Skip to main content

Full text of "USPTO Patents Application 09848616"

See other formats


This Page Is Inserted by IFW Operations 
and is not a part of the Official Record 



BEST AVAILABLE IMAGES 

Defective images within this document are accurate representations of 
the original documents submitted by the applicant. 

Defects in the images may include (but are not limited to): 

• BLACK BORDERS 

• TEXT CUT OFF AT TOP, BOTTOM OR SIDES 

• FADED TEXT 

• ILLEGIBLE TEXT 

• SKEWED/SLANTED IMAGES 

• COLORED PHOTOS 

• BLACK OR VERY BLACK AND WHITE DARK PHOTOS 

• GRAY SCALE DOCUMENTS 



IMAGES ARE BEST AVAILABLE COPY. 



As rescanning documents will not correct images, 
please do not report the images to the 
Image Problem Mailbox. 



WORLD INTELLECTUAL PROPERTY ORGANIZATION 
International Bureau 




PCT 

INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) 



(51) International Patent Classification 6 : 
A61K 39/39 



Al 



(11) International Publication Number: WO 98/40100 

(43) International Publication Date: 17 September 1998 (17.09.98) 



(21) International Application Number: PCT/US98/04703 

(22) International Filing Date: 10 March 1998 (10.03.98) 



(30) Priority Data: 
60/040,376 



10 March 1997(10.03.97) 



US 



(63) Related by Continuation (CON) or Continuation-in-Part 
(CIP) to Earlier Application 

US 60/040,376 (CIP) 

Filed on 10 March 1997 (10.03.97) 



(71) Applicants (for all designated States except US): OTTAWA 

CIVIC LOEB RESEARCH INSTITUTE [CA/CA]; 725 
Parkdale Avenue, Ottawa, Ontario K1Y 4E9 (CA). QI- 
AGEN GMBH [DE/DE]; Max-Vomer-Strasse 4, D-4010 
Hilden (DE). THE UNIVERSITY OF IOWA RESEARCH 
FOUNDATION [US/US]; 214 Technology Innovation Cen- 
ter, Oakdale Research Campus, Iowa City, IA 52242 (US). 

(72) Inventors; and 

(75) Inventors/Applicants (for US only): DAVIS, Heather, L. 
[CA/CA]; Loeb Research Institute, Ottawa Civic Hos- 
pital, 1053 Carting Avenue, Ottawa, Ontario K1Y 4E9 
(CA). SCHORR, Joachim [DE/DE]; Qiagen GmbH, 



Max-Vormer-Strasse 3, D-4010 Hilden (DE). KRIEG, 
Arthur, M. [US/US]; 890 Park Place, Iowa City, IA 52246 
(US). 

(74) Agent: HAILE, Lisa, A.; Fish & Richardson P.C., Suite 1400, 
4225 Executive Square, La Jolla, CA 92037 (US). 



(81) Designated States: AL, AM, AT, AU, AZ, BA, BB, BG, BR, 
BY, CA, CH, CN, CU, CZ, DE, DK, EE, ES, FI, GB, GE, 
GH, HU, IL, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, 
LS, LT, LU, LV, MD, MG, MK, MN, MW, MX, NO, NZ ? 
PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, 
UA, UG, US, UZ, VN, YU, ZW, ARIPO patent (GH, GM, 
KE, LS, MW, SD, SZ, UG, ZW), Eurasian patent (AM, AZ, 
BY, KG, KZ, MD, RU, TJ, TM), European patent (AT, BE, 
CH, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, 
PT, SE), OAPI patent (BF, BJ, CF, CG, CI, CM, GA, GN, 
ML, MR, NE, SN, TD, TG). 



Published 

With international search report. 
With amended claims. 



(54) Tide: USE OF NUCLEIC ACIDS CONTAINING UN METHYLATED CpG DINUCLEOTIDE AS AN ADJUVANT 



(57) Abstract 

Hie present invention is based on the rinding that nucleic acids containing at least one unmethylated cytosine-guanine (CpG) 
dinucleotide affect immune responses in a subject These nucleic acids containing at least one unmethylated cytosine-guanine (CpG) 
dinucleotide can be used to induce an immune response in a subject. The method includes administering to the subject a therapeutically 
effective amount of nucleic acid encoding an antigenic polypeptide, and a therapeutically effective amount of an oligonucleotide containing 
at least one unmethylated CpG dinucleotide. The invention also provides a method for treating a subject having or at risk of having 
viral-mediated disorder, comprising administering to the subject a therapeutically effective amount of a nucleic acid encoding an antigenic 
polypeptide and an effective amount of an oligonucleotide containing at least one unmethylated CpG dinucleotide. 



FOR THE PURPOSES OF INFORMATION ONLY 



Codes used to identify States party to the PCX on the front pages of pamphlets publishing international applications under the PCT. 



AL 


Albania 


ES 


Spain 


LS 


Lesotho 


SI 


Slovenia 


AM 


Armenia 


FI 


Finland 


LT 


Lithuania 


SK 


Slovakia 


AT 


Austria 


FR 


France 


LU 


Luxembourg 


SN 


Senegal 


AU 


Australia 


GA 


Gabon 


LV 


Latvia 


sz 


Swaziland 


AZ 


Azerbaijan 


GB 


United Kingdom 


MC 


Monaco 


TD 


Chad 


BA 


Bosnia and Herzegovina 


GE 


Georgia 


MD 


Republic of Moldova 


TG 


Togo 


BB 


Barbados 


GH 


Ghana 


MG 


Madagascar 


TJ 


Tajikistan 


BE 


Belgium 


GN 


Guinea 


MK 


The former Yugoslav 


TM 


Turkmenistan 


BF 


Burkina Paso 


GR 


Greece 




Republic of Macedonia 


TR 


Turkey 


BG 


Bulgaria 


HU 


Hungary 


ML 


Mali 


TT 


Trinidad and Tobago 


BJ 


Benin 


IE 


Ireland 


MN 


Mongolia 


UA 


Ukraine 


BR 


Brazil 


IL 


Israel 


MR 


Mauritania 


UG 


Uganda 


BY 


Belarus 


IS 


Iceland 


MW 


Malawi 


US 


United States of America 


CA 


Canada 


IT 


Italy 


MX 


Mexico 


UZ 


Uzbekistan 


CF 


Central African Republic 


JP 


Japan 


NE 


Niger 


VN 


Viet Nam 


CG 


Congo 


KE 


Kenya 


NL 


Netherlands 


YU 


Yugoslavia 


CII 


Switzerland 


KG 


Kyrgyzstan 


NO 


Norway 


ZVV 


Zimbabwe 


CI 


COte d'lvoire 


KP 


Democratic People's 


NZ 


New Zealand 






CM 


Cameroon 




Republic of Korea 


PL 


Poland 






CN 


China 


KR 


Republic of Korea 


PT 


Portugal 






CU 


Cuba 


KZ 


Kazakstan 


RO 


Romania 






cz 


Czech Republic 


IX 


Saint Lucia 


RU 


Russian Federation 






DE 


Germany 


LI 


Liechtenstein 


SD 


Sudan 






DK 


Denmark 


LK 


Sri Lanka 


SE 


Sweden 






EE 


Estonia 


LR 


Liberia 


SG 


Singapore 







WO 98/40100 



PCT/US98/04703 



T!S ? r Off NUCLEIC ACIDS CONTAI NING UNMETHYLATED CpG 
nimiCIJCOTIDE AS AN ADJUVANT 

FIELD OF THE INVENTION 

This invention relates to generally to adjuvants, and specifically to the use of 
oligonucleotides having at least one unmethylated CpG dinucleotide (CpG ODN).as an 
adjuvant 

BACKGROUND OF THE INVENTION 

Bacterial DNA, but not vertebrate DNA, has direct immunostimulatory effects on 
peripheral blood mononuclear cells (PBMQ in vitro (Krieg et a/., 1995). This 
lymphocyte activation is due to unmethylated CpG dinucleotides, which are present at the 
expected frequency in bacterial DNA (1/16), but are under-represented (CpG suppression, 
1/50 to 1/60) and methylated in vertebrate DNA. Activation may also be triggered by 
addition of synthetic oligodeoxynucleotides (ODN) that contain an unmethylated CpG 
dinucleotide in a particular sequence context. It appears likely that the rapid immune 
activation in response to CpG DNA may have evolved as one component of the innate 
immune defense mechanisms that recognize structural patterns specific to microbial 
molecules. 

CpG DNA induces proliferation of almost all (>95%) B cells and increases 
immunoglobulin (Ig) secretion. This B cell activation by CpG DNA is T cell independent 
and antigen non-specific. However, B cell activation by low concentrations of CpG DNA 
has strong synergy with signals delivered through the B cell antigen receptor for both B 
cell proliferation and Ig secretion (Krieg et al., 1995). This strong synergy between the B 
cell signaling pathways triggered through the B cell antigen receptor and by CpG DNA 
promotes antigen specific immune responses. In addition to its direct effects on B cells, 



I 



WO 98/40100 



PCT/US98/04703 



CpG DNA also directly activates monocytes, macrophages, and dendritic cells to secrete a 
variety of cytokines, including high levels of IL-12 (Klinman et a/., 1996; Halpern et a/., 
1996; Cowdery et al. % 1996). These cytokines stimulate natural killer (NK) cells to 
secrete g-interferon (IFN-g) and have increased lytic activity (Klinman et al., 1996, supra; 
Cowdery et aL 9 1996, supra; Yamamoto et aL 9 1992; Ballas et al. y 1996). Overall, CpG 
DNA induces a Thl like pattern of cytokine production dominated by IL-12 and IFN-g 
with little secretion of Th2 cytokines (Klinman et al. 9 1996). The strong direct effects 
(T cell independent) of CpG DNA on B cells, as well as the induction of cytokines which 
could have indirect effects on B-cells via T-help pathways, suggests utility of CpG DNA 
in the form of ODN as a vaccine adjuvant. ' s 

A DNA vaccine induces immune responses against an antigenic protein expressed 
in vivo from an introduced gene. The DNA vaccine is most often in the form of a 
plasmid DNA expression vector produced in bacteria and then purified and delivered to 
muscle or skin (see Vogel and Sarver, 1995; Brazolot Millan and Davis, 1997; Donnelly 
et aL 9 1996). DNA vaccines have been demonstrated to show efficacy against numerous 
viral, bacterial and parasitic diseases in animal models. Almost all studies show induction of 
very strong and long-lasting humoral and cell-mediated immune responses, and protection 
against live pathogen challenge (where it could be evaluated). The efficacy of DNA 
vaccines is attributed, at least in part, to the continuous in vivo synthesis of antigen that 
leads to efficient antigen presentation. In particular, endogenously-synthesized antigen is 
presented by class I MHC, leading to induction of CD8+ cytotoxic T lymphocytes (CTL). In 
contrast, most whole killed and subunit vaccines, where antigen is processed solely in the 
exogenous form, often fail to induce CTL. More recently however, it has been shown that 
the presence of unmethylated CpG motifs in the DNA vaccines is essential for the induction 
of immune responses against the antigen (Sato et al, 1 996). 

Hepatitis B virus (HBV) poses a serious world-wide health problem. The current 
HBV vaccines are subunit vaccines containing particles of HBV envelope protein(s) which 



WO 98/40100 



PCT/US98/04703 



include several B and T cell epitopes known collectively as HBV surface antigen (HBsAg). 
The HBsAg particles may be purified from the plasma of chronically infected individuals or 
more commonly are produced as recombinant proteins. These vaccines induce antibodies 
against HBsAg (anti-HBs), which confer protection if present in titers 1 0 milli-International 
Units per milliliter (mlU/ml) (Ellis, 1993). While the subunit vaccines are safe and generally 
efficacious, they fail to meet all current vaccination needs. For example, early vaccination of 
infants bom to chronically infected mothers, as well as others in endemic areas, drastically 
reduces the rate of infection, but a significant proportion of these babies will still become 
chronically infected themselves. This could possibly be reduced if high titers of anti-HBs 
antibodies could be induced earlier and if there were HBV-specific CTL. In addition, there 
are certain individuals who fail to respond (non-responders) or do not attain protective 
levels of immunity (hypo-responders). Finally, there is an urgent need for an effective 
treatment for the estimated 350 million chronic carriers of HBV and a therapeutic vaccine 
could meet this need. 

SUMMARY OF THE INVENTION 

The present invention is based on the finding that nucleic acids containing at least 
one unmethylated cytosine-guanine (CpG) dinucleotide affect the immune response in a 
subject by activating natural killer cells (NK) or redirecting a subject's immune response 
from a Th2 to a Thl response by inducing monocytic and other cells to produce Thl 
cytokines. These nucleic acids containing at least one unmethylated CpG can be used as 
an adjuvant, specifically to induce an immune response against an antigenic protein. 

In one embodiment, the invention provides a method of inducing an immune 
response in a subject by administering to the subject a therapeutically effective amount of 
a nucleic acid encoding an antigenic protein and a therapeutically effective amount of an 
oligonucleotide containing at least one unmethylated CpG dinucleotide. 

In another embodiment, the invention provides a method for treating a subject 
having or at risk of having a virally mediated disorder by administering to the subject a 



WO 98/40100 



PCT/US98/04703 



therapeutically effective amount of a nucleic acid encoding an antigenic protein and an 
effective amount of an oligonucleotide containing at least one unmethylated CpG 
dinucleotide. 

In further embodiment, the invention provides a method for treating a subject 
having or at risk of having a chronic viral infection by administering to the subject an 
effective amount of an antigenic polypeptide and an effective amount of an 
ligonucleotide containing at least one unmethylated CpG dinucleotide. 

In another embodiment, a pharmaceutical composition containing an 
immumostimulatory CpG oligonucleotide and a nucleic acid encoding an antigenic protein 
in a pharmaceutically acceptable carrier is provided 

BRIEF DESCRIPTION OF THE DRAWINGS 

FIG. 1 is a graph illustrating humoral responses in BALB/c mice immunized with 
1 g recombinant HBsAg protein alone, adsorbed onto alum (25 mg APVmg HBsAg), with 
100 g of immunostimulatory CpG ODN, or with both alum and CpG ODN. Each point 
represents the group mean (n=10) for titers of anti-HBs (total IgG) as determined in 
triplicate by end-point dilution ELISA assay. End-point titers were defined as the highest 
plasma dilution that resulted in an absorbance value (OD 450) two times greater than that 
of control non-immune plasma with a cut-off value of 0.05. The upper graph shows 
results on a linear scale and the lower graph shows results on a logarithmic scale (log 10 ). 

FIG. 2 is a graph illustrating humoral responses in BALB/c mice immunized with 
1 g recombinant HBsAg protein with alum and with 0, 10, 100 or 500 g of CpG ODN added. 
Each point represents the group mean (n^lO) for anti-HBs titers (total IgG) as determined 
by end-point dilution ELISA assay. 



WO 98/40100 



PCT/US98/04703 



FIG. 3 is a graph of humoral responses in C57BL/6 mice immunized with 1 g 
recombinant HBsAg protein without adjuvant, with alum, with 100 g of CpG ODN, or with 
both alum and CpG ODN. Mice were boosted in the identical fashion after 6 weeks. Each 
point represents the group mean (n=5) for anti-HBs titers (total IgG) as determined by 
end-point dilution ELIS A assay. 

FIG. 4 is a graph of humoral responses in C57BL/6 mice immunized with 1 g 
recombinant HBsAg protein without adjuvant, or with 1, 10 or 100 g of CpG ODN. Mice 
were boosted in the identical fashion after 6 weeks. Each point represents the group mean 
(n=5) for anti-HBs titers (total IgG) as determined by end-point dilution ELIS A assay. 

FIG. 5 is a graph of humoral responses in B10.S hypo-responder mice immunized 
with 1 g recombinant HBsAg protein without adjuvant, with alum, and/or with 1 0 g of CpG 
ODN. Each point represents the group mean (n=5) for anti-HBs titers (total IgG) as 
determined by end-point dilution ELISA assay. 

FIG. 6 is a graph of humoral responses in C2D non-responder mice immunized with 
1 g recombinant HBsAg protein with alum or with alum plus 10 g of CpG ODN. Each point 
represents the group mean (n=5) for anti-HBs titers (total IgM or IgG) as determined by 
end-point dilution ELISA assay. 

FIG. 7 is a bar graph illustrating humoral responses in C57BI76 mice at 8 weeks 
after immunization with 1 g recombinant HBsAg protein without adjuvant, with alum, with 
100 g of CpG ODN, or with both alum and CpG ODN. Mice had been boosted in the 
identical fashion at 6 weeks. Each point represents the group mean (n=5) for anti-HBs titers 
(IgGl and IgG2a isotypes) as determined by end-point dilution ELISA assay. 

FIG. 8 is a graph of humoral responses in BALB/c mice immunized with 10 g 
HBsAg-expressing DNA vaccine (pCMV-S) injected alone or with 100 or 500 g of CpG 



WO 98/4010* 



PCT/US98/04703 



ODN added. Each point represents the group mean (n=10) for anti-HBs titers (total IgG) as 
determined by end-point dilution ELIS A assay. 

FIG. 9 is a graph of humoral responses in B10.S mice immunized with 2 g 
recombinant HBsAg protein without adjuvant or with 50 g pCMV-S DNA vaccine. Each 
point represents the group mean (n=5) for anti-HBs titers (total IgG) as determined by 
end-point dilution ELISA assay. 

FIG. 10 is a graph of humoral responses in newborn BALB/c mice imm mvreA with 
1 g recombinant HBsAg protein with alum or with 10 g pCMV-S DNA vaccine on the day 
of birth or 7 days later. Each point represents the group mean (n=10) for anti-HBs titers 
(total IgG) as determined by end-point dilution ELISA assay. 

FIG. 1 1 is a graph of humoral responses in BALB/c mice primed with 10 g 
HBsAg-expressing DNA vaccine (pCMV-S) and given 2 g recombinant HBsAg protein at 
the same time in the same or a different muscle or given the HBsAg 2 or 8 weeks later. Each 
point represents the group mean (n=l 0) for anti-HBs titers (total IgG) as determined by 
end-point dilution ELISA assay. 

DESCRIPTION OF THE PREFERRED EMBODIMENTS 

It is to be understood that this invention is not limited to the particular methodology, 
protocols, sequences, models and reagents described as such may, of course, vary. It is also 
to be understood that the terminology used herein is for the purpose of describing particular 
embodiments only, and is not intended to limit the scope of the present invention which will 
be limited only by the appended claims. 

All publications mentioned herein are incorporated herein by reference for the 
purpose of describing and disclosing the oligonucleotides and methodologies which are 
described in the publications which might be used in connection with the presently 
described invention. 



WO 98/40100 



PCT/US98/04703 



The binding of DNA to cells has been shown to be similar to a ligand receptor 
interaction: binding is saturable, competitive, and leads to DNA endocytosis and 
degradation into oligonucleotides (Bennet, R.M., etaL 9 J. Clin. Invest 26:2182, 1985). Like 
DNA, oligodeoxyribonucleotides are able to enter cells in a process which is sequence, 
temperature, and energy independent (Jaroszewski and Cohen, Ad Drug Del Rev. £:235, 
1991). An "oligodeoxyribonucleotide" as used herein is a deoxyribonucleic acid sequence 
fiom about 3-50 bases in length. Lymphocyte oligodeoxyribonucleotide uptake has been 
shown to be regulated by cell activation (Krieg, A.M., et aL.Antisense Research and 
Development 1:161, 1991). The present invention is based on the finding that certain 
oligonucleotides (ODN) containing at least one unmethylated cytosine-guanine (CpG) 
dinucleotide activate the immune response. 

In one embodiment, the invention provides a method for stimulating an immune 
response in a subject by administering a therapeutically effective amount of a nucleic acid 
sequence containing at least one unmethylated CpG. The term "nucleic acid" or 
"oligonucleotide" refers to a polymeric form of nucleotides at least five bases in length. The 
nucleotides of the invention can be deoxyribonucleotides, ribonucleotides, or modified 
forms of either nucleotide. Generally, double-stranded molecules are more stable in vivo, 
while single-stranded molecules have increased activity. 

The nucleic acid molecule can include the use of phosphorothioate or 
phosphorodithioate rather than phosphodiesterase linkages within the backbone of the 
molecule, or methylphosphorothioate terminal linkages (Krieg, A.M, et al 9 Antisense and 
Nucl Acid Drug Dev 6:133-9, 1996; Boggs, R.T., et al, Antisense and Nucl Acid Drug Dev, 
2:461-71, 1997). The phosphate backbone modification can occur at the 5 1 end of the 
nucleic acid, for example at the first two nucleotides of the 5* end of the nucleic acid. The 
phosphate backbone modification may occur at the 3 1 end of the nucleic acid, for example at 
the last five nucleotides of the 3' end of the nucleic acid. International Patent Application 
WO 95/26204, entitled "Immune stimulation by phosphorothioate oligonucleotide analogs" 
reports the nonsequence-specific immunostimulatory effect of phosphorothioate modified 



WO 98/40100 



PCT/US98/04703 



oligonucleotides. Nontraditional bases such as inosine and queosine, as well as acetyl-, 
thio- and similarly modified forms of adenine, cytidine, guanine, thymine, and uridine can 
also be included, which are not as easily recognized by endogenous endonucleases. Other 
stabilized nucleic acid molecules include: nonionic DNA analogs, such as alkyl- and aryl- 
phosphonates (in which the charged oxygen moiety is alkylated). Nucleic acid molecules 
which contain a diol, such as tetrahyleneglycol or hexaethyleneglycoi, at either or both 
termini are also included. The term "oligonucleotide" includes both single and double- 
stranded forms of DNA. 

A "CpG" or "CpG motif 1 refers to a nucleic acid having a cytosine followed by a 
guanine linked by a phosphate bond. The term "methylated CpG" refers to the methylation 
of the cytosine on the pyrimidine ring, usually occurring the 5-position of the pyrimidine 
ring. The term '^unmethylated CpG" refers to the absence of methylation of the cytosine on 
the pyrimidine ring. Methylation, partial removal, or removal of an unmethylated CpG 
motif in an oligonucleotide of the invention is believed to reduce its effect Methylation or 
removal of all unmethylated CpG motifs in an oligonucleotide substantially reduces its 
effect The effect of methylation or removal of a CpG motif is "substantial" if the effect is 
similar to that of an oligonucleotide that does not contain a CpG motif. 

Preferably the CpG oligonucleotide is in the range of about 8 to 30 bases in size. 
For use in the instant invention, the nucleic acids can be synthesized de novo using any of a 
number of procedures well known in the art. For example, the b-cyanoethyl 
phosphoramidite method (Beaucage, S.L., and Caruthers, M.H., TeL Let. 22:1859, 1981); 
nucleoside H-phosphonate method (Garegg etaL, TeL Let. 27:4051-4054, 1986; Froehler 
etal. 9 Nucl. Acid Res. 14:5399-5407, 1986, ; Garegg etaL, TeL Let 27:4055-4058, 1986, 
Gafifeey et al 9 TeL Let. 29:2619-2622, 1988). These chemistries can be performed by a 
variety of automated oligonucleotide synthesizers available in the market Alternatively, 
CpG dinucleotides can be produced on a large scale in plasmids, (see Sambrook, T., et a/., 
Molecular Cloning: A La boratory Manual. Cold Spring Harbor laboratory Press, New York, 
1989) which after being administered to a subject are degraded into oligonucleotides. 

8 



WO 98/40100 



PCT/US98/047G3 



Oligonucleotides can be prepared from existing nucleic acid sequences (e.g., genomic or 
cDNA) using known techniques, such as those employing restriction enzymes, exonucleases 
orendonucleases. 

For use in vivo, nucleic acids are preferably relatively resistant to degradation (eg., 
via endo-and exo-nucleases). Secondary structures, such as stem loops, can stabilize nucleic 
acids against degradation. Alternatively, nucleic acid stabilization can be accomplished via 
phosphate backbone modifications. A preferred stabilized nucleic acid has at least a partial 
phosphorothioate modified backbone. Phosphorothioates may be synthesized using 
automated techniques employing either phosphoramidate or H-phosphonate chemistries. 
Aryl-and alkyl-phosphonates can be made, e.g., as described in U.S. Patent No. 4,469,863; 
and alkylphosphotriesters (in which the charged oxygen moiety is alkylated as described in 
U.S. Patent No. 5,023,243 and European Patent No. 092,574) can be prepared by automated 
solid phase synthesis using commercially available reagents. Methods for making other 
DNA backbone modifications and substitutions have been described (Uhlmann, EL and 
Peyman, A., Chem. Rev. 90:544, 1990; Goodchild, J., Bioconjugate Chenu 1:165, 1990). 

For administration in vivo, nucleic acids may be associated with a molecule that 
results in higher affinity binding to target cell (e.g, B-cell, monocytic cell and natural killer 
(NK) cell) surfaces and/or increased cellular uptake by target cells to form a "nucleic acid 
delivery complex." Nucleic acids can be ionically or covalently associated with appropriate 
molecules using techniques which are well known in the art. A variety of coupling or 
cross-linking agents can be used, e.g. , protein A, carbodiimide, and N-succinimidyl- 
3-(2-pyridyldithio) propionate (SPDP). Nucleic acids can alternatively be encapsulated in 
liposomes or virosomes using well-known techniques. 

In one embodiment, the nucleic acid sequences useful in the methods of the 
invention are represented by the formula: 

STSI.XjCGX^ (SEQIDNO:!) 



WO 98/40100 



PCT/US98/04703 



wherein at least one nucleotide separates consecutive CpGs; X, is adenine, guanine, or 
thymidine; X 2 is cytosine or thymine, N is any nucleotide and N t + N 2 is from about 
0-26 bases. In a preferred embodiment, N, and N 2 do not contain a CCGG quadmer or more 
than one CGG trimer, and the nucleic acid sequence is from about 8-30 bases in length. 
However, nucleic acids of any size (even may kb long) can be used in the invention if CpGs 
are present, as larger nucleic acids are degraded into oligonucleotides inside ceils. Preferred 
synthetic oligonucleotides do not include a CCGG quadmer or more than one CCG or CGG 
trimer at or near the 5' or 3* terminals and/or the consensus mitogenic CpG motif is not a 
palindrome. A "palindromic sequence" or "palindrome" means an inverted repeat (Le., a 
sequence such as ABCDEE'D'C'B'A', in which A and A' are bases capable of forming the 
usual Watson-Crick base pairs. 

In another embodiment, the method of the invention includes the use of an 
oligonucleotide which contains a CpG motif represented by the formula: 

S'NjX^CGX^N, 3* (SEQ ID NO:2) 
wherein at least one nucleotide separates consecutive CpGs; X,X 2 is selected from the group 
consisting of GpT, GpG, Gp A, ApT and ApA; X 3 X 4 is selected from the group consisting 
ofTpT or CpT;N is any nucleotide and N, + N 2 is from about 0-26 bases. In a preferred 
embodiment, N, and N 2 do not contain a CCGG quadmer or more than one CCG or CGG 
trimer. CpG ODN are also preferably in the range of 8 to 30 bases in length, but may be of 
any size (even many kb long) if sufficient motifs are present, since such larger nucleic acids 
are degraded into oligonucleotides inside of cells. Preferred synthetic oligonucleotides of 
this formula do not include a CCGG quadmer or more than one CCG or CGG trimer at or 
near the 5 1 and/or 3' terminals and/or the consensus mitogenic CpG motif is not a 
palindrome. Other CpG oligonucleotides can be assayed for efficacy using methods 
described herein. An exemplary nucleic acid sequence of the invention is 
5-TCCATGACGTTCCTGACGTT-3' (SEQ ID NO:3). 

A prolonged effect can be obtained using stabilized oligonucleotides, where the 
oligonucleotide incorporates a phosphate backbone modification (e.g., a phosphorothioate or 

to 



WO 98/40100 



PCT/US98/04703 



phosphorodithioate modification). More particularly, the phosphate backbone modification 
occurs at the 5' end of the nucleic acid for example, at the first two nucleotides of the 5* end 
of the nucleic acid. Further, the phosphate backbone modification may occur at the 3' end of 
the nucleic acid for example, at the last five nucleotides of the 3' end of the nucleic acid 
Preferred nucleic acids containing an unmethylated CpG have a relatively high stimulation 
with regard to B cell, monocyte, and/or natural killer cell responses (e.g., induction of 
cytokines, proliferative responses, lytic responses, among others). 

Nucleic acids containing an unmethylated CpG can be effective in any mammal 
preferably a human Different nucleic acids containing an unmethylated CpG can cause 
optimal immune stimulation depending on the mammalian species. Thus an oligonucleotide 
causing optimal stimulation in humans may not cause optimal stimulation in a mouse. One 
of skill in the art can identify the optimal oligonucleotides useful for a particular 
mammalian species of interest. 

The "stimulation index" is a measure of a CpG ODN to effect an immune response 
which can be tested in various immune cell assays. The stimulation of the immune response 
can be assayed by measuring various immune parameters, e.g., measuring the antibody- 
forming capacity, number of lymphocyte subpopulations, mixed leukocyte response assay, 
lymphocyte proliferation assay. The stimulation of the immune response can also be 
measured in an assay to determine resistance to infection or tumor growth. Methods for 
measuring a stimulation index are well known to one of skill in the art For example, one 
assay is the incorporation of 3 H uridine in a murine B cell culture, which has been contacted 
• with a 20jiM of oligonucleotide for 20h at 37°C and has been pulsed with 1 nCi of 3 H 
uridine; and harvested and counted 4h later. The induction of secretion of a particular 
cytokine can also be used to assess the stimulation index. Without meaning to be bound by 
theory, for use in vivo, for example to treat a subject at risk of exposure to a hepatitis virus, 
it is important that the CpG ODN be capable of effectively inducing cytokine secretion by 
monocytic cells and/or Natural Killer (NK) cell lytic activity. In one method, the 
stimulation index of the CpG ODN with regard to B-cell proliferation is at least about 5, 

11 



WO 98/40100 



PCT/US9S/04703 



preferably at least about 10, more preferably at least about 1 S and most preferably at least 
about 20, while recognizing that there are differences in the stimulation index among 
individuals. 

The CpO ODN of the invention stimulate cytokine production (e.g., IL-6, TL-12, 
IFN-y, TNF-a and GM-CSF). Exemplary sequences include: 

TCCATGTCGCTCCTGATGCT (SEQ ID NO:4), 

TCCATGTCGTTCCTGATGCT (SEQ ID NO:5), and 

TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID NO:6). 
The CpG ODN of the invention are also useful for stimulating natural killer cell (NK) lytic 
activity in a subject such as a human. Specific, but nonl uniting examples of such sequences 
include: 

TCGTCGTTGTCGTTGTCGTT (SEQ ID NO:7), 

TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID NO:6), 

TCGTCGTTGTCGTTTTGTCGTT (SEQ ID NO:8), 

GCGTGCGTTGTCGTTGTCGTT (SEQ ID NO:9), 

TGTCGTTTGTCGTTTGTCGTT (SEQ ID NO: 10), 

TGTCGTTGTCGTTGTCGTT (SEQ ID NO:l 1), and 

TCGTCGTCGTCGTT (SEQ ID NO:12). 
The nucleic acid sequences of the invention are also useful for stimulating B cell 
proliferation. Specific, but nonlimiting examples of such sequences include: 

TCCTGTCGTTCCTTGTCGTT (SEQ ID NO: 13), 

TCCTGTCGTTTTTTGTCGTT (SEQ ID NO: 14), 

TCGTCGCTGTCTGCCCTTCTT (SEQ ID NO: 15), 

TCGTCCtCTGTTGTCGTTTCTT (SEQ ID NO: 16), 

TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID NO:6), 

TCGTCGTTGTCGTTTTGTCGTT (SEQ ID NO:8) and 

TGTCGTTGTCGTTGTCGTT (SEQ ID NO: 1 1 ). 



12 



WO 98/40100 



PCT/US98/04703 



Preferred CpG ODN can effect at least about 500 pg/ml ofTNF-a, 15 pg/ml IFN-y, 
70 pg/ml of GM-CSF 275 pg/ml of IL-6, 200 pg/ml IL-12, depending on the therapeutic 
indication. These cytokines can be measured by assays well known in the art The ODNs 
listed above or other preferred CpG ODN can effect at least about 10%, more preferably at 
least about 15% and most preferably at least about 20% YAC-1 cell specific lysis or at least 
about 30%, more preferably at least about 35%, and most preferably at least about 40% 
2C1 1 cell specific lysis, in assays well known in the art. 

An u antigenic polypeptide" is any polypeptide that can, under appropriate - 
conditions, induce an immune response. Antigenic polypeptides include, but are not limited 
to, viral proteins, or fragments thereof. Minor modifications of the primary amino acid 
sequences of a viral polypeptide may also result in a polypeptide which have substantially 
equivalent antigenic activity as compared to the unmodified counterpart polypeptide. Such 
modifications may be deliberate, as by site-directed mutagenesis, or may be spontaneous. 
All of the polypeptides produced by these modifications are included herein as long as 
antigenicity still exists. One non-limiting example of an antigenic viral polypeptide is the 
hepatitis B surface antigen. 

The term "substantially purified" as used herein refers to a polypeptide which is 
substantially free of other proteins, lipids, carbohydrates or other materials with which it is 
naturally associated. One skilled in the art can purify viral polypeptides using standard 
techniques for protein purification. The substantially pure polypeptide will yield a single 
major band on a non-reducing polyacrylamide gel. The purity of the viral polypeptide can 
also be determined by ammo-terminal amino acid sequence analysis. 

The invention utilizes polynucleotides encoding the antigenic polypeptides. These 
polynucleotides include DNA, cDNA and RN A sequences which encode an antigenic 
polypeptide. Such polynucleotides include naturally occurring, synthetic, and intentionally 
manipulated polynucleotides. For example, polynucleotide enocing an antigenic 



13 



WO 98/40100 



PCT/US98/04703 



polypeptide may be subjected to site-directed mutagenesis, so long as the polypeptide 
remains antigenic. 

The term "polynucleotide" or "nucleic acid sequence" refers to a polymeric form of 
nucleotides at least 1 0 bases in length. By "isolated polynucleotide** is meant a 
polynucleotide that is not immediately contiguous with both of the coding sequences with 
which it is immediately contiguous (one on the 5' end and one on the 3' end) in the naturally 
occurring genome of the organism from which it is derived The term therefore includes, for 
example, a recombinant DNA which is incorporated into a vector; into an autonomously 
replicating plasmid or virus; or into the genomic DNA of a prokaryote or eukaryote, or 
which exists as a separate molecule (e.g. a cDNA) independent of other sequences. The 
nucleotides of the invention can be ribonucleotides, deoxyribonucleotides, or modified 
forms of either nucleotide. The term includes single and double forms of DNA. 

In the present invention, the polynucleotide sequences encoding an antigenic 
polypeptide may be inserted into an expression vector. The term "expression vector" refers 
to a plasmid, virus or other vehicle known in the art that has been manipulated by insertion 
or incorporation of the genetic sequences encoding the antigenic polypeptide. 
Polynucleotide sequence which encode the antigenic polypeptide can be operatively linked 
to expression control sequences. "Operatively linked" refers to a juxtaposition wherein the 
components so described are in a relationship permitting them to function in their intended 
manner. An expression control sequence operatively linked to a coding sequence is ligated 
such that expression of the coding sequence is achieved under conditions compatible with 
the expression control sequences. As used herein, the term "expression control sequences" 
refers to nucleic acid sequences that regulate the expression of a nucleic acid sequence to 
which it is operatively linked. Expression control sequences are operatively linked to a 
nucleic acid sequence when the expression control sequences control and regulate the 
transcription and, as appropriate, translation of the nucleic acid sequence. Thus expression 
control sequences can include appropriate promoters, enhancers, transcription terminators, 
as start codon (i.e., ATG) in front of a protein-encoding gene, splicing signal for introns, 

14 



WO 98/40100 



PCT/US98/04703 



maintenance of the correct reading frame of that gene to permit proper translation of mRNA, 
and stop codons. The term "control sequences" is intended to included, at a mininrimn, 
components whose presence can influence expression, and can also include additional 
components whose presence is advantageous, for example, leader sequences and fusion 
partner sequences. Expression control sequences can include a promoter. 

By "promoter" is meant minimal sequence sufficient to direct transcription. Also 
included in the invention are those promoter elements which are sufficient to render 
promoter-dependent gene expression controllable for cell-type specific, tissue-specific, or 
inducible by external signals or agents; such elements may be located in the 5' or 3' regions 
of the gene. Both constitutive and inducible promoters, are included in the invention (see 
e.g., Bitter et aL, 1987, Methods in Enzymology 153:5 16-544). Promoters derived from the 
genome of mammalian cells (e.g., metallothionein promoter) or from mammalian viruses 
(e.g., the retrovirus long terminal repeat; the adenovirus late promoter; the vaccinia virus 
7.5K promoter) may be used. Promoters produced by recombinant DNA or synthetic 
techniques may also be used to provide for transcription of the nucleic acid sequences of the 
invention. 

By "therapeutically effective amount" is meant the quantity of a compound 
according to the invention necessary to prevent, to cure or at least partially arrest symptoms 
in a subject A subject is any mammal, preferably a human. Amounts effective for 
therapeutic use will, of course, depend on the severity of the disease and the weight and 
general state of the subject. Typically, dosages used in vitro may provide useful guidance in 
the amounts useful for in situ administration of the pharmaceutical composition, and animal 
models may be used to determine effective dosages for treatment of particular disorders. 
Various considerations are described, e.g., in Gilman et al y eds., Goodman And Gilman's: 
The Pharmacological Bases of Therapeutics . 8th ed., Pergamon Press, 1990; and 
Remington's Pharmaceutical Sciences, 17th ed., Mack Publishing Co., Easton, Pa., 1990, 
each of which is herein incorporated by reference. 



15 



WO 98/40100 



PCT/US98/047G3 



An oligonucleotide containing at least one unmethylated CpG can be used alone to 
activate the immune response or can be administered in combination with another adjuvant 
An "adjuvant" is any molecule or compound which can stimulate the humoral and/or 
cellular immune response. For example, when the oligonucleotide containing at least one 
unmethylated CpG is administered in conjunction with another adjuvant, the oligonucleotide 
can be administered before, after, and/or simultaneously with the other adjuvant The 
ligonucleotide containing at least one unmethylated CpG can have an additional efficacy 
(e.g., through antisense or other means) in addition to its ability to activate the immune 
response. 

The invention further provides a method of modulating the level of a cytokine. The 
term "modulate" envisions the suppression of expression of a particular cytokine when it is 
overexpressed, or augmentation of the expression of a particular cytokine when it is 
underexpressed. Modulation of a particular cytokine can occur locally or systemically. It is 
believed that the CpG oligonucleotides do not directly activate purified NK cells, but rather 
render them competent to respond to IL-1 2 with a marked increase in their IFN-y 
production. By inducing IL-12 production and the subsequent increased IFN-y secretion by 
NK cells, the immunostimulatory nucleic acids also promote a Thl type immune response. 
No direct activation of proliferation or cytokine secretion by highly purified T cells has been 
found. Cytokine profiles determine T cell regulatory and effector functions in immune 
responses. 

Cytokines also play a role in directing the T cell response. Helper (CD4 + ) T cells 
orchestrate the immune response of mammals through production of soluble factors that act 
on other immune system cells, including other T cells. Most mature CD4 + T helper cells 
express one of two cytokine profiles: Thl or Th2. Thl cells secrete 1L-2, IL-3, IFN-y, 
TNF-P, GM-CSF and high levels of TNF-a. Th2 cells express IL-3, EL-4, IL-5, IL-6, IL-9, 
IL-10, IL-13, GM-CSF and low levels of TNF-a. The Thl subset promotes delayed-type 
hypersensitivity, cell-mediated immunity, and immunoglobulin class switching to IgG a . 



16 



WO 98/40100 



PCT/US98/04703 



The Th2 subset induces humoral immunity by activating B cells, promoting antibody 
production, and inducing class switching to IgG, and IgE. 

Several factors have been shown to influence commitment to Thl or Th2 profiles. 
The best characterized regulators are cytokines. IL-12 and IFN-y are positive Thl and 
negative Th2 regulators. IL-12 promotes IFN-y production, and IFN-y provides positive 
feedback for IL-1 2. IL-4 and EL- 10 appear to be required for the establishment of the Th2 
cytokine profile and to down-regulate Th 1 cytokine production; the effects of IL-4 arc in 
some cases dominant over those of EL-12. IL-13 was shown to inhibit expression of 
inflammatory cytokines, including IL-12 and TNF-a by LPS-induced monocytes, in a way 
similar to IL-4. The IL-12 p40 homodimer binds to the IL-12 receptor and antagonizes 
IL-12 biological activity; thus it blocks the pro-Thl effects of IL-12. 

This invention further provides administering to a subject having or at risk of having 
an virally mediated disorder, a therapeutically effective dose of a pharmaceutical 
composition containing the compounds of the present invention and a pharmaceutical^ 
acceptable carrier. "Administering" the pharmaceutical composition of the present 
invention may be accomplished by any means known to the skilled artisan. 

The pharmaceutical compositions according to the invention are in general 
administered topically, intravenously, orally, parenterally or as implants, and even rectal use 
is possible in principle. Suitable solid or liquid pharmaceutical preparation forms are, for 
example, granules, powders, tablets, coated tablets, (micro)capsules, suppositories, syrups, 
emulsions, suspensions, creams, aerosols, drops or injectable solution in ampule form and 
also preparations with protracted release of active compounds, in whose preparation 
excipients and additives and/or auxiliaries such as disintegrants, binders, coating agents, 
swelling agents, lubricants, flavorings, sweeteners or solubilizers are customarily used as 
described above. The pharmaceutical compositions are suitable for use in a variety of drug 
delivery systems. For a brief review of present methods for drug delivery, see Langer, 
Science 249:1527-1533, 1990, which is incorporated herein by reference. 



17 



WO 98/40100 



PCT/US98/04703 



The pharmaceutical compositions are preferably prepared and administered in dose 
units. Solid dose units are tablets, capsules and suppositories. For treatment of a patient, 
depending on activity of the compound, manner of administration, nature and severity of the 
disorder, age and body weight of the patient, different daily doses are necessary. Under 
certain circumstances, however, higher or lower daily doses may be appropriate. The 
administration of the daily dose can be carried out both by single administration in the form 
of an individual dose unit or else several smaller dose units and also by multiple 
administration of subdivided doses at specific intervals. 

The pharmaceutical compositions according to the invention may be administered 
locally or systemically. By "therapeutically effective dose" is meant the quantity of a 
compound according to the invention necessary to prevent, to cure or at least partially arrest 
the symptoms of the disorder and its complications. Amounts effective for this use will, of 
course, depend on the severity of the disease and the weight and general state of the patient 
Typically, dosages used in vitro may provide useful guidance in the amounts useful for in 
situ administration of the pharmaceutical composition, and animal models may be used to 
determine effective dosages for treatment of particular disorders. Various considerations are 
described, e.g., in Gilman et a/., eds., Goodman And Gilman's: The Pharmacological Bases 
QfTterepeutics, 8th ed., Pergamon Press, 1990; and Remington's Pharmaceutical Sciences. 
17th ed., Mack Publishing Co., Easton, Pa., 1990, each of which is herein incorporated by 
reference. 

The following examples are intended to illustrate but not to limit the invention in any 
manner, shape, or form, either explicitly or implicitly. While they are typical of those that 
might be used, other procedures, methodologies, or techniques known to those skilled in the 
art may alternatively be used. 



18 



WO 98/40100 



PCT/US98/04703 



EXAMPLES 

Here we evaluate the use of CpG ODN as an adjuvant for immunization of mice 
against hepatitis B virus surface antigen (HbsAg) given as a recombinant protein or 
expressed in vivo from a DNA vaccine. 

Compared with the recombinant protein vaccine alone, addition of either CpG ODN 
or alum alone resulted in a 10-100 fold increase in the level of antibodies against HBsAg 
(anti-HBs). However when used together, these two adjuvants resulted in 500-1000 times 
higher levels of anti-HBs, indicating a strong synergistic response. Immunization with 
HBsAg alone or with alum resulted in a strong Th2-type response with almost all IgG being 
of the IgGl isotype. CpG ODN induced a high proportion of IgG2a, indicative of a Thl-type 
response, even in the presence of alum. 

DNA "vaccines" also induce potent Thl-type immune responses and this is likely 
due in large part to the presence of CpG motifs in the bacterially-derived plasmid DNA. We 
show here that responses are further augmented by the addition of CpG ODN to the DNA 
vaccine. The DNA vaccine but not the protein subunit vaccine was able to induce anti-HBs 
in mice injected on the day of birth. A combination approach of DNA prime and protein 
boost appears to be particularly effective for vaccination purposes, although a sufficient 
period (>2 weeks) must elapse before a boosting response is seen. These studies 
demonstrate that the addition of CpG ODN to protein or DNA vaccines is a valid new 
adjuvant approach to improve efficacy. 

MATERIALS AND METHODS 

Animals 

Experiments on adult mice were carried out using female BALB/c (H-2 d , good 
responder), C57BL/6 (B10, H-2 b , fair responder) and B10.S (H-2 $ ,MHC-restricted 
hypo-responder to HBsAg) mice (Charles River, Montreal, QC) at 6-8 weeks of age. Mice 
with class II MHC deficiency (C2D, H-2 b , GenPharm, Mountain View, CA) due to gene 
knockout were used as a model of a non-responder. 

19 



WO 98/40100 



PCT/US98/04703 



Newborn mice were obtained through breeding male and female BALB/c mice 
(Charles River) in our own animal facility (Locb Research Institute, Ottawa Civic Hospital, 
Ottawa, ON). Pregnant females were monitored daily to ensure accurate recording of the 
date of birth. Both male and female neonates were used for immunization. 

HbsAg subonit vaccination of mice 

The subunit vaccine consisted of HBsAg (ay subtype) which had been produced as a 
recombinant protein in yeast cells (Medix Biotech #ABH0905). This was diluted in saline 
for use without adjuvant. HBsAg was also formulated with alum and/or CpG ODN as 
adjuvant HBsAg protein was mixed with aluminum hydroxide (Alhydrogel 85, [AI 2 0 3 ], 
Superfos Biosector, Vedbaek, Denmark) in the same ratio of 25 mg Al 3 * per mg protein as 
used in the commercial vaccines (i.e., 2.5 1 2% Al 2 0 3 per g HBsAg). The protein and alum 
were mixed with a vortex and then left on ice for at least 30 minutes prior to use to allow the 
protein to adsorb onto the A1 2 0 3 . This solution was mixed again immediately prior to 
injection by drawing up into the syringe 3-5 times. 

For groups treated with CpG ODN, an appropriate volume of synthetic 
oligodeoxynucleotide (ODN #1 826) of the sequence TCCATGACGTTCCTGACGTT synthesized 
with a phosphorothioate backbone (Oligos Etc. & Oligo Therapeutics, Wilsonville, OR) was 
added alone or with alum to HBsAg on the day of injection. Adult mice received a single 
intramuscular (IM) injection into the left tibialis anterior (TA) muscle of 1 or 2 g HBsAg, 
without or with adjuvant (alum and/or CpG ODN), in 50 1 vehicle. When CpG DNA was 
added, each animal received a total of 1 , 1 0, 1 00 or 500 g ODN. Newborn mice were 
immunized within 24 hours of birth or 7 days after birth by bilateral injection of a total of 
1 g HBsAg into the posterior thigh muscles (2 x 1 0 1 @ 0.05 mg/ml). All injections were 
carried out with a 0.3 ml insulin syringe which has a fused 29G needle (Becton Dickenson, 
Franklin Lakes, NJ). For injection of adults, the needle was fitted with a collar of 
polyethylene (PE) tubing to limit penetration of the needle to about 3 mm. All intramuscular 
injections were carried out through the skin (unshaved) and under general anesthesia 
(Halothane, Halocarbon Laboratories, River Edge, NJ). 

20 



WO 98/40100 



PCI7US98/04703 



DNA-based immunization of mice 

Mice were immunized against HBsAg using plasmid constructs encoding the major 
protein (S) of the HBV envelope. The plasmid pCP 10, containing two copies of the HBV 
genome (ayw subtype; GeneBank reference HPBAYW) as a head-to-tail fusion (Dubois 
et al, 1980), was the source of the envelope coding sequences and the 3* untranslated 
sequences which include the viral polyadenylation signal. A 1.9 kb Xhol-BglU restriction 
fragment from pCPIO (containing the S coding sequences) was cloned into the 
corresponding sites of a modified p Bluescript SK vector containing extra restriction sites in 
the polylinker (kindly provided by Dr. ShahragimTajbakhsh, Pasteur Institute), A 
Kpnl-BssHR restriction fragment was then removed and cloned into the pRc/CMV 
expression vector (Invitrogen) using the Kpn\ site of the polylinker and the BssHR site 
within the neomycin gene of the vector. This cloning step places the envelope sequences 
under the control of the CM V promoter and removes the bovine growth hormone 
polyadenylation sequences, the fl origin, the SV40 promoter and origin, and most of the 
neomycin gene. An SV40 polyadenylation signal from the pRc/CMV vector is found after 
the transcribed HBV sequences. This construct has been described previously (Davis et a/., 
1993) and is designated here as pCMV-S. 

DNA was purified on Qiagen anion-exchange chromatography columns (Qiagen 
GmbH, Hilden, Germany). This method, which yields predominantly supercoiled, 
double-stranded, closed circular DNA, results in virtually no contamination with 
chromosomal DNA, RNA or protein and very low contamination with endotoxin. The DNA 
was resuspended in sterile saline (0.1 5M NaCl, BDH) and the concentration of DNA was 
calculated based on absorbance of ultraviolet light (OD 260). The final concentration was 
adjusted to 0.1 to 1 mg/ml and the DNA solutions were stored at -20C until required for 
injection. 

Direct gene transfer in adult mice was carried out by unilateral or bilateral IM 
injection into the TA muscle of DNA in 50 1 such that each animal received a total of 1, 10 
or 100 g DNA. Newborn mice received a total of 10 g DNA by bilateral injection into the 

21 



WO 98/40100 



PCT/US98/04703 



posterior thigh muscles (2 x 10 1 @ 0.5 mg/ml). Injections were with a 0.3 ml insulin syringe 
which has a fused 29G needle, and for injection of adults the needle was fitted with a collar 
of PE tubing to limit penetration of the needle to about 2 mm. All intramuscular injections 
were carried out (through shaved skin for adults) under general anesthesia (Halothane) 

Experimental groups 

Comparison of alum and CpG ODN as adjuvant, with HBsAgsubunit vaccine 

Six groups of adult BALB/c mice (n=l0) were injected with 1 g HBsAg (i) alone, 
Qi) mixed with alum, (iii) mixed with 1 00 g CpG ODN, or (iv, v, vi) mixed with both alum 
and 10, 100 or 500 g CpG ODN. These mice were bled at 1, 2, 3 and 4 weeks after 
immunization and the plasma was assayed for anti-HBs. Groups of adult C57BL/6 (B10), 
B10.S and C2D mice (n=5) were injected 1 g HBsAg (i) alone, (ii) mixed with alum, (iii, iv, 
v) mixed with 1, 10 or 100 g CpG ODN, or (vi, vii) mixed with both alum and 10 or 100 g 
CpG ODN. Each animal was boosted by the identical procedure at 6 weeks. The mice were 
bled at 1 , 2, 4, 6 and 8 weeks after immunization and the plasma was assayed for anti-HBs. 

Use of CpG ODN as adjuvant, with HBsAg-expressing DNA vaccine 

Three groups of adult BALB/c mice (n=10) were injected with a total of 10 g 
pCMV-S DNA alone or with 100 or 500 g CpG ODN added, divided between two injection 
sites. Groups of hypo-responder (B10.S) and congenic (B10) mice (n=10) were immunized 
with 50 g pCMV-S DNA divided between two sites. 

Immunization of neonates with subunit or DNA vaccine 

Groups of newborn BALB/c mice (n=10) aged <24 hours or 7 days were injected 
with a total of 1 g HBsAg with alum or with 1 0 g pCMV-S DNA. Plasma was obtained at 4, 
8, 12 and 16 weeks for assay of anti-HBs. 



22 



WO 98/40100 



PCT/US98/047G3 



Combined DNA prime with protein boost 

Five groups of BALB/c mice (n=10) were first immunized with a single injection 
into the left TA of 10 g pCMV-S, and received (i) no other treatment, or received 2 g pure 
HBsAg (no adjuvant) (ii) at the same time at the same site, (iii) at the same time and at a 
different site (left quadriceps), (iii) 2 weeks later at the different site or (iv) 8 weeks later at 
the different site. Mice were bled at 1, 2 r 4, 6, 8, 12, 20 and 24 weeks. 

Evaluation of immune response to HbsAg 

Heparinized blood was collected by retrobulbar puncture of lightly anaesthetized 
mice as described elsewhere (Michel et al , 1 995). Plasma was recovered by centrifugation 
(7 min @ 13,000 rpm). Antibodies specific to HBsAg in plasma were detected and 
quantified by end-point dilution ELIS A assay (in triplicate) on individual samples. Ten-fold 
serial dilutions of plasma were first added to 96-well microtiter plates with a solid phase 
consisting of plasma-derived HBsAg particles (100 1/well of HBsAg ay subtype at 1 gfail, 
coated overnight at RT) and incubated for 1 hr at 37C. The bound antibodies were then 
detected by incubation for 1 hr at 37C with HRP-conjugated goat anti-mouse IgG, IgM, 
IgGl or IgG2a (1:4000 in PBS-Tween, 10%FCS; 100 1/well, Southern Biotechnology Inc., 
Birmingham, AL), followed by incubation with OPD solution (100 1/well, Sigma, St Louis, 
MO) for 30 minutes at RT in the dark. The reaction was stopped by the addition of sulfuric 
acid (50 1 of 4N H 2 S0 4 ). End-point titers were defined as the highest plasma dilution that 
resulted in an absorbance value (OD 450) two times greater than that of non-immune plasma 
with a cut-off value of 0.05. Anti-HBs titers were expressed as group means of individual 
animal values, which were themselves the average of triplicate assays. 



23 



WO 98/40100 



PCT/US98/04703 



RESULTS 

CpG ODN versus alum as adjuvant for HBV subunit vaccine 

Strength and kinetics of humoral response 

Immunization of BALB/c mice with HBsAg alone elicited only low titers of 
anti-HBs (<100) by 4 weeks. These titers were 10-fold higher with the addition of alum as 
adjuvant, 60-fold higher with CpG ODN and more than 500-fold higher with both alum and 
CpG ODN (FIG. 1). When combined with alum, there is a dose-response for CpG ODN 
with the best results being obtained witlvan intermediate dose (100 g) and similar some what 
poorer results being obtained with lower and higher doses (10 or 500 g) (FIG. 2). 
Nevertheless, all doses of CpG ODN greatly improved the titers compared to alum alone. 

In the C57BL/6 strain of mouse, antibody titers 4 weeks after HBsAg prime were 
about 10-times lower than those seen in BALB/c mice, but when boosted at 6 weeks rose to 
similar levels within 2 weeks. When used alone, alum and CpG ODN (100 g) each 
augmented the humoral response about 100-fold but when used together increased titers 
about 1000-fold. A dose-response for CpG ODN was also noted in these mice (in the 
absence of alum) with 100 g being superior to either 10 or 1 g, although all doses had an 
adjuvant effect (FIG. 4). 

In the hypo-responder B10.S mice no anti-HBs antibodies were detected with 
HBsAg alone and low titers were obtained if either CpG ODN or alum are added. The use of 
alum and CpG together gives the best result although the synergy is less evident than in the 
BALB/c and C57BL/6 mice (FIG. 5). Non-responder (C2D) mice have no detectable 
anti-HBs after immunization with HBsAg alone. There are low levels of IgM with addition 
of alum and this is increased 4-fold with further addition of CpG ODN. There is essentially 
no detectable IgG after injection of HBsAg + alum, but low titers with both alum and CpG 
ODN (FIG. 6). Treatment with CpG DNA was well tolerated by all mice, even those 
receiving the 500 g dose. There was no apparent ruffling of fur, diarrhea or other signs of 
toxicity. 

24 



WO 98/40100 



PCT/US98/047Q3 



Thl versus Th2 responses 

Immunization with either HBsAg alone or with alum induces a predominantly 
Th2-type humoral response with almost all (>99%) antibodies being of the IgGl isotype. 
CpG ODN induces significantly more IgG2a antibodies, which are indicative of a Thl-type 
response, although IgGl still predominate. Remarkably, the combination of alum and CpG 
ODN induces about ten-times more IgG2a than IgGl , indicating a real shift from Th2 to Thl 
(FIG. 7). 

CpG ODN as adjuvant to HBV DNA vaccine 

DNA vaccines induced higher levels of anti-HBs more rapidly than did HBsAg, even 
when alum was included (compare FIG.S 1 and 8). Addition of CpG ODN to the pCMV-S 
DNA vaccine increased anti-HBs titers a further five-fold by 4 weeks. The 500 g dose was 
slightly better than the 100 g dose (FIG. 8). The DNA vaccine was also superior to the 
HBsAg subunit vaccine in hypo-responder mice. A single injection of DNA induced earlier 
appearance of anti-HBs, and these reached higher titers than with two doses of protein given 
at 0 and 4 weeks (FIG. 9). 

Antigen versus DNA-based immunization of neonates 

Mice immunized with HBsAg plus alum on the day of birth had no detectable 
anti-HBs even up to 16 weeks later. In contrast, those injected with the DNA vaccine had 
low levels of anti-HBs by 4 weeks and a good titer (10 3 ) by 16 weeks. Immunization of 
7 day old mice with either DNA or protein induced anti-HBs, although these appeared much 
earlier and were much higher with the DNA vaccine. In fact, the DNA vaccine at one day 
was superior to the protein vaccine given at 7 days (FIG. 10). 

Combined DNA- and antigen-based immunization 

Co-administration of pure recombinant HBsAg and the DNA vaccine at either the 
same or different sites did not significantly improve titers of anti-HBs over those induced by 
the DNA vaccine alone. Nor was a boosting response seen when the HBsAg protein was 
given two weeks after the DNA vaccine. However, administration of the protein vaccine 

25 



WO 98/40100 



PCT/US98/04703 



8 weeks after the DNA vaccine gave a strong boosting response with titers increasing more 
than 10-fold over those with the DNA vaccine alone (FIG. 1 1). 

DISCUSSION 

CpG ODN versus alum as adjuvant with H BV subunit vaccine in mice 

CpG ODN is as good as or superior to alum when each is used alone as adjuvant 
with the HBsAg subunit vaccine in mice. This indicates that CpG ODN could be used to 
replace alum in vaccine formulations, which could be desirable to avoid associated 
side-effects due to local irritation in the muscle. Furthermore, for certain live-attenuated or 
multivalent vaccines, it is not possible to use alum which through chemical interactions 
interferes with the efficacy of the vaccine. This should not occur with CpG ODN. 

Of even greater interest is the strong synergistic response when CpG ODN and alum 
are used together to adjuvant the HBsAg subunit vaccine. In humans, this could result in a 
much higher proportion of individuals attaining protective titers of anti-HBs after two or 
possibly even one dose of vaccine. Furthermore, protective titers should be reached more 
quickly and this would be beneficial for immunization in endemic areas. There is a fairly 
weak dose response to CpG ODN whether or not alum is present, indicating that a wide 
range of CpG ODN could be useful to adjuvant vaccines in humans. 

CpG ODN induces Thl response even in presence of alum 

Aluminum hydroxide (alum) is currently the only adjuvant approved for human use. 
An important disadvantage of alum is that it induces a Th2- rather than a Thl -type immune 
response, and this may interfere with induction of CTL. Indeed, in mice immunized with 
recombinant HBsAg, the addition of alum selectively blocked activation of CD8 + CTL 
(Schirmbeck et al, 1994). Although not essential for protective immunity against HBV, 
CTL may nevertheless play an important role. For example, a lack of HBV-specific CTL is 
thought to contribute to the chronic carrier state. In contrast, one of the primary advantages 
of CpG DNA over alum as an adjuvant is the Th 1 -bias of the responses and thus the 

26 



WO 98/40100 



PCT/US98/04703 



possibility to induce CTL. A striking finding from the present study is that CpG can 
completely counteract the Th2-bias of alum when the two adjuvants are delivered together. 
This could allow one to capitalize on the strong synergistic action of the two adjuvants on 
the humoral response while still allowing CTL. 

The use of alum has been linked to Th2-type diseases. The much higher prevalence 
of asthma (another Th2-type disease) in more highly developed nations may be linked to the 
high hygiene level and rapid treatment of childhood infections (Cookson and Moffatt, 1997). 
Early exposure to bacterial DNA (and immunostimulatory CpG motifs) pushes the immune 
system away from Th2- and towards a Thl -type response and this may account for the lower 
incidence of asthma in less developed countries, where there is a much higher frequency of 
upper respiratory infections during childhood. Addition of CpG ODN as adjuvant to all 
pediatric vaccines could re-establish a Thl -type response thereby reducing the incidence of 
asthma. 

CpG dinucleotides and DNA vaccines 

More recently however, it has been shown that the presence of unmethylated CpG 
motifs in the DNA vaccines is essential for the induction of immune responses against the 
antigen, which is expressed only in very small quantities (Sato et al , 1996). As such, the 
DNA vaccine provides its own adjuvant in the form of CpG DNA. Since single-stranded but 
not double-stranded DNA can induce immunostimulation in vitro (Krieg et al y unpublished 
observation), the CpG adjuvant effect of DNA vaccines in vivo is likely due to 
oligonucleotides resulting from plasmid degradation by nucleases. Only a small portion of 
the plasmid DNA injected into a muscle actually enters a myofiber and is expressed, the 
majority of the plasmids is degraded in the extracellular space. 

CpG and HBV vaccines for human use 

Prophylactic vaccine 

Fewer than 20% of healthy individuals attain protective levels of anti-HBs 
(10 mlU/ml) after a single dose of subunit HBV vaccine and only 60-70% reach this level 

27 



WO 98/40100 



PCI7US98/04703 



after two doses. Thus, three doses (usually given at 0, 1 and 6 months) are required to 
seroconvert >90% of vaccinated individuals. The three dose regime is frequently not 
completed owing to poor patient compliance, and in endemic areas, protective levels may 
not be induced quickly enough. Thus there is a need for a prophylactic vaccine that can 
induce protective immunity more quickly and with fewer doses. This might be possible with 
the addition of CpG ODN as an adjuvant to the subunit vaccine. Another possibility is an 
HBsAg-expressing DN A vaccine, which could be optimized by addition of CpG 
dinucleotide motifs. DNA vaccines would offer additional advantages such as relatively low 
cost and ease of manufacturing, and heat-stability which circumvents the requirement for a 
cold-chain. 

Neonates bom in endemic areas require particularly rapid induction of strong 
HBV-specific immunity owing to the high rate of chronicity resulting from infection at a 
young age. Without immunoprophylaxis, 70-90% of infants bom to mothers positive for 
both HBsAg and the e antigen (HBeAg) become infected and almost all of these become 
chronic carriers (Stevens et al , 1987). Even when vaccinated with a four dose regime of the 
HBV subunit vaccine commencing on the day of birth, 20% of such infants became 
chronically infected and this was reduced to only 15% if they were also given HBV-specific 
immunoglobulin (Chen et al , 1996). Subunit or DNA vaccines with CpG adjuvant should 
reduce this further owing to a more rapid appearance and higher titers of anti-HBs 
antibodies and the induction of HBV-specific CTL, which could help clear virus from the 
liver of babies infected in utero, and which likely account for most of the failures with 
neonatal vaccination. DNA vaccines could be particularly effective if coupled with a protein 
boost 

Non-responders and hypo-responders 

Between 5 and 10% of individuals are non-responders or hypo-responders to the 
subunit HBsAg vaccine. This may be MHC-restricted (Kruskall et al t 1992) and is thought 
to result from a failure to recognize T-helper epitopes. In certain immunocompromised 
individuals (e.g., kidney dialysis patients, alcoholics) the rate of non-response can approach 

28 



WO 98/40100 



PCT/US98/04703 



50%. In the present study, alum plus CpG ODN gave higher anti-HBs titers than alum alone 
in a strain of mice which has MHC-restricted hypo-responsiveness to HBsAg, thought to 
result in a failure to recognize T-helper epitopes. CpG ODN also overcame non-response in 
mice genetically incapable of providing T-help owing to an absence of class H MHC 
(Milich, 1988). These results support the in vitro finding that CpG ODN drives the T cell 
independent activation of B cells. Use of CpG DNA as an adjuvant may increase the 
response rate to HBsAg in humans. A link between MHC phenotype and 
non-responsiveness to HBsAg has been demonstrated in humans (Kruskail et a/., 1992). 

Chronic carriers of HBV 

HBV chronicity results in 10-15% of individuals infected as adolescents or adults, 
but 90-95% for those infected (either vertically or horizontally) as infants. HBV chronicity 
eventually leads to cirrhosis and increased risk of hepatocellular carcinoma and an estimated 
one million people die each year from HBV-related liver disease. Persistent HBV infection 
of the liver results when acute infection fails to launch an appropriate immune response to 
clear the virus. Such chronic carriers have circulating HBsAg and HBV core antigen 
(HBcAg/HBeAg) without specific immunity. It is thought that the absence of HBV-specific 
CTL may contribute to the establishment and maintenance of the chronic carrier state. 
Indeed, many previously infected individuals, even years after clinical and serological 
recovery, have traces of HBV in their blood and HBV-specific CTL that express activation 
markers indicative of recent contact with antigen (Rehermann et ai, 1996). These results 
suggest that sterilizing immunity may not occur after HBV infection and that chronic 
activation of CTL is responsible for keeping the virus under control. 

There is currently no cure for the HBV chronic infection. Interferon is used currently 
but this cures only 10-20% of treated individuals (Niederau et al, 1996). Anti-viral drugs 
(e.g., lamivudine) can reduce circulating virus to undetectable levels, however these return 
to pretreatment levels if the drug is stopped. Each of these types of treatment is also 
expensive and has certain undesirable side-effects. 



29 



WO 98/40100 



PCT/US98/04703 



The possibility to induce a strong Th 1 -type response with CpG ODN added to a 
subunit vaccine may help overcome the chronic carrier state. For this application, it might 
be desirable to include additional B and T cell epitopes encoded by other domains of the 
HBV envelope protein (e.g., pre-Sl and pre-S2). Since the pre-Sl polypeptide may prevent 
secretion, it might be desirable to encode a truncated version of this such as that described 
by U et al. (1 994) with only amino acids 2 1 -47 which include the hepatocyte 
receptor-binding site and induce anti-preSl immune responses yet still maintain particle 
secretion. Repeated doses of a subunit vaccine containing the middle HBV envelope protein 
(preS2 + S) reduced viral replication in 50% of vaccinated chronic carriers (Pol efal. , 
1993). Addition of CpG ODN would presumably improve these results through its strong 
Thlbias. 

A DNA vaccine might also prove very effective as a therapeutic vaccine for HBV 
chronic carriers. We have previously shown that an HBsAg-expressing DNA vaccine could 
break tolerance to HBsAg in transgenic mice expressing HBsAg in the liver from before 
birth (Mancini et al. , 1996). This response appears to be mediated by T cells via a non-lytic 
mechanism Addition of CpG dinucleotide motifs that preferentially induce Thl cytokines 
and strong CTL responses could further improve DNA vaccines for application to HBV 
chronic carriers. 

CONCLUSION 

ODN containing CpG dinucleotides, in the proper base context to cause immune 
activation, are useful as an adjuvant to protein vaccines (whole pathogen or subunit). The 
CpG ODN could be used alone or in combination with alum. Used alone, it will allow the 
possibility to adjuvant vaccines that cannot be mixed with alum (e.g., live attenuated 
pathogens, multivalent vaccines). Used together, it will capitalize on the synergistic effect t< 
induce very potent immune responses, yet still maintain the Thl bias of CpG DNA. CpG 
dinucleotides also act to adjuvant DNA vaccines. Additional CpG given as ODN or cloned 
into the plasmid vector could further augment immune responses. 



30 



WO 98/40100 PCT/US98/04703 



With respect to vaccines against HBV, CpG ODN could be added as an adjuvant to 
recombinant HBsAg subunit vaccines, either alone or in combination with alum, or can be 
cloned into an HBsAg-expressing DNA vaccine. These improved vaccines can (i) induce 
higher titers more quickly and reduce the number of doses required to induce protective 
immunity from three to two, (ii) overcome hypo- or non- responsiveness to HBsAg, (iii) 
control the chronic carrier state through induction of CTL, and (iv) induce rapid and 
stronger immunity in neonates in HBV endemic areas. 



31 



WO 98/40100 PCT/US98/04703 - 

REFERENCES 

ChenD.S. etal. (1996). Cancer Causes & Control! : 305-311. 
Cookson, W.O.C.M. & Mof&tt, M.F. (1997). Science 275: 41-42. 
Cowdery, J.S. etal (1996). J. Immunol 156: 4570. 
Davis, Hi. et al. (1993). Human Molec. Genet. 2: 1847-1851. 
Davis, Hi. et al (1995). Human Gene Ther. 6: 1447-1456. 
Davis, H.L. et al (1996). Proc. Natl Acad. Set USA 93: 7213-7218. 
Davis, H.L. et al (1996). Vaccine 14: 910-915. 
Davis, Hi. et al (1997). Gene Ther. (in press). 

Davis, Hi. & Brazolot Millan, C.L. (1997). Blood Cell Biochem. (in press) 

Donnelly, J.J. et al. (1996). Life Sciences. 60: 163-172. 

Dubois, M.-F. et al. (1980). Proc. Natl. Acad Set USA 11: 4549-4553. 

Ellis, R. W. (Ed.) (1993). Hepatitis B Vaccines in Clinical Practise. New York: 
Marcel-Dekker. 

Halpem, M.D. et al. (1996). Cell. Immunol. 167: 72. 

Klinman, D.M. et al. (1996). Proc. Natl Acad Sci. USA 93: 2879-2883. 

Krieg, A.M. et al. (1995). Nature 374: 546-549. 

Kniskall, M.S. etal (1992). J. Exp. Med 175: 495-502. 

Li etal. , (1994). J. Gen. Virol. 75: 3673-3677. 

Mancini, M. et al (1996). Proc. Nad. Acad ScL USA 93: 12496-12501. 

32 



WO 98/40100 



PCT/US98/D4703 ~ 



Michel M-L.e/o/. (1984) Proc. Natl. Acad. Sci. USA 81: 7708-7712. 
Michel, M.-L. et al. (1995). Proc. Natl. Acad. Sci. USA 92: 5307-53 11. 
Milich, D.R. (1988). Immunol Today 9: 380-386. 
Niederauef al. (1996). New Eng. J. Med. 334: 1422-1427. 
Pol, S. etal. (1993). C. R. Acad Sci. (Paris) 316: 688-691. 
Rehennann, B. et al. (1996). Nature Med. 2: 1 104-1 108. 

Sato, Y., et al. (1996). Science 273: 352-354. 

Schiimbeck, R. e/ a/- (1994). J. Immunol. 1 52: 1 1 10-1 1 19. 

Stevens, CZ. et al. (1987). J. Am. Med Assoc. 257: 2612-2616. 

Vogel, F.R. & Sarver, N. (1995). Clin. Microbiol Rev. 8: 406-410. 



33 



WO 98/40100 



PCT/US98/04703 



1 . A method of inducing an immune response in a subject, said method comprising: 

administering to the subject a therapeutically effective amount of nucleic acid 
encoding an antigenic polypeptide, and a therapeutically effective amount of an 
oligonucleotide containing at least one unmethylated CpG dinucleotide. 

2. The method of claim 1, wherein the oligonucleotide is from 8-30 bases in length. 

3. The method of claim 1 , wherein the subject is human. 

4. The method of claim 1, wherein said nucleic acid encoding an antigenic protein and an 
effective amount of an oligonucleotide containing at least one unmethylated CpG 
dinucleotide are administered in a vector. 

5. The method of claim 1 , wherein said nucleic acid encoding an antigenic protein encodes 
viral antigen. 

6. The method of claim 5, wherein said viral antigen is a hepatitis viral antigen. 

7. The method of claim 6, wherein said hepatitis viral antigen is a hepatitis B virus surface 
antigen. 

8. The method of claim 1, further comprisimg administering an adjuvant. 

9. The method of claim 8, wherein the adjuvant is aluminum hydroxide. 

10. The method of claim 1, wherein the oligonucleotide has a formula: 
S-N.X.CGXiN^' (SEQ ID NO: 1 ) 

wherein at least one nucleotide separates consecutive CpGs; X, is adenine, guanine, or 
thymidine; X 2 is cytosine or thymine, N is any nucleotide and N, + N 2 is from about 0-: 
bases. 



34 



WO 98/40100 



PCI7US98/04703 



U. The method ofclaim 10, wherein N, and N 2 do not contain a CCGG quadmer or 
more than one CGG trimer, and the nucleic acid sequence is from ab ut 8-30 
bases in length. 

12. The method ofclaim 1, wherein the oligonucleotide has a formula: 
5' N.X.XjCGXjX^ 3' (SEQ ID NO:2) 

wherein at least one nucleotide separates consecutive CpGs; X,X 2 is selected from the 
group consisting of GpT, GpG, GpA, ApT and ApA; X 3 X« is selected from the group 
consisting of TpT or CpT; N is any nucleotide and N, + N, is from about 0-26 bases. 

13. . The method ofclaim 12, wherein N, and N 2 do not contain a CCGG quadmer or 

more than one CCG or CGG trimer, and the nucleic acid sequence is from about 
8-30 bases in length. 

1 4. The method of claim 1 2, wherein said oligonucleotide is 5 - 
TCCATGACGTTCCTGACGTT-3' (SEQ ID NO:3). 

1 5. The method of claim 1 , said further comprising: 

administering to the subject an therapeutically effective amount of the antigenic 
polypeptide. 

16. A method for treating a subject having or at risk of having a viral-mediated 
disorder, comprising administering to the subject a therapeutically effective 
amount of a nucleic acid encoding an antigenic polypeptide and an effective 
amount of an oligonucleotide containing at least one unmethylated CpG 
dinucleotide. 

17. The method ofclaim 16, wherein the oligonucleotide is from 8-30 bases in length. 

18. The method ofclaim 16, wherein the subject is human. 



35 



WO 98/40100 



PCT/US98/04703 



19. The method of claim 16, wherein said nucleic acid encoding an antigenic protein 
and an effective amount of an oligonucleotide containing at least one 
unmethylated CpG dinucleotide are administered in a vector. 

20. The method of claim 16, said further comprising administering to the subject an 
therapeutically effective amount of the antigenic polypeptide . 

21. The method of claim 16, wherein said nucleic acid encoding an antigenic 
polypeptide encodes a viral aniigen. 

22. The method of claim 20, wherein said viral antigen is a hepatitis antigen. 

23. The method of claim 22, wherein said hepatitis antigen is a hepatitis B surfece 
antigen. 

24. The method of claim 16, further comprisimg administering an adjuvant 

25. The method of claim 24, wherein the adjuvant is aluminum hydroxide. 

26. The method of claim 16, wherein the oligonucleotide has a formula: 
5 , N,X 1 CGX I N 2 3' (SEQ ID NO: I) 

wherein at least one nucleotide separates consecutive CpGs; X, is adenine, guanine, or 
trrymidine; X 2 is cytosine or thymine,N is any nucleotide and N, + N 2 is from about 0-26 
bases. 

27. The method of claim 26, wherein N, and N 2 do not contain a CCGG quadmer or 
more than one CGG trimer, and the nucleic acid sequence is from about 8-30 
bases in length. 



36 



WO 98/40100 PCT/US98/04703 

28. The method of claim 16, wherein the oligonucleotide has a formula: 
5' N,X,X 2 CGX^N 2 3' (SEQ ID NO:2) 

wherein at least one nucleotide separates consecutive CpGs; X,X 2 is selected from the 
group consisting of GpT, GpG, GpA, ApT and ApA; X, X, is selected from the group 
consisting of TpT or CpT; N is any nucleotide and N, + N 2 is from about 0-26 bases. 

29. The method of claim 28, wherein N, and N 2 do not contain a CCGG quadmer or 
more than one CCG or CGG t rimer; and the nucleic acid sequence is from about 
8-30 bases in length. 

30. The method of claim 28, wherein said oligonucleotide is 5'- 
TCCATGACGTTCCTGACG1T-3' (SEQ IDNO:3). 

31. A method for treating a subject having or at risk of having a chronic viral 
infection, said method comprising administering to the subject an effective 
amount of a nucleic acid encoding an antigenic polypeptide and an effective 
amount of an oligonucleotide containing at least one unmethylated CpG 
dinucleotide. 



32. The method of claim 3 1 , wherein the oligonucleotide is from 8-30 bases in length. 

33. The method of claim 3 1 , wherein the subject is human. 

34. The method of claim 3 1 , said further comprising administering to the subject an 
therapeutically effective amount of the antigenic polypeptide . 

35. The method of claim 3 1 , further comprisimg administering an adjuvant. 

36. The method of claim 34, wherein the adjuvant is diirninum hydroxide. 

37. The method of claim 3 1 , wherein said antigenic protein is a viral antigen. 



37 



WO 98/40100 



PCT/US98/04703 



38. The method of claim 37, wherein said viral antigen is a hepatitis viral antigen. 

39. The method of claim 38, wherein said hepatitis viral antigen is a hepatitis B 
surface antigen. 

40. The method of claim 31, wherein the oligonucleotide has a formula: 
SN^CGXJV 1 (SEQ ID NO: I) 

wherein at least one nucleotide separates consecutive CpGs; X, is adenine, guanine, or 
thymidine; X 2 is cytosine or thymine, N is any nucleotide and N, + N 2 is from about 0-26 
bases. 

41. The method of claim 40, wherein N, and N 2 do not contain a CCGG quadmer or 
more than one CGG trimer, and the nucleic acid sequence is from about 8-30 
bases in length. 

42. The method of claim 3 1 , wherein the oligonucleotide has a formula: 
y N^XjCGXjX^ 3' (SEQ ID NO:2) 

wherein at least one nucleotide separates consecutive CpGs; X,X 2 is selected from the 
group consisting of GpT, GpG, GpA, ApT and ApA; Xj X 4 is selected from the group 
consisting of TpT or CpT; N is any nucleotide and N, + N 2 is from about 0-26 bases. 

43. The method of claim 42, wherein N, and N 2 do not contain a CCGG quadmer or 
more than one CCG or CGG trimer, and the nucleic acid sequence is from about 
8-30 bases in length. 

44. The method of claim 42, wherei a said oligonucleotide is 
S'-TCCATGACGTrCCTGACGTrO* (SEQ ID NO:3). 



38 



WO 98/40100 PCT/US98/04703 

A pharmaceutical composition comprising an immumostimulaotry CpG 
oligonucietide and a nucleic acid encoding an antigenic protein in a 
phamaceuticaily acceptable carrier. 



39 



WO 98/40100 



PCT/US98/04703 



AMENDED CLAIMS 

[received by the International Bureau on 14 August 1998 (14.08.98); 
original claims 1-45 cancelled; new claims 1-136 added (15 pages)] 

I a method of inducing protective immune response in a subject having or at 

risk of having infection with an infections organism, said method comprising 
administering to the subject a therapeutically effective amount of an antigen, 
and a therapeutically effective amount of an oligonucleotide containing at 
5 least one unmethyiated CpG dinucleotide. 

2. The method of claim 1, wherein said infectious organism is a bacteria or a 
parasite. 

3. The method of claim 1, wherein said infectious organism is a virus. 

4. The method of claim 3, wherein said virus is a hepatitis virus. 

10 5. The method of claim 4, wherein said hepatitis virus is a hepatitis B vims, 

6. The method of claim 1, wherein the oligonucleotide is from 8-30 bases in 
length. 

7. The method of claim 1, wherein the oligonucleotide is contained within a 
plasmid made with a natural phosphodiester backbone. 

15 8. The method of claim 1 , wherein the oligonucleotide is made completely or 

partially with a synthetic backbone. 

9. The method of claim 8, wherein the oligonucleotide is made completely with 
a synthetic phosphorothioate backbone. 

10. The method of claim 8, wherein the oligonucleotide is made with a chimeric 
20 backbone with synthetic phosphorothioate linkages at the 3' and 5' ends and 

natural phosphodiester linkages in the CpG-containing center. 

-40- 



AMENDED SHEET (ARTICLE 19) 



The method of claim 10, wherein the said chimeric oligonucleotide is made 
with synthetic phosphorothioate linkages for five linkages at the 3' end and 
two linkages at the 5' end, and with natural phosphodiester linkages in 
between. 

The method of claim 1, wherein the oligonucleotide has a formula: 
5NlXlCGX2N23 f (SEQ ID NO: 1) wherein at least one nucleotide separates 
consecutive CpGs; XI is adenine, guanine or thymidine; X2 is cytosine or 
thymine; N is any nucleotide and Nl + N2 is from about 0-26 bases. 

The method of claim 12, wherein the Nl + N2 do not contain a CCGG 
quadmer or more than one CGG trimar, and the nucleic acid sequence is from 
about 8-30 bases in length. 

The method of claim 1, wherein the oligonucleotide has a formula: 
5 , N1X1X2CGX3X4N23 , (SEQ ID NO: 2) wherein at least one nucleotide 
separates consecutive CpGs; X1X2 is selected from the group consisting of 
GpT, GpG, GpA, ApT and ApA; X3X4 is selected from the group consisting 
of TpT and CpT; N is any nucleotide and Nl + N2 is from about 0-26 bases. 

The method of claim 14, wherein the Nl + N2 do not contain a CCGG 
quadmer or more than one CGG trimer, and the nucleic acid sequence is from 
about 8-30 bases in length. 

The method of claim 14, wherein said oligonucleotide is 
5 , -TCCATGACGTTCCTGACGTT-3' (SEQ ID NO:3), 

The method of claim 1 , wherein the antigen is a polypeptide. 

The method of claim 1 7, wherein said antigenic polypeptide is from a virus. 



-41- 

AMENDED SHEET (ARTICLE 19) 



WO 98/40100 PCT/US98/04703 



19, The method of claim 18, wherein said viral antigen is a hepatitis viral 
antigen. 

20. The method of claim 19, wherein said hepatitis viral antigen is a hepatitis B 
viral antigen. 

5 21. The method of claim 20, wherein said hepatitis B viral antigen is a hepatitis 

B virus surface antigen. 

22. The method of claim 1 , further comprising at least one additional adjuvant. 

23. The method of claim 22, wherein the additional adjuvant contains aluminum 
(alum). 

10 24. The method of claim 23, wherein the aluminum^ontaiiiing adjuvant is 

aluminum hydroxide. 

25. The method of claim 1, wherein the antigen and the CpG containing 
oligonucleotide are administered in a delivery vector or vehicle. 

26. The method of claim 1 , wherein the subject is a mammal. 

15 27. The method of claim 1, wherein the subject is a human. 

28. A method of inducing an immune response in a subject, said method 

comprising: administering to the subject a therapeutically effective amount 
of nucleic acid encoding an antigenic polypeptide, and a therapeutically 
effective amount of an oligonucleotide containing at least one unmethylated 
20 CpG dinucleotide. 



-42- 

AMENDED SHEET (ARTICLE 19) 



WO 98/40100 PCT/US98/04703 



29. The method of claim 28, wherein said immune response is to prevent 
infection by an infectious organism. 

30. The method of claim 29, wherein said infectious organism is a virus. 

3 1 . The method of claim 30, wherein said virus is a hepatitis virus. 

5 32. The method of claim 31, wherein said hepatitis virus is a hepatitis B virus. 

33. The method of claim 28, wherein said nucleic acid vector is a DNA vector 

34. The method of claim 33, wherein the CpG containing oligonucleotide is 
cloned into said vector. 

35. The method of claim 33, wherein said DNA vector is plasmid DNA. 

10 36. The method of claim 28, wherein the CpG-containing oligonucleotide is a 

separate entity from the antigen-encoding nucleic acid vector. 

37. The method of claim 36, wherein the CpG oligonucleotide is contained in a 
plasmid with a phosphodicster backbone. 

38. The method of claim 36, wherein said CpG-containing oligonucleotide has 
IS a partially synthetic backbone. 

39. The method of claim 38, wherein said oligonucleotide is made with a 
chimeric backbone with synthetic phosphorothioate linkages at the 3' and 5' 
ends and natural phosphodiester linkages in the CpG-containing center. 



-43- 

AMENDED SHEET (ARTICLE 19) 



WO 98/40100 PCT/US98/04703 



40. Hie method of claim 39, wherein said chimeric oligonucleotide is made with 
synthetic phosphorothioate linkages for five linkages at the 3' end and two 
linkages at the 5' end, and with natural phosphodiester linkages in between. 

41. The method of claim 28, wherein the oligonucleotide has a formula: 
5 SNlXlCGXa^* (SEQ ID NO: 1) wherein at least one nucleotide separates 

consecutive CpGs; XI is adenine, guanine or thymidine; X2 is cytosine or 
thymine; N is any nucleotide and Nl + N2 is from about 0-26 bases. 

42. The method of claim 41, wherein the Nl + N2 do not contain a CCGG 
quadmer or more than one CGG trimer, and the nucleic acid sequence is from 

10 about 8-1 000 bases in length* 

43. The method of claim 28, wherein the oligonucleotide has a formula: 
SmXlXZCGX^X^mY (SEQ ED NO: 2) wherein at least one nucleotide 
separates consecutive CpGs; X1X2 is selected from the group consisting of 
GpT, GpG, GpA, ApTand ApA; X3X4 is selected from the group consisting 

15 ofTpT and CpT;N is any nucleotide and Nl + N2 is from about 0-26 bases. 

44. The method of claim 43, wherein the Nl + N2 do not contain a CCGG 
quadmer ox more than one CGG trimer; and the nucleic acid sequence is from 
about 8-1000 bases in length. 

45. The method of claim 43, wherein said oligonucleotide is 
20 5*-TCCATGACGTTCCTGACGTT-3' (SEQ ID NO:3). 

46. The method of claim 28, wherein said antigen-encoding nucleic acid encodes 
a viral antigen. 



-44- 



AMENDED SHEET (ARTICLE 19) 



WO 98/40100 



PCT/US98/04703 



47. The method of claim 46, wherein said viral antigen is a hepatitis viral 
antigen. 

48. The method of claim 47, wherein said hepatitis viral antigen is a hepatitis B 
viral antigen. 

49. The method of claim 48, wherein said hepatitis B viral antigen is a hepatitis 
B virus surface antigen. 

50. The method of claim 28, wherein the antigen-encoding nucleic acid and the 
CpG-dinucleotide are administered in a delivery vector or vehicle. 

5 1 . The method of claim 28, wherein the antigen-encoding nucleic acid and the 
CpG-dinucleotide are administered with an additional adjuvant 

52. The method of claim 28, wherein the subject is a mammal. 

53. The method of claim 28, wherein the subject is a human. 

54. A method of inducing an immune response in a subject, said method 
comprising administering to the subject a therapeutically effective amount of 
nucleic acid encoding an antigenic polypeptide, a therapeutically effective 
amount of an oligonucleotide containing at least one unmethylated CpG 
dinucleotide, and a therapeutically effective amount of an antigen. 

55. The method of claim 54, wherein the CpG dinucleotide is contained in same 
plasmidas that encoding the antigen and this is administered mixed together 
with the antigen. 



-45- 



AMENDED SHEET (ARTICLE 19) 



WO 98/40100 PCT/US98/04703 



56. The method of claim 54, wherein said antigen-encoding and CpG dinucleo- 
tide-containing nucleic acid is given at a different site than said antigen plus 
CpG dinucleotide-containing oligonucleotide. 

57. The method of claim 54, wherein the said antigen-encoding and CpG 
5 dinucleotide-containing nucleic acid is given at a different time from said 

antigen plus CpG dinucleotide-containing oligonucleotide. 

58. The method of claim 57, wherein the immune response is primed by said 
antigen-encoding and CpG dinucleotide-containing nucleic acid and the 
response is boosted by said antigen plus CpG dinucleotide-containing 

10 oligonucleotide. 

59. The method of claim 54, wherein said antigenic polypeptide is the same as 
that encoded by the antigen-encoding nucleic acid. 

60. The method of claim 54, wherein said antigenic polypeptide is different than 
that encoded by the antigen-encoding nucleic add. 

15 61. A method of treating a subject having an infectious disorder that is chronic 

or likely to become chronic, said method comprising: administering to the 
subject a therapeutically effective amount of an antigen, and a therapeutically 
effective amount of an oligonucleotide containing at least one unmethylated 
CpG dirxucleotide. 

20 62. The method of claim 61, wherein said infectious disease is viral. 

63. The method of claim 62 wherein said viral disease is hepatitis. 

64. The method of claim 63, wherein said hepatitis disease is hepatitis B. 



-46- 

AMENDED SHEET (ARTICLE 19) 



WO 98/40100 PCT/US98/04703 



65. The method of claim 61, wherein the oligonucleotide is from 8-30 bases in 
length. 

66. The method of claim 61, wherein the oligonucleotide is contained within a 
plasmid made with a natural phosphodiester backbone. 

5 67. The method of claim 6 1 , wherein the oligonucleotide is made completely or 

partially with a synthetic backbone. 

68. The method of claim 67, wherein the oligonucleotide is made completely 
with a synthetic phosphorothioate backbone. 

69. Use method of claim 67, wherein the oligonucleotide is made with a chimeric 
10 backbone with synthetic phosphorothioate linkages at the 3 1 and 5' ends and 

natural phosphodiester linkages in the CpG-containing center. 

70. The method of claim 69, wherein the oligonucleotide is made with a chimeric 
backbone with synthetic phosphorothioate linkages for five linkages at the 3' 
end and two linkages at the 5* end, and with natural phosphodiester linkages 

IS in between. 

71. The method of claim 61, wherein the oligonucleotide has a formula: 
5 I N1X1CGX2N23' (SEQ1DNO: 1) wherein at least one nucleotide separates 
consecutive CpGs; XI is adenine, guanine or thymidine; X2 is cytosine or 
thymine; N is any nucleotide and Nl + N2 is from about 0-26 bases. 

20 72. The method of claim 71, wherein the Nl + N2 do not contain a CCGG 

quadmer or more than one CGG trimer, and the nucleic acid sequence is from 
about 8-30 bases in length. 

-47- 



AMENDED SHEET (ARTICLE 19) 



WO 98/40100 PCT/US98/04703 



73. The method of claim 61, wherein the oligonucleotide has a fonnula: 
5 f NlXlX2CGX3X4N23' (SEQ ID NO: 2) wherein at least one nucleotide 
separates consecutive CpGs; X1X2 is selected from the group consisting of 
GpT, GpG,GpA» ApT and Ap A; X3X4 is selected from the group consisting 

5 ofTpT and CpT;N is any nucleotide and Nl + N2 is from about 0-26 bases. 

74. The method of claim 73, wherein the Nl + N2 do not contain a CCGG 
quadmer or more than one CGG trimcr, and the nucleic acid sequence is from 
about 8-30 bases in length. 

75. The method of claim 73, wherein said oligonucleotide is 
10 S , -TCCATGACGT^CCTGACGT^-3 , (SEQIDNO:3). 

76. The method of claim 61, wherein die antigen is a polypeptide. 

77. The method of claim 76, wherein said antigenic polypeptide is from a virus. 

78. The method of claim 77, wherein said viral antigen is a hepatitis viral 
antigen. 

IS 79. The method of claim 78, wherein said hepatitis viral antigen is a hepatitis B 

viral antigen. 

80. The method of claim 79, wherein said hepatitis B viral antigen is a hepatitis 
B virus surface antigen. 

8 1 . The method of claim 6 1 , further comprising at least one additional adjuvant. 

20 82. The method of claim 8 1 , wherein the additional adjuvant contains aluminum 

(alum). 

-48- 



AMENDED SHEET (ARTICLE 19) 



WO 98/40100 PCT/US98/04703 



83. The method of claim 82, wherein the additional aluminum-containing 
adjuvant is aluminum hydroxide. 

84. The method of claim 61, wherein the antigen and the CpG containing 
oligonucleotide are administered in a delivery vector or vehicle. 

S 85. The method of claim 61, wherein the subject is a mammal. 

86. The method of claim 61, wherein the subject is a human. 

87. A method of treating a subject having an infectious disorder that is chronic 
or likely to become chronic, said method comprising administering to the 
subject a therapeutically effective amount of nucleic acid encoding an 

10 antigenic polypeptide, and a therapeutically effective amount of an oligonu- 

cleotide containing at least one unmeditated CpG dinucleotide. 

88. The method of claim 87, wherein said infectious disease is viral. 

89. The method of claim 88, wherein said viral disease is hepatitis. 

90. The method of claim 89, wherein said hepatitis disease is hepatitis B. 

15 91 . The method of claim 87, wherein said nucleic acid vector is a DNA vector 

92. The method of claim 91, wherein the CpG containing oligonucleotide is 
cloned into said vector. 

93 . The method of claim 9 1 , wherein said DNA vector is plasmid DNA. 



-49- 

AMENDED SHEET (ARTICLE 19) 



The method of claim 87, wherein the CpG-conlainmg oligonucleotide is a 
separate entity from the antigen-encoding nucleic acid vector. 

The method of claim 94, wherein said CpG-conlaining oligonucleotide has 
a completely or partially synthetic backbone. 

The method of claim 95, wherein said oligonucleotide is made with a 
chimeric backbone with synthetic phosphorothioate linkages at the 3' and 5' 
ends and natural phosphodiester linkages in the CpG-containing center. 

The method of claim 96, wherein said chimeric oligonucleotide is made with 
synthetic phosphorothioate linkages for five linkages at the 3' end and two 
linkages at the 5' end, and with natural phosphodiester linkages in between. 

The method of claim 87, wherein the oligonucleotide has a formula: 
5N1X1 CGX2N23' (SEQ ID NO: 1) wherein at least one nucleotide separates 
consecutive CpGs; XI is adenine, guanine or thymidine; X2 is cytosine or 
thymine; N is any nucleotide and Nl +N2 is from about 0-26 bases. 

The method of claim 98, wherein the Nl + N2 do not contain a CCGG 
quadmer or more than one CGG trimer; and the nucleic acid sequence is from 
about 8-1000 bases in length. 

The method of claim 87, wherein the oligonucleotide has a formula: 
5 l NlXlX2CGX3X4N2y (SEQ ID NO: 2) wherein at least one nucleotide 
separates consecutive CpGs; XI X2 is selected from the group consisting of 
GpT, GpG, GpA, ApT and ApA; X3X4 is selected from the group consisting 
of TpT and CpT; N is any nucleotide and Nl + N2 is from about 0-26 bases. 



-50- 



AMENDED SHEET (ARTICLE 19) 



WO 98/40100 



PCT/US98/04703 



101. The method of claim 100, wherein the Nl + N2 do not contain a CCGG 
quadmeror more man one CGG trimer, and the nucleic acid sequence is from 
about 8-1000 bases in length. 

102. The method of claim 100, wherein said oligonucleotide is 
5 5'-TCCATG ACGTTCCTGACGTT-3 ' (SEQ ID NO:3). 

103. The method of claim 87, wherein said antigen-encoding nucleic acid encodes 
a viral antigen. 

104. The method of claim 103, wherein said viral antigen is a hepatitis viral 
antigen. 

10 105. The method of claim 104, wherein said hepatitis viral antigen is a hepatitis 
B viral antigen. 

106. The method of claim 105, wherein said hepatitis B viral antigen is a hepatitis 
B virus surface antigen. 

107. The method of claim 87, wherein the antigen-encoding nucleic acid and the 
j 5 CpG-dinucleotide are administered in a delivery vector or vehicle. 

108. The method of claim 87, wherein the antigen-encoding nucleic acid and the 
CpG-dinucleotide are administered with an additional adjuvant 

109. The method of claim 87, wherein the subject is a mainmal. 

110. The method of claim 87, wherein the subject is a human. 



-51- 

AMENDED SHEET (ARTICLED 



I 



WO 98/40100 PCI7US98/04703 



111. 



10 



or 

su< 



A method of treating a subject having an infectious disorder that is chronic 
Ukely to become chronic, said method comprising: administering to the 
lD ject a therapeutically effective amount of nucleic acid encoding an 
antigenic polypeptide, a therapeutically effective amount of an oligonucleo- 
tide containing at least one unmethylated CpG dinucleotidc, and a therapeuti- 
cally effective amount of an antigen. 

1 12. The method of claim 111, wherein the CpG ^nucleotide is contained in the 
same plasmid as that encoding the antigen. 

1 13. The method of claim 1 12, wherein said antigen-encoding and CpG dinucleo- 
tide-containing nucleic acid is given mixed together with said antigen. 

114. The method of claim 111, wherein said antigen encoding and CpG dinucleo- 
tide containing nucleic acid is given at a different site than said antigen plus 
CpG dinucleotide-containing oligonucleotide. 

115. The method of claim 1 11, wherein the CpG-containing oligonucleotide is a 
IS separate entity from the nucleic acid encoding an antigenic polypeptide. 

116. The method of claim 115, wherein said CpG-containing oligonucleotide is 
contained within a plasmid. 

117. The method of claim 115, wherein said CpG-containing oligonucleotide is 
made with a completely or partially synthetic backbone. 

20 118. The method of claim 111, wherein the said antigen-encoding and CpG 
dinucleotide-containing nucleic acid is given at a different time from said 
antigen plus CpG dinucleotide-containing oligonucleotide. 



-52- 

AMENDED SHEET (ARTICLE 19) 



WO 98/40100 PCT/US98/04703" 



119. The method of claim 1 1 8, wherein the immune response is primed by said 
antigen-encoding and CpO dinucleotide-containiiig nucleic acid and the 
response is boosted by said antigen plus CpO dinucleotide-containing 
oligonucleotide. 

5 120. The method of claim 1 1 1, wherein said antigenic polypeptide is the same as 
that encoded by die antigen-encoding nucleic acid. 

121 . Hie method of claim 111, wherein said antigenic polypeptide is different than 
that encoded by the antigen-encoding nucleic acid. 

122. A pharmaceutical composition comprising an antigen and an oligonucleotide 
10 containing an immunostimulatoiy CpG motif in a pharmaceutical^ 

acceptable carrier. 

123. The composition of claim 122, wherein the said antigen is a viral antigen. 

124. The composition of claim 123, wherein the said viial antigen is a hepatitis 
viral antigen. 

IS 125. The composition of claim 124, wherein the said viral hepatitis antigen is a 
hepatitis B antigen. 

126. The composition of claim 125, wherein the said hepatitis B antigen is a 
hepatitis B surface antigen. 

127. A pharmaceutical composition comprising a nucleic acid encoding an 
20 antigenic protein and an oligonucleotide containing an immunostimulatory 

CpG motif in a pharmaceutical^ acceptable carrier. 



-53- 

AMENDED SHEET (ARTICLE 19) 



WO 98/40100 



PCT/US98/04703" 



128. The composition of claim 127, whereto the said antigen is a viral antigen. 

129. The composition of claim 128, wherein the said viral antigen is a hepatitis 
viral antigen. 

130. The composition of claim 129, wherein the said viral hepatitis antigen is a 
5 hepatitis B antigen. 

131. The composition of claim 130, wherein the said hepatitis B antigen is a 
hepatitis B surface antigen. 

132. A pharmaceutical composition comprising a nucleic acid encoding an 
antigenic protein and an antigen in aphannaceutically acceptable carrier. 



10 



133. The composition of claim 132, wherein tie said antigen is a viral antigen 

134. The composition of claim 133, wherein the said viral antigen is a hepatitis 
viral antigen. 

135. The composition of claim 134, wherein the said viral hepatitis antigen is a 
hepatitis B antigen. 

15 136. The composition of claim 135, wherein the said hepatitis B antigen is a 
hepatitis B surface antigen. 



66S7dj1 



-54- 



AMENDjED SHEET (ARTICLE 19} 



WO 98/40100 



1/11 



PCT/US98/04703 



Immunization of BALB/c mice against HBsAg 
using alum and/or CpG oligos as adjuvant 



o 

a? 
< 

CO 

_i 
in 

(A 
01 



C 
(0 



60000 j 

50000- 

40000- 

30000- 

20000- 

10000- 

oi 



100000 



O 
at 

< 

CO 

□ 

UJ 

to 
CO 



10000 



1000 



100 




12 3 

Time (weeks) 




12 3 

Time (weeks) 



HBsAg 
-® — HBsAg + alum 
-a — HBsAg + CpG 
-■ — HBsAg + alum + CpG 



HBsAg 

HBsAg + alum 
ffl — HBsAg + CpG 
« — HBsAg + alum + CpG 



Figure 1 



WO 98/40100 2/11 PCT/US98/04703 



Immunization of BALB/c mice with HBV vaccine 
Dose response for CpG oligos 



60000 




Time (weeks) 



* — HBsAg/alum + 500 ng CpG 

O — HBsAg/alum+ lOOjigCpG 

« — HBsAg/alum + 10 ]ig CpG 

■o — HBsAg/alum 



Figure 2 



WO 98/40100 3/11 PCT/US98/04703 



Immunization of C57BU6 mice against HBsAg 
Use of alum and/or CpG oligos as adjuvant 



10000000 



1000000 




100000 




Figure 3 



WO 98/40100 



4/11 



PCT/US98/04703 



Immunization of C57BL/6 mice against HBsAg 
Use of CpG oligos as adjuvant : Dose response 




Time (weeks) 



Figure 4 



WO 98/40100 5/^ PCT/US98/04703 



Immunization of hypo-responder mice (B10.S) 
against HBsAg: 
Adjuvant effect of alum and/or CpG DNA 



HBsAg 



HBsAg + 10 ngCpG 



750- 



500- 



O 
cp 

o 

< 

CO 

-J 

UJ 



to 
CQ 

X 250- 
c 

< 



No alum 




750 



500- 



250- 



With alum 




Time (weeks) 



Time (weeks) 



Figure 5 



WO 98/40100 



6/11 



PCT/US98/04703 



Immunization of non-responder mice (C2D) 
against HBsAg: 
Adjuvant effect of alum and CpG DNA 



HBsAg — ♦ HBsAg + 10 fig CpG 




Time (weeks) Time (weeks) 



Figure 6 



WO 98/40100 



7/11 



PCT/US98/D4703 



Immunization of C57BL/6 mice against HBsAg 
Effect of adjuvant of antibody isotype 



1000000 



100000- 




none alum CpG CpG+alum 
Adjuvant 



Figure 



7 



WO 98/40100 



8/11 



PCTAJS98/04703 



DNA immunization of BALB/c mice against HBsAg 
Use of CpG oligos as adjuvant 



100000 



10000 



o 

75 
o 

< 

CO 

_l 
1U 

w 
CD 
X 

t 

c 
< 



1000 



100 




2 3 4 

Time (weeks) 



Figure 8 



WO 98/40100 PCMJS98/04703 



DNA-based immunization of 
hypo-responder mice against HBsAg with 
protein (subunit) or DNA vaccines 



10000 



c 

< 





3SE 



t 1 1 1 1 1 1 r 

8 12 16 20 24 28 32 36 




Time (weeks) 



Figure 9 



WO 98/40100 1Q/11 PCT/US98/04703 



Immunization of newborn BALB/c mice against HBsAg 

DNA vs protein vaccine 



10000 



o 

"re 
o 

< 

CO 

_i 
u 

M 
CD 
X 

• 

c 

< 



1000 



100 




■« — ' DNA @ 7d 
— DNA@1d 
-B — HBsAg @ 7d 
-e — HBsAg @1d 



4 8 12 
Time (weeks) 



Figure 10 



WO 98/40100 PCT/US98A>4703 

Immunization of BALB/c mice against HBsAg by 
combined DNA and subunit vaccine approach 




Time (weeks) 





PRIME 


BOOST 




- DNA 


none 


Q 


- DNA + HBsAg (same site) 


none 


ffl— 


- DNA, HBsAg (different sites) 


none 


• 


- DNA 


HBsAg @ 2 wks 




- DNA 


HBsAg@8wks 



Figure 11 



INTERNATIONAL SEARCH REPORT 



International application No. 
PCT/US9SV04703 



A. CLASSIFICATION OF SUBJECT MATTER 
1PC(6) :A61K 39/39 

US CL :424/278.l, 184.1; 514/44; 536/23.1. 24.1 
According to International Patent Classification (IPC) or to both national classification and IPC 



FIELDS SEARCHED 



Minimum documentation searched (classification system followed by classification symbols) 
U.S. : 424/278.1, 184.1; 514/44; 536/23.1.24.1 



Documentation searched other than minimum documentation to the extent that such documents are included in the fields searched 



Electronic data base consulted during the international search (name of data base and, where practicable, search terms used) 

Medline, Capias* WPIDS. Scisearch, Europatfull 

search terms: CpG, unmcthylated, immune, adjuvant, hepatitis B 



DOCUMENTS CONSIDERED TO BE RELEVANT 



Category* 



Citation of document, with indication, where appropriate, of the relevant passages 



Relevant to claim No. 



x 

Y 

X,P 
Y.P 
Y,P 



BRANDA, R. F. et al. Amplification of Antibody Production by 
Phosphorothioate Oligodeoxynucleotides. Journal of Laboratory and 
Clinical Medicine, 1996. Vol 128, No.3 pages 329-338, see 
especially abstract and discussion page 336, second column. 

WO 97/40163 Al (SCHORR, J. et al.) 30 October 1997, pg. 12, 
third paragraph and examples. 



US 5,663,153 Al (HUTCHERSON et al.) 02 September 1997, col 
4 lines 33-52, and all examples. 



1, 2, 4, 5, 8 
3, 6, 7, 9-45 

1, 2, 4, 5, 8 
3, 6, 7, 9-45 
1-45 



| x| Further documents arc listed in the continuation of Box C. | | See patent family annex. 



Special categories of cited document*: 

rtonimrm defining (ho general state of the art which is not considered 
to be of particular relevance 

earlier document published on or after the international Tiling date 

document which may throw doubts on priority claim (s) or which is 
cited to establish the publication date of another citation or other 
special reason (as specified) 

document referring to an oral disclosure, use. exhibition or other 



document published prior to the international filing date but later than 
the priority date claimed 



later document published after the international filing date or priority 
date and not in conflict with the application but cited to understand 
the principle or theory underlying the invention 

document of particular relevance; the claimed invention cannot be 
considered novel or cannot bo considered to involve an inventive step 
when the document is taken alone 

document of particular relevance; the claimed invention cannot be 
considered to involve an inventive step wbcn the document is 
combined with one or more other such documents, such combination 
being obvious to a person skilled in the art 

document member of the same patent family 



Date of the actual completion of the international search 



09 JUNE 1998 



Date of mailing gffhe international search report 

6 JUJJS98J 




Name and mailing address of the ISA/US 
Commissioner of Patents and Trademarks 
Box PCT 

Washington. D.C. 20231 
Facsimile No. (703) 305-3230 



EMAN 

(703) 308-0196 



Form PCT/ISA/210 (second shectX-luly 1992)* 



INTERNATIONAL SEARCH REPORT 



International application No. 
PCT/US98/04703 



C (Continuation). DOCUMENTS CONSIDERED TO BE RELEVANT 



Category* 


Citation of document, with indication, where appropriate, of the relevant passages 


Relevant to claim No. 


X,P 
Y.P 
Y.P 


KLINMAN, D. M. et al. Contribution of CpG Motifs to the 
Immunogenicity of DNA vacccines.The American Association of 
Immunologists, 1997. vol.158, pages 3635-3639. 

CHU et al. CpG Oligodeoxynucleotides Act as Adjuvants that 
Switch on T Helper 1 (Thl) Immunity. Journal of Experimental 
Medicine, November, 1997. Vol 186 No.10, pages 1623-1631. 


I, 2, 4, 5, 8 
3, 6, 7, 9-45 
1-45 



Form PCT/ISA/210 (continuation of second sheeiXJuly 1992)*