Skip to main content

Full text of "USPTO Patents Application 09848616"

See other formats


This Page is Inserted by IFW Operations 
and is not a part of the Official Record 



BEST AVAILABLE IMAGES 



Defective images within this document are accurate representations c 
the original documents submitted by (he applicant. 

Defects in the images may include (but are not limited to): 



• BLACK BORDERS 

• TEXT CUT OFF AT TOP,. BOTTOM OR SIDES 

• FADED TEXT 

• ILLEGIBLE TEXT 

• SKEWED/SLANTED IMAGES 

• COLORED PHOTOS 

• BLACK OR VERY BLACK AND WHITE DARK PHOTOS 

• GRAY SCALE DOCUMENTS 



IMAGES ARE BEST AVAILABLE COPY. 

As rescanning documents will not correct images, 
please do not report the images to the 
Image Problem Mailbox. 



Document AP2 „ 
Appl.No. 09/848,616 



PCT 



WORLD INTELLECTUAL PROPERTY ORGANIZATION 
International Bureau 




INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) 



(51) International Patent Classification 6 : 

C12N 15/49, 15/62, C07K 14/16, 19/00, 
14/03, A61K 39/21, 39/245 



A2 



(11) International Publication Number: WO 96/30523 

(43) International Publication Date: 3 October 1996 (03.10.96) 



(21) International Application Number: PCT/EP96/0I433 

(22) International Filing Date: 1 April 1996 (01 .04.96) 



(30) Priority Data: 

95 10 4848.7 31 March 1995 (31.03.95) EP 

(34) Countries for which the regional or 

international application was filed: DE et al. 

95 10 4849.5 31 March 1995 (31.03.95) EP 

(34) Countries for which the regional or 

international application was filed: DE et al. 

95 10 4850.3 31 March 1995 (31.03.95) EP 

(34) Countries for which the regional or 

international application was filed: DE et al. 



(71) (72) Applicant and Inventor: WOLF, Hans [DE/DEj; Josef- 

Jagerhuber-Strasse 9, D-82319 Starnberg (DE). 

(72) Inventors; and 

(75) Inventors/Applicants (for US only): WAGNER, Ralf [-/DE]; 
Franz-von-Taxis-Ring 4, D-93049 Regensburg (DE). 
DEML, Ludwig [-/DE]; Schneitweger Strasse 30, D- 
93128 Regensburg (DE). OSTERRIEDER, Klaus [-/DE]; 
Holzhauser Strasse 30, D-86919 Utting (DE). NOTKA, 
Frank [-/DE]; Gebhardstrasse 5, D-93059 Regensburg 
(DE). 



(74) Agent: VOSSIUS & PARTNER; P.O. Box 86 07 67, D-8I634 
Munchen (DE). 



(81) Designated States: BR, CA, CN, JP, US, ARIPO patent (KE, 
LS, MW, SD, SZ, UG), European patent (AT. BE, CH, DE. 
DK, ES, FI, FR, GB. GR, IE. IT, LU, MC, NL, PT, SE). 



Published 

Without international search report and to be republished 
upon receipt of that report. 



(54) Title: ANTIGEN PRESENTATION SYSTEM BASED ON RETROVTJRUS-LIKE PARTICLES 
(57) Abstract 



The present invention relates to the provision of an antigen presentation system on the basis of a DNA sequence encoding a protein 
capable of self assembly into particles without a lipid membrane, preferably a retroviral group-specific antigen (gag) that can be used, e.g., 
for the preventive and therapeutic immunization of mammals against infectious diseases or neoplasias. 



FOR THE PURPOSES OF INFORMATION ONLY 



Codes used to identify States 
applications under the PCX 



AM 


Armenia 


AT 


Austria 


AU 


Australia 


BB 


Barbados 


BE 


Belgium 


BF 


Burkina Faso 


BG 


Bulgaria 


BJ 


Benin 


BR 


Brazil 


BY 


Belarus 


CA 


Canada 


CF 


Central African Republic 


CG 


Congo 


CH 


Switzerland 


a 


Cote d'lvoire 


CM 


Cameroon 


CN 


China 


CS 


Czechoslovakia 


CZ 


Czech Republic 


DE 


Germany 


DK 


Denmark 


EE 


Estonia 


ES 


Spain 


H 


Finland 


FR 


France 


GA 


Gabon 



party to the PCT on the front pages 



GB 


Untod Kingdom 


GE 


Georgia 


GN 


Guinea 


GR 




HU 


Hungary 


IE 


Ireland 


IT 


Italy 


JP 


Japan 


KE 


Kenya 


KG 


Kyrgystan 


KP 


Democratic People's Republic 




of Korea 


KR 


Republic of Korea 


KZ 


Kazakhstan 


U 


Liechtenstein 


LK 


Sri Lanka 


LR 


Liberia 


LT 


Lithuania 


LU 


Luxembourg 


LV 


Latvia 


MC 


Monaco 


MB 


Republic of Moldova 


MG 


Madagascar 


ML 


Mali 


MN 


Mongolia 


MR 


Mauritania 



pamphlets publishing international 



MW 


Malawi 


MX 


Mexico 


NE 


Niger 


NL 


Netherlands 


NO 


Norway 


NZ 


New Zealand 


PL 


Poland 


FT 


Portugal 


RO 


Romania 


RU 


Russian Federation 


SD 


Sudan 


SE 


Sweden 


SG 


Singapore 


SI 


Slovenia 


SK 


Slovakia 


SN 


Senegal 


sz 


Swaziland 


TD 


Chad 


TG 


Togo 


TJ 


Tajikistan 


TT 


Trinidad and Tobago 


UA 


Ukraine 


UG 


Uganda 


US 


United States of America 


UZ 


Uzbekistan 


VN 


Viet Nam 



WO 96/30523 



PCT/EP96/01433 



ANTIGEN PRESENTATION SYSTEM BASED ON RETROVIRUS-LIKE PARTICLES 



Technical field of the invention 

The technical problem underlying the present invention is to provide an antigen 
presentation system on the basis of retroviral group specific antigens (gag) that can 
be used for the preventive and therapeutic immunization of mammals against 
infectious diseases or neoplasias. This invention particularly relates to a newly 
designed antigen delivery system produced in appropriate expression systems e.g. 
recombinant baculoviruses, semliki forest viruses or stably transfected insect or 
mammalian cells, respectively. The invention is based on retroviral group specific 
antigens such as the human immunodeficiency virus type 1 (HIV-1) Pr55S fl S 
precursor protein constituing immature forms of retroviral particles when expressed 
in eucaryotic cells. The immunogenicity of the immature virus-like particles (VLPs) 
can be extended by anchoring complete proteins on the surface of the VLPs. These 
proteins can either constitute autologous membrane proteins derived from the same 
retrovirus as the particulate gag carrier component or from any other virus, infectious 
agent or neoplastic cell. Stable anchoring of the autologous or "foreign" proteins on 
the surface of the VLPs requires the co-expression of the retroviral gag-precursor 
together with the antigen to be presented. In addition the antigen to be presented 
must include an aminoterminal signal sequence as well as a transmembrane domain 
in order to allow transport of the antigen via endoplasmic reticulum to the 
cytoplasmic membrane and stable anchoring on the surface of the budding VLP. To 
demonstrate the universal principle of this novel antigen presentation system, we 
generated recombinant VLPs on the basis of the HIV-1 Pr55^g precursor allowing 
the presentation 

• of the complete HIV-1 envelope protein gp160, 

• of a derivative of the HIV-1 external glycoprotein gp120 anchored 
on the surface of the VLPs via a heterologous transmembrane 
domain derived from the Epstein-Barr vims major membrane 
antigen gp220/350 and 

• of an equine herpesvirus glycoprotein (gB) to the immune system. 
In complete absence of adjuvants, these spiked and nonreplicating/noninfectious 
VLPs result d in different animal models in the induction of a humoral as w II as cell 
mediated immune respons and, when tested, in a protective immunity. 



WO 9600523 



PCT/EP96/01433 



2 

Background art 



Deeper insight into pathobiological processes induced by viral infections or the 
generation of neoplasias resulted in the development of preventive and therapeutic 
strategies. Many of these strategies include the assistance of the hosts immune 
response. An improved understanding of of the immunological network including a 
variety of immune competent cell types, cytokines and antigen presentation 
pathways now allows the induction of defined arms of the immune response on a 
rational basis. The induction of a ceil mediated immunity seems to play a key role in 
controlling e.g. the human immunodeficiency virus (HIV) during the early and 
asymptomatic phase of HIV infection. Similar observations are true for the control of 
tumor growth by the patients cellular immune resopnse. One of the key issues to 
achieve the induction of a cell mediated in addition to a humoral immune response is 
the development of appropriate and - most importantly for future application in 
humans - safe antigen presentation systems. 

The mode of processing and presentation by antigen presenting cells (APC) 
determines which T-cell effector functions are specifically activated in an immune 
response to a protein antigen. In the most simplistic view two alternative processing 
pathways are distinguished: In the exogeneous processing pathway proteins in the 
extracellular fluid or in the cell membrane enter the APC through the endocytic 
pathway to be denatured and proteolytically degraded to peptides 12-15 residues 
long in an acid milieu at a late endosomal stage. Peptides generated in this pathway 
bind to MHC class II molecules, transit to the APC surface, and selectively stimulate 
CD4+ T cells. Immunization with soluble protein antigens thus stimulate preferentially 
CD4+ T cells (Germain, 1991; Germain and Hendrix, 1991). 
CD8+ cytotoxic T lymphocytes (CTL) are selectively stimulated in the alternative 
endogenous processing pathway. Intracellular proteins are degraded to peptides of 
an optimal 8-15 residue size in the cytosol. These peptides are transported into the 
endoplasmic reticulum (ER) where they bind to nascent MHC class I heavy chain 
I32m microglobulin dimers. This generates transport competent trimeric complexes 
that move rapidly by the default secretory route to the surface membrane of the 
APC. Peptides presented in the context of class I molecules stimulate selectively 
CD8+T ceils (Yewdell and Bennink, 1992; Townsend and Bodmer, 1989). 
An increasing unpopular way to overcome the problem of antigen delivery to the 
endogenous processing pathway is the use of live recombinant, viral vectors such as 
recombinant vaccinia or adenoviruses. However, the application of these strategies 
in compromised patients is hardly acceptable from a safety point of view. Instead, a 
number of different formats have been devised for the presentation of selected 
epitopes or proteins to the immune system by nonreplicating reagents including short 



WO 96/30523 



PCT/EP96/01433 



3 

lipopeptides, incorporation of prot ins into ISCOM particles (Takahashi et al. 1990; 
van Binnendijk et al. 1992; Larsson et al. 1993) or liposomes (Collins et al. 1992; 
Huang et ai 1992; Lopes and Chain, 1992; Nair et al. 1992; Nair et al. 1992; Reddy 
et al. 1992; Zhou et al. 1992; Chen et at. 1993) or associated with detergent type 
adjuvants like saponin (Newman et at. 1992) orsqualene (Raychaudhuri etal. 1992). 
Particulate carrier systems which were also demonstrated to induce CD8+ MHC 
class l-restricted cytotoxic T cells in vivo are mainly based on viral antigens or on the 
yeast TY-particles (Layton et al. 1993; Martin et al. 1993). These antigen 
presentation systems appear to evoke strong immune responses without need of 
additional adjuvants, but suffer from the presentation of a limited number of relevant 
"foreign 0 epitopes. 

In order to develope a nonrepiicating, recombinant HIV-vaccine, we investigated the 
possibility of constructing an antigen delivery system based on recombinant HIV-1 
PrS59 a 9 VLPs mimicking immature HIV virions. This approach allows the 
presentation of additional, selected epitopes by a highly immunogenic relevant 
carrier which has been demonstrated previously to contribute to beneficial immune 
responses by inducing inhibitory antibodies (Papsidero et al. 1989; Wagner et al. 
1992) and cytolytic T-lymphocytes (Nixon etal. 1988; Nixon etal. 1990; Phillips and 
McMichael, 1993). The formation of noninfectious, morphologically immature HIV-1 
retrovirus-like particles (VLPs) solely depends on the expression of the myristoylated 
HIV-1 gag-polyproteins (Gottlinger et at. 1989). Accordingly, the production of 
recombinant VLPs has been demonstrated by transiently (Lopes and Chain, 1992) or 
stably transfected eucaryotic cells (Krausslich et ai 1993) and after infection of 
different host cells with recombinant vaccinia- (Karacostas et al. 1993; Wagner et al. 
1991) or baculoviruses (Gheysen et al. 1989; Wagner et al. 1992). On the basis of 
these recombinant HIV-1 Pr559 a 9 VLPs, we constructed a novel per se highly 
immunogenic antigen presentation system which allows the presentation of selected, 
immunologically relevant epitopes to the immune system. 

This concept follows the construction of Pr5S9 a 9 expression cassetts allowing the 
insertion of carefully selected epitopes from HIV reading frames other than gag. 
Resulting chimeric proteins should assemble into premature VLP when expressed in 
eucaryotic cells and allow the presentation of additional imunologically relevant 
epitopes. This concept also allowes to exclude epitopes suggested to be associated 
with adverse side effects such as induction of graft versus host-like diseases, 
antibodies enhancing the infection of CD4+ cells by HIV or gp120 mediated 
apoptosis. Carefull deletion analysis within PrSS^ 3 ^ revealed two domains located 
within p24CA (aa 211-241) and within the p6LI moiety (aa 436-471), which are 
dispensable for the assembly of th mutants to prematur VLP. Consequently either 
(i) the gp120 principal neutralizing determinant V3 or (ii) the CD4-binding domain or 
(iii) a highly conserved gp41 neutralizing epitope w re inserted into these susceptible 



WO 96/30523 



PCT/EP96/01433 



4 

sites of th Pr550 a 3-d letion constructs or fus d to- the carboxyterminus of the 
complete precursor protein. Following expression of these chimeric constructs by 
recombinant baculoviruses in insect cells chimeric VLP resembling immature virions 
could be readily rescued and purified from the cell culture supematants in good 
purity and yields (Wagner et a/. 1994). 

To analyze the immunogenic potential of these antigens, different preparations of 
purified VLP have been administered in four week intervalls to four groups of rabbits, 
respectively. The immunisation with all chimeric VLPs resulted in high antibody titers 
of 1/100000 to the Pr559 a 9 carrier component. However, the induction of insert 
specific antibodies and neutralisation of the homologous virus depended critically on 
the position of the inserted epitope within the gag-carrier polypeptide. Administration 
of Pr559 a 9 VLPs with complete freund's adjuvant did not significantly increase the 
antibody titers or neutralisation potential of the resulting antisera. In comparison 
purified monomelic polypeptides have been by far less immunogenic as compared to 
the preperations of recombinant VLPs. 

For many viral infections cell mediated immunity, in particular CTL response, plays a 
crucial role in controlling diesease. There is now ample evidence to suggest that this 
may also be the case in HIV-1 infection. Brand new data from "long term non 
progressors" indicated that a broard and complex CTL response might considerably 
contribute to the control of an HIV-1 infection. The findings by Takahashi and 
coworkers demonstrating the V3-IIIB loop to contain a H2-D d restricted CTL epitope 
for BALB/c mice represents an usefull and fast accessible animal model to 
investigate the induction of a CTL response by rationally designed antigens 
(Takahashi et at. 1988). As demonstrated previously the immunisation of BALB/c 
mice with three variants of Pr550 a 9/V3 recombinant vaccinia viruses resulted in a 
strong CD8+ CTL response, irrespective of the position of the V3-loop within Pr5S9 a 9. 
This indicated that - by using a replicating vector - altered flanking sequences do not 
negatively influence processing and presentation of the V3 peptide from the tested 
chimeric polypeptides (Wagner et al. 1 993). 

However, as evidenced above, it seems to be possible to induce CD8+ CTL by 
exogenously applied lipoprotein particles, lipoproteines or liposome mediated protein 
transfer. Therefore we tested the capacity of chimeric Pr55S a 9/V3 VLP to induce a V3- 
specific CD8+ CTL response. Therefore different VLP preparations were injected either 
intraperitonealty (IP), subcutaneously (SC) and intravenously (IV) into BALB/c mice. : ive 
days post immunization, spleen cells from primed mice were transferred into culture 
and restimulated with V3 peptide-labelled syngenic P815 cells in a 5 day mixed 
lymphocyte-tumor cell culture (MLTC). After the 5 days in vitro restimulation, effector 
cells were tested for specific cytotoxic activity. Target cells in the standard 51 Cr 
release assay w r syngeneous A20 or P815 cells lab II d with a 16-m r V3 
cons nsus peptide (RIRIGPGRAFVTIGKI) previously demonstrated to be recognized 



WO 96/30523 



PCT/EP96/01433 



5 

by V3 specific CTL (Wagner et ai 1992). The induction of V3 specific CTL strictly 
depended on the dose of administered antigen ranging from 20yg to 100 ng, which 
was still considered positive. The route of adminsttration whether IP, SC or IV did not 
influence the CTL reactivity. V3 specific CTL were not only found in splenocytes, but 
in lymphnodes when tested. Immunization of BALB/c mice with naked Pr55S a fl7V3 
VLP efficiently primed the CTL response in absence of adjuvant or replicating vector 
(69% specific lysis): In contrast VLP adsorbed , to alum or emulsified in IFA only 
weakly stimulated CTL response (24%. 37% specific lysis). As demonstrated above 
for different types of Pr55ff a 0/V3 recombinant vaccinia viruses, the position of the 
V3-domain within different variants of chimeric VLP (Pr555ag/V3-3, Pr55^ a 9yV3-4, 
Pr550 a 0V3-5) did not influence the induction of a V3-specific CTL response. In 
comparison only weak priming of CTL was detected for in vivo priming with 
recombinant gp160. Immunisation of Pr550 a 0 VLP or V3-16mer peptide was not 
sufficient for priming a specific CTL response. These data clearly demonstrate that 
recombinant chimeric VLP represent useful tools for inducing a strong, specific 
CD8+/CTL response in vivo in addition to a humoral immunity. 

Recently the induction of antibodies has been proven for HIV patients as well as for 
immunized chimpanzees neutralizing a variety of different HIV strains by recognizing 
conserved conformations within the gp120 external glycoprotein (Steimer and 
Haigwood, 1991). In order to be capable of inducing this antibody population 

• in addition to an efficient CTL response 

• in complete absence of adjuvants 

• and in absence of replicating vector 

we established a novel approach, which allows stable and covalent anchoring of 
gp120 or derivatives thereoff on the surface of the recombinant HIV-virus like 
particles by a heterologous transmembrane (TM)-region. Here, we describe the 
presentation of the complete external glycoprotein or chimeric derivatives thereof to 
the immune system. In addition we extended this antigen delivery system towards 
heterologous proteins derived from viruses other than HIV such as Epstein-Barr virus 
(EBV) or equine herpesviruses (EHV-1). In all cases tested, we were able to 
demonstrate the induction of a cell mediated in addition to a humoral immune 
response in experimental animals. 



WO 96/30523 



PCI7EP96/01433 



6 

Brief summary of the invention 

Thus, the technical problem underlying the invention is to provide DNA sequences 
encoding authentic or modified polypeptides derived from HIV, or from any other 
virus, infectious agent or neoplastic cell which allow the presentation of the 
polypeptides on the surface of noninfectious retroviral virus-like particles (VLPs). 

The solution of the above technical problem is achieved by providing the 
embodiments characterized in the claims. 

Accordingly, the present invention relates to the presentation of immunologically 
important epitopes, authentic or chimeric polypeptides via noninfectious retrovirus- 
tike particles to the immune system. 

In a preferred embodiment, the retrovirus-like particulate carrier is encoded by the 
group specific antigen (gag) of a retrovirus being pathogenic to humans, subhuman 
primates or other mammals. 

In a particularly preferred embodiment the DNA sequence encoding the retrovirus- 
like particles is derived from any of the retroviruses HTLV-1 , HTLV-2, HIV-1 , HIV-2, 
SIV or FIV. 

In a further particularly preferred embodiment the gag polypeptid is pr550 a 0 of HIV-1 . 
Depending on the host organism used, the gag polypeptides spontaneously form 
said retrovirus-like particles. 

In another preferred embodiment the retrovirus-like particles, which are composed by 
retroviral gag polypeptides are spiked by additional immunologically relevant 
peptides or proteins which are presented to the immune system. 

These immunologically relevant peptides or proteins can be derived from any 
infectious agent or neoplastic cell. 

In a preferred embodiment, the proteins to be presented by the retrovirus-like 
particles represent authentic (occurring in nature) or chimeric (not occurring in 
nature) membrane proteins. 

In a particularly preferred embodiment, these membrane antigens are derived from 
different viruses such as retroviruses or herpesviruses. 

In a further specific embodiment the envelope proteins being anchored on the 
surface of a retrovirus-like particle are derived from any of the retroviruses HTLV-1, 
HTLV-2, HIV-1. HIV-2, SIV or FIV or the Epstein-Barr (EBV) virus or the equine 
herpesvirus EHV. 



WO 96/30523 



PCT7EP96/01433 



7 

Mor specifically the antigen anchored on the surface of said retrovirus-lik particles 
is the complete envelope protein gp160 of HIV-1 or th major m mbrane antigen of 
EBV gp220/350 or the herpes simplex virus gB homologue of EHV. 

In another particularly preferred embodiment, the transmembrane and cytoplasmic 
domain of a given membrane protein may be replaced by a heterologous membrane 
anchor sequence. This heterologous transmembrane domain may be encoded by 
any viral envelope protein or cellular membrane protein. 

The above mentioned transmembrane domain including a short cytoplasmic tail is 
derived from the Epstein-Barr virus major membrane antigen gp220/350. 

The DNA sequence encoding the EBV gp220/350 transmembrane domain including 
a short cytoplasmic tail is fused by a short linker sequence encoding a flexible 
glycin/serin stretch to the DNA sequence encoding different derivatives of the HIV-1 
external glycoprotein gp120. 

More specifically, a 5' DNA sequence derived from the lnterteukin-3 (IL-3) gene and 
encoding the IL-3 signal peptide is connected via a short multiple cloning site with 
the DNA sequence encoding the glycin/serin linker and the EBV gp220/350 
transmembrane anchor sequence. 

The multiple cloning site allows the insertion of any other DNA sequence encoding 
an immunologically relevant protein. 

More importantly, the NH 2 terminal fused IL-3 signal sequence induces the transport 
of the chimeric proteins via endoplasmic reticulum to the cytoplasmic membran upon 
expression of the construct in eucaryotic cells. Anchoring of said chimeric 
polypeptides in the cell membrane is achieved by the EBV gp220/350 
transmembrane anchor sequence fused to the COOH-terminus of the chimeric 
polypeptides. 

Depending on the host organism used, co-expression of the above mentioned 
retroviral gag polypeptides with authentic (occurring in nature) or chimeric (not 
occurring in nature) membrane proteins spontaneously leads to the formation 
retrovirus-like particles, which are spiked with the authentic or chimeric membrane 
proteins. 

Depending on the host organism and culture conditions used, said spiked retrovirus- 
like particlesare secreted into the cell culture supematantallowing the recovery of the 
expression product from the medium. 

Its a further specific embodiment of the invention to produce said spiked retrovirus- 
like particles (i) in a baculovirus dependent expression system in ins ct cells, (ii) in 
stably transfected Drosophila Schneider cells, (iii) in a Semliki-Forest virus driven 
expr ssion system or (iv) in any other mammalian cell line such as CHO cells. 



WO 96/30523 



PCT/EP96/01433 



8 

Polyvalent antigens which contain at least one antigenic domain are suitable for 
diagnosis of a variety of infectious agents and neoplasias based on antibodies 
binding to the antigens presentet on the surface of retrovirus-like particles. 

Said recombinant VLPs represent a pharmaceutical composition delivering at least 
one antigenic domain suitable for prevention and therapy of a variety of infectious 
agents and neoplasias to the immune system by means of inducing a humoral and 
cell mediated immune response. 

Administration of said VLPs represents a general method of preventing or treating 
HIV-infection. EBV-infection or EBV-related diseases and EHV-infection after 
administration to humans or horses in amounts sufficient to modulate or induce an 
immune response. 



WO 56/30523 PCT/EP96/01433 

9 

Bri f descrioti n of the figures 



Figure 1: Scematic drawing illustrating the construction of the plasmids encoding the 
chimeric gp160 and gp120 genes gp160, gp120/TM, gp120 5 YTM and gp12020-n*M. 

The numbers below the hatched boxes refer to the 1 st nucleotide of the coding 
region (A of ATG start codon); ^_ refers to synthetic oligonucleotides (Ol) 

(A) plin20 was generated from pUC8 by insertion of 2 annealed oligonucleotides Ol 
1 and Ol 2 (MCS = multiple cloning site of 56 nucleotides). The restriction sites 
included within the MCS are indicated. 

(B) Ol 3a and Ol 4a were synthetic oligonucleotides used to generate a PCR 
fragment encoding the IL-3 signal peptide from annealed and filled up 
oligonucleotides Ol 3 and Ol 4. The redigested 75 nucleotide (nc) PCR product was 
inserted into the EcoRI/Kspl site of plin20 to generate plin20-S. 

(C) Ol 5 and Ol 6 were used to generate a PCR fragment encoding the complete 
gp160gene lacking the 30 aa NH2-terminal signal peptide. After redigestion with 
Kspl/Pstl the resulting 2481 bp PCR fragment was inserted into plin20-S to generate 
plin20-S-gp160 

(D) Ol 7 and Ol 8 were used to generate a PCR fragment encoding a 6 aa Gly/Ser 
hinge strech, fused to the EBV gp220/350 transmembrane domaine NH2-terminus. 
The Mrol/Pstl redigested PCR fragment (153 bp in length) was inserted into the 
Mrol/Pstl site of plin20-S to generate plin20-ST. 

(E) Ol 5 and Ol 9 were used to generate a PCR fragment encoding the gp120 gene 
lacking the 30 aa NH2-terminal signal peptide. After redigestion with Kspl/Mrol the 
resulting 1431 bp PCR fragment was inserted into the Kspl/Mrol site of plin20-ST to 
generate plin20-S-gp120-T. 

Figure 2: Expression of the rgp160 and chimeric rgp120 derivatives in insect cells. 

Spodoptera frugiperda cells were infected with recombinant baculoviruses rAc160 
(lane 4), rAc120/TM (lane 5), rAcMO^fTM (lane 6) and rAc12020-/TM (lane 7) at a 
MOI of 10. For control. Sf 9 cells were either not infected (lane 1), or infected with 
wildtype baculovirus (lane 2) or a recombinant baculovirus expressing the HIV-1 
Pr550 a 0 gene product (rAcgag; lane 3). Correct expression of the different HIV-1 
gp160/120 derivatives was proven by analyzing extracts of 10 4 infected cells 
harvested 3 days p.i. by conventional Western blot analysis. Recombinant proteins 



WO 96/30523 PCT/EP96/01433 

10 

were detected by monoclonal antibodies directed to the third variable domain V3 of 
gp120 (A) (DuPont, NEA 9303) and the HIV-1 transmembraneprotein gp14 (B) 
(DuPont, NEA 9305). Positions of the molecular weight standart are given from the 
left, positions of specifically detected recombinant proteins are indicated at the right 
side of the figure. 



Figure 3: Co-expression of the chimeric HIV-1 envelope proteins in insect cells. 

For coexpressing HIV-1 Pr55$ a s with different variants of the chimeric HIV-1 
envelope proteins, HighFive insect cells were co-infected with a Pr550 a 3 recombinant 
baculovirus (rAcgag) and a recombinant baculovirus expressing one of the HIV-1 
envelope constructs rAc160 (lane 4) or rAc120/TM (lane 5) or rAc120 5 YTM (lane 6) 
or rAc120 2 °-/TM (lane 7) at a MOI of 10 for each virus, respectively. Co-expression 
of both components was demonstrated in cell lysates of co-infected insect cells by 
conventional Western blot analysis as described above by using a monoclonal 
antibody to the HIV-1 p24 capsid moiety within the Pr55ff a 0 precursor (16/4/2) (A) 
and to the gp120 V3-domain (B). Positions of the molecular weight standart are 
given from the left, positions of specifically detected recombinant proteins are 
indicated at the right side of the figure. 

Figure 4: Expression of gp160 or derivatives thereoff on the surface of recombinant 
retrovirus-like particles (VLP). 

A, B: Serum free cell culture supematants were harvested four days after co- 
infection of 10 6 HighFive insect cells with rAcgag and rAc160 (lane 4) or rAc120fi"M 
(lane 5) or rAc120/ 5 TM (lane 6) or rAc120/2°-TM (lane 7) at a MOI= 10 for each 
vims. For control, Sf 9 cells were either not infected (lane 1), or infected with wildtype 
baculovirus (lane 2) or coinfected with wildtype baculovirus and a recombinant 
baculovirus expressing the HIV-1 Pr55^ gene product (rAcgag; lane 3). The 
supematants were separated by isopycnic sucrose sedimentation analysis. 600 |xl 
aliquots were analyzed by using a commercial p24 sandwich assay (Abbott). 
Characterization of the antigenic peak fraction by immunoblotting using monoclonal 
antibodies to p24 (16/4/2) (A) and to the V3-domain within gp120 (B) revealed 
coincidence of the Pr55^ precursor and the envelope protein derivatives in it ■ 
antigenic peak fraction. C, D: Immunoprecipitations from the antigenic peak fractions 
were performed with 10 pxl of a gp120 V3-loop specific murine monoclonal antibody 
(DuPont, NEA 9303). Immunoprecipitates were separated by SDS-Page and 
analyzed after conventional western blotting. Recombinant antigens were detected 
by using using monoclonal antibodies to p24 (16/4/2) (C) and to the V3-domain 
within gp120 (D). Positions of the molecular weight standart are given from the left, 



WO 96730523 PCI7EP96/01433 

11 

positions of specifically d tected recombinant proteins are indicated at the right side 
of the figure. 



Figure 5: 

Recombinant Pr55sa»env VLP, but not HIV-1 V3-loop derived peptides primed V3- 
specific CTL from BALB/c mice. BALB/cJ mice (H-2^) were either not primed or were 
primed in vivo by a single injection of either 6pg of Pr55$ a s VLP or chimeric 
Pr55^P/env VLP or 50pg of a 16mer V3-peptide, in absence of adjuvants. The in 
vitro restimulation of CTL and cytotoxity assay was carried out as described in the 
examples. 



Figure 6: 

Virus-like particles (VLPs) spiked with gpH were generated in insect cells by co- 
infection of two different recombinant baculoviruses. 4 days p.i. supematants were 
harvested and the particles were collected by isopycnic centrifugation in a sucrose 
gradient and checked for purity by electron microscopy. Five microliters of these 
preparations were run in a 15% SDS-PAGE. transferred to nitrocellulose and probed 
with anti-HIV gag mab 16/4/2 or with anti-EHV-1 serum 528/84. HIV-VLPs produced 
by infection with rAcgag alone and harvested at 72 h p.i. were used as a control 
(lane Co). The MWs of the reactive proteins are indicated in kD. 

Figure 7: Immunoelectron microscopy of VLPs. 

VLP-gp14 preparations were adsorbed to grids and incubated with anti-gpl4 mab 
3F6. Bound mab 3F6 was detected with an anti-mouse IgG gold conjugate and and 
analyzed by electron microscopy. A representative immunogold labeled particle is 
shown. 



Figure 8: DTH response in immunized BALB/c mice 

DTH response in mice immunized with different gp14-preparations. Panel A shows 
the mean increases in ear thickness of two individual mice after i.m, immunization at 
0, 24 and 48 h post inoculation of inactivated RacL11 and uninfected cell culture 
supematants (see Materials and Methods). Panel B shows the DTH response of 
mice immunized i.nas. with the same antigens. Standard deviations ranged from 0 to 
4% and are not shown. 



W 96/30523 PCT/EP96/01433 

12 

Figure 9: 

Mean weight losses of immuniz d animals after challenge infection with wt EHV-1 at 
different days aft r challenge infection. Panel A shows the development of mean 
weights after i.m. immunization and subsequent challenge, panel B shows mean 
weights after i.nas. immunization. There were no to moderate losses in mean body 
weights in all groups except for mice immunized i.nas. with pDESl , where a marked 
reduction of mean body weights was observed after EHV-1 challenge infection. 
Values are given in percent of the scores obtained at day 0 (pre-challenge). 
Standard deviations ranged from 0 to 5.2% and are not shown. 



Figure 10: 

Mean virus titers of left lung lobes of two individual mice collected on days 1 , 3, 5, 
and 8 post challenge after i.m. (Panel A) or i.nas. immunization (Panel B). Standard 
deviations are shown as bars. The limit of detection was 10 1 PFU per organ and the 
cases where no virus from tissues was recovered is indicated by <1. Stars indicate 
that the difference of the respective mean values was significant (p<0.05) by analysis 
of variance and subsequent Bonferroni comparisons to the values obtained for BSA- 
immunized mice. 



WO 96/30523 



PCT/EP96/01433 



13 

Examples illustrating th invention 

Example 1 : Development of vector modules allowing the construction of authentic or 
chimeric membrane proteins (fig. 1). 

In order to be capable of inducing HIV-spezific neutralizing antibodies in addition to 
a HIV-envelope specific CTL response we established a novel approach, which 
allows stable and covalent anchoring of gp120 or derivatives thereoff on the surface 
of the recombinant HIV virus-like particles by a heterologous transmembrane (TM)- 
region. Using this strategy well documented immunological side effects associated 
with the gp41 transmembrane protein can be excluded. To allow stable presentation 
of HIV-1 gp120 epitopes in a correct, immunologically relevant conformation, we 
constructed recombinant bacuioviruses expressing chimeric gp1 20 derivatives, which 
are covalently linked via their COOH-termini to a heterologous type 1 
transmembrane moiety (TM) of the Epstein-Barr-Virus (EBV) gp250/350. Both 
domains are separated by a flexible (gly/ser)3 hinge region to allow independent 
folding of both domains. To avoid either unspecific cleavage of the gp120 at 
carboxyterminal cleavage sites or uncorrect folding of the entKihimeras, we 
additionally established derivatives truncated from the COOH-terminus by either five 
(gp120/5-) or 20 amino acids (gp120/20 _ ), linked to the TM. In a second set of DNA 
constructs, the original gp160/120 signal peptide encoding sequence was replaced 
by a DNA sequence encoding the signal peptide of interleukin-3 (IL-3). The 
construction of the chimeric envelope proteins was performed as follows in detail!: 

(A) Construction of plin20: In order to establish a vector system for convenient 
cloning of authentic or chimeric membrane proteins, we replaced the EcoRI/Hindlll 
multiple cloning site (MCS) by a new MCS including the restriction sites 5'-EcoRI- 
Kspl-Sacl-Bglll-Xbal-Sall-Xhol-Mrol-Pstl-3' by ligating two annealed complementary 
oligonucleotides into a EcoRI/Hindlll linearized pUC 8. The synthetic oligonucleotides 
1 and 2 (refered to as Ol 1 and Ol 2 respectively) and all additional oligonucleotides 
mentioned in the following text are given in the appendix. The Hindlll restriction site 
was disturbed by the cloning procedure. 

The following constructions were all accomplished by polymerase chain reaction 
(PCR) procedures under standard PCR conditions. Besides amplifying the desired 
nucleotide sequences, restriction sites flanking the coding regions were introduced 
for more convenient cloning procedures by means of 5 '-overhanging primers. The 
resulting reaction products were verified after subcloning by double stranded DNA 
sequenzing utilizing a 373A DNA Sequencer (Applied Biosystems). 

(B) Construction of plin20-S: The 5' 75 nucleotides of th murine int rleukin 3 (IL-3) 
gene encoding a ucaryotic signal sequence were cloned into the above described 
plin20 vector. Two overlapping synthetic oligonucleotides (Ol 3 and Ol 4) served after 



WO 96/30523 



PCT/EP96/01433 



14 

ann aling and filling up the protruding single stranded ON A sequences as template 
in a PCR (reaction 1). Two amplification primers 01 3a and Ol 4a were used to 
amplify th IL-3 leader t mplate and to introduce terminal restriction sites. The 
reaction yielded a double-stranded synthetic oligonucleotide containing a EcoRI- 
restriction site at the 5*- and a Kspl-restriction site at the 3 '-end. To generate the 
plin20-S plasmid this double-stranded oligonucleotide was cleaved with EcoRI/Kspl 
and inserted into the EcoRI/Kspl linearized plin20. 

(C) Construction of plin20-S-gp160: To construct a full-length HIV-1 gp160 gene, 
having the natural signal sequence replaced by the IL-3 signal-peptide, the plasmid 
pNL4-3 containing the entire HIV-1 genome was used as the source for amplification 
of the HIV-1 envelope glycoprotein (gp) coding sequence. Using the oligonucleotides 
5 and 6 in a PCR reaction, a 1.4 kb fragment containing a Kspl restriction site at the 
5 - and a Pstl restriction site at the 3 '-end was amplified and subsequently cloned 
into a Kspl/Pstl digested plin20-S vector. The introduction of the 5'Ksp restriction site 
into the gp 160 open reading frame resulted in a conversion of the residues 32 (E) 
and 33 (K) of HIV-1 HX-10 isolate to A, E, N. The subcloned HIV-1 gp160 fragment 
reasembles the gp160 sequence from amino acid (aa) position 31 to 856 (nucleotide 
position 6314-8791). 

(D) Construction of pfin20-ST: To generate the plin20-ST plasmid the coding region 
of the EBV gp 220/350 transmembrane (TM) domaine was amplified in a PCR 
reaction using the plasmid pBRBamHI-L as a template and the oligonucleotides 7 
and 8 as primer. Furthermore the oligonucleotides 7 and 8 introduced a Mrol 
restriction site at the 5'- and a Pstl restriction site at the 3 '-end respectively, flanking 
the EBV gp220/350 TM coding sequence. The 5'primer Ol 7 additionally 
accomplished the fusion of the Gly/Ser hinge region coding to the 5' end of the EBV 
gp220/350 TM domaine coding nucleotide-sequence. The PCR product was 
digested with Mrol/Pstl and ligated into the plin20-S vector. The position of the 
cloned EBV fragment in the virus genome is nucleotide 89433-89576 on the 
complementary strand corresponding to aa 860 - aa 907 of the EBV gp220/350 (EBV 
B95-8, Baer et al. 1984, Nature 310: 207-21 1; Genebank, accession V01555). 

(E) Construction of plin20-S-gp120 (variants) -T: For the introduction of the different 
HIV-1 gp120 derivatives (1207TM, 120 5 VTM and 120 20 VTM) into the plin20-TS 
plasmid the same source for HIV-1 coding sequences mentiond under (C) was used. 
Using the oligonucleotides 5 (5'primer) and 9a or 9b or 9c (3 'primer) in a PCR, DNA 
fragments encoding truncated HIV-1 gp120 derivatives were produced (120/TM with 
Ol 9a, 120 5 "/TM with Ol 9b and 120 20 "/TM with Ol 9c). All subgenomic fragments 
included a Kspl r striction site at th 5'- and a Mrol restriction site at th 3* -end. 
Using these r striction sites all three gp120 derivatives were subcloned into the 
plin20-ST vector. The cloned HIV-1 gp120 variants reasembl the aa sequences 
from residue 31 to r sidue 506, 502 and 487 (the corresponding nucleotide positions 



WO 96/30523 



PCT/EP96/01433 



15 

are 6314 - 7741, 7729 and 7684) for 120, 12CP7TM and 12020-/TM respectively. In 
th following text, above described gp160/120 derivatives are referred to as gp160, 
gp120/TM, gp120 5 -/TM and gp1202°-/TM. 

In an analogous procedure the HIV-1 gp160/120TM derivative constructs exhibiting 
the autologous HIV-1 signal sequence were obtained. The PCR amplifications of 
above mentioned gene segments were performed using the pNL4-3 template, one 
5'primer (Ol 10) for all four constructs (introducing a 5' EcoRI restriction site) and the 
above described 3'primer Ol 6, Ol 9a, Ol 9b or Ol 9c. The resulting DNA fragments 
were subcloned into plin20 derivatives. The gp160 original coding region (aa 1-856) 
was inserted into plin20 after EcoRI/Pstl digestion and ligation. The different gp120 
coding sequences (gp120: aa 1-506, gp1205-: aa 1-502, gp1202°-: aa 1-487) were 
subcloned into plin20-ST using the EcoRI/Mrol restriction sites. 

Oligonucleotides used: 



Ol 1 5 AATTCAATCCG CGGGAGCTCAG ATCTAGAGTCGACTCGAGTCCGGAAATCTGCAGT -3" 

Ol 2 5 '-AGCTACTGCGATTTCCGGACTCGAGTCGACTCT AGATCTGAGCTCCCGCGGATTG -3* 

Ol 3 5*-ATATTAGAATTCGCCATGCTATTACTACTTCTTATGCTATTCCATCTAGGACTACAAGCT -3 ' 

Ol 4 S*-CCTTCGCTGCAGTTCGTTCCCCGC^GTCATGTrrATGGGGTCTCGTCCTGATATTGAAG 

CTTGTAGTCCTAGATG -3* 

Ol 3a 5 '-ATATTAGAATTCGCCATGC -3' 

Ol 4a 5-ATACCTTCGCTGCAGTTCGTTCC-3* 

Ol 5 5-ATATTAGAATTCTCGAGCCGCGGAAAACTTGTGGGTCACAGTC-3' 

Ol 6 5 "-ATATTACTGCAGTTATAGCAAAATCCTTTC C-3' 

Ol 7 5 "-AT ATTATCCGGAAGCGGGGCAGG ATCCATGCTAGTACTTC AATGGGCCTCTCTG-3 " 

Ol 8 5 -ATATTACTGC AGTTATACATAGGTCTCGGCCTC -3' 

Ol 9a 5 -ATATTATCCGGACACCACTCTTCTCTTTGC -3' 

Ol 9b 5-ATATTATCCGGACTTTGCCTTGGTGGGTGCTACTCC -3* 

Ol 9c 5 ATATTATCCGGATTTATATTTATATAATTCACTTCTCC-3 " 

Ol 1 0 5 ATATTAG AATTC ATGAG AGTG AAGGAGAAATATC AGC-3 * 



Example 2: Subcloning of the chimeric HIV-1 envelope genes into the baculovirus 
transfervector pVL1393 and construction of recombinant baculoviruses. 

In order to be able of constructing recombinant baculoviruses expressing the 
chimeric HIV-1 envelope proteins in an insect cell expression system, the EcoRI/Pstl 
DNA fragments encoding the gp160 and gp120 derivatives have been subcloned into 
the EcoRI/Pstl site of the transvervector pVL1393. Plasmid DNAs have been purified 
by using a Quiagen tip 100 kit (Oiagen). Recombinant baculoviruses encoding the 
gp160 (rAc160) and gp120 (rAc120/TM, rAc120/ 5 TM t rAc120/2°-TM) derivatives 
were established and plaque purified according to standard procedures as described 
(Wagn r tal. 1994) 



WO 96/30523 



PCT/EP96/Q1433 



16 

ExampI 3: Expression of the chimeric HIV-1 envelope proteins in insect cells. 

Spodoptera frugiperda cells w re infected by recombinant baculoviruses (rAc160, 
rAc120/TM. rAc120/ 5 *TM, rAc120/2°-TM) at a MOI of 10. Correct expression of the 
different HIV-1 gp160/120 derivatives was proven by analyzing extracts of 10 4 
infected cells by conventional Western blot analysis. Briefly, the cell lysates were 
diluted in sample buffer (Sambrook et al. ( 1989), separated by electrophoresis on 10- 
12,5% SDS-polyacrylamide gels and transferred to nitrocellulose (Schleicher and 
Schuell) by electroblotting. Sheets were incubated for 1 h at RT with 10% nonfat dry 
milk in Tris-buffered saline (TBS) containing 0.05% Tween 20 (Sigma) and washed 
in TBS-Tween 20. Filters were then incubated overnight at 4°C with mabs to the third 
variable domain V3 of gp120 (DuPont 9303). After removing the antibodies, blots 
were washed twice with TBS-Tween20 and incubated for 1 h at RT with anti-mouse 
IgG-POD conjugate. Blots were washed again and substrate (4-chloro-1-naphtole) 
was added (fig. 2). Exposition of the envelope derivatives on the cell surface was 
proven by immunoflourescence analysis and confirmed by FACSscan analysis 
(tab.1). 

For that purpose infected insect cells were fixed with paraformaldehyde (1% in PBS). 
Cells were incubated with a mab directed to the V3 domain of gp120 (1/100 dilution 
in PBS), washed twice and incubated for 10 min at RT with an anti-mouse IgQ 
fluoroisothio-cyanate (FITC) conjugate. After two washes in PBS, DNA was stained 
with propidium iodide and samples were analyzed with a fluorocytometer 
(FACSscan, Becton- Dickinson) or by UV-microscopy. 

Example 4: Co-expression of the chimeric HIV-1 envelope proteins in insect cells. 

For coexpressing HIV-1 Pr550 a 0 with different variants of the chimeric HIV-1 
envelope proteins, high five insect cells were co-infected with a Pr559 a 9 recombinant 
baculovirus (rAcgag) and a recombinant baculovirus expressing one of the HIV-1 
envelope constructs depicted in fig. 1 (MOI=10 for each virus). Co-expression of both 
components was demonstrated in cell lysates of co-infected insect cells by 
conventional Western blot analysis as described above by using a monoclonal 
antibody to the HIV-1 p24 capsid moiety within the Pr55S a 0 precursor and to the 
gp120 V3 domain (fig. 3). FACSscan analysis of the co-infected cells by using the 
V3-loop specific murine monoclonal antibody demonstrated clearly that the chimeric 
gp120 derivatives including the COOH-terminal transmembrane domain of the EBV 
gp220/350 glycoprotein were incorporated into the cell membrane in 2-3 fold 
amounts if compared with the gp160 wildtype polypeptide (tab.1). 



Example 5: Analysis of particle formation. 



WO 96/30523 PCT/EP96/01433 

17 

Ultrathin sections of insect cells coexpressing Pr559 a 9 and the gp120 derivatives 
(fig. 1: gp160, gp120/TM f gp120/5-TM, gp120/20-TM) after co-infection with th 
respectiv recombinant baculoviruses revealed efficient budding of recombinant VLP 
(not shown). To further assess the nature of these VLPs serum free cell culture 
supematants were harvested four days after the co-infection of 10 6 high five insect 
cells (rAcgag and rAc160 or rAc120/TM or rAd 20/^1^1 or rAc120/2°*TM) and 
analyzed by sucrose sedimentation analysis in a gradient from 10% to 60%. 
Quantification of p24 antigen in different fractions by a commercial sandwich assay 
(Abbott) revealed retrovirus-like particles sedimenting at a density of 1.15-1.17 g/cm 3 
for all co-infections tested, which is identical to the density which has been 
demonstrated previously for mature HIV-virions. Analysis of the antigenic peak 
fraction by immunoblotting using monoclonal antibodies to p24 (16/4/2) and to the V3 
domain within gp120 revealed coincidence of the Pr559 a 9 precursor and the 
envelope protein derivatives in the antigenic peak fraction (fig. 4 A, B). 



Example 6: Expression of gp160 or derivatives thereoff on the surface of 
recombinant retrovirus-like particles (VLP). 

Expression of gp160 or derivatives thereoff on the surface of recombinant retrovirus- 
like particles was assessed by a co-immunoprecipitation analysis from the antigenic 
peak fractions of the sucrose gradients. Immunoprecipitations were performed 
according to standart procedures (Sambrook et al., 1989) with 10 fxl of a gp120 V3- 
loop specific murine monoclonal antibody (DuPont 9303) in absence of detergent. 
Immunoprecipitates were diluted in sample buffer (Sambrook et al., 1989), separated 
by electrophoresis on 10-12,5% SDS-polyacrylamide gels and transferred to 
nitrocellulose (Schleicher and Schuell) by electroblotting. Sheets were incubated for 
1 h at RT with 10% nonfat dry milk in Tris-buffered saline (TBS) containing 0.05% 
Tween20 (Sigma) and washed in TBS-Tween20. Filters were then incubated 
overnight at 4°C with mabs to p24 (16/4/2) or gp120 (fig. 4 C, D). After removing the 
antibodies, blots were washed twice with TBS-Tween20 and incubated for 1 h at RT 
with anti-mouse IgG-POD conjugate. Blots were washed again and substrate (4- 
chloro-1-naphtole) was added. As indicated in fig. 4 C and D, the Pr559 a 9 precorsor 
has been co-immunoprecipitated only from peak fractions of the sucrose 
sedimentation analysis which were derived from supematants of co-infected cells. 
This clearly indicates the gp160 or derivatives thereoff are exposed on the surface of 
the infected cells. In addition, we confirmed that co-expression of Pr55$ a 0 with the 
wild type gp160 construct significantly reduces the exposition of the envelope protein 
if compared to the chimeric derivatives of gp120 (fig. 4 C, D). 

These results wer further confirmed by immuno lectron microscopy of th VLPs. 
Immunoel ctron microscopy of VLPs was performed essentially as described by 



WO 96/30523 



FCT/EP96/01433 



18 

Czemy and Mahnel (Czerny and Mahnel, 1990). Purified VLPs were adsorbed to 
grids after fixation with 2% glutaraldehyde. Grids were washed in TBS, blocked with 
3% gelatine in TBS for 1 hour at RT, and incubated with the V3-specific mab in TBS 
for 1 hour at RT. After three washes in TBS, grids were floated on an anti-mouse IgG 
immunogold conjugate (Sigma, particle sice 5 nm) for 1 hour at RT. After three 
washes (TBS) grids were contrasted with phosphoric tungstic acid and examined in 
an electron microscope (Zeiss EM 10C/CR). 

Example 7: Purification of recombinant VLPs 

VLPs were generated by co-infection of HighFive cells with a multiplicity of infection 
(MOl) of 1 per cell with the recombinant baculoviruses expressing gp160 (rAc160), 
gp120 or dervatives thereoff (rAc120/TM, rAc^O/STM, rAcl20/2°TM) and rAcgag, 
the latter encoding the HIV 55 kD gag protein Pr550agf. Supematants of infected 
HighFive cells were collected 4 days p.i. t purified by isopycnic sucrose gradient 
centrifugation as described above, and checked for purity and absence of 
baculoviruses by electron microscopy. After dilution of the baculovirus-free fractions 
VLP were pelletted by centrifugation in a TFT 41.14 rotor in Kontron centrifuge and 
resuspended PBS. 

Example 8: Induction of a humoral immune response by recombinant VLPs. 

To asses the capability of different VLP preparations to induce an adequate humoral 
immune response, rabbits immunized each with 20 \ig of *he the chimeric particles in 
four week intervalls in complete absence of adjuvants (Tab. 2). Determination of 
ELISA antibody titers and quantification of neutralizing activity of the indicated 
antisera was performed as follows: 

Antigen ELISA: Micro-ELISA plates (Greiner, Frickenhausen, Germany) were coated 
with 500 ng HIV-1 HX10 lysate, 500 ng recombinant p24, 80 ng rgp120 or 300 ng 
V3-peptide (36mer)/well in 50pl 0.05 M sodium carbonate puffer pH 9.5 at 4°C 
overnight in a wetchamber. Sera diluted 1:10 to 1:1000 in PBS with 3% FCS and 2% 
Tween-20 were added to the coated wells. After incubation for 2 hours at 37°C the 
plates were washed 5 times. Bound antibody was detected with horseradish 
peroxidase-conjugated anti-rabbit antibody (Dakopatts, Copenhagen, Denmark) at a 
dilution of 1:1000, followed by incubation with o-phenylendiamine-0.01% hydrogen 
peroxide in phosphate buffered saline (pH 6.0). The reaction was stopped by adding 
1 M H2SO4 and read at 492 nm. Values above the mean optical density +3 SD of 
negative controls were considered positive. All rabbits immunized with recombinant 
VLPs dev lop d high titers of antibodi s ranging from 1/64000 to the Pr55S a 9 carri r 



WO 96/30523 PCI7EP96/01433 

19 

component to 1/64000-1/32000 towards purified gp120. Only low titers (1/256) to a 
36 amino acid peptide representing the homologous V3-peptide hav been detected. 

HIV-1 neutralisation assays: Serial twofold dilutions of heat inactivated serum were 
incubated for 1 .5 h at 37°C with 50 TCID50 of HIV ' 1 HX10-strain produced on MT4 
cells. The virus-serum mixture was incubated for 1h at 37°C with 5x1 0 4 MT4 
suspension cells. After virus adsorbtion, the unbound virus was removed and 100 pi 
of medium (RPMI-1640 supplemented with 10% FCS) was added to each well. 7 
days p.i., 100 pi of supernatant medium was removed in order to quantify the amount 
of virions released from the cells using a commercial p24 sandwich assay (Abbott 
Laboratories, Chicago III.). Neutralisation titres were calculated by comparison with 
control wells of virus only and are expressed as the reciprocal of the highest serum 
dilution that inhibited p24 production and release by more than 90 %. Sera from 
rabbits obtained after 3 immunisations were used for the neutralisation assay. As 
shown in table 2 all of the sera showed neutralization titers in a range of 1:128 to 
1:256, depending to the PrSSfl^/env preperation used for immunisation. 

Example 9: Induction of a cell mediated immune response by recombinant VLPs 

The findings by Takahashi and coworkers demonstrating the V3-IIIB loop to contain 
a H2-D d restricted CTL epitope for BALB/c mice represents an usefull and fast 
accessible animal model to investigate the induction of a CTL response by rationally 
designed antigens (Takahashi et ai 1988). As demonstrated previously the 
immunisation of BALB/c mice with three variants of Pr550 a 3/V3 recombinant 
vaccinia viruses resulted in a strong CD8+ CTL response, irrespective of the position 
of the V3-loop within Pr550 a 0 (Wagner et af. 1 993). 

To study the capability of the chimeric gag/env VLP to induce cytotoxic T- 
lymphocytes in vivo, BALB/cJ mice (H-2 d ) were immunized with 10pg of the different 
gag/env hybrid VLP in complete absence of adjuvants or replicating vector. For 
control BALB/c mice were injected with 50pg of a 16mer V3-peptide 
(RIQRGPGRAFVTIGKI) or 10pg of Pr550 a 0 VLP only. Lymphoid cells were 
prepared from immuniced mice 6 days post immunisation and cocultivated with 
syngenic V3-16mer peptide labelled syngenic P815 cells, irradiated with 20000rad. A 
control group included unprimed BALB/c cells stimulated in vitro with V3 peptide 
labelled P815 cells. Cytotoxic effector cell populations were harvested after 5 days of 
in vitro culture. The cytotoxic response was determined against the syngenic target 
cell line A20 pulsed for 1h with lO'^M V3-16mer peptide. Negative controls were not 
pulsed target A20 cells in a standard 51 Cr release test. Neither the synthetic V3- 
peptide nor Pr559 a 9 VLP were sufficient to prime an adequat V3-specific CTL 
response. A comparably weak CTL respons could be demonstrated aft r 
administration of purified gp160 (fig.5). These data clearly indicat , that anchoring of 



WO 96/30523 



PCT/EP96/01433 



gp160 or derivativ s thereoff on the surface of recombinant Pr550 a 9 VLPs results in 
a favourable antigen presentation, which is capable of inducing a highly efficient CTL 
response to the presented membrane proteins. 



Example 10: Presentation of membrane proteins derived from other viruses than 
HIV-1 by recombinant VLPs: The equine herpesvirus gp14 (gB) 

VLPs were generated by. co-infection of HighFtve cells with a multiplicity of infection 
(MOI) of 1 per cell with the recombinant baculoviruses rAd 7-11 expressing the EHV 
gp14 membrane protein (Osterrieder et at. 1994) and rAcgag, the latter encoding the 
HIV 55 kD gag protein PrSSiW. In a first series of experiments, the time point of 
maximal load of the VLPs with recombinant gp14 was determined. Supematants of 
infected HighFive cells were collected at different times p.i., purified by isopycnic 
sucrose gradient centrifugation, and checked for purity and absence of baculoviruses 
by electron microscopy. Five-microliter aliquots of the resuspended VLPs were 
separated by PAGE, immunoblotted and detected with both anti-p24 mab 16/4/2 and 
horse serum 528/84. HIV-gag was present at nearly constant levels in the 
preparations from 12 h p.L, but gp14 was first detected on the VLPs at 36 h p.i. and 
reached a maximal load at 72 h p.i. (fig. 6). For all further studies, particles were 
harvested at 72 h p.L 

To further demonstrate that the gp14 not only co-purified with the VLPs but was 
incorporated into the particles, fluorocytometric studies were performed. Anti-gag 
mab1 6/4/2 and anti-gp14 mab 4B6 precipitated the VLPs as shown by the reciprocal 
reaction with biotinylated mabs 4B6 and 16/4/2. In the next experiments we 
addressed the question why gp14 was present on the VLPs although the 
transmembrane and cytoplasmic domain of the protein had been deleted. As shown 
previously, the recombinant gp14 could be demonstrated in the cytoplasm of rAc17- 
11 infected HighFive cells from 12 h p.i. and was present on the surface of insect 
cells from 24 h p.i. reaching a maximum at 72 h p.i. (Osterneder et a/. 1994). The 
protein remained on the surface of infected ceils up to 120 h p.i. when almost ail 
insect cells were dead as determined by trypan blue stain (data not shown). These 
results indicated that despite the truncation of gp14, the glycoprotein was stably 
present in the membrane of insect cells and that the transmembrane and 
cytoplasmic domain are dispensable for retaining of gp14 on the cytoplasmatic 
membrane in the insect cell system. 

These results were further confirmed by immunoelectron microscopy (Zeiss EM 
10C/CR) of the VLPs as described above for the gag/env chimeric VLPs by using an 
anti-gp14 mab 3F6 (fig.7). 



WO 96/30523 PCTVEP96/01433 

21 

Example 11: Humoral immun response to recombinant gp 1 4 induced by chimeric 
VLPs in comparison to other antigen formulations 

Different antigen preparations were compared with respect to the induction of a 
humoral, cell mediated and potential protective immune response. For that purpose, 
BALB/C mice were immunized with 



10 ^g of pCEP-8-gp14 (rgp14 exressed in and purified from E.Coli; 

(Osterrieder etal. 1994)) 

of rAc17-1 1-gp14 (rgp14 exressed in and purified from insect 
cells after infection with a gp1 4 recombinant baculovirus; 
(Osterrieder etal. 1994)) 

of VLP-gp14 (recombinant HIV-1 Pr55^ VLPs presenting 
gp14 on their surface) 

BSA 

50 ^g of pDES-gp14 (DNA vaccine; pcDN A/Amp (Invitrogen) derived 

expression plasmid containing the EHV-1 gp14 without its 
transmembrane and cytoplasmic domain under the control of 
the CMV immediate early promotor; Osterrieder et al. v in press) 

1 06.5PFU RacL1 1 (Mayr et al. ( 1 968) 
1 06.5RFU RacH (Mayr et al. f 1 968) 



The ELISA and NT antibody titres obtained for the specific gp14-formulations in 
immunized mice are summarized in table 3. The highest ELISA and NT antibody 
titres were observed after im. and inas. immunization with gp14-spiked VLPs. The 
ELISA antibody titres were even higher than those obtained after Lm. and i.nas. 
application of live EHV-1 virus (RacL11; RacH). Intramuscular immunization with 
purified gp14 produced with gp14 purified from the supematants of insect cells 4 
days p.i. with a gp14 recombinant baculovirus (rAc!7-1 1) gave rise to antibody levels 
comparable to those of the VLPs, but the titres observed after i. nas. immunization 
were significantly lower. Immunization with both the gp14 expressed in £ coli 
(pCEP-8-gp14) or with the pDESl-gp14 DNA vaccine yielded weak ELISA titers and 
no neutralizing antibodies could be demonstrated after inas immunization with both 
formulations. 



Example 12: DTH response to recombinant gp14 induced by chimeric 
VLPs in comparison to other antigen formulations 



W 96/30523 PCT/EP96/01433 

22 

The DTH response aft r immunization with the various recombinants was assayed 
by d termining the increas in ear thickness of two individual mice at different time 
points post inoculation (p. inoc.) of inactivated antigen into the ear pinna. At 24 h 
p.inoc., a readily detectable increase in ear thickness was observed in mice 
immunized with VLPs and the E.Coli derived gp14 (pCEP-8-gp14) via the i.m. and 
i.nas route. This reaction was decreasing at 48 h p.inoc. A marked increase in ear 
thickness was also observed in mice immunized i.m. with purified gp14 produced by 
rAc17-11 in insect cells and with the pDESl DNA vaccine. In contrast, a weak DTH 
reaction was detectable after i.nas. immunization with these two gp14 formulations. 
The results of the comparative DTH tests are summarized in Fig. 8. 

Example 13: Clinical observations in mice immunized with gp14 chimeric VLPs 
in comparison to other antigen formulations after challenge with wt- 
EHV-1 

Immunized mice were challenged inas with 106.5 PFU of EHV-1 wt strain RacL11. 
All mice immunized with BSA developed signs of illness such as ruffled fur, 
respiratory symptoms, and hunched posture associated with a dramatic loss of body 
weight of up to 23% by day 2 after challenge infection. Similar observations have 
been reported for EHV-1 strain Ab4 (A wan etal. 1990). 

In contrast to others (Awan et al. 1990; Inazu et a/. 1993), no deaths in BSA- 
immunized mice were observed after challenge infection and animals recovered from 
the weight losses by day 4/5 p.chall. but did not reach the preinfection weight until 
day 8 p.chall. In contrast, no or only a mild (up to 6%) decrease in the mean body 
weights was observed after challenge infection of mice immunized im with all 
recombinant gp 14 formulations and subsequent challenge infection. In mice 
immunized im with pDESl DNA vaccine, however, one individual mouse exhibited 
ruffled fur, dyspnoea, and a body weight loss of 15% on Day 4 p.chall.. Similarly, no 
or mild mean body weight depression was observed in mice immunized inas with the 
VLP-gp14 preparation and the recombinant gp14 produced by rAc17-1 1. In pCEP-8- 
gp14- and pDES-1 immunized mice, one and two individual animals, respectively, 
showed signs of illness and body weight losses of up to 20% after challenge infection 
was seen in mice previously infected inas with the live virus strains RacL1 1 or RacH 
(fig. 9). 

Example 14; Virus reisolation from mice immunized with gp14 chimeric VLPs 

in comparison to other antigen formulations after challenge with wt- 
EHV-1 

After challenge infection, virus was recovered from lungs of two individual mice killed 
on days 1, 3, 5 and 8 p. chall., respectively. A significant (<0.05) reduction of lung 



WO 96/30523 PCT/EP96/01433 

23 

virus titers (103 PFU/lung) on all days p.chall. was observed in mice pr viously 
infected i.m. or i.nas. with liv virus strains RacL11 and RacH when compared to 
BSA-immunized mice. From day 3 p.chall. on, virus titers were below 10 1 pfu/organ 
in the mouse groups immunized with live virus and differed significantly from the 
means of BSA immunized mice from day 1 to 8 p.chall. (Fig. 10). The most obvious 
and marked decrease in virus recovery from lungs after immunization with 
recombinant gp14 preparations was seen after i.m. and i.nas. immunization with the 
VLPs spiked with gpU. On day 1 p.chall.. mean virus titers of groups 9 and 10 
(Table 3) reached values of around 10 4 PFU/organ, a more than 100-fold reduction 
compared to BSA immunized mice. From day 3 p.chall., virus titers in lungs were 
below 10 PFU/organ, both after previous im and inas immunization. This reduction 
of virus load was obtained although the antigen preparation was not emulsified in 
Freund's adjuvant prior to im. immunization (Table 3). Moreover, the means of lung 
virus titers were reduced significantly (p<0.05) when compared to BSA-immunized 
mice on all days p.chall.. After immunization with purified rAc17-11-gpl4 (insect cell 
derived gp14), a significant reduction (p<0.05) in virus load of mouse lungs was seen 
after i.m. immunization (emulsified in Freund's adjuvant) from day 3 p.chall.. After 
i.nas. immunization with that antigen, virus titers recovered from lungs were higher 
compared to those after immunization with RacL, RacH or the VLPs, but we were not 
able to demonstrate any virus on day 5 p.chall.. In pCEP-8-gp14 (E.Coli derived 
gp14) immunized mice, protection against challenge infection appeared to be 
efficient after both im. and inas. immunization. The virus titres in lungs were in 
general comparable to those seen in insect cell derived gp14 (rAc17-11gp14) 
immunized mice and were also reduced significantly after i.m. and i.nas. 
immunization from day 3 p.chall. (p<0.05). The lowest - but still significant - 
reductions in lung vims titres on days 3, 5, and 8 p.chall. were observed in mice 
immunized i.nas. and i.m. with 50 pg pDES1-DNA vaccine (Fig. 10). 

In summary, mice immunized with gp14-spiked VLPs both i.m. and i.nas. were found 
to be best protected against subsequent EHV-1 challenge. 



WO 96/30523 



PCT7EP96/01433 



24 



J3 



0) 

a. 

O 0) 

> > 
£ g 

X a 

o co 

■z O 
0 < 

E 

M 

o £ 

'55 <j> 

0 0) 

s.° 

x w 
Ui .E 

I? 

t: a. 

CO 



a 

w 



o 

CO 

a 

in 
q. 

CD 



o 
o * 

m 



c 

(0 
0) 

E 



0) 

a 
a> 



i2 

a> 

a 



CM 



05 S (O 
CO CM CM 



CM N O 

a) o 
cm co 



CO 
CO 



■o 

£ 
T5 



m 



o 
c 



in 



OQ 



o ? 



2 

CM 



CM 



C 

o 

• mm 

o 

0) 



CD 



CD 



Ql 



m CD ° 



CO 



co o) t- m 

CO CD LO - 



X 
2 



in 



CM I s - CM 
O) O) N 
CM 1- <r- 



co cd in 
co o) co m 



CO 

05 



f- O CO 
00 05 CO 
CM 1- «r- 



o 

CD 

Q. 
1 

CD 

LO 

in 
^» 

a. 

1 

CD 



O 
CM 

T— 

O) 
1 

00 
55 

a. 

1 

CD 



m 

CM 
Q. 
1 

CD 

in 
in 

m 



O 
CM 

O 
CM 

1 

m 

in 

in 
w. 

I 

co 



WO 96/30523 PCT/EP96/01433 

25 

Table 2: Antibody response induced by Pr55gag/env chimeric VLPs 







Ab-titer° 






Vaccine 3 


HTV-lvsate 


p24 


gp!20 


V3 


Pr55*°« 
pr55* fl */gpl60 
Pr55SOf/gpl20TM 
Pr55* ffl «/gpl205-/TM 
Pr55* a */gpi2020-/TM 


3.2X10 4 
6.4X10 4 
3.2X10 4 
1.6X10 4 
1.6X10 4 


3.2x10* 
6.4x10* 
3.2x10* 
1.6x10* 
3.2x10* 


6.4x10* 
3.2x10* 
1.6x10* 
1.6x10* 


<16 
<16 
<16 
256 



NT C 



1:256 
1:256 
1:256 
1:128 

a Rabbits received 10 u,g the chimeric VLP preparations in absence of any adjuvants 

b Serum antibody levels were tested by ELISA three weeks after the second booster immunization and 
expressed reciprocal of the dilution that gave rise to one half the maximal density at 492 nm 
(midpoint tire). The antibody levels were determined against various antieens such as HIV- 1 lysate. 
rp24, rgpl20 and a synthetic V3 peptide (36-merj. Titers below 1/16 were considered to be unspecific 
and reactions counted as negative. 

c Reciprocal of the highest serum dilution that inhibited p24 production bv more than 90% 7 days p.i. 
were classified as neutralizing. 



WO 96/30523 



PCTYEP96/01433 



26 



Z (0 



If) 
< CO> 
CO >, 



cn 

Z 

CO 



^5 CO 

< 5 



CD 



CO 
-J 

tu 

1 

CO 



2 -.a 
ro o c 
to r 
>» c 

CO - 



CD 
tn 

g C = 

£ 
c 

O) 



tt) 



£ 3 C 

: °E 

o c:^= 

(A 
OJ 

T3 

CD 
-C 

u 
(/> 

c 
o 

His c 

CD m 

II 

e 

CO CD 

o> £ §■ 
.a o o 
2 5 & 



CM CN 
O O 

w I en 



UJ 
C I O 



CD 



O L 

c < 
£ CO 



o 8 

o 

n co 

% 8 

cm X 

o c 

T3 * 



II 

xj o 
£=> °- 
E T) 

"Si ® 

.2. 

V £ 
c a) 

> tn 

2 
• o 

> o 
X « 
UJ -a 

*s 

11 
is 

■a ■ 

C CO 

E £ 
S £ 

a $ 

■o ? 

<D in 

!» CD 

1 c 

2| 

2 o 

cn 

3< 

_f c 
LU O 

1 1 
O XJ 

UJ T- 



o 

CO 



c 
o 



£ 3 =■ 

o c o 

CD 3 *- 

10 E ^ 

"S 1 a 

r- CD _ 

2 CD w CO 

cd ? o tr 

CO 

"B TO ~" ° 



in 
C 

o 



CO t- 

5 - 



_ _ CO 



81 



22 £ c 5 
.§ I 2 J 

1-8 ^ °- 



a 3 T3 

8-3 



III s < 

« ^ 5 5 co 

E ' 

CD 



9 2 
o 



CD 

a) £ 

CD 



(0 O 



£ 3: 
0-, 



to 5} 

' CD £ n 

in — > = o 

*n ^ 
c 

CO 



Z 5 

> m a> c 

m *- 3 5 

• 5P -Q 

in . o m q_ 

0 o CO* c o 

« o 5 B g o 

*5 — CO 2- ^ 

1 ? «» § "-o 

1 1 * s s » 

cog 2 eb> 

s -o I I 8 c 

« a) -5. .£ .E«o 

>> ^ z ^ CM g 

2 z c 5 5-8 
S OT E £ BE 



SUBSTITUTE SHEET (RULE 26) 



WO 96/30523 



27 

Refer nces 



PCT/EP96/01433 



Awan, A. R., Chong, Y. C. ( and Field. H. J.(1990). The pathog nesis of equin 
herpesvirus type 1 in the mouse: a new model for studying host responses to the 
infection. J. Gen. Virol. 71, 1131-1140. 

Chen ( W. , Carbone, F. R., and McCluskey, J. (1993). Electroporation and 
commercial liposomes efficiently deliver soluble protein into the MHC class I 
presentation pathway. Priming in vitro and in vivo for class l-restricted recognition of 
soluble antigen. J. Immunol Methods 160, 49-57. 

Collins, D. S„ Findlay, K. , and Harding, C. V.(1992). Processing of exogenous 
liposome-encapsulated antigens in vivo generates class I MHC-restricted T cell 
responses. J. Immunol. 148, 3336-3341. 

Czemy, C. P. and Mahnel, H. (1990). Structural and functional analysis of 
orthopoxvirus epitopes with neutralizing monoclonal antibodies. J. Gen. Virol. 71, 
2341-2352. 

Germain, R. N.(1991).. Antigen presentation. The second class story [news; 
comment]. Nature 353, 605-607. 

Germain, R. N. and Hendrix, L R.(1991). MHC class II structure, occupancy and 
surface expression determined by post-endoplasmic reticulum antigen binding. 
Nature 353, 134-139. 

Gheysen, D. , Jacobs, E. , de Foresta, F. , Thiriart, C. , Francotte, M. , Thines, D. t 
and De Wilde, M. (1989). Assembly and release of HIV-1 precursor Pr55gag virus- 
like particles from recombinant baculovirus-infected insect cells. Ce//59, 103-1 12. 

Gottlinger, H. G., Sodroski, J. G. t and Haseitine, W. A.(1989). Role of capsid 
precursor processing and myristoylation in morphogenesis and infectivity of human 
immunodeficiency virus type 1 . Proc. Natl. Acad. Sci. U. S. A. 86, 5781-5785. 

Huang, L. , Reddy, R. , Nair, S. K. t Zhou, F. , and Rouse, B. T.(1992). Liposomal 
delivery of soluble protein antigens for class I MHC-mediated antigen presentation. 
Res. Immunol. 143, 192-196. 

Inazu, M. , Tsuha, O. , Kirisawa, R. , Kawakami, Y. , and Iwai, H. (1993). Equid 
herpesvirus 1 infection in mice. J. Vet Med. Sci. 55, 1 19-121 . 

Karacostas, V. , Wolffe, E. J. t Nagashima, K. , Gonda, M. A. t and Moss, B. (1993). 
Overexpression of the HIV-1 gag-pol poiyprotein results in intracellular activation of 
HIV-1 protease and inhibition of assembly and budding of virus-like particles. 
Virology 193, 661-671. 

Krausslich, H. G. f Ochsenbauer, C. , Traenckner, A. M., Mergener, K. , Facke, M. , 
Gelderblom, H. R., and Bosch, V. (1993). Analysis of protein expression and virus- 
like particle formation in mammalian cell lines stably expressing HIV-1 gag and env 
gene products with or without activ HIV proteinase. Virology 1 92, 605-61 7. 



WO 96/30523 



PCI7EP96/01433 



28 

tarsson, M. , Lovgren. K. , and Morein f B. (1993). Immunopotentiation of synthetic 
oligopeptides by chemical conjugation to iscoms. J. Immunol. Methods 162, 257- 
260. 

Layton, G. T., Harris, S. J., Gearing, A. J., Hill Perkins, M. , Cole, J. S., Griffiths, J. 
C f Bums, N. R., Kingsman, A. J., and Adams, S. E.(1993). Induction of HIV-specific 
cytotoxic T lymphocytes in vivo with hybrid HIV-1 V3:Ty-virus-like particles. J. 
Immunol. 151, 1097-1107. 

Lopes, L M. and Chain, B. M.(1992). Liposome-mediated delivery stimulates a class 
l-restricted cytotoxic T cell response to soluble antigen. Eur. J. Immunol. 22, 2 C7 - 
290. 

Martin, S. J., Vyakamam, A. , Cheingsong Popov, R. , Callow, D. , Jones, K. L, 
Senior, J. M., Adams, S. E., Kingsman, A. J M Matear, P. , Gotch, F. M., and et 
(1993). Immunization of human HIV-seronegative volunteers with recombinant 
p17/p24:Ty virus-like particles elicits HIV-1 p24-specific cellular and humoral immune 
responses. AIDS 7, 1315-1323. 

Nair, S. , Zhou, F. , Reddy, R. , Huang, L , and Rouse, B. T.(1992). Soluble proteins 
delivered to dendritic cells via pH-sensitive liposomes induce primary cytotoxic T 
lymphocyte responses in vitro. J. Exp. Med. 175, 609-612. 

Nair, S. , Zhou, X. , Huang, L. , and Rouse, B. T.(1992). Class I restricted CTL 
recognition of a soluble protein delivered by liposomes containing lipophilic 
polylysines. J. Immunol. Methods 152, 237-243. 

Newman, M. J., Wu, J. Y. f Gardner, B. H., Munroe, K. J., Leombruno, D. , Recchia, 
J. , Kensil, C. R., and Coughlin, R. T.(1992). Saponin adjuvant induction of 
ovalbumin-specific CD8+ cytotoxic T lymphocyte responses. J. Immunol. 148, 2357- 
2362. 

Nixon, D. F., Huet, S. , Rothbard, J. , Kieny, M. P., Delchambre, M. , Thiriart, C. , 
Rizza, C. R., Gotch, F. M., and McMichael, A. J.(1990). An HIV-1 and HIV-2 cross- 
reactive cytotoxic T-cell epitope. AIDS 4, 841-845. 

Nixon, D. F., Townsend, A. R., Elvin, J. G., Rizza, C. R., Gallwey, J. . and 
McMichael, A. J.(1988). HIV-1 gag-specific cytotoxic T lymphocytes defined with 
recombinant vaccinia virus and synthetic peptides. Nature 336, 484-487. 

Osterrieder, N. , Wagner, R. , Pfeffer, M. , and Kaaden, O. R.(1994). Expression of 
equine herpesvirus type 1 glycoprotein gp14 in Escherichia coli and in insect cells: a 
comparative study on protein processing and humoral immune responses. J. Gen. 
Virol. 75, 2041-2046. 

Papsidero, L D., Sheu, M. , and Ruscetti, F. W.(1989), Human immunodeficier ' 
virus type 1 -neutralizing monoclonal antibodies which react with p17 core prote 
characterization and epitope mapping. J. Virol. 63, 267-272. 



Phillips, R. E. and McMichael, A. J.(1993). How does the HIV escape cytotoxic T cell 
immunity?. Chem. Immunol. 56, 150-164. 



WO PCT/EP96/01433 

29 

Raychaudhuri, S. , Tonks. M. . Carbone, R , Ryskamp, T. , Morrow, W. J. f and 
Hanna t N. (1992). Induction of antigen-specific class l-restricted cytotoxic T cells by 
soluble proteins in vivo. Proc. Natl. Acad. ScL U. S. A. 89. 8308-8312. 

Reddy, R. , Nair, S. , Brynestad. K. , and Rouse, B. T.(1992). Liposomes as antigen 
delivery systems in viral immunity. Semin. Immunol. 4, 91-96. 

Sambrook. I., Fritsch, E. R and Maniatis, T. (1989) Molecular cloning; a laboratory 
manual. Cold Spring Harbor Press 

Smith G. E, Ericson B. L, Moschera J., Lahm H. W., Chizzonite R., Summers M. D. 
(1985) Modification and secretion of of human interleukin 2 produced in insect cells 
by a baculovirus expression vector. Proc. Natl. Acad ScL USA. 82:8404-8408 

Steimer, K. S. and Haigwood, N. L(1991), Importance of conformation on the 
neutralizing antibody response to HIV-1 gp120. Bio techno!. Ther. 2, 63-89. 

Takahashi, H. , Cohen, J. , Hosmalin. A. , Cease, K. B., Houghten, R. , Comette, J. 
L, DeLlsi, C. , Moss, B. , Germain, R. N., and Benzofsky, J. A.(1988). An 
immunodominant epitope of the human immunodeficiency vims envelope 
glycoprotein gp160 recognized by class I major histocompatibility complex molecule- 
restricted murine cytotoxic T lymphocytes. Proc. Natl. Acad. ScL U. S. A 85 3105- 
3109. 

Takahashi, H. , Takeshita, T. , Morein, B. , Putney, S. , Germain, R. N„ and 
Berzofsky, J. A.(1990). Induction of CD8+ cytotoxic T cells by immunization with 
purified HIV-1 envelope protein in ISCOMs [see comments]. Nature 344, 873-875. 

Townsend, A. and Bodmer, H. (1989). Antigen recognition by class l-restricted T 
lymphocytes. Annu. Rev. Immunol. 7, 601-624. 

van Binnendijk, R. S., van Baaien, C. A. f Poelen, M. C, de Vries, P. , Boes, J. , 
Cerundolo,. V. , Osterhaus. A. D. t and Uytdehaag, F. G.(1992). Measles virus 
transmembrane fusion protein synthesized de novo or presented in 
immunostimulating complexes is endogenously processed for HLA class I- and class 
ll-restricted cytotoxic T cell recognition. J. Exp. Med. 176, 1 19-128. 

Wagner, R. , Boltz, T. , Demi, L , Modrow, S. , and Wolf, H. (1993). Induction of 
cytolytic T lymphocytes directed towards the V3 loop of the human immunodeficiency 
virus type 1 external glycoprotein gp120 by p55gag/V3 chimeric vaccinia viruses. J. 
Gen. Virol. 74, 1261-1269. 

Wagner, R. , Demi, L , Fliessbach, H. , Wanner, G. , and Wolf, H. (1994). Assembly 
and extracellular release of chimeric HIV-1 Pr55gag retrovirus-like particles. Virology 
200, 162-175. 

Wagner, R. , Fliessbach, H. . Modrow, S. , von Brunn, A. , Wolf, H. , Boelz, T. , and 
Gel$lerblom, H. (1991). Modem approaches to new vaccines including prevention of 
AIDS. In "Vaccines STfChanock, R. M., Ginsberg, H. S. f Brown, F. , and Lemer, R. 
A. -., Eds.) Cold Spring Habour Laboratory, Cold Spring Habour, NY. . 109-1 14. 

Wagner, R. , Fliessbach, H. , Wanner, G. , Motz, M. , Niedrig, M. , Deby, G. , von 
Brunn, A. , and Wolf, H. (1992). Studies on processing, particle formation, and 



WO 96/30523 



PCI7EP96/01433 



30 

immunogenicity of the HIV-1 gag gen product: a possible component of a HIV 
vaccin . Arch. ViroL 127, 117-137. 

Wagner, R. , Modrow, S. , Boltz, T. , Firessbach, H. , Niedrig, M. , von Brunn, A. , 
and Wolf, H. (1992). Immunological reactivity of a human immunodeficiency virus 
type I derived peptide representing a consensus sequence of the GP120 major 
neutralizing region V3. Arch. ViroL 127, 139-152. 

Yewdell, J. W. and Bennink, J. R.(1992). Cell biology of antigen processing and 
presentation to major histocompatibility complex class I molecule-restricted T 
lymphocytes. Adv. Immunol. 52, 1-123. 

Zhou, F. , Rouse, B. T., and Huang, L. (1992). Induction of cytotoxic T lymphocytes 
in vivo with protein antigen entrapped in membranous vehicles. J. Immunol 149 
1599-1604. 



WO 96/30523 



PCT7EP96/01433 



CLAIMS 



1 . An antigen presentation system comprising: 

(a) a DNA sequence encoding a protein capable of self assembly into 
proteinaceous particles without a lipid membrane, preferably a 
retroviral group specific antigen (gag) capable of forming a 
particulate structure when expressed in a host cell and of being 
delivered into the extracellular medium; and 

(b) a DNA sequence encoding 

(ba) a signal peptide; and operatively linked thereto 

(bb) an extracellular domain of a polypeptide; 
(be) a transmembrane region; and 

(bd) a cytoplasmic region which does not comprise the amino acid 
sequence that mediates a specific interaction with the matrix 
protein: 

wherein said DNA sequences (a) and (b) are together expressible in a 
suitable host cell. 

2. The antigen presentation system according to claim 1 , wherein the signal 
sequence and/or the transmembrane region and/or the cytoplasmic region 
are heterologous with regard to the extracellular domain. 

3. The antigen presentation system according to claim 1, wherein the signal 

* 

sequence and/or the transmembrane region and/or the cytoplasmic region 
are autologous with regard to the extracellular domain. 



WO 96/30523 



PCT/EP96/01433 



32 

4. The antigen pr s ntation system according to any one of claims 1 to 3, 
wherein interactive sites of the cytoplasmic amino acid sequence have been 
deleted. 

5. The antigen presentation system according to any one of claims 1 to 3, 
wherein said amino acid sequence in said cytoplasmic domain has been 
mutagenized so as to not mediate the specific interaction with the matrix 
protein. 

6. The antigen presentation system according to any one of claims 1 to 5, 
wherein said extracellular domain of a polypeptide is derived from a 
pathogenic agent. 

7. The antigen presentation system according to claim 6, wherein said 
pathogenic agent is a virus, a bacterium, a prion or a neoplastic cell. 

8. The antigen presentation system according to claim 7, wherein said virus is 
HIV-1, HIV-2, HTLV-1, HTLV-2, SIV or FIV, Epstein-Barr virus or a herpes 
virus such as equine herpes virus. 

9. The antigen presentation system according to any one of claims 6 to 8 f 
wherein said extracellular domain of said polypeptide is an authentic 
extracellular domain. 

10. The antigen presentation system according to any one of claims 6 to 8, 
wherein said extracellular domain of said polypeptide is a non-authentic 
extracellular domain and preferably a chimeric extracellular domain. 

11. The antigen presentation system according to any one of claims 7 to 10, 
wherein said extracellular domain is derived from an env protein. 



WO 96/30523 



PC1/EP96/01433 



33 



12. 



13. 



The antigen presentation system according to any on of claims 1 to 11, 
wherein said gag is derived from HTLV-1, HTLV-2, HIV-1, HIV-2 SIV or 
FIV. 

The antigen presentation system according to claim 12, wherein said gag is 
pr55°^ of HIV-1. 



14. The antigen presentation system according to any one of claims 1 to 13, 
wherein said signal peptide is derived from an interleukin-3 signal peptide,. 

15. The antigen presentation system according to any one of claims 1 to 14, 
wherein said transmembrane region is derived from the EBV gp220/350 
transmembrane anchor region or from a herpes virus, optionally connected 
via a glycine/serine linker with said extracellular domain. 

16. The antigen presentation system according to any one of claims 1 to 15, 
wherein said DNA sequence (a) and (b) are contained in the same 
expression vector. 

17. The antigen presentation system according to any one of claims 1 to 15, 
wherein said DNA sequences (a) and (b) are contained in different 
expression vectors. 

18. The antigen presentation system according to claim 16 or 17, wherein said 
vectors) is/are (a) baculovirus derived vector(s) or semliki forest virus 
based vector(s). 

19. The antigen presentation system according to any one of claims 1 to 18, 
which is expressible in eukaryotic cells, preferably mammalian cells or 
insect cells, preferably Drosophila Schneider cells. 



WO 96/30523 



PCT/EP96/01433 



34 

20. A host cell transfected with the antigen presentation system according to 
any one of claims 1 to 19. 

21 . The host cell according to claim 20, which is a mammalian or an insect cell r 
preferably a Drosophila Schneider cell. 

22. An antigenic polypeptide encoded by the antigen presentation system 
according to any one of claims 1 to 19 or produced by the host cell 
according to claim 20 or 21 . 

23. A pharmaceutical composition or vaccine comprising the antigen 
presentation system according to any one of claims 1 to 19, the host cell 
according to claim 20 or 21 and/or the polypeptide according to claim 22. 

24. A diagnostic composition comprising the polypeptide of claim 22. 

25. A method of producing the polypeptide of claim 22, comprising culturing the 
host cell according to claim 20 or 21 in a suitable culture medium and 
collecting immature virus-like particles carrying said polypeptides produced 
by said host cells from the medium. 

26. A method for eliciting an immune response specific to the route of antigen 
administration which is topical, preferably via mucosal exposure or invasive, 
preferably via injection or scarification. 



WO 96/30523 



PCIYEP96/01433 



1/10 




Figure 1 



SUBSTITUTE SHEET (RULE 26) 



WO 96/30523 



PCT/EP96/01433 



2/10 



<D CM 
Q.Q. 



c© 
in 

CO 
CM 



00 



CO 
LO 

CO 
CM 




Q 



A A A 



CO to 

~" to 



LO 



A 

CD 
CM 



Figure 2 



SUBSTITUTE SHEET (RULE 26) 



WO 96/30523 



PCT/EP96/D1433 



<0 CM 



3/10 




CD 

10 

CO 
CM 



U) 

to 

Q. 

T 

i 



Q 

< 



A A A 



CO (O 
l- <£> 



in 



Figure 3 



▲ 

CM 



SUBSTITUTE SHEET (RULE 26) 



WO 96/30523 



4/10 



PCT/EP96/01433 



oo 

CD CM 

Q.Q. 
D) D) 



(O 

m 

CO 
CM 



oo 

(O CM 
D.Q- 

o>o> 



(O 

in 

CO 
CM 



CD 

CD 

m 

CO 
CM 



m 
in 

Q. 

T 

) 

I 

\ 



Q 

(O 

m 

CO 
CM 



m 
m 

Q. 

T 



< 



▲ AAA 



CD CD 
t- CD 



in 



CM 



AA A A 

£g £ gi 



Rgure 4 



SUBSTITUTE SHEET (RULE 26) 



WO 96/30523 



PCT/EP96/01433 



5/10 




Figure 5 



SUBSTITUTE SHEET (RULE 26) 



WO 96/30523 



PCT/EP96/01433 



6/10 




Figure 6 



SUBSTITUTE SHEET (RULE 26) 




SUBSTITUTE SHEET (RULE 26) 



WO 96/30523 



PCT/EP96/01433 





Figure 8 



SUBSTITUTE SHEET (RULE 26) 



WO 96/30523 



PCT/EP96/01433 



9/10 



105 



100 - 



£95 



| 90 
85 



BO 



B. 



105 



100 



~ 95 



a go 
I 

85 



80 




012345678 
days p.i. 




012345678 
days p.i. 



■» BSA (d4; 2.8%) 

♦ RacL11 (d4; 4.3%) 

• RacH (d4; 3.7%) 
pCEP-8 <d4, 3.8%) 

o- rAc17-11 (d4; 3.1%) 
VLP-gpU (d4; 3.0%) 
o pDES1 (d4; 4.8%) 



♦ BSA (d4; 3.0%) 

♦ RacL11 (d2; 3.1%) 
«• RacH (d3; 2.5%) 

pCEP-8 (d3; 4.8%) 
o- rAc17-11 (d4; 2.0%) 

VLP-gp14(d3; 1.9%) 
-t> pDES1 (d5; 5.2%) 



Figure 9 



SUBSTITUTE SHEET (RULE 26) 



WO 96/30523 FCT/EP96/01433 



A. 



10/10 




■ BSA 

□ RacL11 

□ RacH 
El pCEP-8 
9 rAc17-11 
G3 VLP-gp14 
HPDESI 



B. 




** 



fill 



iilll 



d3 d5 
Figure 10 



ic1«l<KI«l<t 



d8 



■ BSA 

□ RacL11 

□ RacH 
Q pCEP-8 

■ rAc17-11 
E3 VLP-gp14 
OpDESI 



SUBSTITUTE SHEET (RULE 26)