codon usage to the L. 
lactis translation machinery, has a positive effect on 
the level of protein produced. In a similar way as 
described above, the murine interleukin 6 gene was 
5 inserted into pT!PM2LHBc and pTlM2LHBc, giving rise to 
pTlPM2LHBcIL6 and pTlM2LHBcIL6 , respectively. 

12. Construction of M2C3d in Lactococcus lactis 

A second carrier protein, C3d, is also an 

10 attractive molecule for the presentation of the 

extracellular part of the M2 protein. Dempsey et al . 
(1996) demonstrated that the attachment of an antigen to 
three consecutive C3d molecules, was much more efficient 
in producing a high antibody response than the antigen 

15 administered in complete Freund's adjuvant. 

The universal sequence of the extracellular 
part of the M2 protein, with the adapted leucine codons, 
was used for making a fusion to the amino- terminus of the 
first C3d molecule. The coding sequence for three 

20 different fusion proteins were constructed. In the first 
example the M2C3d3 fusion protein is expressed in the 
cytoplasm of L. lactis (cM2C3d3) , similar to the M2HBc 
fusion proteins. In the second case the M2C3d3 protein is 
secreted into the growth medium by making an in frame 

25 fusion to the usp45-signal sequence (sM2C3d3) , and the 
last construct, which is a derivative of the secreted 
form, contains in addition an anchor sequence (spaX) 
after the last C3d molecule to attach the fusion protein 
covalently in the cell wall (sM2C3d3X) . 

30 The amplified C3d3 fragment was first subcloned 

in a derivative of pUC18, namely pUCB/S. pUC18 was 
linearized with Hindu and a Bglll linker was inserted. 
The resulting plasmid was then opened with Smal and a 
Spel linker was inserted, resulting in the plasmid pUCB/S 

35 (see figure 18) . Three succeeding copies of C3d were 
amplified from pSG5.C3d3.YL (a gift from Dr. D. Fearon) 
by PCR with the oligonucleotides C3ds and C3da (see 
figure 17) . This amplified fragment was cut with Bglll 



WO 99/07839 



PCT/EP98/05106 



50 

and Spel. The resulting 2830 bp Bglll-Spel fragment was 
cloned into the Bglll and Spel opened vector pUCB/S (see 
figure 18) . The genes cm2 and sm2 were amplified by PCR. 
For the amplification of cm2 we used the sense 
5 oligonucleotide M2Ls (see figure 13) and the ant i -sense 
linker M2Ca, which carried for our purposes a BamHI site 
in the correct reading frame (see figure 17) . The same 
anti-sense linker was used for the amplification of sm2 . 
The sense oligonucleotide for the amplification of sm2 . 
10 M2LSs, started at the first codon of the mature M2 
protein. 

For the synthesis of the cytoplasmic form of 
M2C3d3, the information coding for the extracellular part 
of the M2 protein was inserted into pTREXl analogous as 

15 the m2hbc gene described above (see also figure 18) . The 
amplified cm2 fragment was cut with BamHI (77 bp) , 
phosphorylated with T4 polynucleotide kinase and inserted 
in the SphI and BamHI opened pTREXl, creating pTlcM2L. 
For the synthesis of the secreted and anchored form of 

20 M2C3d3, the information coding for the extracellular part 
of the M2 protein was inserted into pTINX. The vector 
pTINX carries the usp4 5 - signal sequence ( usp45-ss ) and 
the anchor sequence derived from Staphylococcus aureus 
protein A ( spaX ) . The plasmid pTINX was cut with Nael, 

2 5 correctly positioned at the end of the usp45-ss and 
BamHI. The amplified fragment, sm2 , was cut with BamHI 
and phosphorylated with T4 polynucleotide kinase. This 73 
bp sm2 fragment was inserted into the Nael and BamHI 
opened pTINX, resulting in the plasmid pTlsM2LX (see 

30 figure 18) . One single C3d fragment, isolated from 

pUCC3d, can then be inserted into the BamHI site at the 
end of the cm2 or sm2 sequence. Afterwards one or two 
additional C3d copies can be inserted. 

35 13. Construction of M2TTFC in Lactococcus lactis 

A third carrier protein, tetanus toxin fragment 
C (TTFC) , can also be used. TTFC has already been 
expressed in L. lactis under control of the PI promoter, 



WO 99/07839 PCT/EP98/05106 

51 

pTITT (Wells and Schof ield, 1996) . L. lactis expressing 
TTFC in combination with mIL2 or mIL6 to raise the 
antibody production, was successfully used in 
immunization experiments (Patent GB 9521568.7). 
5 As positive control for analysis of antibody response in 
the present immunization experiments with L. lactis 
expressing I (P)M2HBcm, a fusion was made between the 
extracellular part of the M2 protein and the amino 
terminus of TTFC. 

10 The ttfc gene was amplified by PCR (see 

Materials and methods) from pTITT. The sense 
oligonucleotide (TTFCs) provided a BamHI site, positioned 
in the correct reading frame, before the second codon of 
ttfc , corresponding to threonine. The anti-sense linker 

15 (TTFCa) provided a Spel and a BamHI site after the stop 
codon (see figure 19) . The amplification reaction that 
produced a sufficient amount of fragment, under the most 
stringent conditions, was used for further cloning (see 
Materials and methods) . The amplified ttfc fragment was 

20 cut with BamHI, phosphorylated with T4 polynucleotide 
kinase and inserted in the Bell opened pATIPM2ml (see 
figure 20) . This plasmid construct was called pATIPM2TT . 
From this plasmid the m2ttf c gene was amplified by PCR 
(see Materials and methods) with M2Ls and TTFCa (see 

25 figure 19) . The amplified m2ttfc fragment was cut with 
BamHI, phosphorylated with T4 polynucleotide kinase and 
inserted in the SphI and BamHI opened pTREXl (see figure 
20) . The new plasmid was called, pTlPM2LTT . In this 
construct the extracellular part of the M2 protein is 

3 0 derived f rom the virus A/PR/8/34, with the two leucine 
codons adapted for use in L. lactis . The sequence of the 
inserted fragment was determined on a model 373A 
sequencer (Applied Biosystems, Foster City, CA. , USA) and 
shown to be correct . 

35 The murine interleukin genes, mIL2 and mIL6 . 

were inserted in the same operon as m2ttfc. The murine 
interleukin 2 gene was isolated as a 572 bp Xbal-Spel 
fragment from plasmid pL2MIL2 (Steidler et al . , 1995). 



WO 99/07839 PCT/EP98/05106 

52 

This fragment was inserted into the Spel opened pTlPM2LTT 
giving rise to pTlPM2LTTIL2 (see figure 20) . In an 
analogous way the murine interleukin 6 gene was isolated 
as a 687 bp Xbal-Spel fragment from pL2MIL6 (Steidler et 
5 al . , 1996) and inserted into the Spel opened vector 
PT1PM2LTT to create pTlPM2LTTIL6 (see figure 20) . 

14. Expression of TTFC and M2TTFC in L. lactis 

Lactoccoccus lactis strain MG1363 (Gasson, 

10 1983) containing the plasmids for the expression of the 
antigen alone (pTlPM2LTT) or in combination with mouse 
interleukin 2 (pTlPM2LTTIL2) or mouse interleukin 6 
(pTlPM2LTTIL6) were cultured as described in Materials 
and Methods. MG1363 [pTITT] was used as a control. 

15 An equivalent of 10 9 bacteria was analyzed by SDS 10% 
PAGE . The expression of the IPM2TTFC fusion protein was 
analyzed by Western immunoblotting (see figure 21) 
carried out as described in Materials and Methods. 
The production and secretion of interleukins into the 

20 growth medium was analyzed by a biological assay. L. 

lactis [pTlPM2LTTIL2] produced about 500 ng/ml mIL2 and 
L. lactis [pTlPM2LTTIL6] about 1 ^g/ml mIL6 . These 
results are comparable with the expression levels 
obtained with I(P)M2HBcm in combination with the two 

25 interleukins. 

15. Construction of pACsgpM2C3d3 and generation of the 
corresponding recombinant baculovirus 

The amplified sequence of the baculovirus gp67 
30 secretion signal was cut with Spel and Hindlll, and then 
subcloned in the Spel-Hindlll vector fragment of pUCC3d, 
resulting in pUCsgp. After Hindlll and Nael digestion of 
pUCsgp, the gp67 secretion signal was ligated with a 
Hindlll treated M2e fragment (universal sequence) 
35 obtained from a PCR amplification (primers M2Ss and 
UM2ECa) . This construct, referred to as pUCsgpM2, was 
digested with BamHI and subsequently recirculized by 



WO 99/07839 PCT/EP98/05106 

53 

ligation with the Bglll-BamHI pUCC3d3 fragment containing 
3 consecutive C3d fragments, yielding pUCsgpM2C3d3 . 

The latter fragment was excised after ligation 
of the BamHI (dephosphorylated) -EcoRI pUCC3d fragment, 
5 the Bglll (desphosphorylated) -EcoRI pUCC3d fragment and 
the Bglll-BamHI pUCC3d fragment. The Spel fragment of 
pUCsgpM2C3d3 containing the sgpM2C3d3 fusion sequence was 
then inserted behind the polyhedrin promoter by 
exchangement with the Spel-Xbal fragment of the 

10 baculovirus transfer vector pACGP67A. The resulting 
transfer vector, called pACsgpM2C3d3 , was then used to 
generate recombinant AcNPV/sgpM2C3d3 baculovirus by 
calcium phosphate cotransf ection of Sf 9 insect cells with 
BaculoGold baculovirus DNA (Pharmingen, San Diego, CA, 

15 USA) , following the procedure as described in King and 
Possee (1992) . The presence of the sgpM2C3d3 fusion 
sequence behind the polyhedrin promoter in the genome of 
the corresponding recombinant AcNPV/sgpM2C3d3 baculovirus 
was confirmed by PCR analysis. 

20 

16. Expression of secreted M2C3d3 by Sf9 insect cells 

Log-phase Sf 9 insect cells were inoculated with 
recombinant AcNPV/sgpM2C3d3 baculovirus at high 
multiplicity of infection {> 10) . Cells were subsequently 

25 transferred to serum-free TC100 medium and further 
incubated for 48 h before harvesting the supernatant. 
Proteins were precipitated by adding an equal volume of 
acetone (preequilibrated at -20°C) and subsequently 
analyzed by Western blotting. 

30 In a preferred construction, three or more 

copies of the C3d protein are preceded by the 
extracellular domain of the M2 protein. 

17. Passive immunisation 

35 The survival is shown in figure 28. In both 

control groups only one mouse out of 12 survived the 
lethal influenza challenge, while 11 out of 12 mice 
immunized with 3 x 10 pg IM2HBcm or all passively 



WO 99/07839 PCT/EP98/051 06 

54 

immunized mice were protected. This experiment 
demonstrates that anti-M2 antibodies produced during the 
vaccination account for the observed protection. 

5 18. DNA vaccination 

Table 3 shows the results of a DNA vaccination 
experiment in which 12 mice injected with 3 x 100 fxg 
pCIM2 were compared with a control group injected three 
times with 100 /xg pCDNA3 for the survival against a 
10 lethal challenge (5 LD 50 ) with m.a. X47. A partial 

protection against a heterologous (immunising antigen = 
universal M2, challenge = A/PR/8/34 derived M2) influenza 
challenge could be demonstrated. 

15 Table 3 



vector 


surviving mice/ total 
number 


pCDNA3 (control) 


1/12 


pCIM2 (complete m2 gene) 


7/12 



20 

19. Expression in HEKT cells 

The expression level of the complete M2 protein 
is too low to be detected, in the soluble fraction and in 
the pellet (see figure 30) . It is possible that the 

25 expression is kept low due to the ion channel activity of 
the M2 protein, which can be toxic for the HEKT cells. 
The two fusion proteins, IM2HBcm and IP3M2HBcm however 
are well expressed. This experiment demonstrates that the 
vectors used in the DNA vaccination studies can express 

30 the protein, except maybe for pCIM2 . 

20. Analysis of the serum 

A specific antibody response directed towards 
the extracellular part of the M2 protein could be 
35 demonstrated, although this response is low. In panel B 
from figure 31 pCIM2 is compared to the control vector. 



WO 99/07839 



PCT/EP98/05106 



55 

In this ELISA M2 protein expressed in insect cells was 
used as coating (see Materials and Methods) . A specific 
anti-M2 response could be demonstrated, especially after 
the third immunization. The higher anti-M2 response with 
5 pCIM2 can be due to additional epitopes located in the 
cytoplasmic domain of the M2 protein. 

DISCUSSION 

The present document describes several systems 

10 for the presentation of the highly conserved 

extracellular part of the influenza A virus M2 protein to 
the immune system. The M2 fragment was fused to the amino 
terminus of the carrier protein in order to retain a free 
N- terminus of the M2 -domain and in this way mimic the 

15 wild type structure of the M2 protein. The first fusion 
protein, M2 linked to human ^-microglobulin <IPM2hB2Mm) / 
was used to produce monoclonal antibodies. A second 
fusion protein, M2 linked to Hepatitis B core protein 
(IPM2HBcm) was used for vaccination studies. Both 

20 proteins could also be used in the detection of a 

specific antibody response against the extracellular part 
of the M2 protein, since a correction has to be made for 
antibodies directed against the carrier protein, which 
are also produced during the immunization process. 

25 The vaccination studies with IPM2HBcm showed 

that the administered dose in the range that was used, 
was apparently not a very critical parameter for 
obtaining protection, as a dose ranging from 5 to 50 /xg 
protected the mice, although the immunized mice still 

30 showed a high morbidity. This may have been due to the 
high dose of virus (5 LD 50 ) that was used for the 
challenge in order to obtain a clear-cut result for the 
degree of protection. In a natural influenza infection 
the number of infecting virus particles is much lower, so 

35 that it can be assumed that the morbidity would decrease 
accordingly. 

Analysis of the serum of immunized mice showed 
a substantial antibody response towards the extracellular 



WO 99/07839 



PCT/EP98/05106 



56 

part of the M2 protein, especially after viral challenge. 
This latter, high response can be due to another way of 
administration, intraperitoneal versus intranasal. Or it 
can be explained on the basis of a more complete defense 
5 mechanism against the incoming virus. 

Slepushkin et al . (1995) described a 
vaccination strategy, based on a membrane extract 
containing the natural complete M2 protein for homologous 
and heterologous virus challenge. But they used a very 

10 strong adjuvant, incomplete Freund's, which is not 
appropriate for medical use. 

In contrast, the M2 extracellular domain 
fusions of the invention, described here can be obtained 
in a pure form (at least 95% purity) , and can be 

15 administered in combination with safe adjuvants. A high 
degree of protection was obtained, despite the fact that 
the challenge was fairly severe. In view of the almost 
invariant sequence of the M2 extracellular domain (see 
table 1 which shows an overview of the amino acid 

20 sequences of the extracellular domain of the influenza A 
M2 protein) it may be expected that the protection 
achieved will be similar against all human influenza A 
strains known so far. 

The vaccine may be further improved by the 

25 inclusion of an influenza specific T helper epitope as 
well as a CTL epitope into the fusion protein, for 
example internally or linked to the C-terminus of the 
Hepatitis B core protein. Other immunization routes are 
possible as well, for example intraperitoneal versus 

30 intranasal. 

Besides the gram negative organism, E. coli. 
also L. lactis was used, a gram positive organism, for 
the expression of the M2HBcm fusion proteins. In 
lactis it is not necessary to purify the expressed fusion 

35 protein. The bacteria can be administered directly either 
intranasally or orally. 

A third promising carrier protein is also 
described, namely the third complement protein fragment d 



WO 99/07839 



PCT/EP98/05106 



57 

(C3d) (Dempsey et al . , 1996). In a preferred 
construction, three copies of the C3d protein are 
preceded by the extracellular domain of the M2 protein. 
This M2C3d3 fusion protein can be expressed either in an 
5 intracellular form, anchored in the cell wall or secreted 
into the growth medium, by genetic fusion to appropriate 
regulatory sequences . 



WO 99/07839 



PCT/EP98/05106 



58 

REFERENCES 

Allen et al . (1980) Virology 107, 548 - 551 

Baez et al . (1980) J. Infect, dis. 141, 362-365 

Belshe et al . (1988) J. Virol. 62, 1508 - 1512 

Birnboim and Doly (1979) N.A.R. 7, 1513 - 1523 

Black et al. (1993a) J. Gen. Virol. 74, 143-146 

Black et al. (1993b) J. Gen. Virol. 74, 1673-1677 

Borisova et al . (1989) FEBS Lett. 259 , 121 - 124 

Casadaban and Cohen (1980) J. Mol . Biol. .138 , 179 - 207 

Clarke et al . (1987) Nature 330 , 381 - 384 

Cohen and Richmond (1982) Nature 296 , 677 - 678 

Cox et al. (1988) Virology 167, 554 - 567 

Dempsey et al . (1996) Science 271, 348 - 350 

Deng and Nickolov (1992) Anal. Biochem. 200 , 81 - 88 

Gasson (1983) J. Bact . 154 , 1-9 

Gillis et al. (1978) J. Immunol. 120, 2027 - 2032 

Hirst (1941) Science 94, 22 - 23 

Holsinger and Lamb (1991) Virology 183 , 32-43 

Kahn et al . (1979) Methods Enzymol . 68, 268 - 280 

Kendal et al . (1982) Concepts and procedures for 

laboratory-based influenza surveillance, p. B7 - Bl 2, Bl 

7 - Bl 9 

King and Possee (1992) The Baculovirus Expression System. 

Chapman & Hall, University Press, Cambridge, UK 

Klimov et al . (1992) Virology 186, 795 - 797 

Kohler and Milstein (1975) Nature 256 , 495 - 497 

Laemmli (1970) Nature 227, 680 - 685 

Lamb and Lai (1981) Virology 112 , 746 - 751 

Lamb et al. (1981) Proc. Natl. Acad. Sci. USA 78, 4170 - 

4174 

Lamb et al. (1985) Cell 40, 627 - 633 
Levi and Arnon (1996) Vaccine 14, 85 - 92 
Markushin et al . (1988) Virus Res. 10,, 263 - 272 
Miller (1972) Experiments in Molecular Genetics. Cold 
Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 
p. 431 

Min Jou et al . (1980) Cell 19, 683-696 

Nakamaye and Eckstein (1986) N.A.R. 14, 9679 - 9698 



WO 99/07839 



PCT/EP98/05106 



59 

Nassal (1988) Gene 66, 279 - 294 

Neu and Heppel (1965) J. Biol. Chem. 240 , 3685 - 3692 
Ortin et al . (1983) Gene 23, 233 - 239 
Parker and Wiley (1989) Gene 81, 117 - 124 
Remaut et al . (1981) Gene 15, 81 - 93 
Remaut et al . (1983a) N.A.R. 11, 4677 - 4688 
Remaut et al. (1983b) Gene 22, 103 - 113 
Schoder et al. (1992) J. Virol. £6, 106 - 114 
Slepushkin et al . (1995) Vaccine 13, 1399 - 1402 
Stanssens et al . (1989) N.A. R. 17, 4441 - 4454 
Steidler et al . (1994) Biotechn. Bioeng. 44/ 1074 - 1082 
Steidler et al . (1995) Appl . Environ. Microbiol. 61, 1627 
- 1629 

Steidler et al . (1996) NATO ASI Series H 98 p 63 - 79. 

eds. Bozoglu, T.F. and Ray, B. Springer, Berlin 

Struhl (1985) Biotechniques 3, 452 - 453 

Sugrue et al . (1990) Virology 179, 51 - 56 

Sugrue and Hay (1991) Virology 180 , 617 - 624 

Treanor et al . (1990) J. Virol. 64/ 1375 - 1377 

van Asseldonk et al . (1990) Gene 95, 155 - 160 

van de Guchte et al . (1992) FEMS Microbiol. Rev. 88/ 73 - 

92 

Van Snick et al. (1986) Proc. Natl. Acad. Sci . USA 83 , 
9679 

Vogelstein and Gillespie (1979) Proc . Natl. Acad. Sci. 
USA 76, 615 - 619 

Wells et al. (1993) J. Appl. Bact . 74, 629 - 636 
Wells and Schofield (1996) NATO ASi Series H 98 p 37 - 
62. eds. Bozoglu, T.F. and Ray, B. Springer, Berlin 
Winter and Fields (1980) N.A.R. 8, 1965 - 1974 
Zebedee and Lamb (1988) J. Virol. 62, 2762 - 2772 
Zebedee and Lamb (1989) N.A.R. 17, 2870 
Zell and Fritz (1987) EMBO J. 6, 1809 - 1815 



WO 99/07839 



60 



PCT/EP98/05106 



CLAIMS 

1. Influenza antigen, comprising a fusion 
product of at least the extracellular part of a conserved 
influenza membrane protein or a functional fragment 
thereof and a presenting carrier. 
5 2. Influenza antigen, wherein the presenting 

carrier is a presenting (poly) peptide . 

3. Influenza antigen, wherein the presenting 
carrier is a non-peptidic structure, such as glycans, 
peptide mimetics, synthetic polymers. 
10 4. Influenza antigen as claimed in claims 1-3 

further comprising an additional domain for enhancing the 
cellular immune response immunogenicity of the antigen. 

5. Influenza antigen as claimed in claims 1-4, 
wherein the conserved influenza membrane protein is the 

15 M2 membrane protein. 

6. Influenza antigen as claimed in claim 5, 
wherein the M2 membrane protein originates from influenza 
A virus. 

7. Influenza antigen as claimed in claims 1-6, 
20 wherein the presenting (poly) peptide is selected from the 

hepatitis B core protein, one or more C3d domains, 
tetanus toxin fragment C. 

8. Influenza antigen as claimed in claims 1-7, 
wherein the antigen consists of Lactococci cells 

25 expressing the fusion product in or on their cell 

membrane, optionally said cells release said product. 

9. Influenza antigen as claimed in claims 1-8, 
wherein the functional fragment of the conserved 
influenza membrane protein is a fragment that is capable 

30 of eliciting a statistically significant higher 

immunoprotection when administered in an immunoprotective 
dose to test members of a species than is found in 
control members of the same species not receiving the 
functional fragment. 



WO 99/07839 



PCT/EP98/05106 



61 

10. Influenza antigen as claimed in claims 1-9, 
wherein the additional domain is an influenza specific T 
helper cell epitope or cytotoxic T cell epitope. 

11. Influenza antigen as claimed in claims 1- 

5 10, obtainable by preparing a gene construct comprising a 
coding sequence for at least the extracellular part of a 
conserved influenza membrane protein or a functional 
fragment thereof and at least one coding sequence for a 
presenting (poly) peptide operably linked thereto, 

10 optionally in the presence of suitable transcription 
and/or translation regulatory sequences, bringing this 
gene construct in a suitable acceptor cell, effecting 
expression of the gene construct in the acceptor cell and 
optionally isolating the antigen from the acceptor cell 

15 or its culture medium. 

12. Influenza antigen as claimed in claim 11, 
wherein the coding sequence for the extracellular part of 
a conserved influenza membrane protein consists of a 
coding sequence for the extracellular part of the M2 

20 protein of the influenza A virus or a functional fragment 
thereof and the coding sequence for the presenting 
(poly) peptide is selected from coding sequences for 
hepatitis B core protein, one or more C3d domains, or 
tetanus toxin fragment C. 

25 13. Influenza antigen as claimed in claims 1- 

12, comprising the amino acids 2 to 24 of the M2 protein 
of influenza A virus, or modified versions thereof not 
substantially altering the tertiary structure of this 
part of the protein and hepatitis B core protein and/or 

3 0 one or more C3d domains. 

14. Influenza antigen as claimed in claims 1-13 
for use in the preparation of a vaccine against influenza 
for humans and animals. 

15. Influenza antigen as claimed in claims 1-14 
35 for use in the preparation of a vaccine against influenza 

A for humans and animals. 



WO 99/07839 PCT/EP98/051 06 

62 

16. Vaccine against influenza, comprising at 
least an antigen as claimed in claims 1-15, optionally in 
the presence of one or more excipients. 

17. Vaccine as claimed in claim 16, wherein the 
5 antigen is in isolated form. 

18. Vaccine as claimed in claim 16, wherein the 
antigen is part of a membrane fragment. 

19. Vaccine as claimed in claim 16, wherein the 
antigen is anchored in the membrane of an acceptor cell 

10 expressing the antigen. 

20. Vaccine as claimed in claim 16, wherein the 
antigen consists of Lactococci cells expressing the 
fusion product in or on their cell envelope. 

21. Vaccine as claimed in claims 16-20, further 
15 comprising one or more other influenza antigens, for 

example selected from hemagglutinin, neuraminidase 
nucleoprotein and/or native M2 . 

22. Use of an antigen as claimed in claims 1-13 
for the preparation of a vaccine against influenza. 

20 23. Method of preparing an antigen as claimed 

in claims 1-15, comprising the steps of: 

a) preparing a gene construct comprising a 
coding sequence for at least the extracellular part of a 
conserved influenza membrane protein or a functional 

25 fragment thereof and at least one coding sequence for a 
presenting (poly) peptide operably linked thereto, 
optionally in the presence of suitable transcription 
and/or translation regulatory sequences, 

b) bringing this gene construct in a suitable 
30 acceptor cell, 

c) effecting expression of the gene construct 
in the acceptor cell, and 

d) optionally isolating the antigen from the 
acceptor cell or its culture medium. 

35 24. Acceptor cell, expressing an antigen as 

claimed in claims 1-15. 

25. Acceptor cell as claimed in claim 24, 
wherein the cells are Lactococcus cells. 



SUBSTITUTE SHEET (RULE 26) 



WO 99/07839 



PCT/EP98/05106 



1/35 



Figure 1 



KE1- 



-intron- 



BamHi 



AG&ECT- 

Stut 



-E2- 



BamH I and Stu ! + oligonucleotides 



oligonucleotides for E1 : 

GATCC6TCTCTGCTGACCGAAGTT6AAACC 
GCAGAGACGACTGGCTTCAACTTTGG 



B 



KEl*h 



E2 



BamHI 



-M2e M2t- 



-M2c- 



BamH I 



• TGA 



T 

BamH I Bel I 



I 

Site-directed mutagenesis 
(Stanssens et al., 1 989) 



mutator oligonucleotide 

CGGTTCAAG TGATCA TCTCGC 

Bdl 



23456789 10. 11 

Nucleotide sequence : TCT CTG CTG ACC GAA GTT GAA ACC CCT ATC 

Amino acid sequence : Ser Leu Leu Thr Glu Va 1 Gl u Thr Pro He 

12 13 14 15 16 17 18 19 20 21 22 23 24 

AGA AAC GAA TGG GGG TGC AGA TGC AAC GGT TCA AGT GAT 

Arg Asn Glu Trp Gly Cys Arg Cys Asn Gly Ser Ser Asp 



WO 99/07839 



PCT/EP98/05106 



2/35 



fiqure2a1 




I TO 2a3 



WO 99/07839 



PCT/EP98/05106 



3/35 



00 

o 

CM 




WO 99/07839 



PCT/EP98/05106 




WO 99/07839 



PCT/EP98/05106 



5/35 



Figure 2b 



OmpA ss 

- GCG CAG GCC 



Ala Gin Ala 



hB2m 



ATC CAG CGT- 



He Gin Arg 




Insertion of a linker 



GCG CAG r,rriTfA EAI t'TTl CTC CAG CGT- 



Ala Gin Ala js" Asp Leu| L eu Gin Arggg^^^!^g||||l|| 



Insertion of the M2-fragment 



GCG CAG GCC TCA GAT ffir. jTf.T f.lft H fi — \i\k Atil ECTj CTT CTC CAG CGT 



Ala Gl 



n Al a j j s'e Leu Gin ' Arg;;- ^' 



Looping out mutagenesis 



GCG CAG GCCjTCT CTG CTG TCA AGT GAT 



CTT CTC CAG CGT- 



WO 99/07839 



PCT/EP98/05106 



6/35 




Nco I + Xba 1 : 346 bp 




WO 99/07839 



PCTVEP98/05106 




7/35 



fiqure3a2 



Sea I + EcoRI : 865 bp 
Xba I + Sea 1 : 2900 bp 

\ 

Site-directed mutagenesis 
(Stanssens et al., 1989) 



Mutator oligonucleotide 

fiSALLtATATCCATCGC 

/ 

ssDNA 




BamHI + Bgl 1 : 1900 bp + 2220 bp 




Bel I + BamHI : 72 bp 



I 4 TO 3a3 



WO 99/07839 



PCT/EP98/05106 



8/35 



fiqure3a3 




PCT/EP98/05106 



9/35 




fiqure3a4 



P Ma.PM2HBc2 ^ «« ^ , ^ ^ ,„ ; 

586 bp + 2843 bp 



looping out mutagenesis 
(Deng and Nickotoff, 1992) 

Mutator oligonucleotide : 

CGGTCAGCAGAGACATGGGTAATCC 

Selection oligonucleotide 

CCAGACCGTTCAGCTGGATATTACGG 




SgrAI + EcoRI : 499 bp 



WO 99/07839 



PCT/EP98/05106 



Figure 



10/35 



Hepatitis B core 






1 2 3 4 5 
Met Asp He Asp Pro 
ATG GAT ATC GAT CCT 


6 .. 
Tyr . . 

TAT 


| wild type 


Hepatitis B core 






Met Asp Met Asp Pro 

ATG GAT ATG GAT CCT 
Bam HI 


Ty r . . 
TAT .. 


| mutant 



Figure 3c 

HBc 

ATG GAT ATG GAT CCT I TAT AAA GAA 




Insertion ofM2 fragment 



M2e 


GAT CCT TAT AAA GAA 


— ATG GAT ATG GAT CCGfTCT CTG CTG GGT TCA TCA 




|Met Asp Met Asp Pro! Ser Leu Leu / / Gly Ser Ser 


Asp Pro Tyr Lys Glu 


! ' ' 





Looping out mutagenesis 



-ATG 



TCT CTG CTG — — GGT TCA TCA 



GAT CCT TAT AAA GAA- 



It 




WO 99/07839 



PCT/EP98/05106 



Figure 4 



11/35 



kDa 



94 



67 



43 



pPU245 pPLcAl pPLclPM2HBcm 

mw t ~~H\ i "HnS i "~~ni I ' 



30 



20 




Fi gure 7 



A. 



Nl 



:ooo 



B. 



Nl 



[OOO 

OOi 



WO 99/07839 



PCT/EP98/05106 



12/35 




WO 99/07839 



Figure 6 



ATG TCT 


CTG 


CTG ACC GAA 


GTT 


GAA 


Nucleotide sequence of ipm2hbcm 


Met Ser 


Leu 


Leu Thr Glu 


Val 


Glu 


Translated amino acid sequence 


Ser 


Leu 


Leu Thr Glu 


Val 


Glu 


Amino terminus of the fusion protein IPM2HBcm 


Ser 


Leu 


Leu Thr Glu 


Val 


Glu 


Amino terminus of the M2 protein of A/Udorn/72 



PCT/EP98/05106 

13/35 



WO 99/07839 



PCT/EP98/05106 



Figure 8 



B 



1. 



1A/35 



Rectal temperature 




2 4 6 8 10 
days after infection 

Weight 



12 14 16 




6 8 10 
days after infection 



Survival 



16 




-+-50pglPM2HBcm 


-•— 10 M9 IPM2HBcm 


—6— 5 pg PWGHBcm 


Control 



WO 99/07839 PCT/EP98/051 06 



15/35 

fig.8D 



survival 




10 pg IPM2HBcm (i n.) 
10pg IM2HBcm (i.n.) 
control (i.n.) 



0 2 4 6 8 10 12 14 16 18 20 



days after Infection (30 HAU m.a. X47) 



survival 




days after Infection (30 MAU m.a.X47) 





surviving mice 


10 UQ IPM2HBcm (i.n.) 


12/12 


10 uq IM2HBcm (i.n.) 


11/12 


control (i.n.) 


2/11 


10 pq IPM2HBcm (i.p.) 


8/12 


10 gq IM2HBcm (i.p.) 


12/12 


control (i.p.) 


2/12 



fig.8C 



WO 99/07839 



PCT/EP98/05106 



Figure 10 



T7/35 



Pvu l + SgrAI : 1736 bp 
EcoRI + Pvul : 2172 bp 



Pvu I * SgrAI : 747 bp 
EcoRI + Pvu I : 2012 bp 




Site-directed mutagenesis (Deng and Nickoloff, 1992) 
Mutator oligonucleotide : 

GGATCACTTGAATCGTTACATCTGCACCC 

Selection oligonucleotide 

CCAGACCGTTCAGCTGGATATTACGG 



SgrA I + EcoR 1 : 499 bp 



WO 99/07839 



PCT/EP98/05106 



Figure 11 18/ 35 



pPU245 pPLcAl P PLclPM2HBcm pPLclM2HBcm 

MW I ""Hi I "~~N( i " Nl i ' 

(cOa i 1 1 1 1 1 1 1 1 - — 1 1 1 1 ■ • 1 1 1 1 t 




Figure 21 



pTI PM2LTT 
MW pT11T ' - mtl2 mlL6 



WO 99/07839 



PCT/EP98/05106 




WO 99/07839 



PCT/EP98/05106 



Figure 13 20/35 



HBcs (27-mer) 

CATGGATATGGATCCTTATAAAGAATT 
start 

M2s (23-mer) 

CATGTCTCTGCTGACCGAAGTTG 
start 

M2Ls (29-mer) 

CATGTCT fTTATTAI ACCGAAGTTGAAACCC 

start 

HBca (39-mer) 

CG TGATCAACTAGTTCA CTAACATTGAGATTCCCGAGAT 

Bel I Spe I stop 



WO 99/07839 



PCT/EP98/05106 




WO 99/07839 



PCT/EP98/05106 




Fi gure 16 



kDa 



pTlPM2HBc pT1M2HBc 
MW C ' E I " i L 



PCT/EP98/05106 



23/35 



M2Ca (33-mer) 

CG GGATCC CCACTTGAATCGTTACATCTGCACC 

BamH I 

M2LSs (30-mer) 

TCTfTTATTAI ACCGAAGTTGAAACCCCTATC 

Ser 

C3ds (35-mer) 

CCGCGCCCACCCGACG AGATCT CGGATCTACCCCC 

Bglll 

C3da (38-mer) 

GC ACTAGTTCA A GGATCC GATCCGAACTCTTCAGATCC 

Spe I stop BamH I 



WO 99/07839 



PCT/EP98/05106 




WO 99/07839 



PCT/EP98/05106 



Figure 19 25/35 



TTFCs (35-mer) 

CG GGATCC GACACCAATTCCATTTTCTTATTCTAA 

BamHI 

TTFCa (25-mer) 

G6 GGATCCACTAGTTTA ATCATTTG 
Bet I Spe I stop 

M2Ls (29-mer) 

CATGTCT fTTATTAI ACCGAAGTTGAAACCC 

start 



WO 99/07839 



PCT/EP98/05106 




WO 99/07839 



PCT/EP98/05106 



27/35 



Figure 22 



GP67s (25-mer) 

GCT ACTAGT AAATCAGTCACACCAA 
Spel 

GP67a (33-mer) 

CGAAGCTTGCCGGCAAAGGCAGAATGCGCCGCC 
HinDIN Nael 



Figure 23 



M2Ss (23-mer) 

TCTCTGCTGACCGAAGTTGAAAC 
UM2ECa (50-mer) 

CG AAGCTTACTAGTTCA C GGATCC CCACTTGAATCGTTGCATCTGCACCC 
Hindlll Spel stop Bam HI 



WO 99/07839 



PCT/EP98/05106 




WO 99/07839 



PCT/EP98/05106 



IW1 



29/35 



in 

o 

3 



CM 

2 



CD 

a 

(A 



« 5 



0) 
"oo 
a) 

■ CO 

> 

CD 
0 
O 



stop 


TGA 


Pro 


CCG 


Asp 


GAT 


Ser 


TCG 


Gly 


GGA 


a> 


Oil 


G/ii 


GAG 


G/u 


GAA 


Ser 


TCT 


G/y 


< 
o 
o 


Ser 


AGT 



■o 

CO 

o 



t/i 

"o 

CO 

o 
c 

i 

(0 

- 

a> 

CM 



III! 



lis 
iil 

PI 



^ < 

=3 O 

a> »— 

-J O 



WO 99/07*39 



PCT/EP98/05106 



31/35 



Figure 27 




25 kDa-* 



16.5 kDa-* 



37 kDa 



WO 99/07839 



PCT/EP98/05106 



32/35 




WO 99/07839 



PCT/EP98/05106 



33/35 

Fi gure 29 





WO 99/07839 



PCT/EP98/05106 



34/35 



Figure 30 



Soluble fraction 



Pellet fraction 



4 12 3 4 




B. 

1.6 
1.4 
1.2 
1 

» 0.8 i 

o 

< 0.6 
0.4 
0.2 
0 



Anti-M2 response 



□pCDNA3 
□ pCIM2 



1/50 b 



1/50 c 



1/50 d