Skip to main content

Full text of "USPTO Patents Application 09848616"

See other formats


Document A02 
Appl.No. 09/848,616 



J 



WORLD INTELLECTUAL PROPER 
International Bun 



PCT 

INTERNATIONAL APPLICATION PUBLISHED UNDER 




wo 



9605293A1 



(51) International Patent Classification 6 : 

C12N 7/00, 15/86, 15/62, C07K 14/06, 
14/16, 14/18, A61K 39/12, G01N 33/53 



Al 



(11) International Publication Number: WO 96/05293 

(43) International Publication Date: 22 February 1996 (22.02.96) 



(21) International Application Number: PCT/EP95/03 1 1 4 

(22) International Filing Date: 4 August 1995 (04.08.95) 



(30) Priority Data: 
1545/94 



8 August 1994 (08.08.94) 



AT 



(71) Applicant (for all designated States except US): UNITED 

NATIONS INDUSTRIAL DEVELOPMENT ORGANIZA- 
TION [AT/ ATI; Vienna International Centre, A- 1140 Vi- 
enna (AT). 

(72) Inventors; and 

(75) Inventors/Applicants (far US only): BARALLE, Francesco, 
Ernesto [AR/IT]; Area Science Park, Padriciano, 99, 1-34012 
Trieste (IT). SCODELLER, Eduardo [AR/IT]; Are a Scie nce 
Park, Padriciano, 99. 1-34012 Trieste (IT). TTSMINETZKY, 
Sergio [AR/IT]; Area Science Park, Padriciano, 99, 1-34012 
Trieste (TO. 

(74) Agents: ITZE, Peter et al.; Amerlingstrasse 8, A- 1061 Vienna 
(AT). 



(81) Designated States: AM. AT, AU, BB, BG. BR, BY. CA. CH. 
CN, CZ. DE, DK. EE, ES, FI, GB. GE, HU, IS, JP, KE, 
KG. KP. KR, KZ, LK, LR, LT, LU, LV, MD, MG, MN, 
MW, MX. NO, NZ, PL. PT, RO. RU. SD, SE, SG, SI, SK, 
T7, TM, TT, UA. UG, US, UZ. VN, European patent (AT, 
BE, CH. DE, DK, ES, FR. GB, GR, IE, IT, LU, MC. NL. 
PT, SE), OAPI patent (BF, BJ, CF, CG, CI, CM, GA. GN. 
ML, MR, NE, SN, TD, TG). ARIPO patent (KE. MW, SD, 
SZ, UG). 



Published 

With international search report. 

Before the expiration of the time limit for amending the 
claims and to be republished in the event of the receipt of 
amendments. 



(54) Title: MOLECULAR PRESENTING SYSTEM 
(57) Abstract 

The invention refers to a molecular presentation system in which viral 
proteins are foreseen as carriers for heterologous amino acid sequences. 
Hereby, the viral protein is derived from small insect viruses, primarily 
from Flock House Virus (FHV), with a known 3 -dimensional structure 
and amino acid sequence, whereby heterologous amino acid sequences, for 
exemple epitopes, are inserted inthe outwards directed loops of the viral 
capsid protein. Moreover, the expression of the FHV capsid protein in insect 
cells can produce mature virus like particles (VLP) through a recombinant 
baculovirus. 



FHV CapsoMr virus-like particlea produced in 
Baculovirus, 





coat r»tcuR»o* won* Y ooaH 



I 



FOR THE PURPOSES OF INFORMATION ONLY 



Codes used to identify States party to the PCT on the front pages of pamphlets publishing international 
applications under the PCT. 



AT 


Austria 


GB 


United Kingdom 


MR 


Mauritania 


AU 


Australia 


GE 


Georgia 


MW 


Malawi 


BB 


Barbados 


GN 


Guinea 


NE 


Niger 


BE 


Belgium 


GR 


Greece 


NL 


Netherlands 


BF 


Burkina Faso 


HU 


Hungary 


NO 


Norway 


BG 


Bulgaria 


IE 


Ireland 


NZ 


New Zealand 


BJ 


Benm 


IT 


Italy 


PL 


Poland 


BR 


Brazil 


JF 


Japan 


FT 


Portugal 


BY 


Belarus 


KE 


Kenya 


RO 


Romania 


CA 


Canada 


KG 


Kyrgyttan 


RU 


Russian Federation 


CF 


Centra] African Republic 


KP 


Democratic People's Republic 


SD 


Sudan 


CG 


Congo 




of Korea 


SE 


Sweden 


CH 


Switzerland 


KR 


Republic of Korea 


SI 


Slovenia 


ci 


Cote d'lvoire 


KZ 


Kazakhstan 


SK 


Slovakia 


CM 


Cameroon 


14 




SN 


Senegal 


CN 


China 


LK 


Sri Lanka 


TD 


Chad 


CS 


Czechoslovakia 


LU 


Luxembourg 


TG 


Togo 


CZ 


Czech Repubtie 


LV 


Latvia 


TJ 


Tajikistan 


DE 


Germany 


MC 


Monaco 


TT 


Trinidad and Tobago 


DK 


Denmark 


MD 


Republic of Moldova 


UA 


Ukraine 


ES 


Spain 


MG 


Madagascar 


US 


United States of America 


FI 


Finland 


ML 


Mali 


uz 


Uzbekistan 


FR 


Prance 


MN 


Mongolia 


VN 


Viet Nam 


GA 


Gabon 











WO 96/05293 



PCT/EP95/03114 



1 

Molecular presenting system 

The invention concerns a molecular presentation system in which viral proteins are 
5 being used as carriers for heterologous amino acid sequences. 

The possibility to identify and synthesize amino acid sequences from viral 
proteins, which are able to generate a protective immune response in animals, has 
stimulated the development of synthetic vaccines. Although it has already been shown 
that synthetic peptides in some cases can induce a good immune response, it has turned 

10 out that in general they were weak immunogens unless coupled to strongly immunogenic 
carrier molecules. They were frequently unable to induce protective immunity in 
vaccinated animals. Attempts to increase the immunogenicity of these antigens for use as 
vaccine have lead to the development of a series of antigen presentation systems. Many of 
these are designed to present the antigen as a polyvalent, particulate structure. The 

15 development of particulate vector systems for immunogenic epitopes provides a powerful 
approach for the presentation of antigens. Various systems were used to present foreign 
epitopes: the core antigen of Hepatitis B virus (HBV) (HBcAg) [1] and the surface 
antigen of Hepatitis B virus (HBsAg) [2], the capside protein from Polio virus [3], the 
yeast Ty protein [4], the particles obtained after insertion of HIV 1-gag in Baculovirus 

20 [5], rotavirus VP-6 protein [6], core particles of the Bluetongue virus (BTV) [7], and 
filamentous as well as icosahedral bacteriophages [8,9]. 

It has been demonstrated that the immunogenicity of a peptide depends on its 
sequence as well as on the way it is presented to the immune system. By using a human 
rhino virus capsid sequence as a heterologous peptide and the particles of HBcAg as a 

25 carrier, it was shown that the internal location of the foreign sequence increases the 
immunogenicity of the epitope by 10 to 50 fold when compared to the amino terminus 
location [10]. Also the antigenicity (measured as reactivity to a monoclonal antibody 
(mAb)) was greatly enhanced by placing the foreign peptide in that position in the carrier. 
Furthermore, both constructs presented the epitopes considerably more efficiently to the 

30 mAbs than the free peptides. This was also the case when specific HIV-1 epitopes (the 
V3 loop) were introduced into different domains of the HBcAg [11]. Since the properties 



SUBSTITUTE SHEET (RULE 26) 



WO 96/05293 



PCI7EP95/03114 



2 

of a given epitope can be influenced by its conformation it was of great interest to have a 
carrier system with multiple entry sites conferring many possible conformations. This 
would increase the possibility of finding a conformation closer to the native one for a 
given sequence. In spite of the fact that, as mentioned above, various particulate systems 
5 have been developed for the presentation of epitopes, they were all based on the, foreign 
epitope being inserted mainly in one position. This was partly due to lack of knowledge 
about the 3-D structure of the carrier particle. 

Summary of the invention. 

10 

With reference to the above, a new presentation system has been developed, 
characterized by the fact that the carrier protein is derived from small insect viruses, 
Flock House virus (FHV), with a known 3-D structure and amino acid sequence. 
Heterologous amino acid sequences, for example epitopes, are inserted into the outwards 
15 directed loops of the viral capsid protein. This carrier presents multiple possibilities for a 
conformationally suitable location of epitopes. Above all, the carrier system is 
characterized by the fact that the recombinant protein, or the virus like particles, are 
obtained from procaryotic or eucaryotic cells through the expression of the protein 
encoded by the appropriately modified RNA-2 gene of the FHV capsid protein. 

20 

Characteristics of the carrier particle. 

Flock House Virus (FHV). 
FHV is a non-enveloped icosahedrical insect virus with a bipartite RNA genome 
25 and belonging to the Nodaviridae family. These viruses are among the smallest and 
simplest known. The FHV genome consists of two single stranded mRNA molecules 
(RNA-1 with 3.1 kb and RNA-2 with 1.4 kb), both encapsidated in the same particle. 
RNA-1 carries the information for the viral RNA-poIymerase and RNA-2 codes for the 
coat precursor, alpha protein. Upon synthesis the coat precursor alpha is rapidly 
30 assembled with both RNAs, whereby immature, virion-like particles (provirions) are 
formed. These are slowly processed to mature particles by autocatalytic cleavages [12], 



SUBSTITUTE SHEET (SOLE 26) 



WO 96/05293 



PCT/EP95/03114 



X-ray diffraction studies have shown the structure of the viral particles at 3.0 
Angstrom resolution [13] (see fig 1). The virion has 60 icosahedrical f asymmetric units 
each consisting of three quasiequivalent protomers forming a protein shell around the 
inner RNA genome [14]. The protomers consist of 1) a basic, crystallographically 
5 disordered aminoterminus, 2) a Beta-barrel structure, 3) an outer protrusion composed 
predominantly of Beta sheets and formed by three large insertions between the strands of 
the Beta-barrel, and 4) a carboxyterminal domain composed of two distorted helices lying 
inside the shell. The external zone of the virion, which is the least conserved, has many 
sequence differences which essentially contain all the deletions and insertions of the 
10 different strains [12]. The variations in the loops, directed outwards from the segments of 
the Beta-barrel structure, define serologically distinct viral strains. 

These loops were selected as the regions to be manipulated for the insertion of the 
foreign epitopes. The positions for these insertions ( LI, L2, L3, II, 12, 13,) are given by 
the following amino acid regions of the RNA 2 gene: 
15 Loop LI amino acids 195-219 

Loop L2 amino acids 263-277 

Loop L3 amino acids 129-138 

Loop II amino acids 107-1 10 

Loop 12 amino acids 152-165 

20 Loop 13 amino acids 304-310 



In fig. 2, showing the DNA sequence of FHV RNA-2 and the corresponding 
amino acid sequence, the individual loop regions are accentuated. 

Fig. 3 shows the full restriction map of the DNA sequence of FHV RNA-2. 
25 Fig. 4 represents the number of cutting sites of the endonucleases. 

Fig. 5 shows all sites in which the endonucleases cut FHV RNA-2. 
Fig. 6 is a graphic representation of the unique cutting sites of the endonucleases. 
FHV grows vigorously in cultured cells and produces yields of 20% of the total 
cell protein [14]. In addition, FHV grows well in several Lepitopteran larvae. The viruses 
30 of this family show a considerable resistance to inactivation by heat, detergents and other 
denaturants [14]. It was shown recently [15] that the expression of the capside protein 



SUBSTITUTE SHEET (RULE 261 



WO 96/05293 



PCT/EP95/03114 



4 

FHV RNA-2 in insect cells via a recombinant baculovirus produces virion like particles 
(VLP) similar to authentic virions. It was shown by the present inventors that this can 
also be achieved by the expression of a modified gene carrying insertions for the 
expression of foreign amino acids within the capsomer structure. The VLPs generated by 

5 this procedure in insect cells are mature particles since the precursor protein, which is 
present in provirions, is cleaved. This system allows the production of 1 - 2 mg of 
purified synthetic virions (VLPs) in 50 ml of cultured cells [16]. 

Another method for the production of particles carrying foreign epitopes is by 
recovery of infectious virions after cotransfection of the genomic RNA-2 (obtained by in 

10 visa transcription of modified cDNAs) with purified RNA-1 [17]. This is only valid for 
genomes which carry alterations that do not change the replicative cycle or the assembly 
of the virus. The RNA-1 can be purified by several cycles of autonomous replication in 
DM-1 cells (Drosophila Melanogaster) taking advantage of the fact that RNA-1 behaves 
as an autonomous replicon in transfected cells [18]. 

15 

Detailed description of the construction of recombinant baculovirus carrying the 
wild type or modified capsomer gene. 

FHV was grown in DM-1 cells and purified in sucrose and CsCl gradients as 
20 described in [19]. The genomic RNA was extracted from the purified virions by treatment 
with proteinase K and by phenol-chloroform extraction. A single stranded cDNA was 
made with reverse transcriptase using 20 bases long oligonucleotides complementary to 
the 3' end sequence [12] (see fig 2). A double stranded cDNA was made with standard 
PCR techniques [20] amplifying the single stranded cDNA using a 20 bases long 
25 ougonucleotide, complementary to the 5 '-end of the RNA-2, together with the first 
primer. Both primers carried extra bases coding for selected restriction enzyme sites 
(Bam-HI site for the 5'-end and Xba-I site for the 3'-end). After the PCR amplification, 
the double stranded DNA was gel-purified and ligated to pUC18 (Sma I site). For the in 
vitro transcription of RNA-2 the corresponding cDNA was inserted into the plasmid 
30 pBluescript SHI (Stratagene) under the control of phage T7 polymerase. Examples of the 
above mentioned modifications of FHV RNA-2 are shown in table 1. 



SUBSTITUTE SHEET (RULE 26) 



WO 96/05293 



PCT/EP95/03U4 



5 

Table 1 



r 091110(1 


Restriction 
Sites 


Comments 


L1 


Kpn I 

fafter 

mutagenesis) 


a) Aminoacids 205 to 209 (ATE 
the original sequence. 

b) Val 204 mutagenized to Gly i 
create Kpn 1 site: G204 

GGT 
CCA 

c) After oligo insertion, GT du 


DPA) deleted from 

GTT to GGT) to 

T205 

ACC 

TGG 

plicates 


L2 


Pst I 

(after 

mutagenesis) 


a) Aminoacids 2 
the original s 

b) Mutagenesis ( 
CTG) and 02 
site: L269 

CTG 
GAC 

c) After oligo in 


70 to 273 (GSTG) deleted from 
equence. 

>f the codon usage in L269 (CAG to 
>74 (CAA to CAG) to generate Pst 1 

0274 

CAG 

GTC 

isertion, LQ duplicates. 


L3 


Nhe I 

Qno 1 
Op6 1 

(original) 


a) Aminoacids 1i 

after doble d 

A126 
Nhe I GCT 
CGA 

b) Si27andTi3 

insertion. Th 


28 to 134 (VPAGTFP) deleted 
igestion with Nhe l-Spe I: 

S127 T135 S136 
AGC Spel ACT AGT 
TCG TGA TCA 

is are regenerated after oligo 
ere are no duplications of aa. 


13 


Bsu36 1 

(original) 


a) There is no loss of aa in the original sequence. 

b) Oligo insertion duplicates aa P304 and E305 

P304 E305 G 
CCT GAG G 
GGA CTC C 


12 


BamH I 

(after 


a) Aminoacids 154 and 155 (TT) are deleted 
after mutagenesis. 

b) Change of codon usage in S156 (TCA to TCC) 
to generate BamH 1 site: G15?| §t£S 

GGA 1 TCC 
CCT 1 AGG • 

c) GS duplicates after oligo insertion. 


11 


Bsu36 1 

(after 

mutagenesis) 


a) Mutagenesis of G108 and Q109 to generate 
Bsu36 I site: 

G108 Q109 
GGA CAS 
to: P10B E109 

CCT GAG G(cfDl10) 



SUBSTITUTE SHEET (RULE 26) 



WO 96/05293 



PCT/EP95/03114 



6 

The cDNA of RNA-2 was also inserted into the vector pVL-1393 (Invitrogene) 
(Bam-HI/Xba-I sites). In this vector the gene is placed under the control of the polyhedrin 
promotor and flanked by sequences of the Autographa californica Nuclear Polyhedrosis 
5 Virus (AcNPV) which allow in vivo production of recombinant virus after cotransfection 
with AcNPV genomic DNA. 

Introduction of foreign sequences in the cDNA of RNA-2 

10 Small insertions/deletions in the sequences of RNA-2 were carried out by the PCR 
technique [20], The epitope specific sequences were inserted into one or more of the 
selected sites either using restriction enzyme sites (when available) or by the PCR 
technique. The stereo diagram of the FHV capsid protein precursor in fig. 7 shows the 
sites where the specific HIV-1 sequences "IGPGRAF" were inserted. Those amino acids 

15 were inserted into the positions LI, L2, L3, and 12, whereas the aminoacids 
"IGPGRAFE* were inserted into position B. In all positions, except in position 13, 
certain amino acids were deleted: In position LI amino acids 205 - 209 were deleted and 
aa 204 was mutated to create Kpn I site; in position L2 amino acids 270 - 273 were 
deleted and aa 269 and 274 were mutated to create Pst I site; in position L3 amino acids 

20 128 - 134 were deleted after digestion with Nhe I-Spe I. In position 12 amino acids 154 - 
155 were deleted. See table 1. 

Examples of the insertion of foreign sequences into the recombinant FHV 
capsomer are listed in table 2. 

25 



30 



SUBSTITUTE SHEET (RULE 26) 



WO 96/05293 



PCT/EP9S/D3114 



7 



TABLE 2 



Examples of foreign sequences Included In FHV recombinant capsomer 



Sequences Sites Amino acids sequence 

and (heir characteristics 



Expressed in 



HBV-PreS1 

HBV-PreS2 

HBV-S 

HCV-core 

HIV-1 gp120 



HIV-1 gp120 

HIV-1 gp41 
HIV-1 gp41 



13 



13 



L1.L2.L3 
12,13 

L1.L2.L3 
12,13 



L1.L2.L3 
12,13 



L1.L2.L3 
12,13 



L1.L2.L3 
12,13 



L1.L2.L3 
12,13 



MGTNLSVPNPPAFGANST- 
•NPDWDFNPGGMQWNSTAL 

Tcell epitope. 
Receptor binding site. 

MQWNSTALDPRVRGL 

B cell epitope 

CTTPAQGNSMFPSCCCTKPTDGNC 

B cell epitope 

1 . TNPKPQRKTKRNTNRRPQD 

2. VKFPGGGQIVGGVYLLPRR 

B cell epitopes. 



IQRGPGRAF 

IGPGRAF 

FGPGQAL 

IGPGRTL 

KGPGRVI 

IGLGQAL 



oiib) 

(MN) 
(Mai) 
(NY5) 
(RF) 
(22) 



V3 loop.B cell epitope. 
Neutralyzing epitope 

1 .GKAMYAPPI 

2. NMWQE(K)VGKA 

(C4).B cell epitope. 
Neutralyzing epitope 

ELDKWAS 

B cell epitope 
Neutralyzing epitope 

IEEEGGERDRDR 

B cell epitope 
Neutralyzing epitope 



E.coli 



E.coli 



E.coli 

Baculovirus 
E.coli 

Baculovirus 



E.coli 

Baculovirus 



E.coli 

Baculovirus 



E.coli 

Baculovirus 



E.coli 

Baculovirus 



SUBSTITUTE SHEET (RULE 26) 



WO 96/05293 



PCT/EP95/03114 



8 

Production of recombinant Baculovims carrying the RNA-2 gene: 

The cDNA of RNA-2 (wild-type or after genetic manipulation) was inserted into 
5 the transfer vector pVL-1393 under a polyhedrin promotor (sites Bam HI and Xbal of the 
polylinker). This pUC9 based vector carries a segment of AcNPV in the sequence 
flanking its polylinker and allows the transfer of the foreign gene to a baculovims 
genome after in vivo recombination (see fig. 8). Insect cells (Spodoptera Frugiperda 
SF-21 cells) were co-transfected (LipoFectin) with linear genomic DNA (non-viable) of 

10 AcNPV (BaculoGold from PharMingen) and with the transfer vector carrying the FHV 
gene. After 4 days the virus progeny was harvested and titered. Thereafter, several 
recombinant viruses were plaque purified (3 to 4 times from well isolated plaques). These 
recombinants were denominated AcNPV-FHV. In some cases the VLPs can tolerate the 
insertion of up to 20 amino acids without alteration of the assembly process. In other 

15 cases, where the insertions prevented the formation of VLPs, this could be circumvented 
by coinfection with both the wild-type and the modified baculovims. Thereby, mosaic 
VLPs were generated carrying both types of capsomer structures. 

Production and purification of VLPs from insect cells infected with AcNPV-FHV* 

20 

In order to obtain purified antigens for immunological antigen studies, Sf-21 cells 
(in suspension or as monolayer) were infected with recombinant baculoviruses at a 
multiplicity of infection of 10. Two to three days after the infection 0.5% nonidet P-40 
and 0.1% Beta Mercaptoethanol (2-ME) were added to the medium. After 15 minutes on 

25 ice, the cell debris were removed by centrifugation for 10 minutes at 12000 g. The VLPs 
in the supernatant were pelleted through a 30 wt/wt % sucrose cushion (50 mM HEPES, 
0.1% 2-ME) at 40.000 rpm in an SW41 rotor for 3 hours at 4 C. The pellet was 
resuspended in 50 mM HEPES, 0.1% 2-ME and laid on a 10 ml 5-20 wt/wt % 
continuous sucrose gradient in the same buffer. The particles were sedimented in an 

30SW41 rotor at 40.000 rpm for 1 hour at 11 C. The fractions of the gradient were 
collected from the bottom and aliquots 1 of each fraction were mn on a 10% SDS 



SUBSTITUTE SHEET (RULE 26) 



WO 96/05293 



PCI7EP95/03114 



9 

poyacrylamid gel in order t localize the particle peak. The fractions containing the VLPs 
were pooled, pelleted by centrifugation and resuspended in the same buffer. The protein 
content of these preparations was determined by Micro BCA Protein Assay Reagent 
(Pierce). 

5 

Recovery of modified FHV containing exogenous sequences. 

Live, recombinant FHV viruses can be recovered when the heterologous amino acid 
sequences which are inserted into the capsomer do not alter the virion assembly process. 
10 The recovery was carried out by co-transfection of DM-1 cells with in vrtlTP made 
transcripts of modified RNA-2 and authentic RNA-1 purified of RNA-2 by multiple 
transfection passages at the limiting dilution as described by Ball [18]. 

Example 1: 

15 Production of VLPs carrying the HIV-1 (Human Immunodeficiency Virus, type 1) 

specific sequence IGPGRAF: 

Several domains of the HTV-1 gp-120 can induce the production of neutralizing 
antibodies. One of them is the hypervariable region 3 (V-3 loop). This is a linear, 

20 immunodominant epitope known as the "Principal Neutralizing Determinant* (PND) [21, 
22]. Although the entire domain varies greatly among different isolates, it was recently 
found that, maybe due to conformation restraints, the amino acid sequence on the tip of 
the loop is well conserved. Sequence data from 245 isolates from the USA showed that 
the V3 loop sequence "GPGRAF" was present in more than 60% of the isolates [23], In 

25 addition, it was found that animals immunized with peptides containing this sequence 
produced sera which could neutralize several diverging isolates, although with a low titer 
[24]. This sequence was inserted into five different positions on the surface of the FHV 
structure and in some cases in two sites of the same molecule. The positions selected 
were the outwards directed loops mentioned above (see FHV structure fig.l). In one case 

30 (position 13) the foreign sequence was introduced directly as an insert in the original 
sequence of RNA-2. In order to obtain this, the cDNA coding for the FHV capsidprotein 



SUBSTITUTE SHEET (RULE 26) 



W 96/05293 



PCT/EP95/03114 



10 

was digested with Bsu 361 (cuts the DNA at nucleotide 934), and a synthetic 
oligonucleotide was inserted coding for the HIV-1 specific sequence. As a consequence of 
this procedure an additional glutamic acid was inserted at the carboxyterminus of the 
HIV-1 sequence. The structures of all these recombinant proteins are shown in fig.7. 
5 Fig. 9 shows the proteins induced in Sf-21 cells after infection with the 

recombinant bacuiovirus carrying the HIV-1 epitopes in the positions shown in fig. 7. 
Cells infected with these recombinants, mock infected cells and cells infected with 
baculoviruses without inserts were lysed and analyzed in a 10% polyacrylamide gel. 
Coomassie staining of the gel showed, in the lysates from cells infected with recombinant 

10 viruses, the presence of bands with a molecular weight similar to the expected molecular 
weight for FHV capsomer precursor protein (alpha protein) or its cleavage product. 
These bands were not present in the case of lysates from cells infected with bacuiovirus 
without the insert (AcNPV-RP6). Western blots from similar gels, analyzed with rabbit 
hyperimmune anti-FHV serum, confirmed the identity of the chimeric proteins. In 

15 addition to the alpha precursor, its cleavage product (the mature beta protein) was seen in 
all cases. This probably indicates that the modified capsomers are still capable of 
assembling and autocleaving. However, in some cases the percentage of mature protein 
seemed to be low (e.g. L3; 13; 12), probably indicating that the presence of the insert 
affects the autocleavage process. When a similar blot was analyzed, either using sera 

20 from HTV-1 positive patients or HIV-1 specific human monoclonal antibodies, a quite 
different pattern of recognition developed. The patients' sera mainly recognized the 
epitope in the L2 position or in those combinations where this position was used. On the 
contrary, the monoclonal antibodies strongly recognized the position LI or combinations 
derived from that position. Position L3 was also extensively recognized by patients* sera 

25 though consistently less than 12. The other positions were barely detectable by these sera. 
On the other hand, certain human sera detected preferentially proteins carrying the inserts 
in the positions L3 or 13. This suggests a difference in the specificity of the individual 
immune response to the same sequence. However, until now the strongest signals were 
always obtained when the proteins carried the inserts in the positions LI or L2. 

30 Coomassie staining of the gels showed that the differences do not depend upon the 
amount of induced protein in the insect cells. This confirmed the hypothesis that the 



SUBSTITUTE SHEET (RULE 26) 



WO 96/05293 



PCIYEP95/03114 



11 

antigenicity of the epitope is influenced by its localization. Until now the reason for the 
differences in the patterns of recognition in different patients could not be explained. 
Further investigations are now to be carried out to explain these data. For example 
concerning the origin of the infecting strain, the neutralization titer of the sera, the 
5 differences in the idiotypic answers, the difference in the patients' prognosis, etc. 

Purification of VLP-V3 from recombinant, baculovirus infected Sf-21 cells. 

Fig. 10 shows the sedimentation profile and the antigen composition of VLPs 

10 produced by three different baculovirus: AcNPV-FHV which expresses the unmodified 
FHV capside protein; AcNPV-FHV-V3/Ll expressing the same protein yet carrying the 
fflV-1 epitope in position LI; and AcNPV-FHV-V3/L2 carrying the insert in position 
L2. See fig. 7 for details on insert locations. In all cases it was found that the particulate 
material, obtained as described above, migrated to the same position in the gradient as the 

15 FHV particles. The particulate nature of these components was further confirmed by 
electron microscopy. Aliquots from each peak were run on a polyacrylamide gel and 
probed with HIV-1 positive serum after transfer to nitrocellulose paper. In all cases the 
detected proteins migrated to the same position as did the FHV capside protein or its 
precursor. In the case of wild-type or Ll-derived particles the main band corresponded to 

20 the mature protein, whereas in L2-derived particles a large quantity of immature protein 
(alpha protein) was present in addition. However, there seemed to be an increase of 
mature protein in VLPs when these were compared with the input material prior to the 
purification. Similar results were also obtained after analysis of the products of those 
recombinant baculoviruses expressing the FHV capside proteins with the inserts in the 

25 other positions described above. The only differences found were the yield of particulate 
material and the percentage of VLPs carrying immature protein in that material. 

The experiments were carried out as follows. Four days after the infection the 
cells and the medium were processed as previously described and the presence of the 
particles was analyzed by sucrose density gradient sedimentation (SW50.1 rotor at 45000 

30 rpm for 30 minutes at 20 degrees C). The fractions were collected from the bottom of the 
tubes. In order to detect the distribution of the FHV along the gradient, aliquots of each 



SUBSTITUTE SHEET (RULE 26) 



WO 96/05293 



PCT/EP95/03114 



12 

fraction were tested for FHV reactivity by means of an EUSA assay. The distribution of 
HIV-1 specific reactivity along the gradient was measured through western blotting of 
samples from the peak fractions. The western blots were probed with HIV-1 positive sera 
and the resulting bands are shown at the bottom of each graph. In fig. 10 graph a) shows 
5 the reactivity of AcNPV-FHV-derived particles, b) shows particles derived from 
AcNPV-FHV-V3-Ll and c) shows particles derived from AcNPV-FHV-V3-L2. The 
arrows indicate the migration of FHV run in a parallel gradient. 

Immunogenicity of chimeric VLP-V3 particles 

10 

In order to determine whether the seven HIV-amino acids inserted into the VLP 
structure were capable of inducing an immune response, three groups of guinea pigs, 
each consisting of three animals, were immunized with purified VLPs carrying the HTV-1 
insert as described in the following. The first group of animals was inoculated with the 

IS insert in position L3, the second group with the insert in position 13 and the third group 
was inoculated with the insert in both positions L3 and 13. All three groups were 
immunized subcutaneously with 500 microlitres PBS containing 50 microgrammes of the 
respective VLP preparations. For the first immunizations on day 0 the antigens were 
formulated in complate Freund's adjuvant (CFA). For the boosters on days 14 and 28 the 

20 same amount of antigen was formulated in Freund's incomplete adjuvant (IFA). Blood 
was taken from each animal 35 days after the first inoculation by cardiac puncture. Sera 
from the immunized animals were tested for specific anti-V3 and anti-FHV antibodies in 
an EUSA test. The data represent reciprocal dilutions at OD 492. For the anti-FHV titer 
the ELISA plates were coated with CsCl-purified viruses (200 nanogrammes per well). 

25 The titers against the HTV-1 inserts were analyzed on plates coated with recombinant 
gpl20 (ABT-Baculovirus produced, 100 ng per well) as a capture antigen. The data in 
fig. 11 show that these preparations had elicited a good antibody response specific for the 
V3 sequence. As shown by this test, no major differences existed among the various 
constructs. However, the rest of the positions are yet to be analyzed and an evaluation is 

30 to be made of the differences in the affinity shown to the native gp-120 by the immune 
sera, a parameter known to be associated with their neutralizing capacity. 



SUBSTITUTE SHEET (RULE 26) 



WO 96/05293 



PCT/EP95/03114 



13 



Example 2: 

Hepatitis C Virus (HCV) 

5 

The transfusion induced Hepatitis, which can neither be-attributed to Hepatitis A 
virus nor to Hepatitis B virus (NANBH), belongs to the main group of transfusion 
transmitted diseases [25]. The cloning and expression of HCV has allowed the 
development of antibody screening immunoassays for the detection of HCV infections, 

10 using as solid phase antigen a fusion polypeptide expressed through recombinant yeast 
Initial studies using this protein confirmed that HCV was the predominant agent of 
NANBH. However, these and subsequent studies demonstrated a series of shortcomings 
with this serological test due to low sensitivity and specificity. The tests currently used 
are mostly based on the detection of antibodies against the non-structural proteins 

15 NS3-NS4 which, however, do not appear in infected patients until the disease is in an 
advanced state (4-6 months after the onset of the Hepatitis). Later, it was demonstrated 
that most immunodominant epitopes are located within the aminoterminal parts of the 
core protein [25, 26, 27] and that antibodies against these epitopes appear early after the 
infection. This was shown either by using recombinant HCV-core protein produced in 

20 bacteria or baculovirus, or by using synthetic peptides corresponding to these sequences. 
Moreover, the HCV-core protein is considered as the most significant single antigen for 
the detection of antibodies in infected patients. Among all positive samples 80-85% are 
found to be core positive and in most of them this was the only antigen recognized. 

25 Production of FHV-VLPs carrying an HCV-core epitope. 

With reference to these considerations, the epitopes of the HCV core protein were 
tested in the molecular presentation system of the invention here reported. A 20 amino 
acids long sequence was selected corresponding to the amino acids 20-40 in the original 
30 sequence about which it had already been shown that they were very effective for 
diagnostic purposes [26]. The 20 amino acids long epitope was inserted in the 13 position 



SUBSTITUTE SHEET (RULE 26) 



WO 96/05293 



FCI7EP95/D3114 



14 

on the Bsu-361 site of the RNA-2 gene contained in pVL-1393. The recombinant 
Baculovirus was produced and purified as described. The resulting recombinant was 
denominated AcNPV-HCVc. Fig. 12 shows the expression of hybrid FHV-HCV proteins 
through the recombinant baculovirus AcNPV-HCVc. The chimeric capsomer was 
5 produced through the recombinant baculovirus as follows. Sf-21 cells were infected with 
recombinant baculovirus AcNPC-HCVc (lane 3, 6, and 7), with a baculovirus carrying 
an unmodified FHV capside protein AcNPV-FHV (lane 2 and 4) and with a 
polyhedrin-minus baculovirus carrying no insert AcNPV-RP6 (lanel), respectively. The 
whole cell extracts were run in a 10% SDS-Page gel. Purified FHV was included as a 

10 marker (lane 5). Lanes 1-3 were stained with Coomassie blue. After the running, the 
proteins in lanes 4-7 were blotted on Nitrocellulose paper. After staining with Poinceau 
red, paper strips corresponding to each well were cut out and probed with a specific 
serum. Lanes 4 and 6 were probed with serum from a patient who was core positive in a 
RIBA-II test. Lanes 5 and 7 were probed with rabbit-anti-FHV serum. 

IS The insect cells were infected with the recombinant virus and four days after the 
infection the cells were lysed and analyzed on a 10% SDS-PAGE gel. After the running, 
the gel was stained with Coomassie brilliant blue. The introduction of HCV-sequences 
apparently had no influence on the protein production. However, all the detected protein 
migrated with the molecular weight of the precursor (alpha protein). This indicates that 

20 the maturation process is somewhat impaired by the sequence alteration. In order to 
confirm the identity of this protein, the lysates of the infected cells were run on a similar 
gel, transferred to Nitrocellulose paper and probed with specific antisera. As expected, 
the protein reacted strongly with the specific rabbit-anti-FHV antiserum (dilution 1:2000) 
as well as with HCV positive human serum (dilution 1:200). 

25 Fig. 13 shows the FHV reactivity (measured in an ELISA test) after sucrose 
sedimentation of VLPs produced by infection of Sf-21 cells with the recombinant 
baculovirus AcNPV-HCVc. The running conditions were identical to those described in 
connection with fig. 10. Aliquots from each peak fraction were western blotted and 
probed with HCV positive human sera. A photo of the developed Western bands is 

30 inserted at the bottom of the graph. The arrow indicates the position of FHV run in a 
parallel gradient. 



SUBSTITUTE SHEET (RULE 26) 



WO 96/05293 



PCI7EP95/03114 



15 

As in the case of the particles carrying HIV-l specific sequences, the particles 
migrated somewhat slower than the wild-type FHV particles. Western blots f aliquots 
from the peak reacted with HCV-positive sera. This indicates that the unprocessed protein 
is not impaired in its ability to autoassemble into a particulate structure. 
5 To asses the capability of the antigen to detect specific antibodies, purified VLPs 
were used for the ELISA test. Wells of EUSA plates (Nunc) were coated with 100 
microlitres of purified VLPs diluted in PBS buffer (100 nanogrammes per well). After 
blocking with PBS containing 5% BSA, 100 microlitres of serum dilution were added to 
each well and the plate was incubated for two hours at room temperature. The bound 

10 antibodies were detected by a second incubation with a horse radish peroxidase conjugate 
of the IgG fraction of goat anti-human immunoglobulin for one hour at room 
temperature. The enzyme activity was measured using o-phenylendiamine as a substrate. 
The absorbance of each well was measured at A = 490 nanometer. To test the sensitivity 
of this antigen, 100 sera, known to be core positive in a commercial test (RIBA H-Chiron 

15 Corp.), were analyzed. Almost 85% of the samples gave titres higher as 1:1000 which 
indicates a very good sensitivity when detecting anti-core antibodies. These results 
demonstrated that these 20 amino acids from the HCV core sequence represent a very 
reliable antigen for the detection of HCV infections, when introduced in the carrier 
system of the present invention. 

20 The results are represented in the block diagram in fig. 14. 

Comparison of a VLP-based EUSA test with current, commercially available tests. 

In order to test the sensitivity of this EUSA assay, a collection of serially drawn 
25 blood samples from infected patients, encompassing the period of seroconversion, were 
analyzed for specific HCV core antibodies. At that stage, all patients already have a high 
level of the specific liver enzyme Alanine aminotransferase (ALT). In four out of 50 
patients which were analyzed (see fig. 15) the test subject of this invention showed 
seroconversion earlier than in the currently available testkits (RIBA II). These results 
30 show that the antigen is extremely suitable for detection of contaminated samples in blood 
banks. The serially drawn blood samples from selected patients, taken for the RIBA-II 



SUBSTITUTE SHEET (RULE 26) 



WO 96/05293 



PCT/EP95/03114 



16 

test before the seroconversi n, were analyzed by using plates coated with VLPs carrying 
an HCV core-specific epitope. The serum dilution was 1:100 for RIBA-II as well as for 
the EUSA test of the invention here reported. The RIBA-II values are shown in the upper 
panel. The VLP-based ELISA test values are represented in the diagram as circles, the 
5 ALT values as a vertical line. 

A comparison between antibody detection by VLPs, carrying HCV core sequences, 
and antibody detection by the free HCV peptide. 

10 It has been shown that short peptides are very efficient when used as capture 
antigens for detection of specific antibodies in human as well as animal sera especially in 
the form of branched peptides [29]. It has also been reported that they react better than 
the corresponding recombinant antigens [30]. In transfusion induced Hepatitis-C cases it 
was established that by using peptides as capture antigens, positive sera could be detected 

IS as early as one month after the first transfusion. This coincides with the first increase in 
the specific liver enzymes and would make short amino acid sequences a useful marker 
for detecting acute specific HCV infections [27]. For this reason it was decided to 
compare in a dot-blot assay the HCV specific antigens described in the invention at issue 
with the corresponding free peptides (HCc-2p), with a peptide encompassing the first 20 

20 amino acids of the core (HCc-lp), and with peptides corresponding to other HCV 
proteins (NS peptides), respectively. 

Fig. 16 shows a photograph of these dot-blots which were carried out as follows. 
Aliquots of 10 microlitres of purified VLPs (5 microgrammes per ml), carrying an insert 
of 20 amino acids from the core of HCV, and solutions containing peptides representing 

25 different areas of the HCV genome (100 microgrammes per ml) were blotted on 
nitrocellulose paper. After blocking with 5% fat free and dry milk, each strip was 
incubated with a 1:100 dilution of human sera. After washing, each filter was incubated 
with anti-human antibodies conjugated to horse radish peroxidase (Dako, dilution 
1:5000), and finally incubated with diamino benzidine (DAB). Lanes 1 - 6 show patients* 

30 sera. Lane NC shows the negative control serum. 



SUBSTITUTE SHEET (RULE 26) 



WO 96/05293 



PCT/EP95/D3114 



17 

As can be seen, already very low levels of antigen (SO nanogrammes 
corresponding to 2.5 nanogrammes of the specific HCV peptide) are strong enough, in 
the form of VLPs, to elicit a good signal with a positive sample. The corresponding free 
peptide (HCc-2p) gave only a very weak signal although it recognized the same number 
5 of positive samples. In this case, the amount of antigen loaded onto the nitrocellulose 
paper was 400 times higher as in the case of the VLPs, based on a molar ratio. The 
peptide corresponding to the first 20 amino acids (HCc-lp) gave stronger signals, but 
failed to detect one positive sample and gave an indeterminate result with another positive 
sample. Peptides which corresponded to other HCV proteins and which were designed on 
10 the basis of published results [31] are far less efficient for detection of HCV positive sera. 



15 



20 



25 



30 



SUBSTITUTE SHEET (RULE 26) 



W 96/05293 



18 



PCT/EP95/03114 



CLAIMS: 

1. A molecular presentation system in which viral proteins are used as carriers for 
5 specific amino acid sequences and which is characterized by the fact that the viral protein 

is derived from small insect viruses of known 3 -dimensional structure and amino acid 
sequence * preferentially from FHV - in which heterologous amino acid sequences, such 
as epitopes, are inserted into the outwards directed loops of the capsid protein. 

2. A system according to claim 1, characterized by the fact that a recombinant 
10 protein, or virus like particle, is used as viral protein whereby this recombinant protein, 

or virus like particle, is obtained from procaryotic or eucaryotic cells through the 
expression of the protein encoded by the appropriately modified RNA-2 gene of the FHV 
capsid protein, as shown in figure 2. 

3. A system according to claim 2, characterized by the fact that the heterologous 
IS amino acid sequences are inserted into one or more regions of the outwards directed loops 

of the FHV capsid protein, encoded by the RNA-2 gene, in which the loops denoted 
L1,L2,L3 ,11,12,13 are chosen. 

4. A system according to claim 3, characterized by the fact that the regions of the 
loops selected for the insertion of the heterologous amino acid sequences are defined by 

20 the following amino acid sequence regions of the FHV Capsid protein encoded by the 
RNA-2 gen: 

Loop LI amino acid sequence region 195 - 219 
Loop L2 amino acid sequence region 263 - 277 
25 Loop L3 amino acid sequence region 129 - 138 
Loop II amino acid sequence region 107 - 110 
Loop 12 amino acid sequence region 152 - 165 
Loop 13 amino acid sequence region 304-310 

30 5. A process for the production of a molecular presentation system according to 
claims 3 or 4 characterized by the fact that the RNA-2 gene of the FHV capsid protein, in 



SUBSTITUTE SHEET (RULEiB) 



WO 96/05293 



PCT/EP95/D3114 



19 

the regions corresponding to loops LI, L2, L3, II, 12, 13, is modified by deletions and/ r 
mutagenesis and/or insertions in order to create cut sites for restriction enzymes in the 
said loop regions that can be used for the inserts which encode the heterologous amino 
acid sequences. 

5 6. Application of a molecular presentation system according to one of the claims 1 
to 4 for therapeutic, diagnostic and immunization purposes. 



10 



15 



20 



25 



30 



SUBSTITUTE SHEET (RULE 26) 



WO 96/05293 



PCI7EP95/03114 



1/19 

FIG.l Crystallographic representation of the outward 
directed loops of the FHV Capsid protein precursor with 3 
A resolution, showing the positions of insertions of the 
foreign genes (LI, L2, L3, II, 12, 13) . 




SUBSTITUTE SHEET (RULE 26) 



WO 96/05293 



PCT/EP9 5/03114 



2/19 



23 53 

atggttaataacaacagaccaagacgtcaacgagctcaacgcgttgtcgtcacaacaacc 
MVNNNRPRRQRAQRVVVTTT 

83 113 

caaacagcgcctgttccacagcaaaacgtgccacgtaatggtagacgccgacgtaatcgc 
QTAPVPQQNVPRNGRRRRNR 

143 173 

acgaggcgtaatcgccgacgtgtgcgcggaatgaacatggcggcgctaaccagattaagt 
TRRNRRRVRGMNMAALTRLS 

203 233 

caacctggtttggcgtttctcaaatgtgcatttgcaccacctgacttcaacaccgacccc 
QPGLAFLKCAFAPPDFNTDP 

263 293 

ggtaagggaatacctgatagatttgaaggcaaagtggtcagccgaaaggatgtcctcaat 
GKGIPDRFEGKVVSRKDVLN 

323 353 

caatctatcagctttactgccggacaggacacttttatactcatcgcacctacccccgga 
QSISFTAGQDTFILIAPTPG 

383 413 

gtcgcctactggagtgctagcgttcctgctggtacttttcctactagtgcgactacgttt 
VAYWSASVPAGTFPT SATTF 

443 473 

aaccccgttaattatccgggttttacatcgatgttcggaacaacttcaacatctaggtcc 
NPVNYP GFTSMFGTTSTSRS 

503 533 

gatcaggtgtcctcattcaggtacgcttccatgaacgtgggtatttacccaacgtcgaac 
DQVSSFRYASMNVGIYPTSN 



SUBSTITUTE SHEET (RULE 26) 



W 96/05293 



PCT/EP9S/03114 



3/19 



563 593 

ttgatgcagtttgccggaagcataactgtttggaaatgccctgtaaagctgagtactgtg 
LMQFAGS ITVWKCPVKLSTV 



623 653 

caattcccggttgcaacagatccagccaccagttcgctagttcatactcttgttggttta 
QFPVATDPATSSLVHTLVGL 

683 713 

gatggtgttctagcggtggggcctgacaacttctctgagtcattcatcaaaggagtgttt 
DGVLAVGPDNFSESFI KGVF 



743 773 

tcacagtcggcttgtaacgagcctgactttgaattcaatgacatattggagggtatccag 
SQSACNEPDF EFNDILEGIQ 

803 833 

acattgccacctgctaatgtgtcccttggttctacgggtcaaccttttaccatggactca 

tlppanvslgst'gqpftmds 

863 893 

ggagcagaagccaccagtggagtagtcggatggggcaatatggacacgattgtcatccgt 
GAEATSGVVGWGNMDT I V I R 



923 953 

gtctcggcccctgagggcgcagttaactctgccatactcaaggcatggtcctgcattgag 
VSAPEGAVNSAILKAWSCIE 

983 1013 

tatcgaccaaatccaaacgccatgttataccaattcggccatgattcgcctcctctcgat 
YRPNPNAMLYQFGHDSPPLD 



1043 1073 

gaggtcgcgcttcaggaataccgtacggttgccagatctttgccggttgcagtgatagcg 
EVALQEYRTVARSLPVAVIA 



SUBSTITUTE SHEET (RULE 26) 



W 96/05293 



PCI7EP95/D3114 



4/19 



1103 1133 

gcccaaaatgcatcaatgtgggagagagtgaaatccatcattaaatcctccctggctgct 
AQNASM'WERVKSIIKSSLAA 

1163 1193 

gcaagcaacattcccggcccgatcggtgtcgccgcaagtggtattagtggactgtcagcc 
ASNIPGPIGVAASGISGLSA 



1223 1253 

ctttttgaaggatttggcttttagaagcatccggacgccaacctaaccgggcaagtatcc 
L F E G F G F STOP 

1283 1313 

gaacaatcggacatttggccacaataagcccaatttggttgaagattaaagtagtgagcc 



1343 1373 

cccttagcgcgaaaccggaatttatattccaaaccagtttaagtcaacagactaagg 



SUBSTITUTE SHEET (RULE 26) 



W 96/05293 



PCI7EP95/03114 



5/19 



Restriction Endonucleases site usage 



Aat II 


1 


Bspl286I 


2 


Fse I 




Pac I 




Acc I 


1 


Bspl407I 




Fsp I 




PaeR7 I 




Acc65 I 


— 


BspD I 


1 


Gdi II 


i 


PflM I 


1 


Aci I 


5 


BspE I 


1 


Hae I 


i 


Pie I 


3 


Afl II 


- 


BspH I 


— 


Hae II 


2 


Pme I 




Afl III 


2 


BspM I 


1 


Hae III 


6 


Pml I 




Age I 


— 


BspW I 


4 


Hga I 


2 


PpulO I 


1 


Alu I 


3 


Bsr I 


4 


HgiA I 


1 


PpuM I 




Alw I 


1 


BsrF I 


1 


Hha I 


6 


PshA I 




AlwN I 


1 


BssH II 


- 


Hinc II 


5 


Pspl406I 




Apa I 


- 


Bstll07I 


- 


Hind III 


— 


Pst I 




ApaL I 


- 


BstB I 


— 


Hinf I 


4 


Pvu I 


1 


Apo I 


2 


BstE II 


— 


HinP I 


6 


Pvu II 


— 


Asc I 


- 


BstK I 


8 


Hpa I 


1 


Rsa I 


4 


Ase I 


- 


BstN I 


2 


Hpa II 


11 


Rsr II 




Ava I 


- 


BstU I 


4 


Hph I 


— 


Sac I 


1 


Ava II 


2 


BstX I 


1 


Kas I 


— 


Sac II 




Avr II 


— 


BstY I 


2 


Kpn I 


— 


Sal I 




BamH I 


— 


Bsu36 I 


1 


Mae II 


8 


Sap I 




Ban I 


- 


Cla I 


1 


Mae III 


2 


Sau3A I 


4 


Ban II 


2 


Csp6 I 


4 


Mbo I 


4 


Sau96 I 


6 


Bbe I 


— ■ 


Dde I 


6 


Mbo II 


1 


Sea I 


1 


Bbs I 


— 


Dpn I 


4 


Mcr I 


1 


ScrF I 


8 


Bbv I 


2 


Dpn II 


4 


MlU I 


1 






BceF I 




Dra I 




Mme I 


1 


Sfc I 




Beg I 


1 


Dra III 




Mnl I 


9 


Sfi I 




Bel I 




Drd I 


2 


Msc I 


1 


SgrA I 




Ben I 


6 


Dsa I 


1 


Mse I 


8 


Sma I 




Bfa I 


5 


Dsa V 


8 


Msp I 


11 


SnaB I 




Bgl I 




Eae I 


2 


Mun I 




Spe I 


i 


Bgl II 


1 


Eag I 




Nae I 




Sph I 




Bpm I 


1 


Eamll05I 




Nar I 




Srf I 




Bpull02I 




Ear I 




Nci I 


6 


Sse8337I 





SUBSTITUTE SHEET (RULE 26) 



W 96/05293 



PCT/EP95/03114 



6/19 



Bsa I 


— 


Ecll36 I 


1 


Nco I 


1 


Ssp I 


— 


BsaA I 


1 


Eco47 III 


- 


Nde I 


- 


Stu I 


— 


BsaB I 


1 


Eco57 I 


1 


NgoM I 


- 


Sty I 


2 


BsaH I 


3 


EcoN I 


1 


Nhe I 


1 


Swa I 


— 


BsaJ I 


5 


EcoO109 I 


1 


Nla III 


6 


Taq I 


4 


BsaW I 


2 


EcoR I 


1 


Nla IV 


2 


Tfi I 


1 


Bsg I 




EcoR II 


2 


Not I 




Tthlll I 




BsiE I 


1 


EcoR V 




Nru I 




Tthlllll 


3 


BsiW I 


1 


Ehe I 




Nsi I 


1 


Xba I 




Bsl I 


6 


Esp3 I 




Nsp I 




Xcm I 




Bsm I 




Fau I 




Nsp7524I 




Xho I 




BsmA I 


1 


Fnu4H I 


5 


NspB II 




Xma I 




Bspl20I 




Fok I 


4 


NspC I 




Xmn I 


1 



Enzyme /Recognit ion sequence / n . s it es /pos it ions : 



Aat II 


gaegt/c 


1 


45 


Acc I 


gt/mkac 


1 


123 


Alw I 


ggatc 4/5 


1 


641 


AlwN I 


cagn3/ctg 


1 


87 


Beg I 


cgan6tgc 


1 


558 


Bgl II 


a/gatct 


1 


1076 


Bpm I 


ctggag 16/14 


1 


391 


BsaA I 


yac/gtr 


1 


114 


BsaB I 


gatnn/nnatc 


1 


910 


BsiE I 


cgry/cg 


1 


1182 


BsiW I 


c/gtacg 


1 


1064 


BsmA I 


gtctc 1/5 


1 


923 


BspD I 


at /cgat 


1 


469 


BspE I 


t/cegga 


1 


1252 


BspM I 


acctgc 4/8 


1 


811 


BsrF I 


r/ceggy 


1 


1084 


BstX I 


ccan5/ntgg 


1 


531 


Bsu36 I 


cc/tnagg 


1 


932 


Cla I 


at /cgat 


1 


469 



SUBSTITUTE SHEET (RULE 26) 



WO 96/05293 



PCT/EP95/03114 



7/19 



Dsa I 


c/crygg 


1 


852 


Ecll36 I 


gag /etc 


1 


54 


Eco57 I 


ctgaag 16/14 


1 


1052 


EcoN I 


cctnn/n3agg 


1 


513 


EcoO109 I 


rg/gnccy 


1 


700 


EcoR I 


g/aattc 


1 


773 


Gdi II 


yggccg -5/-1 


1 


1018 


Hae I 


wgg/ccw 


1 


1298 


HgiA I 


gwgcw/ c 


1 


54 


Hpa I 


gtt/aac 


1 


944 


Mbo II 


gaaga 8/7 


1 


1323 


Mcr I 


c/grycg 


1 


1182 


Mlu I 


a/cgegt 


1 


61 


Mme I 


tccrac 20/18 


1 


887 


Msc I 


tgg/cca 


1 


1298 


Nco I 


c/catgg 


1 


852 


Nhe I 


g/ctagc 


1 


398 


Nsi I 


atgea/t 


1 


1110 


PflM I 


ccan4/ntgg 


1 


113 


PpulO I 


a/tgeat 


1 


1110 


Pvu I 


cgat/cg 


1 


1182 


Sac I 


gagct/c 


1 


54 


Sea I 


agt/act 


1 


614 


Spe I 


a/ctagt 


1 


425 


Tfi I 


g/awtc 


1 


1025 


Xmn I 


gaann/nnttc 


1 


480 



Afl III a/crygt 2 61 160 

Apo I r/aatty 2 773 1360 

Ava II g/gwee 2 498 969 

Ban II grgcy/c 2 54 1338 

Bbv I gcagc 8/12 2 1157 1160 

BsaW I w/ceggw 2 1252 1356 

Bspl286I gdgch/c 2 54 1338 

BstN I cc/wgg 2 206 1153 

BstY I r/gatcy 2 640 1076 



SUBSTITUTE SHEET (RULE 26) 



WO 96/05293 



PCI7EP9S/03114 



8/19 



DrdI gacn4/nngtc 2 
Eae I y/ggccr 2 
EcoR II /ccwgg 2 
Hae II rgcgc/y 2 
Hga I gacgc 5/10 2 
Mae III /gtnac 2 
Nla IV ggn/ncc 2 
Sty I c/cwwgg 2 

Alu I ag/ct 3 
BsaH I gr/cgyc 3 
Pie I gagtc 4/5 3 
SfaNI gcatc 5/9 3 
TthlllH caarca 11/9 

BspWI gcn5/nngc 4 

BsrI actgg 1/-1 4 

BstU I cg/cg 4 

Csp6 I g/tac 4 

Dpn I ga/tc 4 

Dpn II /gate 4 

Fokl ggatg 9/13 4 

Hinf I g/antc 4 

Mbo I /gate 4 

Rsa I gt/ac 4 

Sau3AI /gate 4 

Taq I t/cga 4 

Aci I cege -3/-1 5 

Bfa I c/tag 5 

BsaJ I c/enngg 5 

Fnu4H I gc/ngc 5 

Hinc II gty/rac 5 

Ben I ccs/gg 6 
Bsl I ccn5/nngg 6 



39 905 
1018 1298 
206 1153 
88 184 
126 1256 
71 756 
700 928 
826 852 

55 332 609 
45 126 1256 
381 719 857 
565 1112 1249 
3 83 589 1164 

103 1091 1103 1340 
390 651 876 1376 
62 167 1048 1350 
414 523 615 1065 
503 641 1077 1183 
503 641 1077 1183 
310 890 916 1250 
381 719 857 1025 
503 641 1077 1183 
414 523 615 1065 
503 641 1077 1183 
470 557 985 1038 

168 182 695 1100 1194 
399 426 495 659 692 
259 376 826 852 1152 
182 1100 1157 1160 1193 
48 201 840 944 1385 

260 377 458 628 1175 1269 
113 259 260 371 513 919 



SUBSTITUTE SHEET (RULE 26) 



WO 96/05293 



PCT/EF9S/D3114 



9/19 



Dde I 
Hae III 
Hha I 
HinP I 
Nci I 
Nla III 
Sau96 I 



c/tnag 

gg/cc 

gcg/c 

g/cgc 

cc/sgg 

catg/ 

g/gncc 



6 
6 
6 
6 
6 
6 
6 



BstK I c/cngg 8 

Dsa V /ccngg 8 

Mae II a/cgt 8 

Mse I t/taa 8 

ScrF I cc/ngg 8 



Mnll 
1149 



Hpa II c/cgg 11 
1253 1269 1357 
Msp I c/cgg 11 
1253 1269 1357 



611 717 859 933 1345 1394 
702 928 1019 1102 1178 1299 
89 166 185 939 1049 1349 
89 166 185 939 1049 1349 
260 377 458 628 1175 1269 
178 532 853 966 1003 1022 
498 701 928 969 1102 1178 

206 260 377 458 628 1153 1175 1269 
206 260 377 458 628 1153 1175 1269 
46 108 115 133 160 437 537 554 
27 197 441 450 945 1143 1328 1381 
206 260 377 458 628 1153 1175 1269 



cctc 7/7 9 145 316 513 791 935 1031 1034 1043 



261 342 378 458 576 629 1085 1176 
261 342 378 458 576 629 1085 1176 



292 sites found 

No Sites found for the following Restriction Endonucleases 



Acc65I 

Aflll 

Age I 

Apal 

ApaLI 

AscI 

Asel 

Aval 

Avrll 



g/gtacc 

c/ttaag 

a/ccggt 

gggcc/c 

g/tgcac 

gg/cgcgcc 

at/taat 

c/ycgrg 

c/ctagg 



Drain 
EagI 

Eamll05I 
Earl 

Eco47III 

EcoRV 

Ehel 

Esp3I 

Faul 



cacn3/gtg 
c/ggccg 
gacn3/nngtc 
ctcttc 1/4 
agc/gct 
gat /ate 
ggc/ gec 
egtetc 1/5 
cccgc 4/6 



Pmel gttt/aaac 
Pmll cac/gtg 
PpuMI rg/gwecy 
PshAI gaenn/nngtc 
Pspl406I aa/egtt 
PstI ctgea/g 
PvuII cag/ctg 
RsrII cg/gwecg 
SacII cegc/gg 



SUBSTITUTE SHEET (RULE 26) 



WO 96/05293 PCT/EP9S/03 114 



10/19 



BamHI g/gatcc Fsel 
BanI g/gyrcc Fspl 
Bbel ggcgc/c Hindi II 
Bbsl gaagac 2/6 HphI 
BceFI acggcl2/13 KasI 
Bell t/gatca Kpnl 
Bgll gccn4/nggc Muni 
Bpull02I gc/tnagc Nael 
Bsal ggtctcl/5 Narl 
Bsgl gtgcagl6/14 Ndel 
BsmI gaatgc 1/-1 NgoMI 
Bspl20I g/ggece NotI 
Bspl407I t/gtaca Nrul 
BspHI t/catga Nspl 
BssHII g/cgege Nsp7524I 
Bstll07I gta/tac NspBII 
BstBI tt/cgaa NspCI 
BstEII g/gtnacc Pad 
Dral ttt/aaa PaeR7I 



ggccgg/cc 


Sail 


g/tcgac 


tge/gea 


Sapl 


gctcttc 1/4 


a/agctt 


Sfcl 


c/tryag 


ggtga 8/7 


Sfil ggccn4/nggcc 


g/gegee 


SgrAI cr/ceggyg 


ggtac/c 


Smal 


ccc/ggg 


c/aattg 


SnaBI 


t^c/gta 


qcc/qgc 


SphI 


gcatg/c 


qcr/cQCC 


Srfl 


gccc/gggc 


ca/tatg 


Sse8337I ectgea/gg 


a/CCQQC 


Sspl 


aat/att 


qc/aaccqc 


StuI 


agg/cct 


tcg/cga 


Swal 


attt/aaat 


rcatg/y 


Tthllll gacn/nngtc 


r/catgy 


Xbal 


t/ctaga 


cmg/ckg 


Xcml 


ccan5/n4tgg 


rcatg/y 


Xhol 


c/tcgag 


ttaat/taa 


Xmal 


c/ceggg 


c/tcgag 







SUBSTITUTE SHEET (RULE 28) 



WO 96/05293 



PCI7EP95/03114 



11/19 



3 "LU 
> o CO 
Q- IE CD 



O Q) _ 
CO 00$ 

o> o> 
^ in 

CM 



O 



CO 
CM 
CO 



CLLL 
II CO 

o 



CM 
CO 



— CD 
05 CO 

X CD 
^CM 



CM ~ 
CO CO = 

o CD _ 

^ CD £ 

i- H 

— CM 

m_ ° 
00 E- 

o2 8 

2 - 

in P 



CO 



O) 



UJ 
CO 



> in 
— co o 

OSCM 

^ o w 
00 t- o 



CO — 

co 5: 

— . (/) 



CO 



o X 

CD co 

^ CD 
CO 

m — 
in 

in 



o — — 



o 

o 
o 
LU 

o ?" 

O CD 

co 



CO 

w 
o 

5" 
*E 

3 



CO 

"co 
Q. 

o 

CO 
<0 
-Q 

o 
o 



in o 

CO 



CD 



CD CD 



CO 



<D 



E 

Q- 
CD 



in 



< 

z 



CO 

CD 



o 
< 

CO 



CM ^ ^ 



*-oSS = = 



CD 

CO _ 



co o> u 75 



P 5 



SUBSTITUTE SHEET (RULE 261 



WO 96/05293 



PCT/EP95/03114 



12/19 

FIG. 7 Stereo diagram of the FHV protein showing the 
positions in which the HIV-1 specific sequence "IGPGRAF" 
is inserted. 




SUBSTITUTE SHEET (RULE 26) 



WO 96/05293 



PCT/EP95/D3114 



13/19 



FIG* 8 FHV Capsomer virus-like particles produced 
Baculovirus. 



BACULOV1RUSDN/V 



POLYHEDRIN 
PROMOTER 



\ 







FHV INSERT 





TRANSCRIPTION 



FHV-RNA 2 




AUG 



J 



UAG 



TRANSLATION 




SUBSTITUTE SHEET (RULE 26) 



WO 96/05293 



PCT/EP95/031I4 



O 



0) C 

(1) N ID 

C Q) 

(0 W 



14/19 



o 

Q) 

-h -p 



4J 0) 

o > 



CM 
I 

Cm 
C/> CO 



CO 

o 



4-> 



I 

> 



0> 

• s 

Q) — ^ 

g « 

o 

CO 

a, r o — 

o c 

> as 

U4 CO 



-H 

CO 



U 

* 8 

a> o 
.c <-> 

■p 

-a 
c 
to 

0) O 

2 8 
5 « 



>1 



a 
o 

CO 
CO 
0) 

a, 
x 
w 



t— i 
i 



c 

g 



CM 



> 
CO 

c 

-H 
03 

g 
n 

0) 
(0 
•H 

-P 

a 

(0 



0). 
CO 

•H 

-P 

C 



CO — £ 

a> m 

4-> •• X 

C5 CO 4-> ~ 

H >i«h m 





SUBSTITUTE SHEET (RULE 26) 



WO 96/05293 



15/19 



PCIYEP95/031J4 



FIG. 10 Sedimentation pj\>J.i3- -i>:c! ^h-L U;en cojnposi Lion of 
VLPs produced by three rii f rer» -fit recombinant Bacuiovirus 
infected SF-21 cells. 




Sedlmentatton 



SUBSTITUTE SHEET (RULE 26) 



wo 96mm 



PCT/EP95/031I4 



16/19 

Fig. 11 SeruTTt anti-Vj antibody litres measured against 
recombinant gpI20 



\Ag . for 

AbX 

titreN. 


Ac NPV-V3 
L3 


Ac NPV-V3 
13 


Ac NPV--V3 
I3-L3 


FHV 


1 : 40000 
1 :20000 
1 : 30000 


1 :20000 
I : 60000 
1:10000 


1:5000 

1:15000 

1:20000 


gp 120 


1 : 500 
1 : 1500 
1 :2000 


1:2000 
1:5000 
1 : 1000 


1 : 2 50 
1 :2000 
1 : 500 



FIG. 12 Expression of hybrid FHV-HCVc protein through 
recombinant Baculovirus AcNPV-HCHc. 



Coomassie 


Western 


12 3 


12 3 4 






SET i Wftf 

j2££j ^jj^ 




3B|S ^SSS^ ^sjS^ 

Wt w ^ 

fit ** •* 













SUBSTITUTE SHEET (RULE 26) 



WO 96/05293 



PCT/EP9S/03114 



17/19 

FIG . 13 Profile and FHV reactivity (ELISA test) after a 
sucrose gradient of VLPs formed by SF-21 infected cells 
with the recombinant Baculovirus AcNPV-HCV. 




PIG. 14 Distribution of the ELISA tit re obtained by a VLP 
based asay among 100 selected HCV core positive sera. 




Titer of samples (x1000) 



SUBSTITUTE SHEET (RULE 26) 



WO 96/05293 



PCI7EP95/031I4 



18/19 

FIG. 15 Detection of HCV specific antibodies in a VLP 
based ELISA test and and its correlation with ALT levels 
and previous RIBA II values. 




SUBSTITUTE SHEET (RULE 26) 



WO 96/05293 



PCI7EP95/0J114 



19/19 

FIG. 16 Detection of HCV core-antibodies in human sera by 
dot-blots using recombinant (VLP-HCV) antigen or free 
peptides. 



Patients 
3 4 5 



NC 



Antigen 



£57 



NS5-p 



NS4 


"P 




NS3- 


-1- 


"P 


NS3 


-2 


"P 


NS3 


-3 


"P 


HCc 


-1 


-P 


HCc 


-2 


-P 



pHCc-2 



SUBSTITUTE SHEET (RULE 26) 



INTERNATIONAL SEARCH REPORT 



Intrmaoorul Application No 

PCT/EP 95/03114 



A. CLASSIFICATION OF SUBJECT M« ITER _ _ .... 

IPC 6 C12N7/00 C12N15/86 C12N15/62 C07K14/06 C07K14/16 
C07K14/18 A61K39/12 G01N33/53 


According to International Patent Claroficaoon ((PC) or to both national class fi cation and IPC 




B. FIELDS SEARCHED 


Minimum documcnuoon searched (classification system followed by class fi canon symbois) 

IPC 6 C12N C07K A61K G01N 


Documentation searched other than minimum documentation to the extent that such documents are included in the fields searched 


Electronic data base consulted during the international search (name of data base and, where practical, search terms used) 


C. DOCUMENTS CONSIDERED TO BE RELEVANT 


Category * 


Citation of document, with indication, where appropriate, of the relevant passages 


Relevant to claim No. 


Y 


J. VIROL. (1993), 67(5), 2950-3 C0DEN : 
J0VIAM;ISSN: 0022-538X, 
May 1993 

FISHER, ANDREW J. ET AL 'Crystallization 
of viruslike particles assembled from 
flock house virus coat protein expressed 
in a baculovirus system* 
see the whole document 


1,2 


Y 


J. VIROL. (1993), 67(5), 2756-63 CODEN: 
JOVIAM-.ISSN: 0022-538X, 
May 1993 

SCHNEEMANN, ANETTE ET AL 'Use of 
recombinant baculoviruses in synthesis of 
morphologically distinct viruslike 
particles of flock house virus, a 
noda virus 1 

see the whole document 


1.2 






-/-- 




| X| Further documents are listed in the continuation of box C. 


j | Patent family members arc listed in annex. 


* Special categories of a ted documents ; 

"A* document defining the general state of the art which is not 
considered to be of particular relevance 

"E" earlier document but published on or alter the international 
filing date 

"L* document which may throw doubts on pnonty cJaimfs) or 
which is a led to establish the publication date of another 
citabon or other special reason (as specified) 

"0* document referring to an oral disclosure, use, exhibition or 
other means 

'P* document published pnor to the international filing date but 
later than the pnoniy date claimed 


T* later document published after the international filing date 
or pnonty date and not in conflict with the application but 
a ted to understand the pnnaple or theory underlying the 
invention 

*X" document of particular relevance; the d aimed invention 
cannot be considered novel or cannot be considered to 
involve an invenbve step when the document is taken alone 

*Y* document of particular relevance; the claimed invention 
cannot be considered to involve an inventive step when the 
document is combined with one or more other such docu- 
ments, such combination being obvious to a person skilled 
in the art. 

document member of the same patent family 


Date of the actual completion of the international search 

4 January 1996 


Date of mailing of the international search report 

26. 01. 95 


Nunc and mailing address of the ISA 

European Patent Office, P.B. SKIS Patentlaan 2 
NL • USO HV Ritswijk 
Td. ( * 31-70) 340-2040, Tx. 31 651 epo nl. 
Far (* 31-70) 340- 3016 


Auihonzed officer 

Hornig, H 



Form PCT1SA 210 (»<on« ihwt) (July Iff!) 



page 1 of 3 



INTERNATIONAL SEARCH REPORT 



International Application No 

PCT/E? 95/03114 



C4Ccrt£>nu*Oon) OOCUMENTS CONSIDERED TO BE RELEVANT 



Cite jcry ' 



Quo on of document, with inctocaoon, where appropriate, of the relevant passages 



Relevant 10 claim No. 



J. VIROLOGY, 

vol. 66, no. 7, July 1992 

AM. SOC. MICROBIOL., WASHINGTON, US, 

pages 4003-4012, 

B. ROVINSKI ET AL. Expression and 
characterization of genetically engineered 
human immunodeficiency virus-like 
particles containing modified envelope 
glycoproteins: Implications for 
development of a cross-protective AIDS 
vaccine' 

see the whole document 
J. GENERAL VIROLOGY, 

vol. 74, no. 7, July 1993 READING, BERKS, 
GB, 

pages 1261-1269, 

R. WAGNER ET AL. 'Induction of cytolytic 
T lymphocytes directed towards the V3 loop 
of the human immunodeficiency virus type 1 
external glycoprotein gpl20 by p55gag/V3 
chimeric vaccinia viruses' 
see the whole document 

NATURE, 

vol. 361, 14 January 1993 MACMILLAN 
JOURNALS LTD., LONDON, UK, 
pages 176-179, 

A.J. FISHER AND J.E. JOHNSON 'Ordered 
duplex RNA controls capsid architecture in 
an icosahedral animal virus 1 
see the whole document 

NUCLEIC ACIDS RES. (1989), 17(18), 7525-6 
CODEN: NARHAD;ISSN: 0305-1048, 
25 September 1989 
DASGUPTA, RANJIT ET AL 'Nucleotide 
sequences of three Nodavirus RNA2's: the 
messengers for their coat protein 
precursors' 

see the whole document 

FEBS LETT. (1994), 353(1), 1-4 CODEN: 
FEBLAL;ISSN: 0014-5793, 
October 1994 

TISMINETZKY, SERGIO G. ET AL 
'Immunoreactivity of chimeric proteins 
carrying the HIV-1 epitope IGPGRAF. 
Correlation between predicted conformation 
and antigenicity' 
see the whole document 



-/-- 



1.2 



1.2 



1-6 



1-6 



1-6 



Form PCT ISA- 210 (eoounuauon of uau* th—l) (Jury »9W) 



page 2 of 3 



INTERNATIONAL SEARCH REPORT inwnttoi-i Appbcaon no 

PCT/EP 95/03114 


CfContrauabon) DOCUMENTS CONSIDERED TO BE RELEVANT. 


Category * 


Guboo of document, with tndicaaon, where appropriate, of the relevant paisafes 


Relevant to claim No, 


T 


VACCINE 13 (13). 1995. 1233-1239. ISSN: 
0264-410X, 

September 1995 
SCODELLER E A ET AL 'A new epitope 
presenting system displays a HIV-1 V3 loop 
sequence and induces neutralizing 
antibodies. 1 
see the whole document 


1-6 



Form PCT/lSA/210 (CBOttfuMbOA of mom* th**t) |)uly lttt) 



page 3 of 3