Skip to main content

Full text of "USPTO Patents Application 09848616"

See other formats


® 



Eur palsch s Pat ntamt 
European Patent Offlc 
Offic europe n d s brevets 



© Publication number: 



Document AL1 
Appl. No. 09/848,616 

0 259 149 

A2 



® 



EUROPEAN PATENT APPLICATION 



If! 

i 

i- 

co 

LU 
CO 



@ Application number: 87307746.5 
@ Date of filing: 02.09.87 



@ Priority: 03.09.86 US 903222 

© Date of publication of application: 
09.03.88 Bulletin 88/10 

@ Designated Contracting States : 

AT BE CH DE ES FR GB fT U LU NL SE 



® Int. CI. 4 : A 61 K 39/15 

A 61 K 39/385, A 61 K 39/00 

//C07K7/20.C12N15/00, 

C12P21/02 



© Applicant: The University of Saskatchewan 
124 Veterinary Road Saskatoon 
Saskatchewan S7N 0W0 (CA) 

@ Inventor: Sahara, Marta Iris 
316-114 Clarence Avenue South 
Saskatoon Saskachewan S7N 1H1 (CA) 

Frenchlck, Patrick John 

722 9th Avenue North 

Saskatoon Saskachewan S7K 2Y9 (CA) 

Mullin-Ready, Kerry Frances 

21-10 Summers Place 

Saskatoon Saskachewan S7H 3W4 (CA) 

@ Representative: Blzley, Richard Edward eta I 
BOULT, WAliE & TENNANT27 Fumfval Street 
London EC4A1PQ (GB) 



o 
u> 

CM 



CL 



@ The use of rotavirus nucleocapald protein VP6 In vaccine compositions. 

(g) New immunological carrier complexes are provided utiliz- 
ing the VP6 polypeptide from rotavirus as the carrier molecule. 
Also provided are methods of binding epitope-bearing mole- 
cules (e.g., haptens) to the VP6 carrier molecule through 
binding peptides. The VPS carrier can be a VP6 monomer, 
oligomer, or a particle comprises of VP6 oligomers. 



*m«u ulMMnnauwupwaH m«ih 



nu phut m n r* WW in SIMM ran Mmnuttg m 



itt tniiM n 



3 VS tSSS9\e&3SfiS5SBfi^3 3 



Bundesdruckerei Berlin 



0 259149 

Descript! n 

THE USE OF ROTAVIRUS NUCLEOCAPSID PROTEIN VP6 IN VACCINE COMPOSITIONS 

The present invention relates to immunological carriers and vaccine compositions. More particularly, the 
present invention relates to the use of rotavirus inner capsid protein VP6 as an immunologic carrier, as well as 
5 its use in a vaccine composition for use in stimulating immunity against rotavirus infections. 

Rotavirus is a genus of the family Reoviridae. This genus of viruses is widely recognized as the major cause 
of gastroenteritis of infants and young children in most areas of the world. In the lesser developed countries 
diarrheal diseases such as gastroenteritis constitute a major cause of mortality among infants and young 
children. For a general background on rotaviruses, see Kapikian et al. t in Virology , pp. 863-906 (B.N. Fields et 

10 al., eds., 1985), the disclosure of which is Incorporated herein by reference. 

Immunity to rotavirus infections and illness has been poorly understood. Animal studies, however, have 
been conducted directed to the relative importance of systemic and local immunity. Bridger et al. (1981) Infect, 
Immun. 31 :906-910; Lecce et aL (1982) J. Clin. Microbiol. 16:715-723; Little et al. (1982) Infect. Immun. 
38:755-763. For example it has been observed that calves develop a diarrheal illness despite the presence of 

15 serum rotavirus antibody at the time of infection. Calves which are fed colostrum-containing rotavirus 
antibodies immediately before and after infection with rotavirus, however, do not develop diarrhea within the 
normal incubation period. See, e.g., Bridger et al. (1975) Br. Vet. J. 131 :528-535; Woode et al. (1975) Vet Rec. 
97:148-149. Similar results have been achieved with newborn lambs, who developed resistance when fed 
colostrum or serum containing rotavirus antibodies for several days during which period the lambs were 

20 challenged with rotavirus. Snodgrass et al. (1976) Arch. Virol. 52:201-205. 

In studies of the effect of administering rotavirus to humans, it was found that a preexisting high titer of 
serum neutralizing antibodies to rotavirus correlated with resistance to diarrheal illness. Kapikian et al. (1983) 
Dev. Biol. Standard 53:209-218; Kapikian et al. (1983) J. Infect. Dis. 147:95-106. In infants and children, 
however, the presence of serum antibody to rotavirus has not been associated with resistance to infection or 

25 illness. See, e.g., Black et al. (1982) J. Infect. Dis. 145:483-489; Gurwith et al. (1981) J. Infect. Dis. 144:218-224; 
McLean et al. (1981) J. Clin. Microbiol. 13:22-29. 

Most current efforts in experimental rotavirus immunoprophylaxis are aimed at the development of live 
attenuated virus vaccines. Attenuation, however, is usually associated with a decrease in the level of viral 
replication in the target organ; i.e., the epithelium of the small intestine. Attenuated mutants of other mucosal 

30 viruses, however, have exhibited a diminished immune response correlated with the decrease in replication. 
Since the protective efficacy of wild-type virus infection is marginal, it may be impossible to achieve the desired 
immunoprophylaxis with a mutant exhibit decreased replication. Two bovine rotaviruses, NCDV and the UK 
strain, have been produced in attenuated form and evaluated as vaccines in humans. Vesikari et al. (1983) 
Lancet 2:807-811; Vesikari et al. (1984) Lancet 1:977-981; Wyatt et al. (1984) In Conference Proceedings: 

35 Control and Eradication of Infectious Diseases in Latin America. 

Another approach to the development of an attenuated rotavirus vaccine Is based on the ability of 
rotaviruses to undergo gene reassortment during coinfection. A number of "hybrid 0 strains have been isolated 
from cultures coinfected with a wild-type animal rotavirus and a human rotavirus. Strains are selected which 
receive the gene coding for the outer nuclear capsid protein VP7, the remaining genes being derived from the 

40 animal rotavirus parent. See, e.g., Immunogenicity , pp. 319-327 (Chanock & Lemer, eds., 1984). 

Still another approach to immunization has been the suggestion of using recombinantly produced VP7 
polypeptide in a vaccine. See, e.g., Virology , p. 892 (B.N. Fields et al., eds. r 1985). It has been further 
suggested, however, that recombinant VP7 Is unlikely to produce an effective primary local intestinal immune 
response. Id. at 893. The VP7 gene from several strains of rotavirus has been cloned and full-length or near 

45 fulllength cDNA has been attained. See, e.g.. Arias et al. (1984). J. Virol. 50:657-661 ; Both et al. (1983) Proc. 
Natl. Acad. Sci. USA 80:3091-3095; Elleman et al. (1983) Nucleic Acid Res. 11:4689-4701; Flores et al. in 
Modern Approached to Vaccines; Molecular and Chemical Basis of virus Virulence and Immunogenicity , 
pp. 159-164 (R.M. Chanock et al., eds., 1983). 
It has also been suggested that synthetic peptides corresponding to major anogenic sites of VP7 may be 

50 useful in immunization. Virology , supra, p. 893. In addition, passive immunization with rotavirus antibodies has 
been shown to be effective in preventing rotavirus illness in animals and In infants and young children. Id. 

The most abundant structural protein in rotavirus particles is the approximate 45 K MW nucleocapsid or 
inner capsid protein coded for by gene 6, known In the art as virus protein 6 or VP6. Although not an integral 
component of the outer capsid, it is an important viral antigen. It has been identified as the subgroup antigen 

55 by using several techniques including complement fixation, EUSA, immunoadherence agglutination assay, 
and specific monoclonal antibodies. VP6 is also described as the common rotavirus group antigen since some 
monoclonal antibodies against it will react with all rotaviruses, and polyclonal serum raised against a single 
rotavirus type can detect most other rotavirus strains. Aside from its antigenic properties, VP6 is very 
immunogenic and several investigators have found that polyclonal serum raised to this protein has neutralizing 

60 ability. Bastardo et al. (1981) Infect. & Immun. 34:641-647. 

Th gene encoding VP6 has been cloned. See, e.g., Estes t al. (1984) Nucleic Acids Res. 12:1875-1887. 
VP6 has also been produced by recombinant methods. Est s et al. (1987) J. Virol. 61:1488-1494. 
Vaccin compositions for rotavirus disease comprised of peptid s from VP7, VP6 and VP3 hav also been 



2 



0 259 149 



proposed. See commonly owned patent applications: U.S. Serial No. 903,325 (filed 3 September 1986); 
Australian Serial No. 526,116 (filed 23 December 1986); Australian Serial No. 66987/86 (filed 24 December 
1986); Chinese Serial No. 86108975 (filed 25 December 1986); EPO Serial No. 86 117 981.0 (23 December 
1986) ; and Japanese Serial No. 61-308945 (filed 26 December 1986>, the disclosures of which are incorporated 
by reference herein. 5 

Several immunologic carriers are known in the art, including, but not limited to, keyhol limpet hemocyanin 
(KLH), bovine serum albumin (BSA), ovalbumin (OVA), beta-galactosidase (B-GAL), penicillinase, 
poly-DL-aianyl-poly-L-lysine, and poly-L-lysine. The coupling of the desired hapten or other epitope-bearing 
molecule to such carriers often requires elaborate chemical procedures. Such procedures are expensive and 
may have a deleterious effect on the final complex comprised of the carrier and epitope-bearing molecule. 10 
Thus, there is a need in the art for improved immunological carriers to which epitope-bearing molecules can be 
attached readily, but which are also at least as effective as prior art immunologic carriers. 

The present invention is based on the discovery that VP6 polypeptides of rotaviruses, or functional 
fragments thereof, in either monomelic or ligomeric forms, have the ability to bind peptides by virtue of an 
interaction between the peptide and binding site(s) on the VP6 polypeptide to form a VP6 - binding peptide 15 
complex. The present invention is also based on the discovery that VP6, in its monomelic or oligomeric forms, 
can be advantageously employed as an Immunologic carrier to which molecules bearing an epitope of interest 
can be attached. Preferably, these epitope-bearing molecules can be attached to the VP6 polypeptide by use 
of a binding peptide. The above discoveries, therefore, provide for the production of compositions which can 
be used to stimulate an immune response to VP6, VP6 complex with an epitope- bearing molecule, as well as 20 
to the binding peptide if it is employed in the complex. 

In one embodiment, the present invention is directed to a composition capable of raising an immunological 
response in a mammal to a selected epitope comprising an immunological carrier complex, said complex 
comprised of an epitope-bearing molecule expressing said selected epitope, said epitope-bearing molecule 
being selected from the group consisting of polypeptides, carbohydrates and nucleic acids; said 25 
epitope-bearing molecule being coupled to a carrier protein selected from the group consisting of monomers 
and oligomers of a polypeptide homologous to a rotavirus VP6 inner capsid protein amino acid sequence. 

In several preferred embodiments of the above composition, the epitope-bearing molecule is a polypeptide, 
and the carrier protein is a VP6 inner capsid protein. In particularly preferred embodiments, the VP6 carrier 
protein is an oligomer formed into a particle, such as a tube or sphere. In a still further preferred embodiment, 30 
the epitope-bearing molecule is copied to the carrier protein through a protein-protein interaction with a 
binding peptide specific for the VP6 binding site(s). 

in another embodiment of the present invention, an improved vaccine composition if provided wherein the 
epitope of interest is on a polypeptide bound to a carrier protein, the improvement comprising using rotavirus 
VP6 inner capsid polypeptide as said carrier protein. 35 
4 In other embodiments of the present invention, vaccination methods are provided, as well as specific 
binding peptides. 

Further embodiments of the present invention will readily occur to those of ordinary skill in the art. 
Figure 1 shows the nucleotide sequence of a cloned copy of the rotavirus strain S-A1 1 gene 6 encoding 
the polypeptide VP6. The sense strand (corresponding to the mRNA) is shown, as well as the predicted 40 
amino acid sequence of VP6. Termination sites are underlined. See Estes et al. (1984) Nucleic Acids Res. 
12:1875-1887. 

Figure 2 shows electron micrographs of particles produced from reassembled rotavirus VP6. Panel A 
shows particles from VP6 isolated from human strain WA rotavirus (subgroup 2), and panel B shows 
particles reassembled from recombinantly produced VP6 from a baculovirus expression system. 45 

Figure 3 is an electron micrograph of VP6 protein forming aggregated spherical particles in 0.01 M 
citrate buffer pH 4.0 and dialyzed to pH 5.0. 

Figure 4 is an electron micrograph of VP6 protein reassembled into various forms by dlalyzing first to 
0.01 M phosphate buffer, pH 6.0, and then to 0.01 M citrate buffer, pH 4.0, at 4°C. The micrograph shows 
hexamers, small hexagonal lattices and tubes as well as sheets (arrows) consisting of a small-hole lattice. 50 
The arrow on the figure indicates the corresponding sheet on the original micrograph. Bars represent 100 
nm. 

Figure 5 is a schematic representation of the assembly of VP6 monomer into various oligomeric 
structures. 

Figure 6 depicts dose-response curves to spherical VP6 carrier protein with and without various 55 
epitope-bearing molecules compfexed therewith. 

Figure 7 depicts dose-response curves to spherical VP6 carriers compiexed with or without various 
epitope-bearing molecules. 

Figure 8 depicts dose-response curves to spherical VP6 carrier protein with or without epitope-bearing 
molecules compiexed therewith. 60 

Figure 9 depicts a dose-response curve for a spherical VP6 carrier protein compiexed with an 
epitope-bearing molecule. 

In describing the present invention, the following terms will b employed, and are intended to be the defined 
as indicated below. . 

An "immunological response" to an epitope of interest is th developm nt in a mammal of either a cell-or 65 



3 



0 259 149 



antibody-mediated immune response to the epitope of interest. Usually, such a respons consists of the 
mammal producing antibodies and/or cytotoxic T c lis directed specifically to the epitope of interest. 

An "immunological carrier complex" refers to a chemical complex between a immunologic carrier molecule, 
usually a protein, and a hapten or other epitope-bearing molecule. The epitope on the hapten or other 
5 epitope-bearing molecule for which an immunological response is desired is referred to as the "epitope of 
interest" or the "selected epitope". 

An "epitope-bearing molecule" refers to a molecule within an immunological carrier complex which is bound 
to the carrier molecule and bears the epitope of interest. The epitope-bearing molecule of the present 
invention can include, but is not limited to, polypeptides, carbohydrates, nucleic acids, and lipids. Further 

10 examples are given below. 

A "rotavirus VP6 inner capsid protein" refers to the art-recognized major viral protein of the inner capsid 
from any species or strain within the genus Rotavirus. See, e.g., Kapikian et aJ., supra Examples of rotavirus 
strains from which the VP6 protein can be isolated and employed in the present invention include, but are not 
limited to, Simian SA-11, human D rotavirus, bovine UK rotavirus, human Wa or W rotavirus, human DS-1 

15 rotavirus, rhesus rotavirus, the "O" agent, bovine NCDV rotavirus, human K8 rotavirus, human KU rotavirus, 
human DB rotavirus, human S2 rotavirus, human KUN rotavirus, human 390 rotavirus, human P rotavirus, 
human M rotavirus, human Walk 57/14 rotavirus, human Mo rotavirus, human Ito rotavirus, human Nemoto 
rotavirus, human YO rotavirus, human McM2 rotavirus, rhesus monkey MMU 18006 rotavirus, canine CU-1 
rotavirus, feline Taka rotavirus, equine H-2 rotavirus, human St. Thomas No. 3 and No. 4 rotaviruses, human 

20 Hosokawa rotavirus, human Hochi rotavirus, porcine SB-2 rotavirus, porcine Gottfried rotavirus, porcine 
SB-1 A rotavirus, porcine OSU rotavirus, equine H-1 rotavirus, chicken Ch.2 rotavirus, turkey Ty.1 rotavirus, and 
bovine C486 rotavirus. Thus, the present invention encompasses the use of VP6 from any rotavirus strain, 
whether from subgroup I, subgroup II, or any as yet unidentified subgroup, as well as from any of the serotypes 
1-7, as well as any as yet unidentified serotypes. Furthermore, the present invention encompasses the use as 

25 an immunologic carrier of polypeptides having homologous amino acid sequences to rotavirus VP6 amino acid 
sequences which are unique to the class, or any member of the class, of VP6 polypeptides. Such unique 
sequences of VP6 proteins are referred to as a "rotavirus VP6 inner capsid protein amino acid sequence". 

"Oligomers" refer to multimeric forms of, for example, VP6 polypeptides. Usually, such VP6 oligomers are 
trimers formed by intermolecular disulfide bridging between VP6 monomers. See, e.g., Figure 5. 

30 The binding of an epitope-bearing molecule to a VP6 carrier protein through "protein-protein interaction(s)" 
refers to the type of chemical binding, both covalent and non-covalent, between a binding peptide region of 
the epitope-binding molecule and the VP6 carrier molecule. The exact nature of this binding is not understood. 
It is characterized, however, as the binding phenomenon observed when a peptide, having a Cys and another 
charged amino acid (e.g., Arg) in a structural relationship to each other analogous to that shown in peptide A 

35 or B (below), binds to VP6 binding sites on the carrier molecule through mere mixing of VP6 carrier protein and 
molecules containing the binding peptide region. It is believed that this protein-protein interaction is a 
combination of a disulfide bridge involving the Cys, and a non-covaient interaction involving the changed 
amino acid, but applicants do not wish to be bound by this theory. 
A "binding peptide" refers to amino acid sequences which have the ability to bind through a protein-protein 

40 interaction with a VP6 polypeptide. These binding peptides are discussed in more detail below. 

A composition "free of rotavirus virions" refers to a composition which does not contain intact virus 
particles, although it may contain particles formed from VP6 complexed to other molecules. 

A "vaccine composition", according to the present invention, is an otherwise conventional vaccine 
formulation employing either VP6 polypeptides alone or in an immunological carrier complex as the active 

45 ingredient. The preparation of vaccines containing the above active ingredients is well understood int he art. 
Typically, vaccines are prepared as injectables, either as liquid solutions or suspensions; solid forms suitable 
for solution in, or suspension in, liquid prior to injection may also be prepared. The preparation may also be 
emulsified or the active ingredient encapsulated in liposomes. The active immunogenic ingredient is often 
mixed with excipients which are pharmaceutical^ acceptable and compatible with the active ingredient. 

50 Suitable excipients are, for example, water, saline, dextrose, glycerol, ethanol, or the like, and combinations 
thereof. In addition, if desired, the vaccine may contain minor amounts of auxiliary substances such as wetting 
or emulsifying agents, pH buffering agents, or adjuvants which enhance the effectiveness of the vaccine. The 
vaccines are conventionally adminstered parenterally, by injection, for example, either subcutaneously or 
intramuscularly. Injectable vaccine formulations will contain an effective amount of the active ingredient, the 

55 exact amount being readily determined by one skilled in the art. The active ingredient can range from about 1% 
to about 950/o (w/w) of the injectable composition, or even higher or lower if appropriate. 

Additional vaccine formulations which are suitable for other modes of administration include suppositories 
and, in some cases, oral formulation. For suppositories, the vaccine composition will include traditional 
binders and carriers, such as, polyaikaline glycols, or triglycerides. Such suppositories may be formed from 

60 mixtures containing the active ingredient in the range of about 0.5% to about 10% (w/w), preferably about Wo 
to about 2%. Oral formulations include such normally employed excipients as, for example, pharmaceutical 
grades of mannitol, lactose, starch, magnesium, stearate, sodium saccharin cellulose, magnesium carbonate, 
and the tike. These oral vaccine compositions may be tak n in the form of solutions, suspensi ns, tablets, pills, 
capsules, sustained release formulations, or powders, and contain from about 10% t about 95% of th active 

65 ingredient, preferably about 25% to about 70%. 



4 



0 259 149 



Furthermore, the VP6 proteins or immunological carrier complexes of th present invention may be 
formulated into vaccine compositions in either neutral or salt forms. Pharmaceutically acceptable salts include 
the acid addition- salts (formed with the free amino groups of the active polypeptides) and which are formed 
with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, 
oxalic, tartaric, mandelic, and the like. Salts formed from free carboxyl groups may also be derived from 
inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such 
organic bases as isopropylamine, trimethylamine, 2-ethylamino ethanol, histidine, procaine, and the like. 

The vaccine composition of the present invention may be administered in a manner compatible with the 
dosage formulation, and in such amounts as will be therapeutically effective and immunogenic. The quantity to 
be administered depends on the subject to be treated, the capacity of the subjects immune system to 
synthesize antibodies, and the degree of protection desired. Precise amounts of active ingredient desired to 
be administered depend on the judgment of the practioner and are peculiar to each subject. The 
establishment of effective dosages for a particular formulation, however, are within the skill of the art through 
routine trials establishing dose-response curves. 

The rotavirus genome consists of eleven segments of double-stranded RNA. These 1 1 genes encode for the 
production of at least six structural proteins of the virus. In complete virus particles, these six proteins occur in 
a double-shelled arrangement. There are three inner shell (capsid) proteins designated virus protein (VP) 1, 2, 
and 6. There are three outer capsid proteins, two of which are designated VP3 and VP7. The third outer capsid 
protein, which is encoded by genomic segment 10 or 11, has not yet been assigned a number. The molecular 
weights of these proteins are shown in Table 1. 

Table 1 

Gene assignment and Molecular Weight 
of the Major Rotavirus Structural Proteins 



Genomic 
Segment 



Protein 
Designation 



Molecular 
Weight 



10 



is 



20 



25 



Location i 



1 
2 
4 
6 
7 
8 
9 



triplet 



10 or 11 



VP1 
VP 2 
VP 3 
vp 6 

VP 7 

ND 



110K 
92K 
84K 
45K 

41K 

20K 



inner 
inner 
outer 
inner 

outer 

outer 



30 



35 



40 



* Designates location of the structural protein in the 

inner or outer capsid of complete rotavirus particles. 45 

In different rotaviruses, the absolute order of the genomic segments does not always correspond to the 
same genes. For example the electrophoretic order of segments 7, 8. and 9 changes among rotaviruses from 
different animal species. This is referred to as inversion or "flip-flopping " of genome segments. The gene ^ 
triplet formed by segments 7, 8, and 9 codes for three polypeptides, the neutralization-specific major outer 
capsid glycoprotein identified as virus protein (VP) 7 and two nonstructural proteins which are now shown in 
the table. In rotavirus strains SA-11. W, and Wa, gene 9 codes for VP7. In rotavirus strain DS-1 and UK bovine 
rotavirus, however, gene 8 codes for VP7. There are discrepancies in the literature about the exact molecular 
weight of VP7, as well as of other rotavirus proteins. Several researchers have suggested that this Is in part & 
due to the many variations in methods used to: (1) separate the individual polypeptides, (2) prepare virus 
samples for electrophoresis, (3) detect polypeptides in polyacrylamide gels, and (4) detect various 
post-translational modifications of primary gene products. In addition, especially for bovine and human 
rotavirus, there are variations in the mobility of proteins derived from different isolates originating from the 
same species. The molecular weights shown in Table 1 are those reported by Sabara et al. (1985) J. Virol. qq 
53:58-66. 

As discussed above, VP6 is the most abundant of the inner capsid proteins, constituting about 80% by 
weight of the inner shell. Rotaviruses can be divided into two subgroups (I or II) based on an epitope on VP6 
which can be identified using monoclonal antibodies. Most rotaviruses examined to date fall into one of the tw 
subgroups; however^ there is evidenc that both subgroup epitopes can b located on a single VP6 ^ 



5 



0 259 149 



molecules. For example, recently an equin rotavirus was identified as having both subgroup 1 and 2 epitopes 
on VP6. See, .g., Hoshlno et a). (1987) Virology 157:488-496. Therefore, it is not inconceivable that the 
subgrouping classification may be extended or modified as new isolates are identified and their genes 
sequenced. There are also at least 7 serology groups into which rotaviruses have been classified. 
5 All VP6 molecules sequenced to date consist of 397 amino acids, although some variability in the molecular 
weight of the protein has been reported which may indicate a protein with more or less than this number of 
amino acids. Specifically, the reported molecular weight range for VP6 is 41-45K, thereby indicating an amino 
acid size range of 397-425. However, molecular weight variability does not necessarily reflect a difference In 
the number of amino acids but can be due to electrophoretic conditions used in characterization of the 

10 protein. Only by sequencing the gene coding for a particular VP6 can the number of amino acids be 
determined (See, e.g., Figure 1). The amino acid homology between VP6s belonging to the two different 
subgroups is 80<Vb or more, based on the VP6 genes sequenced to date. 

Within rotavirus, monomeric units of VP6 exist in a variety of oligomeric forms. Trimeric units (molecular 
weight about 135K) occur in both the virus particle and in infected cells, with the intersubunit linkage 

15 consisting of non-covalent interactions. These trimeric units complex further by virtue of disulfide bridges into 
larger units which likely represent the ring-like structures observed using electron microscopy. By employing 
different sample buffers, these nucleocapsid oligomeric complexes can be visualized on polyacrylamide gels. 

VP6 protein can be prepared by any of several methods. First, VP6 can be purified from in vitro -derived 
single-shelled virus particles by calcium chloride (CaCfe) or lithium chloride (LiCI) treatment by standard 

20 techniques. See, e.g., Almeida et al. (1979) J. Med. Virol. 4:269-277; Bican et aJ. (1982) J. Virol. 43:1 113-11 17; 
Gorziglia et al. (1985) J. Gen. Virol. 66:1889-1900; Ready et al. (1987) Virology 157:189-198. Alternatively, VP6 
can be produced by recombinant DNA techniques, which are fully explained in the literature. See, e.g., 
Maniatis, Fritsch & Sambrook, Molecular Cloning: A Laboratory Manual (1982); DNA Cloning , Volumes I and II 
(D.M. Glover ed. 1985); Oligonucleotide Synthesis (MJ. Gait ed. 1984); Nucleic Acid Hybridization (B.D. 

25 Hames & S.J. Higgins eds. 1 985) ; Transcription and Translation (B.D. Hames & S.J. Higgins eds. 1 984) ; Animal 
Cell Culture (R.L Freshney ed. 1986); Immobilized Cells and Enzymes (IRL Press, 1986); B. PerbaJ, A Practical 
Guide to Molecular Cloning (1984). 

DNA coding sequences encoding VP6 polypeptides can be derived from VP6 mRNA. See, e.g., Estes et al., 
supra ; Both et al. (1984) J. Virol. 51:97-101; Cohen et al. (1984) Virology 138:178-182. Alternatively, a DNA 

30 sequence encoding VP6 can be prepared synthetically rather than cloned. The DNA sequence can be 
designed with the appropriate codons for a VP6 amino acid sequence. In general, one will select preferred 
codons for the intended host if the sequence will be used for expression. The complete sequence is 
assembled from overlapping oligonucleotides prepared by standard methods and assembled into a complete 
coding sequence. See, e.g., Edge (1981) Nature 292:756; Nambair et al. (1984) Science 223:1299; Jay et al. 

35 (1984) J. Biol. Chem. 259:6311. 

Once a coding sequence for VP6 has been prepared or isolated, it can be cloned into any suitable vector or 
replicon. Numerous cloning vectors are known to those of skill in the art, and the selection of an appropriate 
cloning vector is a matter of choice. Example of recombinant DNA vectors for cloning and host cells which 
they can transform include the bacteriophage lambda (E. coli), pBR322 (E. coli), pACYC177 (E. coli), pKT230 

40 (gram-negative bacteria), pGV1106 (gram-negative bacteria), pLAFRI (gram-negative bacteria), pME290 
(non-E. coli gram-negative bacteria), pHV14 (E. coli and Bacillus subtilis), pBD9 (Bacillus), pHV14 (E. coli and 
Bacillus subtilis), pBD9 (Bacillus), plJ61 (Streptomyces), pUC6 (Streptomyces), Ylp5 (Saccharomyces), 
YCp19 (Saccharomyces) and bovine papilloma virus (mammalian cells). See generally, DNA Cloning: Vols, i & 
]l, supra ; T. Maniatis et al., supra ; B. PerbaJ, supra . 

45 The coding sequence for VP6 can be placed under the control of a promoter, ribosome binding site (for 
bacterial expression) and, optionally, an operator (collectively referred to herein as "control" elements), so 
that the DNA sequence encoding VP6 is transcribed into RNA in the host cell transformed by a vector 
containing this expression construction. The coding sequence may or may not contain a signal peptide or 
leader sequence. In bacteria, for example, VP6 is preferably made by the expression of a coding sequence 

50 containing a leader sequence which is removed by the bacterial host in post-translationaJ processing. See, 
e.g., U.S. Patent Nos. 4,431,739; 4,425,437; 4.338.397. 

An expression vector is constructed so that the VP6 coding sequence is located in the vector with the 
appropriate regulatory sequences, the positioning and orientation of the coding sequence with respect to the 
control sequences being such that the coding sequence is transcribed under the "control" of the control 

55 sequences (i.e., RNA polymerase which binds to the DNA molecule at the control sequences transcribes the 
coding sequence). The control sequences may be ligated to the coding sequence prior to insertion into a 
vector, such as the cloning vectors described above. Alternatively, the coding sequence can be cloned 
directly into an expression vector which already contains the control sequences and an appropriate restriction 
site. 

60 A number of procaryotic expression vectors are known in the art. See, e.g., U.S. Patent Nos. 4,440,859; 
4,436,815; 4,431,740; 4,431,739; 4,428.941; 4,425.437; 4.418,149; 4,411,994; 4,366,246; 4,342,832; see also 
U.K. Patent Applications GB 2,121,054; GB 2,008,123; GB 2,007,675; and European Patent Application 
103,395. Yeast expression vectors are also known in the art. See, e.g., U.S. Patent Nos. 4,446,235; 4,443,539; 
4,430,428; see als Eur pean Patent Applications 103,409; 100,561; 96,491. 

65 Depending on the expr ssion system and host selected, VP6 is produced by growing host cells transformed 



6 



0 259149 



by an expression vector described above under conditions whereby the VP6 protein is expressed. Th VP6 
protein is then isolated from the host cells and purified. If the expression system secretes the VP6 into growth 
media, the protein can b purified directly from cell-free media. If the VP6 protein is not secreted, it is isolated 
from cell lysates. The selection of the appropriate growth conditions and recovery methods ar within the skill 
of the art. 5 

Purified VP6 protein exhibits structural polymorphism. Specifically m hexamers and small hexagonal lattices 
are present in many of the samples. Tubular particles form between about pH 5.0 and about pH 9.0, and are 
moderately stable to changes in temperature and ionic strength. The formation of these particles is fully 
reversible. Spherical particles reassembling single-shelled virus can be formed at about pH 4.0. A novel 
structure, in the form of sheets, composed of small-hole lattice, is formed in samples shifted from about pH 6.0 10 
to about pH 4.0. These results demonstrate the importance of VP6 and of protein-protein interactions for 
rotavirus assembly. 

Such protein-protein interactions are likely involved in the observed phenomenon that certain peptides can 
bind to VP6 in its monomelic form or to various oligomeric structures formed from VP6 monomers, such as in 
vitro assembled tubes and spheres. The attachment is mediated by a specific binding site(s) within VP6. The 15 
structures which result from this binding, i.e., VP6 with a bound peptide, shall be referred to as VPS binding 
peptide complexes. They can function as carriers to which other molecules bearing an epitope of interest (e.g., 
haptens) can be attached. By definition, therefore, VP6 bound to another molecule by virtue of a specific amino 
acid sequence (binding peptide), which occurs naturally or has been tailored onto the epitope-bearing 
molecule, can be defined as an immunologic carrier for such a molecule. 20 

Many molecules are known in the art that bear an epitope and which can be useful when attached to a 
carrier. Examples of the classes of such molecules, usually macromoiecules, are polypeptides, carbohydrates, 
and nucleic acids. Proteins, glycoproteins, and peptides can include cytokines, hormones, glucagon, 
insulin-like growth factors, growth hormone, thyroid stimulating hormone, prolactin, inhibin, secretin, 
neurotensin, cholecystokinin or fragments thereof, calcitonin, somatostatin, thymic hormones, neurotransmit- 25 
ters and blockers, peptide-releasing factors (e.g., enkephalins), growth hormone releasing factor, as well as 
antigenic fragments of proteins, such as calmodulin, E. coll heat stable and heat labile enterotoxin, cholera 
toxin; and enzymes, such as protein kinase of Rouse sarcoma virus. Additional polypeptides include steroid 
hormones, such as testosterone, estradiol, aldosterone, endrostenedione, or fragments thereof. Examples of 
nucleotides include polynucleotide fragments, restrictions enzyme sites, and cyclic nucleotides (e.g., cyclic 30 
adenosine monophosphate). Examples of carbohydrates and carbohydrate complexes include bacterial 
capsules or exopolysaccharides (e.g., from Hemophilus influenzae B), bacterial lipid A associated core 
antigens (e.g., from Pseudomonas species), blood group antigens (e.g., the ABO antigens), and glycoiipids. 
Examples of lipids include fatty acids, glycerol derivatives, prostaglandins (e.g., prostaglandin E2), and 
lipopeptides (e.g., leukoteiene B4). Molecules of interest can also include alkaloids, such as vindotine, 35 
serpentine, catharanthine, as well as vitamins containing -OH, NH, SH. CHO, or COOH functional groups. 

In order to attach molecules to VP6 carriers, one may employ conventional chemical coupling techniques. A 
particular advantage of the VP6-binding peptide complex as a carrier, however, is that this system facilitates 
the attachment of molecules with minimal manipulation. For example, a synthetic peptide corresponding to an 
antigenic or immunogenic region of a particular infectious agent (the epitope of interest) can be chemically 40 
synthesized in such a way that it also contains the amino acid sequence (binding peptide) necessary to link it 
to VP6. This can be done without altering the antigenicity of the region to which immune responses are sought 
and may enhance the immunogenicity of this region. The antigenic region can also be produced via 
recombinant DNA technology, as describe above, in which case the nucleotide sequence coresponding to the 
binding peptide can be added so that the resulting product is a combination (fusion protein) of the antigenic 45 
region and the binding peptide. Attachment of the molecule to the VP6 carrier is then simply achieved by 
mixing the two substances without additional manipulation. 

Several peptides have been found or designed that bind to VP6. The amino acid sequences for two are: 

(1) Peptide A (22 amino acids): Cys-Asp-Gly-Lys-Tyr-Phe-Ala-Tyr-Lys-Val-Glu-Thr-lle-Leu-Lys-Arg- 
Phe-His-Ser-Met-Tyr-Gly, and 50 

(2) Peptide B (25 amino acids): Cys-Asn-lle-Ala-Pro-Ala-Ser-lle-Val-Ser-Arg-Asn-lle-Val-Tyr-Thr-Arg- 
Ala-Gln-Pro-Asn-GIn-Asp-lle-Ala. 

Both peptides A and B occur naturally as portions of virus protein 3 (VP3) of rotaviruses and are sensitive to 
trypsin. Cleavage of the peptides by trypsin prevents them from binding to VP6. It is clear that both of the 
sequences which are given herein are by way of example only, and that other compositions related to binding 55 
sequences, or sequences in which limited conservative amino acid changes are introduced, can also be used. 
Indeed, as described below, additional binding peptides can be designed by those of skill in the art in light of 
the present disclosure. For example, variant peptides derived from peptide B were further investigated in order 
to delineate the features of the peptide which are important for binding to VP6. The features relate to the 
spatial arrangement of a cysteine and arginine residue, and the three-dimensional conformation of a peptide 60 
which allows it to bind to VP6. Therefore, any peptide which exhibits these characteristics can be considered 
as a binding peptide. 

Below are exampl s of specific emb dim nts for carrying out the present invention. The examples are 
offered for illustrative purposes only, and are not intended to limit the scope of the present invention in any 
way. 65 



7 



0 259149 



Examples 

1. Production of VP6 

5 

A. isolation of Native VP6 

Bovine rotavirus isolate C486 was propagated and purified as previously described. Sahara et al. (1986) J. 
Gen. Virol. 68:123-133. Briefly, virus was grown in confluent African monkey kidney cells (MA-104) in the 
absence of fetal bovine serum and in the presence of 10 ug trypsin/ml. Virus was purified by differential 

10 centrifugation and pelleted for 2 hours at 100,000 xg through a 40% sucrose cushion. After resuspension in 
water, virus was stored at -70°. 

Nucleocapsjd protein was isolated by successive degradation of purified virus with EDTA and either CaCfe 
or Ltd, as follows. Outer capsid proteins were removed by incubating virus (3 mg/ml) in 50 mM EDTA - 0.01 M 
Tris-HCI pH 7.4 at 4° for 30 minutes. Subviral particles were recovered by ultracentrifugation (100,000 xg, 2-3 

15 hrs, 4°) and resuspended in 0.01 M Tris-HCI pH 7.4 or 0.01 M sodium borate pH 9.0. They were then treated 
with either 1.5 M CaCfc - 0.01 M Tris-HCI pH 7.4 at 20° for 20-30 minutes or frozen in 2 M LiCI - 0.01 M sodium 
borate pH 9.0 at -70o for 4 days. Cores and undegraded particles were separated from solubiltzed protein by 
ultracentrifugation. EDTA and salts were removed by extensive dialysis at 4° against 0.01 M Tris-HCI pH 7.4, 
unless otherwise indicated. The purity of the samples was examined by pofyacrylamide gel electrophoresis 

20 (PAGE) Laemmli (1970) Nature 227:680-685. 

B. Recombinant VP6 

To produce the recombinant VP6, gene 6 of bovine rotavirus C486 was first cloned in the Pst1 site of 
pBR322. The resulting clone was digested with Ahalll and Hpalll and subcloned into the Sma I site of pAC373. 

25 After transfection into Escherichia coli , plasmids in recombinant ampiciilin resistant colonies were screened 
by restriction enzyme analysis for inserts in the correct transcriptional orientation. To transfer gene 6 cDNA 
from the pAC373 vector to the Autographa califomica nuclear polyhedrosis virus (AcNPV) DNA, Spodoptera 
frugiperda ceils were cotransfected with wild-type AcNPV DNA using the calcium phosphate precipitation 
procedure as previously described. Smith et al. (1983) J, Virol. 46:584-593. Following incubation at 27° C for 4 

30 hrs, the medium was removed and the cells observed with an inverted microscope for signs of infection. The 
extracellular virus was harvested at 5 days post-infection and plaqued on Spodoptera frugiperda cell 
monolayers. Recombinants were selected by identifying occlusion negative plaques with an inverted 
microscope. Positive plaques were further grown in microtiter dishes and nucleic acid dot blots on infected 
cells in these dishes were performed to verify the presence of gene 6. Plaque purification of positive 

35 supematants from microtiter wells was performed and the virus from these plaques was used to propagate 
virus stocks. 

To isolate VP6 from infected cells, the cells were first lysed with a buffer containing 1% NP40, 0.137 M 
NaCI, 1 mM CaCfe, 0.5 mM MgCfc and 0.1 mg/ml aprotinin. The lysate was then dialyzed in .01 M citrate buffer 
pH 4.0 for 48 hrs during which time a precipitate which represented reassembled VP6 formed in the dialysis 

40 bag. The precipitate was then collected by centrifugation, then treated with 0.05 M EDTA pH 5.0 for 1 hour and 
recentrifuged. The resulting pellet contained purified VP6 reassembled spheres. 

Rotavirus C486 is publicly available from the American Type Culture Collection (ATCC), 12301 Parklawn Dr., 
Rockville, MD 20852, USA, where it was deposited under Accession No. VR-917 on 15 April, 1981 . The pAC373 
vector containing the rotavirus gene 6 cDNA was designated pAC373BRV6 and deposited with the ATCC on 

45 31 August 1987 under Accession No. 40362, where it will be maintained under the terms of the Budapest 
Treaty. 

2. Binding Peptides 

Seven different synthetic peptides were tested for the ability to bind VP6. The primary structure of the 
50 peptides was as follows: 

Peptide A C-D-G-K-Y-F-A-Y-K-V-E-T-t-L-K-R-F-H-S-M-Y-G 
Peptide B C-N-l-A-P-A-S-l-V-S-R-N-t-V-Y-T-R-A-Q-P-N-Q-D-kA 
Peptide C Y-Q-Q-T-D-E-A-N-K 
Peptide D D-E-A-N-K-K-L-G-P-R-E-N-V-A 
55 Peptide E R-N-OK-K-L-G-P-R-E-N-V-A 

Peptide F R-N-C-K-K-L-G-P-R-M-M-R-l-N-W-K-K-W-W-Q-V 
Peptide G T-N-G-N-E-F-Q-T-G-G-l-G-N-L-P-l-R-N-W-N 
The various peptides were reacted for 30 minutes at 37° C with 2.0 ug of purified VP6 from bovine rotavirus 
strain C486. Binding was then tested by gel electrophoresis. Two of these synthetic peptides (peptides A and 
60 B) bound to VP6 protein in the gel. A "laddering D effect was seen at locations corresponding to the 45K 
(molecular weight of VP6 monomer). 90K (molecular weight of VP6 dimer) and 135K (molecular weight of VP6 
trimer) regions. Additional support for the binding of the two peptides to th various forms f VP6 was 
provided by the fact that the molecular weight increments in each ladd r corresponded t th molecular 
weights of the synthetic peptide mon m rs. Definitive proof that th peptide b und to the VP6 protein was 
65 demonstrated by the fact that a ladder was detected at both the 45 K and 90K regions with antisera produced 



8 



0 259 149 



against the synthetic peptides. 

In order to further delineate the features of the binding peptide required for binding to VP6, several variant 
peptides derived from peptide B (also referred to as 84 TS) were synthesized and tested for their ability to bind 
to VP6. A list of the variant peptides along with their amino acid sequence and their binding ability is shown in 
Table 2, below. 



10 



15 



20 



25 



30 



35 



40 



45 



50 



55 



60 



65 



9 



0 259149 



10 



15 



20 



25 



30 



35 



40 



45 



$0 



55 



M > 

Q 

55 O 

CO 



in 

CM 



to 




E-< 








00 




CQ 






co 


CO 




Q 




H 


w 


^ 






c* 


CO 


co 


P« 


to 


a 


D 


o 




CM 


a: 


a 






< 


(D 






t—i 


Q 


o 




CO 


55 




> 


M 




t— i 




a: 




oa 




a 




CO 




to 




Q 




M 












W 




P< 




. E-» 












f— » 




OS 








> 





o 

CM 



to 
Q 
n 
E* 

CU CO 
W E-« 

O 0i 

COJ > 



+ 


i 


! 


1 


+ 




+ 
















< 


















• * 










Q 


-ft 


* 










O 




-* 


* 














* 








cu 














o 
















-K 




* 






* 


oi 




CO 


CO 








Eh 


* 


-fc 


-K 


* 












-* 


-* 




* 


> 


-K 


* 




* 






M 






* 


* 


* 




IS 






* 








a: 




CO 






CO 




CO 






* 








> 


-* 


* 


* 


< 


< 


< 


M 




* 




a 






CO 








u 


u 


O 




* 




* 






< 


a* 












cu 


< 


* 


* 








< 


M 


* 










O 




* 












a 




■K 








Cm 




























Q 



ST 






CO 






Q 






M 






^ 












CO 


to 




cu 


>* 






u 




CO 


CO 


a: 


9* 




co 






CO 


■sr 




n 


00 


GO 


Q 



CO 
CO 

o 
o 



en 

CO 



to 
I 

os 

CO 



SC 
CO 
I 

I 

CJ 



0) 

•o 

a 
cu 

o 

C CO 

o 

0) 

<a — 1 
c -u 
-h au 
e a) 

a) 

o 
o u 

-H 

£ w 

© o 

JZ (0 

o 

4-> C 

6 

tr> to 
c 

-h -a 
M > 

(O u 

(1) 
to to 
c 

in O 
cm u 
i 

r-t a) 

JJ 
•o <d 
a> u 

x» c 
e -h 

c — 
Q) — 
(0 to 

u 
u a) 

(0 -P 
V) 

O <o 
c 

*H Q) 

IS 

rHj CM 



60 



65 



The importance of the cystein residue located on the binding peptide with respect to VP6 binding was 
apparent due to the fact that the r ducing agent B-mercaptoethano! was able to abolish binding as discussed 



10 



0 259 149 



below in Example 4. However the presence of a cysteine residue is not the only requirement for binding to VP6 
as illustrated by the fact that the 84 TS-Cys peptide, which has the cysteine residue at its carboxy terminal 
instead of the amino terminal end. does not bind VP6. It was therefore hypothesized that the position of the 
cysteine relative to another charged residue, having the ability to int ract electrostatically with charged 
residues on VP6, was also important. The other predominant charged residues on the parent peptide B are 2 5 
arginines at positions 11 and 17. In order to test whether the argihine residues were indeed the important 
charged residues. 2 variant peptides were made. Specifically, the monoser variant peptide had arginine 17 
replaced by an uncharged amino acid (serine) and the diser variant peptide had both arginine 11 and 17 
replaced by serines. Since neither the monoser or diser bound to VP6, it appears that at least arginine 17 or 
both arginine 11 and 17 are required for binding to VPS. 10 

The importance of the cysteine and arginines was further illustrated by the fact that a portion of peptides B 
{84 TS) could be deleted to produce the SHT peptide and still maintain binding to VP6. Specifically, amino acids 
1-09 and 19-25 of peptide B were deleted and 3 amino acids including a cysteine were added to the amino 
terminal end, thereby decreasing the size of peptide B by 50<Vo. Even though a cysteine residue is one of the 
requirements for peptide binding, fls position appears to be somewhat important relative to that of the charged 15 
residues. For example, the peptide gp-41-SHT has a cysteine located in position 7 relative to the numbering 
system for peptide B, but its distance from the arginine residue is similar to that in peptide B and consequently 
binding to VP6 is observed. 

In summary, the features important for peptide binding to VP6 relate to the spatial arrangement of a cysteine 
and arginine (or the charged amino acid) residues in the tree-dimensional conformation of a peptide. Any 20 
peptide which has these features and consequently can bind to VP6 can be considered a binding peptide. An 
example of such a peptide is peptide A, which is derived from a sequence on the rotavirus VP3 protein, and is 
only related to peptide B in that it has a cysteine and arginine residue in the proper arrangement to allow 
binding to VP6. 

25 

3. VP6 Derived from Various Sources for Use as a Particle Carrier With or Without the Binding Peptide 
Preliminary studies into the ability of VP6 to reassemble and to bind peptides in Example 2 were carried out 

using VP6 derived from bovine rotavirus strain C486. This virus strain belongs to subgroup I, and the epitope 
determining subgroup specificity is located on VP6. In order to determine whether VP6 derived from other 
sources will exhibit the same two properties (i.e., reassembly and binding of peptides), SP6 derived from a 30 
subgroup II human rotavirus strain (strain WA) and a subgroup I VP6 produced by recombinant DNA 
technology (Example 1) were tested. The importance of testing a recombinant DNA product is that protein 
processing may not be the same as that in a natural infection, even though the genetic information is identical. 
If the processing is different, the resulting protein product may not have the intrinsic features necessary for 
reassembling or peptide binding. The recombinant DNA VP6 was produced as described in Example 1 . 35 

The testing for the ability of VP6 to reassemble was carried out as follows. First, preparations containing no 
less than 0.1 ug of VP6/ul isolated from the subgroup II rotavirus or recombinant DNA-produced VP6 were 
dialyzed at 4°C against 1 liter of 0.01 M citrate buffer at pH 4.0 for 36 hours, with three changes of buffer during 
this time interval. Second, after dialysis, an aliquot of the preparation was examined by electron microscopy for 
the prsence of particles. Figure 2 illustrates that both subgroup II VP6 (Panel A) and recombinant DNA-derived 40 
VP6 (Panel B) can reassemble in spherical and tubular particles, indicating that they have the intrinsic features 
necessary for this type of process to occur. 

The ability of the various VP6s to bind peptide was also tested. Preparations containing subgroup II rotavirus 
or recombinant DNA-produced VP6 were mixed with peptide B in a ratio of 1 :10 (w/w). The mixture was then 
electrophoresed on a 10% polyacryiamide gel. Both subgroup II VP6 and recombinant DNA-derived VP6 were 45 
able to bind peptide as illustrated by a laddering in the region of the gel containing VP6. 

Therefore, it appears that the features necessary for VP6 reassembly and peptide binding are present on 
both VP6 subgroups, various mammalian rotavirus VP6s, and recombinant VP6. 

4. Characterization of VP6-Monomer-Binding Peptide Complex 50 
Further characterization of the conditions required for binding of peptides in VP6 was carried out using 

peptide B. 

Two micrograms of radiolabeled double-shelled rotavirus was reacted with 100 ug synthetic peptide B for 30 
min, 37° C. Prior to electrophoresis, the sample was aliquoted and treated with one of several buffers. The 
VP6-peptide B complex was treated with Laemmli buffer (0.0625 M Tris-HCI pH 6.8, 4Q/b sodium dodecyl 55 
sulfate, 80/o glycerol and 0.05% bromphenol blue) for 30 mln at 37° C. The same laddering effect described in 
Example 2 was observed. However, when B-mercaptoethanol was included in the sample buffer and the 
sample was boiled prior to electrophoresis, the ladders in both the 45K and 90K regions disappeared. This 
suggested that disulfide bridging was necessary to maintain the VP6-peptide B complex. However, the 
interaction between VP6 and peptide B could withstand such harsh treatments as boiling in sodium dodecyl 60 
sulfate. Identical results were obtained with subgroup II VP6, recombinant DNA-derived VP6 and the other 
binding peptides. 



11 



0 259 149 



5 Ch aracterization of VP6-Assembied Particles-Binding Peptide Complex 

Binding of the peptide B to in vitro -assembled tubular and spherical particles composed of the VP6 
monomers was also observed. These in vitro- assembled particles were produced by subjecting isolated VP6 
to different pH conditions. Specifically, when isolated VP6 was placed in 0.01 M citrate buffer pH 4.0 and 

5 dialyzed to pH 5.0, high aggregated, empty spherical particles occurred (Figure 3). Tubular particles formed at 
pH 5.0 to 9.0 and aggregated at pH 5.0 (Rgur 4). VP6 was dialyzed first to 0.01 M phosphate buffer (pH 5.0) 
and then to 0.01 M citrate buffer (pH 4.0) at 4°C. The surface structure of the particles appears well ordered at 
pH 5.0 to 7.0 and less well ordered at pH 8.0 and 9.0. In addition to hexamers, small hexagonal lattices and 
tubes, the sample contained sheets (arrows) consisting of a small hole lattice. At the higher pH levels there 

10 was more amorphous material present than at pH 5.0 to 7.0, suggesting that perhaps less of the protein had 
polymerized. Figure 5 summaries the relationship between VP6 monomers and VP6 oligomeric structures. 

The spherical particles had a diameter of 62.0 ± 15 nm (n = 56) which is consistent with that of 
single-shelled virus particles. Tubes were 104 ± 15 nm (n » 58) in diameter. Immunoelectron microscopy and 
' immunogold labelling were used to show that the tubes consisted of the VP6 protein. Specifically tubes were 

15 labeled with immunogold when monoclonal antibody specific for VP6 was used as the primary antibody, but 
were not labeled when normal mouse serum was used as the primary antibody. 

To confirm that the synthetic peptides could bind to these in vitro- assembled particles, grids were coated 
with antiserum to VP6, or with antiserum against peptide B. The number of tubular particles trapped on 
equivalent areas of the two types of grid was then counted. When tubular particles were not reacted with 

20 peptide B, grids coated with antibodies to VP6 trapped over 30 times as many tubes as did grids coated with 
antibodies against peptide B. However, when tubular particles were first reacted with peptide B, then the 
number of tubular particles trapped on grids coated with antibodies against the peptide B was at least 5 times 
as large as for unreacted tubular particles (Table 3). 



25 



30 



35 



40 



Table 3 

IMMUNOSORBENT SERUM ELECTRON MICROSOPY OF VP 6 TUBES 
WITH AND WITHOUT PEPTIDE B 

Antibody Used Number of Tubes/ 

■to Coat Grid Sample Counted Area 

Antiserum to VP6 Tubes 300 

Antiserum to Peptide B Tubes 10 

Antiserum to Peptide B Tubes with 53 

Peptide B 



The binding of the peptide B to in vitro- assembled spherical and tubular structures was further confirmed by 
the observation of a ladder formation of the VP6 protein derived from these particles on a polyacrylamide gel. 

The specific nature of this binding phenomenon was investigated further by examining the primary amino 
acid sequence of the peptide binding site, and the number of VP6 binding sites. The conditions for binding to 
occur have already been described above. 

The number of potential binding sites on VP6 can be estimated by conting the number of rungs on a VP6 
ladder formation. There is a shift from one rung to four rungs as the ratio of peptide to VP6 increases from 2:1 
to 25:1. This indicates that there may be as many as four VP6 binding sites. However, since the synthetic 
peptide forms dimers of itself in solution, it is not possible to determine, via this type of experiment, whether 
there are four primary VP6 binding sites or two primary VP6 binding site, with bound peptide dimers t each VP6 
binding site. 

6. Immunogenlclty of the Various Forms of VP6 

The immunogenicity of the VP6 monomer and of tubular and spherical forms of VP6 assembled into particles 
(Figure 4) were investigated. As illustrated in Table 4 below, both particle types were very immunogenic based 
on a comparison of antibody titers produced after immunizing mice with 10 ug of either the VP6 monomer, 
spherical particles, tubular particles or naturally occurring incomplete virus particles. The immunogen was 
administer d three times over an eight-week period and was emulsified in Freund's Incomplete Adjuvant. 



12 



0 259149 



Table 4 

Immunoqenicity of Various Forms of VP6 
Monomer ic and Oliqomeric Structures 
as Compared to Incomplete Rotavirus Particles 



Form of VP6 Used Antibody Titer Determined by. Enzyme-linked 10 
for Immunization Immunosorbent Assay Using the Incomplete 
of Mice Virus Particle as the Capture Antigen 

15 



VP 6 Monomer 
Tubular Structure 
Spherical Structure 
Incomplete Virus 

. — t- 25 



7. Examples of Immunizing with VPS Assembled Particles -Epitope Constructs 

This Example demonstrates the efficacy of the VP6-assembled particles as an immunological carrier for 
epitopes whose amino acid sequences were derived from parasitic, bacterial and viral immunogens. These ^ 
represent protein and glycoprotein haptens as well as a bacterial carbohydrate moiety which demonstrates the 
utility of the carrier with haptens other than those of protein origin. 

A. Production of VP6-Assembled Particles (spherical carrier) 

Bovine rotavirus {strain C486 rotavirus subgroup I was grown in MA-104 ceils (monkey kidney), harvested, & 
then purified and concentrated by ultracentrifugation. The VP6 was extracted from purified virus preparations 
by successive treatment with ethylene-diamine tetra acetic acid (EDTA) and lithium chloride (LiCI 2 ). 
Preparations containing VP6 were then dialyzed to pH 4.0 at which time a precipitate formed, representing 
aggregated spherical particles, as described above. The aggregated spheres were dispersed by dialysis to pH 
5.0 or higher and then were stored at -70°C 40 

Verification of the composition of the paticles was by gel electrophoresis and Immunoblot ELISA, using 
antisera specific for VP6. Verification of the ultrastructure of the particles was by electron microscopy. 

B. Synthesis of SHT Peptide-Epitope (Hapten) Constructs 

SHT peptide-epitope (hapten) constructs were synthesized using Merrifield's solid-phase methodology on ^ 
an Applied Biosystems 430A peptide synthesizer. 

The peptide named 84 TS (MW 2,734) is identical to binding Peptide B described above in Table Z The amino 
acid sequence for this peptide was derived from the trypsin cleavage site of bovine rotavirus VP3 spanning 
amino acids 231-254 and is as follows: H-Cys-Asn-lle-Ala-PrcHAIa-Ser-lle-Val-Ser-Arg-Asn-l!e-Val-Tyr-Thr- 
Arg-A!a-GIn-Pro-Asn-Gln-Asp-lle-Ala-OH. The cysteine at position 1 was added to facilitate coupling to a & 
carrier protein and is not present in the natural sequence. Reevaluation of the criteria required for binding of 
Peptide B to VP6-assembied particles enabled the generation of a shortened version of the binding peptide 
which is referred to as SHT (Table 2). The SHT peptide is composed of amino acids 1 and 10-18 from binding 
Peptide B, plus 2 amino acids to achieve proper spacing. The amino acid sequence of SHT is as follows: 
H-Cys-Gly-Ala-Ser-Arg-Asn-lle-VaJ-Tyr-Thr-Arg-AIa-OH. The amino acids glycine (Gly) and alanine (Ala) at 55 
positions 2 and 3, respectively, are spacers to distance the cysteine (Cys) from the arginine (Arg). 

The remaining three-peptide constructs are composed as follows. Amino acids 1 and 10-18 from Peptide B 
plus the two spacer amino acids (i.e., SHT) comprise the first 12 amino-terminal amino acids of the construct 
and the following three amino acid (either Ala-Pro-Ala or Gly-Ala-Pro) are spacers which distance the SHT 
portion of the construct from a specific epitope that comprises the remaining portion of the peptide construct. ^ 
The peptide designated pili-SHT (MW 3,174) has its amino terminal end comprised of the SHT peptide and its 
carboxy terminal sequence from th amino terminal region of the F pilin of E. colL The amino acid sequence of 
the entire construct is: M^c-ftiy.Ai Q ^-Arq-A£n-ll&-V^ 

Gly-Gln-Asp-Leu-Met-Ala-Ser-Gly-Asn-Thr-Thr-Val-Ala-OH . The underlined portion indicat s the epitope 
whose sequence was derived from the F pilin of E. coli , and to which the immune response is to b directed. & 



10 

10 

10 
10 



4.5 
6.5 
7.9 
7.0 



20 



13 



0 259 149 



The peptide designated Leishmania-SHT (MW 3,876) is comprised of the SHT peptide at the amino terminal 
end and its carboxy terminal end is derived from a sequence of glycoprotein 63 of the Leishmania donovani . 
The amino acid sequence of the construct Is: H-Cys-Ghy-AIa-Ser-Arg-AsrHle-Val-Tyr-Thr-A^ 
Val-Arg-Asp-Val-Asn-Trp-Gly-AIa-Leu Arg-lle-Ala-Val-Ser-Thr-Glu-Asp-Leu-Lys-Thr-Pro-Ala-Tyr-Ala-OH . 
5 Again, the underlining indicates the epitope whose sequence was derived from glycoprotein 63 of Leishmania 
donovani and to which the Immun r sponse is to be directed. 

The peptide designated BHV-1 -SHT (MW 4,645) is comprised of the SHT peptide at the amino terminal, while 
its carboxy terminal is derived from an epitope which spans amino acids 323-345 of bovine herpes virus-1 
glycoprotein g1 (or gB). Hence, the amino acid sequence of the construct is: H-Cys-Gly-Ala-Ser-Arg-Asn-lle- 

10 Val- Tyr-Thr-Arg-Ala-Gly-Ala-Pro -GI^ 

Arg-Asn-Met-Ala-Thr- Ala-Ala-OH. The two carboxy terminal alanines are spacers. The underlining again 
indicates the epitope whose sequence was derived from AA323-345 of BHV-1 glycoprotein and to which the 
immune response is to be directed. In order to evaluate the level of the immune response induced by this 
epitope, a larger sequence spanning amino acids 319-352 on bovine herpes virus 1 glycoprotein gl (or gB) was 

15 used as the capture antigen in ELISAs, described below. The amino acid sequence of this larger peptide, 
called BHV-1, is: Gly-Ala-His-Arg-Glu-His-Thr-Ser-Tyr-Ser-Pro-Glu-Arg-Phe-Gin-Gln-lle-Glu-GIy-Tyr-Tyr-Lys- 
Arg-Asp-Met-Ala-Thr-Gly-Arg-Arg-Leu-Lys-Glu-Pro-Ala-Glu. The terminal 2 amino acids alanine (Ala) and 
glutamic acid (Glu) are spacers. 
A slightly different approach was used in order to produce a SHT peptide-epitope construct where the 

20 epitope was a carbohydrate moiety. A new SHT peptide was prepared having the sequence shown in Table 2, 
but with the following peptide spacer at the carboxy terinal instead of the tripeptide described above: 
-Ala-Pro-Ala-Lys-Ala-Lys-AIa-Lys-AIa-OH. This SHT version has MW 2,054. A capsular polysaccharide moiety 
was isolated from the bacterium Haemophilus pleuropneumoniae , and then oxidized, hydroryzed and 
reducthvely aminated to the SHT peptide. See Altman et al. (1986) Biochem & Cell Biol. 64:707-716; Porter et al. 

25 (1986) J. Immunol. 137:1181-1186. This provided a carbohydrate-SHT (CHO-SHT) construct. (NOTE: The 
taxonomists have recommended that the species name Haemmophilus be replaced with the name 
Actinobacillus.) 

C. Formation of VP6 Assembled Particle - Epitope Constructs 

30 In order to generate VP6 assembled particle-peptide complexes containing the SHT peptide and an epitope 
of protein origin, the VP6 assembled particles and the peptide constructs were mixed together in a ratio of 
1:10 (w/w), respectively, since this ratio produced a complete ladder indicating that most of the potential 
binding sites on VP6 were occupied by the peptide. However, any ratio from 1 :1 up to 1 :10 would produce 
laddering of VP6, albeit to different extents. Verification of binding of the peptide construct to VP6 and 

35 establishment of the ratio of VP6 assembled particle to peptide construct to be used in preparations for in vivo 
studies, was by electrophoresis of the preparations on polyacrylamide gels and observation of VP6 laddering, 
a phenomenon described previously. Verification of the immunoreactivrty of the peptide haptens was 
immunobiot-ELISA reactions using antisera specific fro the protein from which the hapten (epitope) was 
derived. 

40 In order to generate a VP6 assembled particle-peptide complex where the epitope was a carbohydrate, the 
VP6 assembled particles and CHO-SHT binding to VP6 was by polyacrylamide gel electrophoresis. In this case, 
high molecular weight material was observed which represented the VP6-CHO-SHT complex. Verification of 
the compositions of the high molecular weight complex, observed In a polyacrylamide gel, was by an 
immunoblot-EUSA reaction using antisera specific for the carbohydrate and antisera specific for the SHT 

45 peptide. * 

D. Immunization and Serological Responses 

In general, for immunization trials 1 to 4, groups of 5 to 10 CD-1 mice were inoculated with one of the four 
VP6 assembled particle-peptide complexes described above according to the experimental designs shown in 

50 Tables 5, 6, 7 and 8. The VP6 assembled particle to peptide construct ratio was always 1 :10 (w/w), respectively. 
The mice used in these experiments were rotavirus-free unless otherwise stated. 

The baste Immunization schedule was the same for alt trials, except number 5. Basically, animals were bled 
at week 0 and then immunized intramuscularly with 100 ul of the test preparation at week 1 and then again at 
week 4. In some trials, a third immunization was administered. The type of immunogen and purpose for 

55 immunization in each trial is outlined below. Pooled serum samples were obtained from each group of mice on 
a weekly interval. Assessment of antibody levels specific for the VP6 assembled particles (spheres) or the 
peptide constructs (hapten) was by EUSA and Is appropriately indicated in Figures 6-8 corresponding to 
Trials 2 through 4, respectively, while the immunization protocols were shown in Tables 5 through 8, 
corresponding to Trials 1 through 4, respectively. 

60 

Trial 1 (Table 5) 

Th objective of this trial was to evaluate the dose response to the spherical carrier - 84TS complex using 
either Freund's adjuvant or dimethedi ctodecyl ammonium bromide (DDA) adjuvant, and to inv stigate the 
possibility of carrier suppression (described below). Th immunogen us d for primary and secondary 
65 immunization was the spherical carrier-84TS complex. The immunogen used for tertiary immunization t 



14 



0 259 149 



investigate carrier suppression was the spherical carrier -272-295 SHT complex. 

Table 5 outlines the experimental design used to investigate the dose response to the VP6 assembled 
particle-84 TS peptide complex using either Freund's adjuvant or dimethyldioctodecyl ammonium bromide 
(DDA) adjuvant. This stud/ also attempts to investigate the possibility of a carrier suppression phenomenon 
which is a recently recognized immunoregulatory mechanism and has been described in the literature for oth r 5 
carriers currently in use. Basically, carrier suppression occurs when a host is immunized with a hapten 
conjugated to an immunogenic carrier to which the animal has been previously exposed or immunized. A 
strong secondary response is produced to the carrier, but the host fails to produce antibodies to the linked 
hapten. In this experiment, therefore, animals which were immunized twice with the VP6 assembled 
particle-84TS peptide complex were then reimmunized a third time, at week 19, with the VPS assembled 10 
particle-275~295-SHT peptide complex. The 275-295 peptide sequence was derived from a neutralizing domain 
on bovine rotavirus VP7 and represents another example of a viral peptide attached to VP6 assembled 
paticles. The VP7 sequence is: Pro-Thr-Thr-Ala-Pro-Gln-Thr-Glu-Arg-Met-Met-Arg-lle-Asn-Trp-Lys-Lys-Trp- 
Trp-Gln-Val. 

The results illustrated that the VP6 assembled particles are effective in inducing high levels of antibody in 15 
vivo in both themselves (approximately 6.0-6.5 log 10) as well as to the peptide attached to them (approximately 
5.5-6.0 log 10) when a dose equivalent to 1 ug of VP6 assembled particles is administered. In fact, the level of 
antibody specified for the peptide at this dose was almost identical to a dose equivalent to 10 ug of peptide 
bound to 10 ug of peptide bound to 1 ug of VP6 assembled paticles and only slightly less than that using 100 ug 
peptide bound to 10 ug of VP6 assembled particles. Furthermore, the level of antibody produced to the 20 
peptide was significantly higher than that induced by the equivalent amount of unbound or "free" peptide, 
except at the 100 ug dose of "free" peptide, where an anti-peptide response of 5.5 log 10 was observed: 

A comparison of antibody levels in sera from animals administered preparations containing either PCA or 
DDA illustrated that these two adjuvants were equally effective, at least at the two doses investigated. In 
addition, no carrier suppression was observed since an antibody response (approximately 4.5 log 10) to 25 
peptide 275-295-SHT could be detected at week 20. when the VP6 assembled particle-275-295-SHT peptide 
complex was administered at week 19. 

30 



35 



40 



45 



50 



55 



60 



65 



15 



0 259149 



10 



15 



20 



25 



30 



35 



40 



45 







to 




w 




o 








& 








CO 




P* 




1 




+ 












1-4 
















u 








u 




M 




c: 




CO 




pi 




co 


CO 




ft 


TO 






> 


co 




CO 






z 






o 




© 


CU 






to 


< 


ja 


CO 


{J 




C£ 


tu 








CO 


(£, 


cn 


o 


o 




a 






o 


i 


Q 


*-t 
















ac 




£« 




a: 




O 




Co 




z 




o 




I-* 




to 




CO 




a 












CO 




£ 




i-t 




<£ 




CO 




PU 








to 





c 
> 

■a 
< 



U ~4 
10 A> 



c 
o 
u 

(0 

14 
H 

u 



\ cx 

G) 3 

u o 



<<<<<*< 

»~4 HI »-*►-• »-« 

lit [n bi b b (u 



<<< < 

HNH M M M 

Cw Cm Cm Cv» Ci» U« 



UUUUUUQQQQUUUOUUU 
CwCwU«CMCMtwQOOOb.U«CMaCh.b.tu 



OOO— IOOOOOOOOOOOOO 

— ♦ o -< o 



I I I I I I 1 I 1 t I I I I I I • 



^4 O O 

oooo-*ooo«-ioooooooo 



OOOrHOOOOOOOOOO»-iOO 

r—t O ~4 O O 



I f I t I I I I I I I to I I t I I 

* M 



—I o o o o o 

O— *00—iO'-'0»-»OOWOOOOO 



inininoooininmooinmin«ninin 





Li 


* 






<D 
















14 -4 








L| 








(0 at 




•C o 




U — ' 








<D ^ 




-*4 0* 




a 






sz © 


2 


w 




U © 












u 2 




o 




C 0 




U iJ 




<0 £ 








u } 












© "O 




•0 c 




X <D 


Q 


<t-i o 




C U 




M **4 




-4 © 




3 *J 








tn A3 






M 






at 




O *H 




(Q c 
















E 




5 






c O 






c <0 


— * -»4 


*° ^ 


t 


^ ta 


. *|* 








?"» ^* 


*4 




n S 








3 5 


a! >!j 


















© C 




«t .fa 




*i O 






kit K 




o 


♦J Qj - 




3 © 




O G C 


© 


CP (0 




^99 










4J 1-1 




in 




(0 


C 


c 




u *o 


CO <0 


o 


■h ;e o 


o c 




o 




o 






O i to 


o 


© 14 


<t> 


tO ^ 


XJ © 


"O 




CT* Of 


© <0 


—4 E 






a' 


E 




O 1 C 


3 © 


O M 






-C 


14 O* 


© 


p* r— — 4 


10 






p* Ol CO 


10 






> 


3 14 


E u 


O 




o 


3 O 


.U 


E M 




—4 




O M CL 


< 




1-1 


H Q) CL 


CJ T3 


o u 


<D 




b« © 


E O 




M CD 


• « 


E *•"* 


M 




3" 




l-i 


Q) <0 14 




^4 "O 


«J 


> O <P 


c to 


>i CD 


O 




41 «J 


O to 




M (D M 


> 5 


© 3 


«-l 


<D XZ l-i 


3 








1— » --^ 


O 09 


o 


U 


T3 < 






01 


< w 


o s 




10 * © 


h* 


o 


© 


i m j-» 


© v 


—4 U 


Si 






•O HI 


CU 


in -4 D> 


© iJ 




ID 


C7> U-4 


C 


<-4 






CU i0 


>» ' 


U-f 


1 o> to 


B > 


JZ *J 


o 


<n do 


O 3 


*J c 




r- > 


(J i-i 


a at 


0 


cm c 




e > 




X -4 


to < 


—4 3 




O C/3 




-a 


<0 


■o o 


•o o 


x> 


u 


-4 © *J 


c *J 


1 <o 






3 © 




© 




© -4 


< c 




© © 


m a 


O i0 




a. *o "O 


U. E 


Q 






o 


01 


<0 


-O > O 


o u 





50 



55 



60 



Trial 2 (Table 6 Figure 6) 

The objective of this trial was to evaluate the dose response to spherical carrier-BHV-1-SHT complex in 
rotavirus-free and rotavirus-exposed mice, and to investigate the possibility of carrier suppression. The 
immunogen used for primary and secondary immunization was the spherical carrier-BHV-1-SHT complex. The 
immunogen used for tertiary immunization to investigate carrier suppression was the spherical carrier-pilin- 
SHT complex. 

Table 6 outlines the experimental design used to investigate the dose response to the VP6 assembled 
particle-BHV-1-SHT complex in both rotavirus-free and rotavirus-exposed mice. In a natural situation some 
animals as well as humans have a preexisting antibody titer to rotavirus. Therefore, it was important to 
investigate whether the presence of such antibodies would influence the immune response to the VP6 
assembled particle-peptide complex. 

Figure 6 illustrates the antibody responses to the VP6 assembled particle (anti-sphere), the BHV-1-SHT 
peptide (anti-BHV-1-SHT), and to pilin-SHT (anti-pilin-SHT). The latter antibody response was used to 
investigate the possibility of carrier suppression. The quantity of peptide in the VP6-assembled BHV-1-SHT 
peptide preparation administered to mice is indicated on the top right corner of each panel. Th arrows below 
the axis indicating w eks denote the time of immunization. 



65 



16 



0 259149 



u 
u 
c 

(0 

> 
3 

TJ 



< < < < 
t_i i-t #-• »-i 
Cm Cm Cm Cm 



< < < 
Cm Cm Cm 



<<<<<<<< 
OOUOOUUCJ 
Cm Cm Cm Cm Cm Cm Cm Cm 



to 




cu 




o 




w 








CL 




CO 




Cu 




+ 




a; 


CU 


u 


(J 




>-t 


oc 




a: 








cj 


cu 




> 


a 


oc 






CJ 




»-« 


o 


OS 


CO 


u 


C/5 


X 


o 


CL 


a. 


CO 


x 




ca 


? 


t 

CO 






w 


a: 


in 


i— i 


z 


> 


o 


< 




cu 






w 


o 




CO 


a: 


« — < 


CC 




XI 




a 


«a 


U 


z 


6- 


CO 




O 




a 








i 


> 




a: 


CM 






CO 




CO 


M 


a: 


OS 


Cu 








to 






o 


ac 


Cm 


i-i 




> 


z 


< 








1 


to 




CO 




Q 


z 










2 




CO 




ac 




►H 




OS 




CO 




CU 




X 




u 















Q 




fc« 




X 




t/> 




l 




— i 








-4 


CD 


CU 


ID 






o 






M» 


» 


<a 






cu 


c 


© 


o 


cu 


-4 




*J 


D> 


<a 


3 


N 




•H 


t 


C 




3 




£ 


CD 




— 1 




U 




u 








CJ 




o» 




3 




a 








X 




1/5 
1 


tj 




c 


l 


<a 


> 




X 


»-» 


CO 


w 


a> 


-X 


TJ 


a> 


-< 


a> 




£ 


Cu 




© 




Cu 


<d 






o» 


c 


3 


o 




— 1 


1 






a 


U 


N 


ai 


■H 




c 


Wl 




U 


i 


<0 
















3 



at 

3 « 
MOO 
3 U 
> jJ -H 

o w 

OS O 



\ Cu 

0) 3 

O O 

-I M 



o o o o o 

o O -» 



oo^^oooo 



oooooooo 
o o — • o — « 



oo-*— *oooo 



(mCOCmCJCUUCmU 

>>>>>>>> 

cCttccaicZccc&tc 



oooooooo 







2 


c 
























m 








•* 








XI 






Q 


c 






C7» 


3 






— 4 


<D 






*J 


14 






to 


Cm 






01 








> 


X? 






c 


c 








41 






o 


c 






*J 


o 














Li 








tv 








X) 


14 






u 


— f 






o 


c 








3 • 






c 


E c 






— t 


£ O 








—4 -4 






in . 


tJ 








>i <0 








14 N 








•0 


* 




O 


E C 


o 




o 


—1 3 


o 






i-i £ 


•»4 






Cu £ 




* 








o 




CP 








JC 


CO 


** 


XJ 


*J 14 






0) 




cc 






M X# 




CO 




O C 














10 


u 




*~ 




XI o 




O 






o 


3 


*^ 


*2 — 


Cu 


M 


c 


3 CP 


X 


jJ 


XI 




Q) 


01 




to *J 


l 


c 




a) 


to 


O 






3 


u 




o 


Wl 






— 


♦H 


(D 




<" 


> 


TJ 


X c 


U XI 


•a 


*-4 


G) O 


Cm O 


u 


JJ 




— « 


0 


Cu 


CU C9 


3 




CO 


6 <o 






a 


o o 


C m 


x» 




u u 


« <a 


c 


o 


Cu 


> i 


<a 


jj 


X 


3 






X tv 








10 




cT 


© 


t u 


-< 


> 


—4 


-4 © 


Cm 


a: 


w 


— t —4 


CU — 




u 


-« V4 






«3 


CU U 


O mJ 


0) 


o 


c 


— • c 


Q) 




l o 


cu « 


14 






E > 


«4-> 


0 


u 


O 3 


1 




CD O 


(J 


01 


o 




TJ 


3 




u c 


W < 


u 


*J 


U O 




—I 


*> 


<a c 


xi a> 


> 


U 




c u 






£ 


3 <D 


iJ 


o 


CO o 


o 


o 




x: c 


u cu 


ac 






Cm £ 






JC 


0 


c 




o a 


X> O 



Rgur 6 illustrates that there was no significant difference between the level of antibody produced in 
rotavirus-free (RVF) and rotavirus-exposed (RVE) mice to the VP6 assembled particles and the BHV-1-SHT 



17 



0 259 149 

peptide, even though the RVE mice had an anti-sphere titer of approximately 3 logs at the start of the 
immunization schedule. The lowest dose tested in this experiment consisted of 10 ug of BHV-1-SHT peptide 
and 1 ug of VPS assembled particles. As illustrated in Figure 6, 10 ug of the BHV-1-SHT peptide alone did not 
induce a detectable antib dyrespons to the peptide, whereas the same quantity of peptid bound to the VP6 

5 assembled particles induced an antibody response of approximately 5 logs. 

Since the carboxy terminal sequence of th BHV-1-SHT peptide was derived from a larger (BHV-1) peptide 
described above, it was of interest to test the reactivity of the antibodies specific for the BHV-1 -SHT peptide 
with the parent BHV-1 peptide alone. The level of antibody reacting with the BHV-1 peptide gave an indication 
of the immunogenicity of the carboxy terminal portion of the BHV-1 -SHT peptide; the portion containing the 

10 epitope to which an immune response was desired. As illustrated in the anti-BH-1 panels of Figure 6, there was 
a significant antibody response produced against the carboxy terminal portion of the peptide construct; i.e., 
the BHV-1 peptide. 

The carrier suppression phenomenon was also investigated in this experiment using a different VP6 
assembled particle peptide combination than that described in Trial 1. After two immunizations with the VP6 

15 assembled particle-BHV-SHT peptide complex, the VP6 assembled particle-piiin-SHT peptide complex was 
administered at week 15. As illustrated in Figure 6, previously existing antibodies to the VP6 assembled 
particle did not affect the production of antibodies to a new peptide (i.e., pilin-SHT) presented on VP6 
assembled particles. Furthermore, carrier suppression was not observed in either RVF or RVE mice since 
antibodies specific for the pilin-SHT peptide were detected (anti-pilin-SKr panel, Figure 6). Antibodies 

20 detected to the pilin-SHT prior to immunization at week 15 were due to reaction with the shared amino terminal 
portion of the peptide constructs (i.e., SHT peptide). 

Trial 3 (Table 7 and Figure 7) and Trial 4 (table 8 and Figure 8) 
The objectives of these trials were to evaluate the dose response to spherical carrier-Leishmania-SHT (Trial 
25 3) and spherical carrier-pilin-SHT (Trial 4). The immunogens used for primary and secondary immunization 

were spherical carrier-Leishmania.-SHT or spherical carrier-pilin-SHT complexes. 
Tables 7 and 8 outline the experimental design to investigate the dose response to the VP6 assembled 

particle-!etshmania-SHT peptide complex and to the VP6 assembled partide-pilin-SHT peptide complex, 

respectively. The antibody response to the VP6 assembled particles and to both the peptide constructs, 
30 shown in Figures 7 and 8, illustrate that the lower quantity of immunogen which elicits an antibody response in 

mice after two immunizations is 0.1 ug of VP6 assembled particles bound to 1 .0 ug of peptide. In contrast, for 

both the Leishmania-SHT (Figure 7) and pilin-SHT peptides (Figure 8), only 100 ug of free peptide was able to 

elicit an immune response. 

35 



40 



45 



50 



55 



60 



65 



18 



0259149 

Table 7 

EXPERIMENTAL DESIGN FOR TRIAL 3: DOSE RESPONSE 
TO SPHERICAL CARRIER + LEI5HMANIA-SHT PEPTIDE 



# Mice/ 

Group ug Carrier-ug Peptide Leishmania-SHT a Adjuvant^ 



10 


10 


100 


FCA/FIA 


10 


1.0 - . 


10 


FCA/FIA 


10 


0.1 


1.0 


FCA/FIA 


10 


0.01 


0.1 


FCA/FIA 


10 


0 


100 


FCA/FIA 


10 


0 


' 10 


FCA/FIA 


10 


0 


1.0 


FCA/FIA 


10 


0 


0.1 


FCA/FIA 


10 


0 


0 


FCA/FIA 


10 


1.0 rotavirus 


0 


• FCA/FIA 


a The ratio 
1:10. 


of spherical carrier 


to peptide 


construct is 



Freund's Complete Adjuvant (FCA) was used for primary im- 
munization and Freund's Incomplete Adjuvant (FIA) was used 
for secondary immunization. 



19 



0 259 149 

Table 8 

EXPERIMENTAL DESIGN FOR TRIAL 3: DOSE RESPONSE 
TO SPHERICAL CARRIER + PILIN-SHT PEPTIDE 



10 


# Mice/ 
Group 


ug Carrier-ug Peptide Pilin-SHT a 


Adjuvant' 3 


10 


10 


. 100 


FCA/FIA 




10 


1.0 


10 


FCA/FIA 




10 


0-1 


1-Q 


FCA/FIA 


15 


10 


0.01 


0.1 


FCA/FIA 




10- 


0 


100 


FCA/FIA 




10 


0 


10 


FCA/FIA 


20 


10 


0 


1.0 


FCA/FIA 




10 


0 


0.1 


FCA/FIA 




10 


0 - 


0 


FCA/FIA 


25 


10 


1.0 rotavirus 


0 


FCA/FIA 


30 


a The ratio of spherical carrier 

1:10. 


to peptide construct is 



Freund's Complete Adjuvant (FCA) was used for primary im- 
munization and Freund's Incomplete Adjuvant (FIA) was used 
for secondary immunization. 



Trial 5 (Table 9 and Figure 9) 

The objective of this trial was to evaluate in swine the dose response to spherical carrier-CHO-SHT complex. 
The immunogen used for primary and secondary immunization was the spherical carrier-CHO-SHT complex. 

In order to test the VP6 assembled particle-CHO-SHT complex, 1 6 pigs were randomized into 4 groups of 4 
pigs each. One group of pigs was left as unvaccinated controls. The other three groups were immunized with 
different doses of this preparation as shown in Table 9 and according to the following immunization schedule. 



20 



0 259149 



Table 9 



EXPERIMENTAL DESIGN FOR TRIAL 5: MEASURING SWINE 
ANTIBODIES TO SPHERICAL CARRIER + CARBOHYDRATE- PEPTIDE 

(CHO-SHT 



ft Pigs/ 
Group 



ug Carrier-ug CHO-SHT a 



Adjuvant^ 



10 



15 



20 



1.0 
10 
100 
0 



0.1 
1-0 
10 
0 



marcol 52 
marcol 52 
marcol 52 
marcol 52 



The ratio of carrier to CHO-SHT is 10:1. 
Marcol 52 - an oil-based. 



25 



Immunization Schedule 



30 



Weeks Procedure 



35 



0 randomize 16 pigs into 4 groups and bleed 

1 vaccinate intramuscularly , left neck f 2 ml dose 

3 bleed, boost intramuscularly, right neck, 2 ml dose 

4 bleed 

5 bleed 



40 



45 



The antibody responses to the carbohydrate moiety were determined by ELISA and are shown in Figure 9. 
both 1 .0 ug of CHO-SHT bound to 10 ug of VP6 assembled particles (carrier) and 10 ug of CHO-SHT bound to 50 
100 ug of VP6 assembled particles Induce an immune response which was significantly higher than that 
detected in animals given marcol 52 adjuvant alone or 0.1 ug of CHO-SHT bound to 1.0 ug of VP6 assembled 
particles. 

8. Covalent Coupling of Haptens to VP6 55 

The peptide designated FMDV-SHT is comprised of the SHT peptide at the amino terminal end. The amino 
acid sequence of the construct is: H-Cys-Gly-Ala-Ser-Arg-Asn-lle-Val-Tyr-Thr-Arg-Ala-Gly-Als-Gly -Val-Pro- 
Asn-Leu-Arg-Gly-Asp-Leu-Gln-Val-Leu-Ala-Gln-Lys-Val-Ala-Arg-Thr -Ala-Ala-OH. The underlining indicates 
the epitope whose sequence was derived from a sequence from protein VP1 of the Oi Kaufbeuren strain of 
foot and mouth disease (Oi K FMDV). 60 

The FMDV portion of the above peptide plus the C terminal spacer, that is H-VaJ-Pro-Asn-Leu-Arg-Gly-Asp- 
Leu-Gln-VaJ-Leu-Ala-Gln-Lys-Val-Ala-Arg-Thr -Ala-Ala-OH , was also synthesiz d, this underlining indicates the 
spacer. This peptide without the SHT sequence (FMDV) was then chemically coup! d using 1-ethyl-3-(3-di- 
methyl aminopropylj-carbodiimide HCt in carbonate buffer pH 9.0 to VP6 spheres reassembled (described 
previously) for 4-8 hrs. The VP6 spheres with the peptide bonded to them were isolated from the reaction 65 



21 



0259 149 

mixture by ultracentrifugation on a cesium chloride gradient. The product was recovered at a density 
approximately equal to that of the reassembled spheres. 

This preparation was then used to immunize groups of mice. When used with Freund's Complete Adjuvant, 
the groups which were given 10 or 100 ug per mouse responded with anticarrier antibodies and the mice given 
5 100 ug/mouse responded with antipeptide to a titer of 1/10 3 . This shows peptides or other molecules can be 
covalently attached through one of several possible activating reactions to VP6 spheres without the use of a 
binding peptide. This alternate method of attachment to the VP6 spheres does not interfere with the 
production of antibodies to these haptenic molecules. 

The foregoing examples provide specific embodiments of the present invention, other embodiments being 
10 readily within the skill of the art. Thus, the scope of the present invention is defined by the following claims 
without limitation to the foregoing examples. 



15 Claims 

1. A composition capable of raising an immunological response in a mamal to a selected epitope 
comprising an immunological carrier complex, said complex comprised of an epitope-bearing molecule 
expressing said epitope of interest selected from the group consisting of polypeptides, carbohydrates 

20 and nucleic acids; said epitope-bearing molecule being coupled to a carrier protein selected from the 

grop consisting of monomers and oligomers of a polypeptide homologous to a rotavirus VP6 inner capsid 
protein amino acid sequence. 

2. The composition of claim 1 wherein said eiptope-bearing molecule is a polypeptide. 

3. The composition of claim 1 or claim 2 wherein said earner protein is said VP6 Inner capsid protein. 

25 4. The composition of any one of claims 1 to 3 wherein said carrier protein is an oligomer in the form of a 

particle. 

5. The composition of claim 4 wherein said carrier protein is a spherical particle or a tubular particle. 

6. The composition of any one of claims 1 to 5 wherein said coupling of said carrier protein and said 
epitope-bearing molecule is through a protein-protein interaction. 

30 7. In a vaccine composition wherein the epitope of interest is on a polypeptide bound to a carrier 

protein, the improvement comprising using rotavirus VP6 inner capside polypeptides as said carrier 
protein. 

8. The vaccine composition of claim 7 wherein said molecule bearing the eiptope of interest is bound to 
said carrier protein through a protein-protein interaction between said carrier protein and an amino acid 

35 sequence linked in said molecule. 

9. A composition according to claim 6 of claim 8 wherein said amino acid sequence is selected from the 
group consisting of: 

(a) 

Cys-Asp-gly-Lys-Tyr-Phe-Ala-Tyr-Lys-V^ 
40 (b) 

Cys-Asn-lle-Ala-Pro-Ala-Ser-Ile-Val-Ser-Arg-^ 
Ala; and 

(c) an amino acid sequence comprised of fragments of said sequences (a) or (b), any deletions or 
substitutions being selected to maintain the ability to bind to said carrier protein. 
45 10. A composition according to claim 9 wherein said amino acid sequence (c) Is selected from the group 

consisting of: 
(i) 

Cys-Gly-Ala-Ser-Arg-Asn-lle-Val-Tyr-Thr-Arg-Ala; 
(ii) 

50 Cys-Cly-Ala-Ser-Ser-Asn-lle-Val-Tyr-Thr-Arg-Ala; and 

(Hi) 

Asp-Thr-Phe-Glu-Gly-Ala-Pro-Ala-Pro-Ala-^ 
11. The use of a composition as defined in claim 1 or claim 7 in preparing a vaccine by providing a 
composition that is effective in raising neutralizing antibodies to said selected epitope in a mammal. 
55 1 2. A method of forming a vaccine composition for a selected epitope comprising : 

(a) providing an Immunologic carrier protein selected from the group consisting of monomers and 
oligomers of a polypeptide homologous to a rotavirus VP6 Inner capsid protein amino acid sequence; 

(b) providing an epitope-bearing molecule expressing said selected epitope, said epitope bearing 
molecule being selected from the group consisting of polypeptides, carbohydrates and nucleic 

60 acids; and 

(c) contacting said carrier protein and said epitope-bearing molecule under conditions whereby 
said epitope-bearing molecule becomes bound to said carrier protein. 

13. Th use of a protein selected from the group consisting f monom rs and oligomers of a polypeptide 
homologous to a rotavirus VP6 inner capsid protein amino acid sequence, .g„ a rotavirus VP6 inner 
65 capsid protein, in preparing a medicament or vaccine. 



22 



0259149 



* •• • •» •*•• 

• • • •••••• • 

••• • • • • •• • 

-•• • • ••• 

• • •••• • 




FIG. 3 




FIG. 4 



FIG. 5 



ASSEMBLY OF VP6 MONOMER INTO VARIOUS OLIGOMERIC 



MONOMER (45k) 
O 



Nonconvalent 
Interaction 



STRUCTURES 



TRIMER (135k) 



<$> 



Interroolecular 
Di sulphide 
Bridging 



SMALL-HOLE LATTICE 



TRIMERIC PAIR (270k) 



Interroolecular 
Di sulphide 
Bridging 



HMW Aggregate (HEXAMER) 



TUBES 
SPHERES 

_w SMALL HEXAGONAL LATTICE 



DIMER (artifact ) 
0«i-«0 



0259149 



FIG. 6 



& 

111 

X 
EL 
CO 



CO 
J_ 
I 

> 
X 

m 
■ 



CO 



t 

8 




10 



15 
A 



20 25 0 5 
* A 

WEEKS 

# # Peptlde/RVE 

* A Sphere peptide/RVE 

a — a Sphere peptide/RVF 



10 



15 
A 



20 



25 



i 



'4 



0259149 . , 

• •• •••• 

• • • • • 

• * • • • 



FIG. 7 



• — • Spherro+peptldes/FCA 
A — a Peptfde/FCA 



8 
8 



>- 

3 

m 



ui 2 

ua 

Sol 

w 0 



/ 



T 



8 



8 



8 



lOOug 



IO 




lOug 




IO 



6 
4 



lug 



IO 



• lug 



8 IO 

W E 



w 
uj6 



4- 
2 

0, 
< 

6 
4 

2 

0, 
< 

E 



6 



2 4 
K S 



6 



T 



8 



T 



lOug 



10 



lug 



10 



Jug 



(0 



• • • 



FIG. 8 



• — • Spheres* peptides/FCA 
a — a Peptide/FCA 




lOOug 



6 



6 



4 



8 



8 



10 



lOug 



10 





lug 







10 
.lug 



10 



4» 



•• • •• •••• 

• •••••• . 

••• • • • • » 

• • • • • • • 

•• •• ••••••• •* • 



FIO I 

«• ^rr, » MET W VAL LEU ™ SER LEU SER LYS THR LEU LYS ASP AU 14 

5- GGmnAAACGAflGTCTTCAAC AT6 GAT GTC CTA TAC TCT TTG TCA AAG ACT CTT AAA GAC 6a 65 

ARG ASP LYS ILE VAL GLU GLY THR LEU TYR SER ASN VAL SER ASP LEU ILE GLN GLN PHE 34 

AGA GAC AAA ATT GTC GAA G6C ACA TIG TAT TCT AAC GTG ACT GAT CTA ATT CA A CAA TTT 125 



ASN GLN MET ILE ILE 
AATCAAATGATA ATT 



THR MET ASN GLY ASN GLU PHE GLN THR GLY GLY ILE GLY ASN LEU 54 
ACT ATS AAT G6A AAT GAA TTT CAA ACT G6A GGA ATC CCT AAT TT6 185 



PRO ILE ARG ASN TRP ASN PHE ASN PHE GCT LEU LEU GLY THR THR LEU LEU ASN LEU ASP 74 
CCA ATT AGA AAC T6G AAT TT T AAT TTC G6G TTA CTT GGA ACA ACT TTG CTG AAC TTA GAC 94S 

AU ASN TYR VAL GLU THR ALA ARG ASN THR ILE ASP TYR PHE VAL ASP PHE VAL ASP ASN 94 

6CT AAT TAT GTT GAA AC6 GCA AGA AAT ACA ATT GAT TAT TTC GTG GAT TTT GTA GAC AAT 30S 



SAl M £J I** 6LN AR6 m ile ala pro gln ser asp iw 

GTA T6C ATGl GAT GAG AT6 GTT AGA GAA TCA CAA AGG AAC GGA ATT GCA CCT CAA TCA GAC 365 



SER LEU ARG LYS LEU SER ALA ILE LYS PHE LYS ARG ILE ASN PHE ASP ASN SER SER GLU 134 

TCC CTA AGA AAG CTG TCA GCC ATT AAA TTC AAA AGA ATA AAT TTT GAT AAT TCG TCG GAA 425 

'M £tlf 35? LEU Sl-N ASN ARG ARG GLN ARG THR GLY PHE THR PHE HIS LYS 154 

TAC ATA GAA AAC TGG AAT TTG CAA AAT AGA AGA CAG AGG ACA GGT TTC ACT TTT CAT AAA 485 

£K $i !!£ S!l PH $ TYR SER AW SER WE THR LEU ASN ARG SER GLN PRO ALA HIS ASP 174 

CCA AAC ATT TTT CCT TAT TCA GCA TCA TTT ACA CTA AAT AGA TCA CAA CCC GCT CAT GAT 545 

ASN LEU MET GLY THR MET TRP LEU ASN ALA GLY SER GLU ILE GLN VAL ALA GLY PHE ASP 194 

AAT TTG ATG GGC ACA ATG TGG TTA AAC GCA GGA TCG GAA ATT CAA GTC GCT GGA TTT GAC 605 

IS li? SS U ASN m ALA ASN IL E GLN GLN PHE GLU HIS ILE VAL PRO LEU m 

TAC TCA TGT GCT ATT. AAC GCA CCA GCC AAT ATA CAA CAA TTT GAG CAT ATT GTG CCA CTC 665 

ARG ARG VAL LEU THR THR ALA THR ILE THR LEU LEU PRO ASP ALA GUI ARG PHE SER PHE 234 

CGA AGA GTG TTA ACT ACA GCT ACG ATA ACT CTT CTA CCA GAC GCG GAA AGG TTT AGT TTT 725 

PRO ARG VAL ILE ASN SER ALA ASP GLY ALA THR THR TRP PHE PHE ASN PRO VAL ILE LEU 254 

CCA AGA GTG ATC AAT TCA GCT GAC GGC GCA ACT ACA TGG TTT TTC AAC CCA GTG ATT CTC 785 

P J& y& 6UJ VAL 6UJ ^ LEU LEU ASN GLY GLN ILE ILE ASN THR TYR GLN 274 

AGG CC6 AAT AAC GTT GAA GTG GAG TTT CTA TTG AAT GGA CAG ATA ATA AAC ACT TAT CAA 845 

ALA ARG PHE GLY THR ILE VAL ALA ARG ASN PHE ASP THR ILE ARG LEU SER PHE GLN LEU 294 

GCA AGA TTT GGA ACT ATC GTA GCT AGA AAT TTT GAT ACT ATT AGA CTA TCA TTC CAG TTA 905 

M IT &9 fJ9 $58 !8? tkr pro ala \«l ala val leu phe pro asn ala gln pro phe 3m 

ATG AGA CCA CCA.AAC ATG ACA CCA GCA GTA GCA GTA CTA TTC CCG AAT GCA CAG CCA TTC 965 

GLU HIS HIS ALA THR VAL GLY LEU THR LEU ARG ILE GLU SER ALA VAL CYS GUJ SER VAL 334 

GAA CAT CAT GCA ACA GTG GGA TTG ACA CTT AGA ATT GAG TCT GCA GTT TGT GAS TCT GTA 1025 

LEU ALA ASP ALA SER GLU THR LEU LEU ALA ASN VAL THR SER VAL ARG GLN GLU TYR ALA 354 

CTC GCC GAT GCA AGT GAA ACT CTA TTA GCA AAT GTA ACA TCC GTT AGG CAA GAG TAC GCA 1085 

ILE PRO VAL GLY PRO VAL PHE PRO PRO GLY MET ASN TRP THR ASP LEU ILE THR ASN TYR 374 

ATA CCA GTT GGA CCA GTC TTT CCA CCA GGT ATG AAC TGG ACT GAT TTA ATC ACC AAT TAT 1145 

SER PRO SER ARG 6LU ASP ASN LEU GLN ARG VAL PHE THR VAL ALA SER ILE ARG SER MET 394 

TCA CCG.TCT AGG GAG GAC AAT TTG CAA CGC GTA TTT ACA GTG GCT TCC ATT AGA AGC ATC 1205 

LEU ILE LYS fff 397 

CTC ATT AAATGA GGACCAAGCTAACAACTTCCTATCCAA 1280 

CTCTGTA/GI^GGATCCGTATACG 1357 



U L O 3 I *» O 



FIG. 9 



700 




2 4 
WEEKS 
O-O MARCOL CONTROL 
a—a I.OugCARRER+O.lugCHC-SHT 
m-m I Oug CARRIER H.OugCHO-SHT 
I OOug CARRER +1 Oug CHO-SHT