Skip to main content

Full text of "USPTO Patents Application 09848616"

See other formats


Document AN4 
Appl. No. 09/848,616 



WORLD INTELLECTUAL PROPERTY ORGANIZATION 
International Bureau 




PCT 

INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) 



(51) International Patent Classification 6 : 

C12N 15/44, C07K 14/08, 19/00, C12N 
15/62, 15/70, 1/21, A61K 39/145, C07K 
16/10, A61K 39/42, G01N 33/569 



Al 



(11) International Publication Number: 
(43) International Publication Date: 



WO 99/28478 

10 June 1999 (10,06.99) 



(21) International Application Number: PCT/US98/ 16379 

(22) International Filing Date: 6 August 1998 (06.08.98) 



(30) Priority Data: 

08/906,930 



6 August 1997 (06.08.97) 



US 



(71) Applicant (for all designated States except US): CENTERS 
FOR DISEASE CONTROL AND PREVENTION [US/US]; 
1600 Clifton Road, N.E., Mailstop: G16, Atlanta, GA 30333 
(US). 

(72) Inventors; and 

(75) Inventors/Applicants (for US only): FRACE, A., Michael 
[US/US]; 1828 Almeta Avenue, Atlanta, GA 30307 (US). 
KLIMOV, Alexander, I. [RU/RU]; 3197 Amblewood Court, 
Atlanta. GA 30345 (US). KATZ, Jacqueline, M. [AU/AU]; 
447 Hardendorf Avenue, Atlanta, GA 30307 (US). 

(74) Agent: GREENFIELD, Michael, S.; McDonnell Boehnen 
Hulbert & Berghoff, Suite 3200, 300 South Wacker Drive, 
Chicago, IL 60606 (US). 



(81) Designated States: AL, AM, AT, AU, AZ, BA, BB, BG, BR, 
BY, CA, CH, CN, CU, CZ, DE, DK, EE, ES, FI, GB, GE, 
GH, GM, HR, HU, ID, IL, IS, JP, KE, KG, KP, KR, KZ, 
LC, LK, LR, LS, LT, LU, LV, MD, MG, MK, MN, MW, 
MX, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, 
TJ, TM, TR, TT, UA, UG, US, UZ, VN, YU, ZW, ARIPO 
patent (GH, GM, KE, LS, MW, SD, SZ, UG, ZW), Eurasian 
patent (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), European 
patent (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, 
IE, IT, LU, MC, NL, PT, SE), OAPI patent (BF, BJ, CF, 
CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG). 



Published 

With international search report 



(54) Title: PREPARATION AND USE OF RECOMBINANT INFLUENZA A VIRUS M2 CONSTRUCTS AND VACCINES 



(57) Abstract 

The present invention provides a method of increasing the recombinant expression and solubility of influenza A virus M2 polypeptide 
comprising nucleic acids encoding a modified M2 protein of influenza A virus in which transmembrane and other hydrophobic domains have 
been deleted. The present invention also provides purified polypeptides encoded by the nucleic acids, which polypeptides are immunogenic 
and are less hydrophobic than full-length M2. Also provided are vaccines comprising variants of M2 expressed in prokaryotic hosts. Further 
provided are methods of preventing influenza A infection using vaccines comprised of variants of M2. Also provided are antibodies raised 
against the variants of M2, and use of such antibodies in diagnosis and treatment of influenza A infections. 



FOR THE PURPOSES OF INFORMATION ONLY 



Codes used to identify States party to the PCT on the front pages of pamphlets publishing international applications under the PCT. 



AL 


Albania 


ES 


Spain 


LS 


Lesotho 


SI 


Slovenia 


AM 


Armenia 


FI 


Finland 


LT 


Lithuania 


SK 


Slovakia 


AT 


Austria 


FR 


France 


LU 


Luxembourg 


SN 


Senegal 


AU 


Australia 


GA 


Gabon 


LV 


Latvia 


sz 


Swaziland 


AZ 


Azerbaijan 


GB 


United Kingdom 


MC 


Monaco 


TD 


Chad 


BA 


Bosnia and Herzegovina 


GE 


Georgia 


MD 


Republic of Moldova 


TG 


Togo 


BB 


Barbados 


GH 


Ghana 


MG 


Madagascar 


TJ 


Tajikistan 


BE 


Belgium 


GN 


Guinea 


MK 


The former Yugoslav 


TM 


Turkmenistan 


BF 


Burkina Faso 


GR 


Greece 




Republic of Macedonia 


TR 


Turkey 


BG 


Bulgaria 


HU 


Hungary 


ML 


Mali 


TT 


Trinidad and Tobago 


BJ 


Benin 


IE 


Ireland 


MN 


Mongolia 


UA 


Ukraine 


BR 


Brazil 


IL 


Israel 


MR 


Mauritania 


UG 


Uganda 


BY 


Belarus 


IS 


Iceland 


MW 


Malawi 


US 


United States of America 


CA 


Canada 


IT 


Italy 


MX 


Mexico 


uz 


Uzbekistan 


CF 


Central African Republic 


JP 


Japan 


NE 


Niger 


VN 


Viet Nam 


CG 


Congo 


KE 


Kenya 


NL 


Netherlands 


YU 


Yugoslavia 


CH 


Switzerland 


KG 


Kyrgyzstan 


NO 


Norway 


ZW 


Zimbabwe 


CI 


Cote d'lvoire 


KP 


Democratic People's 


NZ 


New Zealand 






CM 


Cameroon 




Republic of Korea 


PL 


Poland 






CN 


China 


KR 


Republic of Korea 


PT 


Portugal 






cu 


Cuba 


KZ 


Kazakstan 


RO 


Romania 






cz 


Czech Republic 


LC 


Saint Lucia 


RU 


Russian Federation 






DE 


Germany 


LI 


Liechtenstein 


SD 


Sudan 






DK 


Denmark 


LK 


Sri Lanka 


SE 


Sweden 






EE 


Estonia 


LR 


Liberia 


SG 


Singapore 







WO 99/28478 PCT/US98/16379 
PREPARATION AND USE OF RECOMBINANANT 
INFLUENZA A VIRUS M2 CONSTRUCTS AND VACCINES 



BACKGROUND OF THE INVENTION 

Field of the Invention 

5 The present invention relates to the field of vaccines against influenza A virus and the 

constructs useful in their production. 
Description of the Related Art 

The prior art illustrates the current strategy for control of influenza by yearly 
vaccination with whole-virus or subunit vaccines. The currently-licensed vaccines are 

10 designed to stimulate neutralizing antibodies against hemagglutinin (HA) and/or 
neuraminidase (NA), the major surface antigens of the influenza virus. However, due to 
frequent and unpredictable structural variation of HA and NA, influenza vaccines must be 
seasonally customized to circulating virus strains, a process which is deficient in providing 
protective immunity against all but closely matched viral strains. 

1 5 There is a need for a vaccine subunit component capable of inducing broader, more 

cross-reactive immunity to type A influenza viruses. One such component may be M2 9 a 
structurally conserved influenza A viral surface protein (Slepushkin et aL, 1995; Ito et aL, 
1991). The DNA sequences of the M2 genes of numerous influenza A viruses are known (Ito 
et aL, 1991). M2 is thought to provide an obligatory transmembrane proton flux for viral 

20 replication (Sugrue et aL, 1990; Ciampor et aL, 1992b; Grambas and Hay, 1992). As a 
membrane transport protein, M2 functions as an open pore which conducts cations in a 
nonselective manner (Tosteson et aL, 1994; Shimbo et aL, 1996). This conductance is 
thought to permeabilize host cells expressing recombinant M2 and may explain difficulties 
that others have had in achieving high levels of recombinant M2 expression in prokaryotic as 

25 well as eukaryotic systems (Guinea and Carrasco, 1996; Black et aL, 1993). 

Antibody to M2 has been shown to restrict influenza virus replication in cell culture 
and in infected mice (Zebedee and Lamb (1988) and Treanor et aL, (1990). Full length M2 
expressed in baculovirus has been shown to raise serum titers and stimulate T-cell responses 
in immunized animals (Katz, et aL, 1996). Further, vaccination of mice with recombinant 

30 full-length M2 has been shown to enhance viral clearance from infected lungs and to provide 
protection from lethal challenge with heterologous influenza A virus (Slepushkin et aL, 
1995). 



WO 99/28478 PCT/US98/16379 

Since M2 is not expressed to any extent in virions (Zebedee & Lamb, 1988), the. 
current whole virus or split-product influenza vaccine contains only minimal amounts of M2. 
To be useful as a component of a vaccine, M2 must be expressed and purified as a 
recombinant product. However, expression of full-length M2 has been shown to be 
5 detrimental to cell culture in prokaryotic and eukaryotic expression systems (Guinea and 
Carrasco, 1996; Black et aL, 1993). To date, expression of sufficient quantities of 
recombinant M2 for use in experimental studies can only be accomplished by culturing 
eukaryotic host cells in the presence of the irreversible M2 inhibitor, amantadine. 

Wholly apart from the challenges in expression of recombinant M2, the hydrophobic 
10 nature of full-length M2 compromises the yield and purity of M2 preparations and 
necessitates the use of detergents or other agents to maintain M2 in a soluble form. Certain 
such solubilizing agents are not desirable constituents of vaccine formulations. The present 
invention solves this shortcoming in the prior art by providing a modified M2 protein with 
reduced hydrophobicity and concomitantly enhanced solubility characteristics relative to full- 
15 length M2. 

SUMMARY OF THE INVENTION 

The present invention solves the problems of the prior art approaches to recombinant 
M2 production by providing new recombinant forms of M2 whose structure has been 
modified to allow simple prokaryotic expression as a soluble, readily purified variant protein 

20 that retains antigenic and immunogenic properties. A preferred embodiment of the present 
invention provides a recombinant construct in which at least the entire portion of the 
transmembrane domain has been deleted. Alternatively, residues within the transmembrane 
domain may simply be altered, for example by substitution of hydrophilic or neutral amino 
acid residues for hydrophobic residues, in such a way as to (a) enhance expression of the 

25 protein in prokaryotic and/or eukaryotic systems relative to the native protein and/or (b) 
render the modified M2 protein more soluble in aqueous solutions relative to the native M2 
protein. The terms M2 polypeptide and M2 protein are used interchangeably herein. The 
present invention further provides vaccines comprised of these new recombinant forms of M2 
and to methods of prevention and treatment of influenza A virus infections. 

30 The foregoing merely summarizes certain aspects of the invention and is not intended, 

nor should it be construed as limiting the invention in any manner. All patent applications, 



2 



WO 99/28478 PCT/US98/16379 
patents, and other publications recited herein are hereby incorporated by reference in their 

entirety. 

BRIEF DESCRIPTION OF THE DRAWINGS 

Fig. 1 is a schematic diagram of M2 and deletion constructs sM2 and ssM2; 
5 Fig. 2 represents growth curves showing the time course of cell replication and 

expression of full-length and modified M2 polypeptides; 

Fig. 3 (A) is a coomassie-stained SDS-PAGE gel; and 

Fig. 3 (B) is a Western blot of fusion proteins containing modified M2 polypeptides. 
Fig. 4 displays the results of vaccination with M2 constructs as described in Example 

10 7. 

DETAILED DESCRIPTION OF THE INVENTION 

In a first aspect, the present invention provides for a modified M2 protein comprising 
the native M2 protein in which at least the hydrophobic, transmembrane region is deleted or 
substituted with neutral or hydrophilic residues. We have discovered that such a modified 

15 M2 protein is more soluble in aqueous solution relative to its native M2 protein counterpart 
and in a form suitable for high-yield expression and purification. Moreover, as demonstrated 
herein, modified M2 proteins according to this aspect of the invention are both immunogenic 
and immunoprotective, making them suitable for use as vaccines. 

For the purposes of this invention, the transmembrane region of M2 is defined 

20 generally as that portion of the M2 polypeptide which spans all or part of the lipid bilayer of 
the influenza A virus surface. Residues 26-43 of the native M2 of the A/Aichi/2/68 (H3N2) 
virus correspond to the transmembrane region, although the modified M2 of the present 
invention can be constructed to correspond to the native M2 protein of any strain. Those 
skilled in the art will appreciate that comparable regions of other influenza A viruses and 

25 newly emerging influenza A viruses will correspond to this general description of a 
transmembrane region and the present invention contemplates removal or alteration of 
sufficient residues within the transmembrane region to render said region functionally 
inactive and, preferably, to reduce overall hydrophobicity, thereby allowing for efficient 
expression and purification of modified M2 polypeptides following culture in prokaryotic and 

30 eukaryotic hosts. 

As mentioned, the modified M2 proteins according to the invention manifest 
enhanced expression in host organisms compared to the expression level of the native M2 



3 



WO 99/28478 PCT/US98/16379 
protein. Although the invention is not limited by any theory, enhanced expression may arise 
due to inactivation (or significantly diminution) of the ion channel activity of the modified 
M2 polypeptide, thereby decreasing the polypeptide's toxicity to the expressing host 
organism. Preferably, modified M2 proteins of the invention are capable of being expressed 

5 in a host organism at levels of 5-50 mg/1 or at levels sufficient to produce a visible band on 
coomassie stained gel. 

In a preferred embodiment, the modified M2 protein according to this aspect of the 
invention comprises a sequence of amino acids identical to a native M2 protein in which the 
transmembrane region and from zero to twelve amino acid residues adjacent to the 

10 transmembrane region on its C-terminus side have been deleted. By this is meant that the 
modified M2 protein comprises the portion of a native M2 protein on the N-terminal side of 
the transmembrane region fused to a portion of the native M2 protein from the C-terminal 
side of the transmembrane region. In another preferred embodiment, the modified M2 protein 
comprises a sequence of amino acids identical to the native M2 protein of the A/Aichi/2/68 

15 (H3N2) virus in which residues 26 through anywhere from 43 to 55 have been deleted. In 
other words, this embodiment comprises the N-terminal 25 amino acid sequence fused at its 
C-terminus to the N-terminal amino acid of the C-terminal portion of the native M2 protein, 
wherein the C-terminal portion begins (at its N-terminal end) at one of amino acid numbers 
44-55 of the native M2 protein. In a more preferred embodiment, the modified M2 protein 

20 comprises a sequence of amino acids identical to the native M2 protein of the A/Aichi/2/68 
(H3N2) virus in which residues 26-43 have been deleted. In another more preferred 
embodiment, the modified M2 protein comprises a sequence of amino acids identical to the 
native M2 protein of the A/Aichi/2/68 (H3N2) virus in which residues 26-55 have been 
deleted. 

25 In another embodiment, the deleted residues of the native M2 protein are replaced 

with one or more neutral or hydrophilic amino acids. In this embodiment, the number of 
amino acid residues in the modified M2 protein is less than or equal to the number in the 
native M2 protein. The deleted residues are preferably replaced with from one to six neutral 
or hydrophilic amino acid residues. In another preferred embodiment, the neutral or 

30 hydrophilic residues in the foregoing embodiments are glycine. 

In another preferred embodiment, the modified M2 protein according to this aspect of 
the invention comprises a sequence of amino acids identical to the native protein in which 
from one to all of the amino acid residues of the transmembrane region and from zero to 



4 



WO 99/28478 PCT/US98/16379 
twelve amino acid residues adjacent to the transmembrane region on its C-terminus side have 

been substituted with neutral or hydrophilic amino acids. In this embodiment, the modified 

M2 protein has the same number of amino acid residues as the native M2 protein. The 

number of amino acid substitutions and the type of substitution are sufficient to yield a 

5 protein having a higher solubility in aqueous solution than the native protein and generally 

increased expression in host organisms. There are numerous such proteins according to this 

embodiment, and it is but a routine matter for one of ordinary skill in the art to substitute one 

or more of the known hydrophilic and/or neutral amino acids into the transmembrane region 

and/or the region adjacent to it on the C-terminal side to obtain a modified M2 protein 

10 according to this embodiment of the invention. Preferably the modified M2 protein according 
to this aspect of the invention has, except for the substituted amino acids, a sequence identical 
to the native M2 of the A/Aichi/2/68 (H3N2) virus. 

In another preferred embodiment, the modified M2 protein according to this aspect of 
the invention comprises any one of the previously recited embodiments in the form of a 

1 5 fusion protein. In one embodiment, the modified M2 protein is fused to a polypeptide that 
renders the fusion construct more easily purified than the modified M2 protein alone. In a 
preferred embodiment, the modified M2 protein is fused to the glutathione S-transferase 
(GST) (e.g., from Schistosoma japonicum). Alternatively or additionally, the modified M2 
protein can be fused to a signal peptide so as to direct secretion of the polypeptide from the 

20 expressing host cell. It is but a routine matter for those skilled in the art to identify, make, 
and use other fusion proteins according to the invention employing a wide variety of 
polypeptides. 

Those skilled in the art will recognize that the modified M2 polypeptides of the 
present invention can be produced by any one of a variety of recombinant methods. The 
25 basic steps in the recombinant production of modified M2 polypeptides include: 

a) construction of a synthetic or semi-synthetic DNA encoding the modified M2 
polypeptide, 

b) integrating said DNA into an expression vector in a manner suitable for the 
expression of the modified M2 polypeptide either alone or as a fusion protein, 

30 c) transforming an appropriate eukaryotic or prokaryotic host cell with said 

expression vector, 
d) culturing said transformed or transfected host cell, and 



5 



WO 99/28478 PCT/US98/16379 
e) recovering and purifying the recombinantly produced modified M2 

polypeptides. 

For recombinant expression, the modified M2 coding sequence may be wholly 
synthetic, semi-synthetic or the result of modification of the native M2 gene sequence. 
5 In another aspect, the invention provides synthetic genes, the in vitro or in vivo 

transcription and translation of which will result in the production of modified M2 
polypeptides. Such genes are derived from the gene sequence of the native M2 protein and 
suitably modified to encode the particular modified M2 protein of which expression is 
desired. Genes according to this aspect may be constructed by techniques well known in the 
10 art. Owing to the natural degeneracy of the genetic code, the skilled artisan will recognize 
that a sizable yet definite number of DNA sequences may be constructed that encode 
modified M2 polypeptides. The gene encoding the modified M2 polypeptides may be created 
by synthetic methodology. Such methodology of synthetic gene construction is well known 
in the art. The DNA sequence corresponding to the modified M2 polypeptide genes can be 
15 generated using conventional DNA synthesizing apparatus such as the Applied Biosystems 
Model 380A or 380B DNA synthesizers (commercially available from Applied Biosystems, 
Inc., 850 Lincoln Center Drive, Foster City, CA 94404). 

One of ordinary skill in the art will recognize that the nucleotide sequence for the M2 
gene from other isolates of influenza type A viruses will be very similar, though not 
20 necessarily identical, to the M2 gene sequence for A/Aichi/2/68 (H3N2). The teachings 
herein are readily applicable to closely related sequences from other influenza A type viruses, 
using techniques well established in the art. Accordingly, this invention contemplates 
variants of other M2 genes in which, as here, the transmembrane and/or hydrophobic regions 
have been deleted. Hybridization and wash conditions and protocols for obtaining sequences 
25 of a desired degree of homology are standard and well known to those skilled in the art. See, 
e.g., Current Protocols in Molecular Biology, vol. 1, unit 2.10 (John Wiley & Sons, Inc. 
1997). These techniques can be employed on a routine basis to isolate homologous DNA 
molecules according to this aspect of the invention. Routine adjustment of the hybridization 
and wash conditions enable artisan of ordinary skill to obtain DNA of virtually any desired 
30 degree of homology. Nucleic acids according to this embodiment can be obtained using the 
protocol set forth in Chapter 5, Table 3 of Nucleic Acid Hybridization: A Practical Approach 
(Hames & Higgins, Eds., IRL Press, Washington D.C., 1985). 



6 



WO 99/28478 PCT/US98/16379 
Vector Construction Generally 

Construction of suitable vectors containing the desired coding and control sequences 

employ standard ligation techniques. Isolated plasmids or DNA fragments are cleaved, 

tailored, and religated in the form desired to form the plasmids required. 

5 To effect the translation of the modified M2 polypeptides, one inserts the engineered 

modified M2 DNA coding sequence in any of a plethora of appropriate recombinant DNA 

expression vectors through the use of appropriate restriction endonucleases. A synthetic 

modified M2 coding sequence is designed to possess restriction endonuclease cleavage sites 

at either end of the transcript to facilitate isolation from and integration into these expression 

10 and amplification and expression plasmids. The coding sequence may be readily modified by 
the use of synthetic linkers to facilitate the incorporation of this sequence into the desired 
cloning vectors by techniques well known in the art. The particular endonucleases employed 
will be dictated by the restriction endonuclease cleavage pattern of the parent expression 
vector to be employed. The choice of restriction sites are chosen so as to properly orient the 

15 modified M2 coding sequence with control sequences to achieve proper in-frame reading and 
expression of the modified M2 polypeptide genes. 

In general, plasmid vectors containing promoters and control sequences which are 
derived from species compatible with the host cell are used with these hosts. The vector 
ordinarily carries a replication site as well as marker sequences which are capable of 

20 providing phenotypic selection in transformed cells. For example, E. coli is typically 
transformed using pBR322, a plasmid derived from an E. coli species (Bolivar, et ai, 1977). 
pBR322 contains genes for ampicillin and tetracycline resistance and thus provides easy 
means for identifying transformed cells. The pBR322 plasmid, or other microbial plasmid 
must also contain or be modified to contain promoters and other control elements commonly 

25 used in recombinant DNA construction. 

The modified M2 polypeptide coding sequence must be positioned so as to be in 
proper reading frame with the promoter and ribosome binding site of the expression vector, 
both of which are functional in the host cell in which the modified M2 polypeptide is to be 
expressed. In the preferred practice of the invention, the promoter-operator region is placed 

30 in the same sequential orientation with respect to the ATG start codon of DNA sequence 
encoding the modified M2 polypeptide as the promoter-operator occupies with respect to the 
ATG-start codon of the gene from which it was derived. Synthetic or modified promoter- 
operator regions such as the tac promoter are well known in the art. When employing such 



7 



WO 99/28478 PCT7US98/1 6379 

synthetic or modified promoter-operator regions they should be oriented with respect to the 
ATG start codon of the modified M2 polypeptide coding sequence as directed by their 
creators. 

Prokarvotic Expression 

In general, prokaryotes are used for cloning of DNA sequences in constructing the 
vectors useful in the invention. For example, E. coli K12 strain 294 (ATCC No. 31446) is 
particularly useful. Other microbial strains which may be used include E. coli B and E. coli 
XI 776 (ATCC No. 31537), E. co/z_W3110 (prototrophic, ATCC No. 27325), bacilli such as 
Bacillus subtilis, and other enterobacteriaceae such as Salmonella typhimurium or Serratia 
marcescans, and various pseudomonas species may be used. Promoters suitable for use with 
prokaryotic hosts include the b-lactamase (vector pGX2907 [ATCC 39344] contains the 
replicon and b-lactamase gene) and lactose promoter systems (Chang et al, 1978; Goeddel et 
al. 9 1979), alkaline phosphatase, the tryptophan (trp) promoter system (vector pATHl [ATCC 
37695] is designed to facilitate expression of an open reading frame as a trpE fusion protein 
under control of the trp promoter) and hybrid promoters such as the tac promoter (isolatable 
from plasmid pDR540 ATCC-37282). However, other functional bacterial promoters, whose 
nucleotide sequences are generally known, enable one of skill in the art to ligate them to 
DNA encoding modified M2 polypeptides using linkers or adapters to supply any required 
restriction sites. Promoters for use in bacterial systems also will contain a Shine-Dalgarno 
sequence operably linked to the DNA encoding modified M2 polypeptides. These examples 
are illustrative rather than limiting. 

Fusion Proteins 

The modified M2 polypeptides may be made either by direct expression or as fusion 
protein comprising the modified M2 polypeptide followed by enzymatic or chemical 
cleavage. It is often observed in the production of certain peptides in recombinant systems 
that expression as a fusion protein prolongs the lifespan and/or increases the yield of the 
desired peptide. A variety of peptidases (e.g., trypsin) which cleave a polypeptide at specific 
sites or digest the peptides from the amino or carboxy termini (e.g., diaminopeptidase) of the 
peptide chain are known. Furthermore, particular chemicals (e.g., cyanogen bromide) will 
cleave a polypeptide chain at specific sites. The skilled artisan will appreciate the 
modifications necessary to the amino acid sequence (and synthetic or semi-synthetic coding 



8 



WO 99/28478 PCT/US98/16379 
sequence if recombinant means are employed) to incorporate site-specific internal cleavage 

sites. See e.g.. Carter P. (1990). 

Therefore, it may be desirable to fuse the coding sequence of a particular modified M2 

polypeptide in-frame to a larger gene coding sequence resulting in the production of a fusion 

5 protein. 

Eukarvotic Expression 

The modified M2 polypeptides can also be recombinantly produced in eukaryotic 
expression systems. 

Eukarvotic Signal Peptides 

10 An advantage of eukaryotic expression systems is that it is possible to obtain a 

secreted protein product. If such a result is desired, it is necessary to modify the coding 
sequence of the modified M2 polypeptide to incorporate a translated signal peptide encoding 
sequence. Generally, signal peptides are proteolytically cleaved from a residual protein as 
part of the secretory process in which the protein is transported into the host cell periplasm or 

1 5 culture medium. 

It is well known in the art that signal peptides facilitate the extracellular discharge of 
secretory proteins in both prokaryotic and eukaryotic environments. It has been shown that 
the addition of a heterologous signal peptide to a normally cytosolic protein will result in the 
extracellular transport of the normally cytosolic protein in E. coli. (Maclntyre, et al., 1987). 

20 It is well known in the art that alternate signal peptide sequences may function with 
heterologous coding sequences. The recombinant production of such fusion proteins maybe 
accomplished by the addition of a DNA sequence encoding a signal peptide appropriate to the 
host organism inserted 5' to, and in reading frame with, the protein coding sequence. 

Signal peptides are well known in the art which could be similarly incorporated into 

25 the modified M2 polypeptide structure. In the preferred practice of the invention the signal 
peptide used is a signal peptide native to a secretory protein of the host cell line. 
Furthermore, the signal sequence may be wholly synthetic. Synthetic "idealized" signal 
peptides have been shown to function in both prokaryotic and eukaryotic environments, (von 
Heijne, G.,1990). The principles of signal peptides are similar in both prokaryotic and 

30 eukaryotic organisms. Both prokaryotic and eukaryotic signal peptides possess an overall 
three domain structure and with no precise sequence conservation necessary to preserve 
function, (von Heijne, G., supra). Generally, the presence of basic and/or charged amino 



9 



WO 99/28478 PCT/US98/16379 
acid residues near the amino terminus of the structural protein inhibits secretion. (Yamane, 

K., et al, 1988; Summers, R.G., et aL, 1989). In order to ensure the efficient cleavage of the 

signal peptide from the fusion protein construct, it is desirable to maintain the nature of the 

amino acid sequence at the interface between the signal peptide and the coding sequence of 

5 the mature art protein. Conservation of charge and hydrophobicity and the elimination of 

charged residues immediately downstream of the signal peptide cleavage point are generally 

important to efficient translocation. However, it is not critical that any one particular amino 

acid sequence be maintained. 

Eukarvotic Promoters 

10 Preferred promoters controlling transcription in mammalian host cells may be 

obtained from various sources, for example, the genomes of viruses such as: polyoma, 
Simian Virus 40 (SV40), adenovirus, retroviruses, hepatitis-B viruj and most preferably 
cytomegalovirus, or from heterologous mammalian promoters, e.g., b-actin promoter. The 
early and late promoters of the SV40 virus are conveniently obtained as an SV40 restriction 

15 fragment which also contains the SV40 viral origin of replication. (Fiers, et al., 1978). The 
entire SV40 genome may be obtained from plasmid pBRSV, ATCC 45019. The immediate 
early promoter of the human cytomegalovirus may be obtained from plasmid pCMBb (ATCC 
77177). Of course, promoters from the host cell or related species also are useful herein. 

Eukarvotic Enhancers 

20 Transcription of a DNA encoding modified M2 polypeptides by higher eukaryotes is 

increased by inserting an enhancer sequence into the vector. Enhancers are cis-acting 
elements of DNA, usually about 10-300 bp, that act on a promoter to increase its 
transcription. Enhancers are relatively orientation and position independent having been 
found 5' (Laimins, L. et al., 1981) and 3' (Lusky, M. L. 5 et ai 9 1983) to the transcription unit, 

25 within an intron (Banerji, J. L. et al. y 1983) as well as within the coding sequence itself 
(Osborne, T. F., et aL, 1984). Many enhancer sequences are now known from mammalian 
genes (globin, RSV, SV40, EMC, elastase, albumin, a-fetoprotein and insulin). Typically, 
however, one will use an enhancer from a eukaryotic cell virus. Examples include the SV40 
late enhancer, the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late 

30 side of the replication origin, and adenovirus enhancers. 



10 



WO 99/28478 PCT/US98/1 6379 

Eukarvotic Expression Vectors 

Expression vectors used in eukaryotic host cells (yeast, fungi, insect, plant, animal, 

human or nucleated cells from other multicellular organisms) will also contain sequences 

necessary for the termination of transcription which may affect mRNA expression. These 

5 regions are transcribed as polyadenylated segments in the untranslated portion of the mRNA 

encoding modified M2 polypeptides. The 3' untranslated regions also include transcription 

termination sites. 

Eukarvotic Selectable Markers 

Expression vectors may contain a selection gene, also termed a selectable marker. 

10 Examples of suitable selectable markers for mammalian cells are dihydrofolate reductase 
(DHFR, which may be derived from the Bgl ll /Hindl H restriction fragment of pJOD-10 
[ATCC 68815]), thymidine kinase (herpes simplex virus thymidine kinase is contained on the 
BamH I fragment of vP-5 clone [ATCC 2028]) or neomycin (G418) resistance genes 
(obtainable from pNN414 yeast artificial chromosome vector [ATCC 37682]). When such 

15 selectable markers are successfully transferred into a mammalian host cell, the transfected 
mammalian host cell can survive if placed under selective pressure. There are two widely 
used distinct categories of selective regimes. The first category is based on a cell's 
metabolism and the use of a mutant cell line which lacks the ability to grow without a 
supplemented media. Two examples are: CHO DHFR* cells (ATCC CRL-9096) and mouse 

20 LTK" cells (L-M(TK-) ATCC CCL-2.3). These cells lack the ability to grow without the 
addition of such nutrients as thymidine or hypoxanthine. Because these cells lack certain 
genes necessary for a complete nucleotide synthesis pathway, they cannot survive unless the 
missing nutrients are provided in a supplemented media. An alternative to supplementing the 
media is to introduce an intact DHFR or TK gene into cells lacking the respective genes, thus 

25 altering their growth requirements. Individual cells which were not transformed with the 
DHFR or TK gene will not be capable of survival in non-supplemented media. 

The second category is dominant selection which refers to a selection scheme used in 
any cell type and does not require the use of a mutant cell line. These schemes typically use a 
drug to arrest growth of a host cell. Those cells which have a novel gene would express a 

30 protein conveying drug resistance and would survive the selection. Examples of such 
dominant selection use the drugs neomycin (Southern P. and Berg, P., 1982), mycophenolic 
acid (Mulligan, R. C and Berg, P. 1980) or hygromycin (Sugden, B. et al. 9 1985). The three 
examples given above employ bacterial genes under eukaryotic control to convey resistance 

11 



WO 99/28478 PCT/US98/16379 
to the appropriate drug G418 or neomycin (geneticin), xgpt (mycophenolic acid) or. 

hygromycin, respectively. 

Eukarvotic Host Cells 

Host cells may be transformed with the expression vectors of this invention and 
5 cultured in conventional nutrient media modified as is appropriate for inducing promoters, 
selecting transformants or amplifying genes. The culture conditions, such as temperature, pH 
and the like, are those previously used with the host cell selected for expression, and will be 
apparent to the ordinarily skilled artisan. The techniques of transforming cells with the 
aforementioned vectors are well known in the art and may be found in such general 
10 references as Maniatis, et al (1989). Molecular Cloning: A Laboratory Manual . Cold Spring 
Harbor Press, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York or Current 
Protocols in Molecular Biology (1989) and supplements. 

Preferred suitable host cells for expressing the vectors of this invention encoding 
modified M2 polypeptides in higher eukaryotes include: African green monkey kidney line 
15 cell line transformed by SV40 (COS-7, ATCC CRL-1651); transformed human primary 
embryonal kidney cell line 293, (Graham, F. L. et al 1977); baby hamster kidney cells (BHK- 

21(C-13), ATCC CCL-10); Chinese hamster ovary cells CHODHFR" (ATCC CRL-9096), 
mouse Sertoli cells (TM4, ATCC CRL-1715); African green monkey kidney cells (VERO 76, 
ATCC CRL-1587); human cervical epitheloid carcinoma cells (HeLa, ATCC CCL-2); canine 
20 kidney cells (MDCK, ATCC CCL-34); buffalo rat liver cells (BRL 3 A, ATCC CRL-1442); 
human diploid lung cells (WI-38, ATCC CCL-75); human hepatocellular carcinoma cells 
(Hep G2, ATCC HB-8065);and mouse mammary tumor cells (MMT 060562, ATCC 
CCL51). 

Yeast Expression 

25 In addition to prokaryotes, eukaryotic microbes such as yeast cultures may also be 

used. Saccharomyces cerevisiae, or common baker's yeast is the most commonly used 
eukaryotic microorganism, although a number of other strains are commonly available. For 
expression in Saccharomyces, the plasmid YRp7, for example, (ATCC-40053, Stinchcomb, 
et al, 1979); Kingsman et al, 1979); Tschemper et al, 1980) is commonly used. This 

30 plasmid already contains the trp gene which provides a selectable marker for a mutant strain 
of yeast lacking the ability to grow in tryptophan, for example ATCC no. 44076 or PEP4-1 
(Jones, 1977). 

12 



WO 99/28478 PCT/US98/16379 
Suitable promoting sequences for use with yeast hosts include the promoters for 3- 

phosphoglycerate kinase (found on plasmid pAP12BD ATCC 53231 and described in U.S. 

Patent No. 4,935,350, June 19, 1990) or other glycolytic enzymes such as enolase (found on 

plasmid pACl ATCC 39532), glyceraldehyde-3-phosphate dehydrogenase (derived from 

5 plasmid pHcGAPCl ATCC 57090, 57091), Zymomonas mobilis (United States Patent No. 

5,000,000 issued March 19, 1991), hexokinase, pyruvate decarboxylase, 

phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate 

kinase, triosephosphate isomerase, phosphoglucose isomerase, and glucokinase. 

Other yeast promoters, which are inducible promoters having the additional advantage 

10 of transcription controlled by growth conditions, are the promoter regions for alcohol 
dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated with 
nitrogen metabolism, metallothionein (contained on plasmid vector pCL28XhoLHBPV 
ATCC 39475, United States Patent No. 4,840,896), glyceraldehyde 3-phosphate 
dehydrogenase, and enzymes responsible for maltose and galactose (GAL1 found on plasmid 

15 pRY121 ATCC 37658) utilization. Suitable vectors and promoters for use in yeast 
expression are further described in R. Hitzeman et al., European Patent Publication No. 
73,657A. Yeast enhancers such as the UAS Gal from Saccharomyces cerevisiae (found in 
conjuction with the CYC1 promoter on plasmid YEpsec— hi 1 beta ATCC 67024), also are 
advantageously used with yeast promoters. 

20 Expression In Vaccinia 

The modified M2 polypeptides may also be expressed in vaccinia virus. 
Paoletti, et al (U.S. Patent Nos. 4,722,848 and 5,110,587) describe a general method 
wherein exogenous DNA sequences are introduced into nonessential regions of the vaccinia 
virus genome, thereby effecting expression of said exogenous sequences. Paoletti, et al 

25 (U.S. Patent No. 5174,993) describes a method for inducing an immunological response in a 
mammal to a pathogen by incorporation of exogenous DNA sequences derived from the 
pathogen into avipox virus. The teachings of these patents are hereby incorporated in their 
entirety be reference. The method of these patents may readily be modified to incorporate 
modified M2 polypeptide sequences of the present invention. 

30 Expression By Naked DNA 

The modified M2 polypeptides may also be expressed in vivo using the "naked DNA" 
approach as described by Feigner, et al (U.S. Patent No. 5,589,466, 5,703,055, and 

13 



WO 99/28478 PCT/US98/1 6379 

5,580,859). This approach entails delivery (typically by injection) of isolated nucleic acids 

into mammalian tissue, resulting in transient expression of the injected nucleic acids. 

Transient expression of foreign genes in mammalian tissue invokes an immune response 

which can be protective. The teachings of this patent are hereby incorporated in their entirety 

5 by reference and may readily be modified for use with the modified M2 polypeptide 

sequences of the present invention. 

In another aspect, the invention comprises immunogenic compositions, including 
vaccines. Such immunogenic compositions comprise a modified M2 protein according to the 
first aspect of the invention and may be prepared as injectables, as liquid solutions, 

10 suspensions or emulsions. The active immunogenic ingredient or ingredients may be mixed 
with pharmaceutically acceptable excipients which are compatible therewith. Such excipients 
may include water, saline, dextrose, glycerol, ethanol, and combinations thereof. The 
immunogenic compositions and vaccines may further contain auxiliary substances, such as 
wetting or emulsifying agents, pH buffering agents, or adjuvants to enhance the effectiveness 

15 thereof. Immunogenic compositions and vaccines may be administered parenterally, by 
injection subcutaneously or intramuscularly. Alternatively, the immunogenic compositions 
formed according to the present invention, may be formulated and delivered in a manner to 
evoke an immune response at mucosal surfaces. Thus, the immunogenic composition may be 
administered to mucosal surfaces by, for example, the nasal or oral (intragastric) routes. 

20 Alternatively, other modes of administration including suppositories and oral formulations 
may be desirable. For suppositories, binders and carriers may include, for example, 
polyalkalene glycols or triglycerides. Such suppositories may be formed from mixtures 
containing the active ingredient(s) in the range of about 0.5 to about 10%, preferably about 1 
to 2%. Oral formulations may include normally employed incipients such as, pharmaceutical 

25 grades of saccharine, cellulose and magnesium carbonate. These compositions can take the 
form of solutions, suspensions, tablets, pills, capsules, sustained release formulations or 
powders and contain about 1 to 95% of the active ingredient(s), preferably about 20 to about 
75%. 

The immunogenic preparations and vaccines are administered in a manner compatible 
30 with the dosage formulation, and in such amount as will be therapeutically effective, 
protective and immunogenic. The quantity to be administered depends on the subject to be 
treated, including, for example, the capacity of the individual's immune system to synthesize 
antibodies, the degree of protection desired, and if needed, to produce a cell-mediated 

14 



WO 99/28478 PCT/US98/16379 
immune response. Precise amounts of active ingredient required to be administered depend 

on the judgment of the practitioner. However, suitable dosage ranges are readily 

determinable by one skilled in the art and may be of the order of micrograms of the active 

ingredient(s) per vaccination. Suitable regimes for initial administration and booster doses 

5 are also variable, but may include an initial administration followed by subsequent 

administrations. The dosage may also depend on the route of administration and will vary 

according to the size of the host. 

The concentration of the active ingredient protein in an immunogenic composition 

according to the invention is in general about 1 to 95%. A vaccine which contains antigenic 

10 material of only one pathogen is a monovalent vaccine. Vaccines which contain antigenic 
material of several pathogens are combined vaccines and are also contemplated by the present 
invention. Such combined vaccines contain, for example, material from various pathogens or 
from various strains of the same pathogen, or from combinations of various pathogens. 

Immunogenicity can be significantly improved if the antigens are co-administered 

15 with adjuvants, commonly used as 0.05 to 0.1 percent solution in phosphate-buffered saline. 
Adjuvants enhance the immunogenicity of an antigen but are not necessarily immunogenic 
themselves. Adjuvants may act by retaining the antigen locally near the site of administration 
to produce a depot effect facilitating a slow, sustained release of antigen to cells of the 
immune system. Adjuvants can also attract cells of the immune system to an antigen depot 

20 and stimulate such cells to elicit immune responses. 

Immunostimulatory agents or adjuvants have been used for many years to improve the 
host immune responses to, for example, vaccines. Intrinsic adjuvants, such as 
lipopolysaccharides, normally are the components of the killed or attenuated bacteria used as 
vaccines. Extrinsic adjuvants are immunomodulatory which are typically non-covalently 

25 linked to antigens and are formulated to enhance the host immune responses. Thus, adjuvants 
have been identified that enhance the immune response to antigens delivered parenterally. 
Some of these adjuvants are toxic, however, and can cause undesirable side-effects, making 
them unsuitable for use in humans and many animals. Indeed, only aluminum hydroxide and 
aluminum phosphate (collectively commonly referred to as alum) are routinely used as 

30 adjuvants in human and veterinary vaccines. The efficacy of alum in increasing antibody 
responses to diphtheria and tetanus toxoids is well established and a HBsAg vaccine has been 
adjuvanted with alum. A wide range of extrinsic adjuvants can provoke potent immune 
responses to antigens. These include saponins complexed to membrane protein antigens 



15 



WO 99/28478 PCT/US98/1 6379 

(immune stimulating complexes), pluronic polymers with mineral oil, killed mycobacteria in 

mineral oil, Fremiti's complete adjuvant, bacterial products, such as muramyl dipeptide 

(MDP) and lipopolysaccharide (LPS), as well as lipid A, and liposomes. 

To efficiently induce humoral immune responses (HIR) and cell-mediated immunity 

5 (CMI), immunogens are often emulsified in adjuvants. Many adjuvants are toxic, inducing 

granulomas, acute and chronic inflammations (Freund's complete adjuvant, FCA), cytolysis 

(saponins and pluronic polymers) and pyrogenicity, arthritis and anterior uveitis (LIPS and 

MDP). Although FCA is an excellent adjuvant and widely used in research, it is not licensed 

for use in human or veterinary vaccines because of its toxicity. 

10 Desirable characteristics of ideal adjuvants include: 

(1) lack of toxicity; 

(2) ability to stimulate a long-lasting immune response; 

(3) simplicity of manufacture and stability in long-term storage; 

(4) ability to elicit both CMI and HIR to antigens administered by various routes, 
15 if required; 

(5) synergy with other adjuvants; 

(6) capability of selectively interacting with populations of antigen presenting 
cells (APC); 

(7) ability to specifically elicit appropriate ThI or Th2 cell-specific immune 
20 responses; and 

(8) ability to selectively increase appropriate antibody isotype levels (for example, 
IgA) against antigens. 

US Patent No. 4,855,283 granted to Lockhoff et al on August 8, 1989 which is 
incorporated herein by reference thereto teaches glycolipid analogues including N- 

25 glycosylamides, N-glycosylureas and N-glycosylcarbamates, each of which is substituted in 
the sugar residue by an amino acid, as immuno-modulators or adjuvants. Thus, Lockhoff et 
al. (US Patent No. 4,855,283 and ref. 32) reported that N-glycolipid analogs displaying 
structural similarities to the naturally-occurring glycolipids. such as glycosphingolipids and 
glycoglycerolipids, are capable of eliciting strong immune responses in both herpes simplex 

30 virus vaccine and pseudorabies virus vaccine. Some glycolipids have been synthesized from 
long-chain-alkylamines and fatty acids that are linked directly with the sugars through the 
anomeric carbon atom, to mimic the functions of the naturally occurring lipid residues. 



16 



WO 99/28478 PCT/US98/ 16379 

U.S. Patent No. 4,258,029 teaches that octadecyl tyrosine hydrochloride (OTH) 

functioned as an adjuvant when complexed with tetanus toxoid and formalin inactivated type 

I, II and III poliomyelitis virus vaccine. Also, Nixon-George et al. reported that octadecyl 

esters of aromatic amino acids complexed with a recombinant hepatitis B surface antigen, 

5 enhanced the host immune responses against hepatitis B virus. 

The choice of adjuvant or combination of adjuvants is entirely within the skills of the 
ordinarily skilled immunologist. The adjuvants discussed above included adjuvants useful in 
experimental settings as well as adjuvants of potential human or veterinary application. The 
influenza A vaccines of the invention can be formulated using any of the aforementioned 
10 adjuvants and as such the use of any of the adjuvants in combination or in conjunction with 
the modified M2 polypeptides of the invention is contemplated by and is thus within the 
scope of the present invention. 

In another aspect, the invention comprises methods of generating antibodies to M2 
and the antibodies thereby produced, the method comprising administering to a subject 
15 capable of producing antibodies to M2 a composition according to the invention (which 
composition comprises a modified M2 protein according to the invention) and collecting 
antibodies to M2 from the subject. 

In another aspect, the invention provides methods for determining current or previous 
exposure of a subject to influenza virus, the method comprising contacting a sample from the 
20 subject with a modified M2 protein according to the first aspect of the invention and detecting 
the binding of antibodies to the modified M2 protein. The presence of antibodies indicates 
current or previous exposure of the subject to influenza. 

In another aspect, the invention provides methods for limiting viral influenza A 
infection in a subject, the method comprising administering to the subject a prophylactically 
25 effective amount of a modified M2 protein-containing composition according to the 
invention. Prophylactic amounts of the composition can be determined routinely. 

In yet another aspect, the invention provides methods of treating a subject suffering 
from viral influenza A infection, the method comprising administering to the subject a 
therapeutically effective amount of the 

30 The following examples are provided for illustrative purposes only and are not 

intended, nor should they be construed, as limiting the invention in any manner. 



17 



WO 99/28478 PCT/US98/16379 

EXAMPLES 

Example 1 

PCR and plasmid construction 
Full length and truncated forms of M2 cDNA were made by PCR from RNA of 

5 A/Aichi/2/68 (H3N2) virus. Figure 1 shows schematic diagrams of M2 and the deletion 
constructs sM2 and ssM2. Each diagram shows a boxed diagram of the M2 structure and the 
area deleted. Below each are the oligonucleotide primer positions used in constructing the 
cDNAs. F(l) is forward primer 1, F(2) forward primer 2, R(l) reverse primer 1, (R2) reverse 
primer 2. (A) The M2 amino acid sequence is represented in three boxes, an extracellular 

10 domain, a darkened transmembrane domain, and an intracellular domain. Notations within 
these boxes include epitopes or post-translational modifications which have been described 
for M2: (<>) epitope for Mab 14C2; vertical dashed lines are cysteine sulfhydryl linkages; (p) 
is a palmitoylation site; and (*) is a phosphorylation site. (B) sM2 shows a deletion between 
Pro(25) and Asp(44). The deletion is performed with primer annealment indicated with 

15 vertical lines. ssM2 has a deletion between Pro(25) to Glu(56). 

Four oligonucleotide primers were designed to generate cDNA. Forward- 1 primer 
(5'-CCCGAATTCTTATGAGCCTTCTAACCGAGGTCGAAACGCCTATCAGAAACGA- 
ATGGGGATGC-3') (SEQ ID NO: 1) was specific for the 5' coding region of the M2 gene 
(nucleotides 1-51) and began with a 5' EcoRl restriction site. The reverse-1 primer (5'- 

20 GTCTTTGCTTACCCCTACGTCTACGTTGCTAAGTTCACTAGGACCTCCTCCC-3') 

(SEQ ID NO: 2) [3'-CCCTCCTCCAGGATCACTTGAATCGTTGCATCTGCATCCCC- 
ATTCGTTTCTG-5 ' ] coded for 3' amplification from nucleotide 75. The forward-2 primer 
(sM2, 5'-CAAGTGATCCTGGAGGAGGAGATCGTCTCTTCTTCAAATGC-3' (SEQ ID 
NO: 3); ssM2, 5'-CAAGTGATCCTGGAGGAGGAAAACACGGTCTGAAAAGAGGGCC- 

25 3' (SEQ ID NO: 5)) was varied to flank areas chosen for deletion and contained a 5' region 
homologous to the reverse-1 primer to allow annealing. These primers also coded for three 
glycine residues inserted in place of the deleted segments. The reverse-2 primer (3'- 
CTATCAGTAAAGCAGTCGTATCTCGACC-TCATCAGCTGCCC-5') (SEQ ID NO: 4) 
[ 5 ' -CCC GTCG ACT ACTCC AGCTCT ATGCTG ACG AAATG AC-T ATC-3 ' ] coded for the 3' 

30 end of M2 and provided a 3' Sail restriction site. Full-length M2 cDNA was prepared by 
RT-PCR using forward -1 and reverse -2 primers. For deletion constructs, "5' side" and "3' 
side" reactions were carried out, annealed, then amplified to produce full length M2 or 



18 



WO 99/28478 PCT/US98/16379 
deletion cDNAs. These were digested with EcoRl and Sail, purified by gel electrophoresis 

and ligated into EcoRl and Sail sites of a plasmid vector, pGEX-5X a (Pharmacia, Piscataway, 

NJ). The construct which has been designated sM2 has a deletion between amino acids 25 

and 44 of native M2. The construct designated ssM2 has a deletion between amino acids 25 

5 and 56 of native M2. Plasmids were transformed into competent E. colt strain JM109 

(Stratagene, La Jolla, CA). Plasmid sequences were verified by automated nucleotide 

sequence analysis using standard protocols. 

Example 2 

Expression and isolation of fusion protein 

10 The pGEX vector ( Pharmacia, Piscataway, NJ) was chosen to express the constructs, 

and allows purification of the products with a simple affinity matrix. pGEX is designed to 
express, under control of the inducible tac promoter, glutathione S-transferase (GST; from 
Schistosoma japonicum) as a 29 kDa fusion to the N-terminus of a subcloned sequence 
(Smith and Johnson, 1988). The fusion protein can be purified from bacterial lysates by 

15 affinity chromatography using glutathione sepharose® 4B. The fusion product may also be 
separated by a site-specific protease, Factor Xa, whose site is immediately downstream of the 
C-terminus of the GST. 

Soluble fusion proteins 

Cells were grown from frozen stocks in overnight cultures of Luria broth (LB) 
20 containing 100 (a.g/ml ampicillin. This culture was then diluted 1:10 the next morning and 
grown for 1.5 hr at 37°C with vigorous shaking. IPTG (isopropyl P-D-thiogalactoside) was 
then added to a final concentration of 0.1 mM and incubation continued for 3-4 hrs. To 
monitor cell growth an aliquot of culture was taken every 0.5 hr after the initial dilution and 
cell density (A 600 nm ) was measured over the induction period. Cells were pelleted by 
25 centrifugation and resuspended in cold lysis buffer (50 Tris, 100 NaCl, 1 EDTA, pH 8.0). 
Lysozyme was added to 1 mg/ml and phenylmethylsulfonylfluoride (PMSF) added to a 
concentration of 0.5 mM. The suspension was kept on ice for 15 min. Dithiothreitol (DTT) 
was added to a concentration of 5 mM, and the suspension was lysed by sonication (probe- 
tip) on ice for 1 min. Triton X-100 was added to a concentration of 1% and the lysate was 
30 mixed gently for 0.5 hr. The lysate was then centrifuged at 12,000 x g for 10 min at 4°C. 
The supernatant was decanted and added to a washed glutathione sepharose® (Pharmacia, 
Piscataway, NJ) slurry (50% v/v in phosphate-buffered saline (PBS)), with the slurry volume 

19 



WO 99/28478 PCT/US98/1 6379 

being equal to 0.2% of the original bacterial culture volume. This mixture was gently stirred 

for 30 min. The sepharose® was then pelleted, the supernatant removed and discarded. The 

sepharose® was washed a minimum of three times in PBS. Fusion protein was eluted from 

the sepharose® pellet by addition of elution buffer (50 Tris, 10 reduced glutathione, pH 8.0) 

using a volume equal to the bed volume of sepharose®. The elution buffer/resin mixture was 

mixed for 15 min at room temperature, then pelleted at 500 x g for 5 min. The supernatant 

was harvested and a second elution was performed for residual product. 

To enzymatically cleave ssM2 from the GST moiety the fusion product was left 

bound to sepharose® and treated overnight with 10 |LXg of Factor Xa (New England Biolabs, 

Beverly, MA) at 4°C. The sepharose® with bound GST was spun down, and the supernatant, 

containing the released ssM2, was harvested. 

Insoluble fusion proteins 

The insoluble forms of M2 were isolated using the above protocol with the suggested 
additions of Frangioni and Neel (1993), which include: (1) introduction of 1.5% sarkosyl 
prior to sonication and (2) raising the concentration of Triton X-100 to 4%. PBS washes of 
the bound glutathione sepharose® and the elution buffer contained 0.1% Triton X-100. 

Example 3 

Electrophoresis and western blotting 
Expressed proteins were analyzed for size and purity on an SDS-12%- polyacrylamide 
gel, followed by staining with Coomassie brilliant blue R-250. Figure 3 (A) shows an SDS- 
PAGE gel of recombinant proteins. Lanes are: (1) molecular weight markers (2) a sample 
from the crude bacterial lysate of an induced sM2/G culture (3) a purified sample of GST 
protein (4) sM2/G protein (6) ssM2 protein which is isolated by cleaving ssM2/G with factor 
Xa protease. Molecular weights were compared to low molecular weight Rainbow Markers 
(Amersham International, Arlington Heights, IL.). For immunoblotting, gels were transferred 
to Immobilon-P membrane (Millipore, Bedford, MA) using a semi-dry transblot apparatus 
(Bio-Rad, Richmond, CA). Membranes were immunoblotted with a 1:5000 dilution of ascitic 
fluid containing the M2-specific antibody 14C2, followed by labeling with the ECL system 
(Amersham International, Arlington Heights, IL.) and exposure to X-ray film. Figure 3 (B) 
shows a Western blot of GST, sM2/G and ssM2/G using 14C2 as the primary antibody. 



20 



WO 99/28478 PCT/US98/16379 

Example 4 

Animal vaccination and challenge 

Fusion proteins or control GST protein were added to equal volumes of PBS and 

incomplete Freund's adjuvant. A volume of 0.2 ml, containing 10 jig of protein was injected 

5 intraperitoneal^ (i.p.) into female BALB/c mice, aged 6-12 weeks. Boosts were given after 3 

and 6 weeks for a total of 3 inoculations. Animals were bled from the orbital plexus at weeks 

6 and 9 and individual sera were tested for antibodies which would react with a synthetic 

peptide composed of the first 17 amino acids of M2 (peptide PM 2 -1, Slepushkin et al. 9 1995). 

Antibody binding was detected on peptide-coated ELISA plates by adding horseradish 

10 peroxidase-conjugated anti-mouse Ig and o-phenylenediaminehydrochloride and hydrogen 

peroxide as colorimetric substrates. Titers are expressed as the highest dilution which yielded 

an optical density (OD) 490 two times higher than a similarly diluted control sera. 

Following inoculations, mice were subjected to sub-lethal challenge by heterologous 

influenza A virus. Mice were anesthetized with C0 2 and were infected intranasally (i.n.) with 

15 100 mouse infectious doses (MID) 50 of MA AJ Ann Arbor/6/60 (H2N2) virus or 

A/Taiwan/1/86 (H1N1) [equivalent to5.3 xlO 6 and 1.3 x 10 s egg infectious doses (EID) 50 

respectively] in a volume of 50 ^il of PBS. Mice were euthanized seven days after challenge. 

Lung homogenates were prepared and titrated into embryonated eggs for virus infectivity. 

Statistical significance of the data was determined using the Fisher exact test or Student's t 

20 test. 

Example S 

Expression of recombinant M2 and M2 transmembrane deletants 
The effects of expression of GST-fusion M2/G, sM2/G, ssM2/G, and GST on cell 
viability was tested at various times following induction of E. coli JM109 cells containing the 

25 respective pGEX constructs (Fig.2). Overnight cultures were diluted 1:100, reamplified for 2 
hrs, and then induced with IPTG. At the time of induction the density of the M2/G culture 
was consistently lower than other cultures, presumably due to basal expression of the protein. 
The density of cells expressing full-length M2/G rose only marginally after induction, 
consistent with the reported lytic properties of M2 when expressed in E coli (Guinea and 

30 Carrasco, 1994). Addition of 5 (J.M amantadine to the culture media did not accelerate this 
growth pattern, and little, if any, M2/G fusion protein was obtainable from these cultures. In 
comparison, cultures of sM2/G and ssM2/G maintained a robust pattern of growth 
comparable to that of the control culture and the GST control protein. 

21 



WO 99/28478 PCT/US98/16379 
The first deletion construct, which removes the transmembrane domain of M2 
(sM2/G, residues 26-43), although expressing well, yielded no purified fusion protein with a 
standard lysis protocol, suggesting that it remained insoluble or in aggregated form. 
Adopting the sarkosyl protocol produced a modest yield of ~3 mg of fusion protein/L of 
bacterial culture, as determined by Bradford protein assay. Further deletion, from residue 26 
to 55 (ssM2/G), was found to substantially improve fusion protein yield without the sarkosyl 
procedure, suggesting a soluble product. Residues 44-55 of mature M2 are all hydrophobic 
and contribute to a positive hydrophobic index for M2 in Kyte-Doolittle analysis (Lamb et al. 9 
1985). Values of up to 15 mg/L of culture are routinely achieved, with the purity of the 
fusion proteins in either preparation being >90%. 

Example 6 

SDS-PAGE and Western Blot 
GST and fusion proteins were electrophoresed on polyacrylamide gels and either 
stained with Coomassie blue or prepared for immunoblotting. In Fig. 3 (A) a Coomassie 
stained gel is shown. A total protein sample from induced cells taken in the initial phase of 
the lysate is included (lane 2). GST (lane 3), from an induction of pGEX without M2 insert, 
is observed as a 29 kDa protein. Fusion proteins, sM2/G (lane 4) and ssM2/G (lane 5) are 
found at approximately 43 kDa. Panel (B) shows proteins run on a gel simultaneously with 
(A) , transferred to Immobilon-P membrane, and immunoblotted with M2-specific antibody 
14C2. Proteins with an approximate weight of 43 kDa reacted with 14C2. GST is not 
visualized in the blot. Together, these results suggest that the 14C2 antibody epitope of the 
M2 deletion proteins is not obstructed by the fusion construction and that 14C2 is binding 
exclusively to the M2 domain. 

Example 7 

Immunogenic and protective properties of recombinant fusion proteins 
The immunogenicity and protective efficacy of several M2 constructs were tested by 
vaccinating groups of BALB/c mice with sM2/G, ssM2/G, and enzymatically isolated ssM2 
recombinant proteins. GST peptide was administered as a control. Results are shown in 
Table 1. 



22 



WO 99/28478 PCT/US98/1 6379 

Table 1 



Virus challenge of mice vaccinated with M2 constructs 



Expt. 


Vaccine 


n 


Serum antibody titer 


Lung virus titer 


1 


GST 


7 


<50 


6.5±0.6 (AA/60) 


2 


GST 


5 


<50 


6.6±0.9 (AA/60) 


3 


PBS 


5 


<50 


6.8±0.4 (AA/60) 


1 


sM2/G 


7 


152,054 


2.6±0.6 (AA/60) 


2 


sM2/G 


5 


19,390 


2.2±1.5 (AA/60) 


2 


ssM2/G 


5 


11,138 


2.9±1.4 (AA/60) 


3 


ssM2 


7 


123,838 


3.2±0.7 (AA/60) 


4 


PBS 


4 


<50 


7.4±0.7 (AA/60) 


4 


GST 


5 


<50 


6.4±0.6 (AA/60) 


4 


PBS 


3 


<50 


7.0±0.6 (TW/86) 


4 


GST 


6 


<50 


7.0±1.0 (TW/86) 


4 


sM2/G 


5 


131,825 


3.0±0.8 (AA/60) 


4 


sM2/G 


6 


131,825 


3.7±0.5 (TW/86) 


4 


ssM2 


5 


1,202,264 


3.2±1.2 (AA/60) 


4 


ssM2 


6 


1,202,264 


3.6±0.5 (TW/86) 



Challenge viruses were mouse adapted A/AA/6/60 (H2N2) and A/Taiwan/ 1/8 6 (H1N1). 
All vaccinations were 3 x 10 ug of antigen, in Incomplete Freund's adjuvant. 
5 a titers are expressed as the highest dilution of sera having a mean (OD 490 greater than the mean plus two 
standard deviations of similarly diluted control sera. 

b Mean Log| 0 EID S0 /ml ± SD. Values for all virus titer reductions were significantly lower than control groups 
by Students /-test (p<0.001). 

Groups of 5 to 7 mice were vaccinated as described above and analyzed for serum 
10 antibody which could recognize a synthetic peptide designed to mimic the extracellular 
domain of M2. Sera from mice vaccinated with GST control peptide showed no detectable 
(<50) antibody titer in any samples prior to challenge. However, groups vaccinated with 
sM2/G, ssM2/G, and ssM2 proteins showed elevated titers after two inoculations and a third 



23 



WO 99/28478 PCT/US98/16379 
inoculation boosted the mean serum antibody titers for each group substantially. 

Surprisingly, deletion of the transmembrane region and additional hydrophobic residues of 

M2 does not appear to alter the immunological properties of the variant polypeptide, making 

such variant polypeptides suitable candidates for vaccines. 

For virus challenge, mice vaccinated with either GST, sM2/G, ssM2/G, or ssM2 were 

challenged with heterologous MA A/ Ann Arbor/6/60 (H2N2) or A/Taiwan/1/86 (H1N1) virus 

4 weeks after their final boost. After 7 days the mice were euthanized, and lungs were 

harvested. Lung virus titers for the sM2/G and ssM2/G fusion protein groups, and isolated 

ssM2, were over 1000-fold lower than the PBS or GST protein control groups (Table 2). No 

significant difference was found between the sM2/G, ssM2/G, and ssM2 protective effect. 

This trend demonstrates a potential of the altered M2 peptides to protect against virus 

challenge, as has been shown for full-length baculovirus M2. Immunogenic compositions, 

suitable to be used as vaccines, may be prepared from immunogenic M2 as disclosed herein. 

Preferably, the antigenic material is extensively dialyzed to remove undesired small 

molecular weight molecules and/or lyophilized for more ready formulation into a desired 

vehicle. The immunogenic composition elicits an immune response which produces 

antibodies, including M2 antibodies which may inhibit viral replication, and also influenza A 

virus-specific cell-mediated immune responses. 

The protocols and discussion provided above are sufficient to enable skilled workers 

in the field to reproduce the claimed inventions. The present inventors supplement the 

disclosure by listing scientific publications pertinent to the protocols and materials used to 

convey the present invention. 

REFERENCES 

Banerji, J. L. et al. 9 (1983) Cell 33:729. 

Black, R. A., Rota, P. A., Gorodkova, N., Cramer, A., Klenk, H. D. & Kendal, A. P. 
(1993) Production of the M2 protein of influenza A virus in insect cells is enhanced in the 
presence of amantadine. Journal of General Virology 74, 1673-1677. 

Black, R. A., Rota, P. A., Gorodkova, N., Klenk, H. D. & Kendal, A. P. (1993) 
Antibody response of M2 protein of influenza A virus expressed in insect cells. Journal of 
General. Virology 74, 143-146. 

Bolivar, et aL, (1977) Gene 2: 95. 

Brophy, P. M. & Pritchard, D. I. (1994) Parasitic helminth glutathione ^-transferases: 
an update 



24 



WO 99/28478 PCT/US98/1 6379 

on their potential as targets for immuno- and chemotherapy. Experimental 

Parasitology 79, 89-96. 

Brown, et ah (1979). Methods in Enzymology, Academic Press, N.Y., Vol. 68, pgs. 

109-151. 

5 Carter P., (1990) Site Specific Proteolysis of Fusion Proteins, Ch. 13 in Protein 

Purification: From Molecular Mechanisms to Large Scale Processes , American Chemical 
Soc, Washington, D.C. 

Chang, et ah, (1978) Nature, 275:615. 

Ciampor, F., Thompson, C. A., Grambas, S. & Hay, A. J. (19926) Regulation of pH 
10 by the M2 protein of influenza A viruses. Vims Research 22, 247-258. 

Cox, N. J. & Bender, C. A. (1995) The molecular epidemiology of influenza viruses. 
Seminars in Virology 6, 359-370. 

Epstein, S. L., Misplon, J. A., Lawson, C. M., Subbarao, E. K., Connors, M. & 
Murphy, B. R. (1993) p 2-microglobulin-deficient mice can be protected against influenza 
15 A infection by vaccination with vaccinia-influenza recombinants expressing hemagglutinin 
and neuraminidase. Journal of Immunology 150, 5484-5493. 
Fiers, et ah, (1978) Nature, 273:113 

Fikrig, E., Barthold, S. W., Kantor, F. S. & Flavell, R. A. (1990) Protection of mice 
against the lyme disease agent by immunizing with recombinant OspA. Science 250, 553- 
20 555. 

Frangioni, J. V. & Neel, B. G. (1993) Solubilization and purification of enzymatically 
active glutathione ^-transferase pGEX fusion proteins. Analytical Biochemistry. 210, 179- 
187. 

Goeddel, et ah, (1979) Nature 281:544. 
25 Graham, F. L. et ah (1977) J. Gen Virol. 36:59-72, Virology 77:319-329, Virology 

86:10-21. 

Grambas, S. & Hay, A. J. (1992) Maturation of influenza A virus hemagglutinin - 
estimates of the pH encountered during transport and its regulation by the M2 protein. 
Virology 190, 11-18. 

30 Guinea, R. & Carrasco, L. (1994) Influenza virus M2 protein modifies membrane 

permeability in E. coli cells. FEBS Letters 343, 242-246. 



25 



WO 99/28478 PCT/US98/16379 
Holsinger, L. J., Shaughnessy, M. A., Micko, A., Pinto, L. H. & Lamb, R. A. (1995) 

Analysis of the posttranslational modifications of the influenza virus M2 protein. Journal of 

Virology 69, 1219-1225. 

Hughey, P. G., Roberts, P. C, Holsinger, L. J., Zebedee, S. L., Lamb, R. A. & 
Compans, R. W. (1995) Effects of antibody to the influenza A virus M2 protein on M2 
surface expression and virus assembly. Virology 212, 411-421. 

Ito, T., Gorman, O. T., Kawaoka, Y, Bean, W. J. & Webster, R. G. (1991) 
Evolutionary analysis of the influenza A virus M gene with comparison of the Ml and M2 
proteins. Journal of Virology 65, 5491-5498. 

Jacob, C. O., Leitner, M., Zamir, A., Salomon, D. & Arnon, R. (1985) Priming 
immunization against cholera toxin and E. Coli heat-labile toxin by a cholera toxin short 
peptide-beta-galactosidase hybrid synthesized in E. Coli. Embo Journal 4, 3339-3343. 

Jakeman, K. J., Smith, H. & Sweet, C. (1989) Mechanism of immunity to influenza: 
maternal and passive neonatal protection following immunization of adult ferrets with a live 
vaccinia-influenza virus hemagglutinin recombinant but not with recombinants containing 
other influenza virus proteins. Journal of General Virology 70, 1523-1531*. 

Johnson, K. S., Harrison, G. B. L., Lightowlers, M. W., O'Hoy, K. L., Cougle, W. G., 
Dempster, R. P., Lawrence, S. B„ Vinton, J. G., Heath, D. D. & Rickard, M. D. (1989) 
Vaccination against ovine cysticercosis using a defined recombinant antigen. Nature 338, 
585-587. 

Jones (1977), Genetics 85:12. 

Katz, J.M., Black, R.A., Rowe, T., Slepushkin, V.A. and Cox, NJ. (1996). Immune 
mechanisms of protection induced by vaccination of Balb/c mice with influenza A virus M2 
protein, pp. 837-43, In: Options for the Control of Influenza III, (L.E. Brown, A.W. 
Hampson, 

R.G. Webster, eds.), Elsevier Science, Amsterdam. 
Kingsman, et aL, (1979) Gene 7:141. 

Kleid, D. G., Yansura, D., Small, B., Dowbenko, D., Moore, D. M., Grubman, M. J., 
McKercher, P. D., Morgan, D. O., Robertson, B. H. & Bachrach H. L. (1981) Cloned viral 
protein vaccine for foot-and-mouth disease: responses in cattle and swine. Science 214, 1125- 
1129. 

Laimins, L. et aL, (1981) PNAS 78:993. 



26 



WO 99/28478 PCT/US98/16379 
Lamb, R. A., Zebedee, S. L. & Richardson, C. D. (1985) Influenza virus M2 protein is 

an integral membrane protein expressed on the infected cell surface. Cell 40, 627-633. 

Ling, I. T., Ogun, S. A. & Holder, A. A. (1994) Immunization against malaria with a 
recombinant protein. Parasite Immunology 16, 63-67. 

Lusky, M. L., et al, (1983) Mol. Cell Bio. 3:1 108. 

Maclntyre, et a/.,(1987) J.Biol.Chem. 262:8416-8422. 

Maniatis, et ah (1989). Molecular Cloning: A Laboratory Manual . Cold Spring 
Harbor Press, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. 
Mulligan, R. C. and Berg, P. (1980) Science 209:1422. 
Nixon-George et al. 

Osborne, T. F., et al, (1984) Mol. Cell Bio. 4:1293. 

Shimbo, K., Brassard, D. L., Lamb, R. A. & Pinto, L. H. (1996) Ion selectivity and 
activation of the M2 Ion channel of influenza virus. Biophysical Journal 70, 1335-1346. 

Slepushkin, V. A., Katz, J. M., Black, R. A., Gamble, W. C, Rota, P. A. & Cox, N. J. 
(1995) Protection of mice against influenza A virus by vaccination with baculo virus 
expressed M2 protein. Vaccine 15, 1399-1402. 

Smith, D. B. & Johnson, K. S. (1988) Single-step purification of polypeptides 
expressed in Escherichia coli as fusions with glutathione s-transferase. Gene 67, 3 1-40. 

Southern P. and Berg, P., (1982) J. Molec. Appl. Genet. 1: 327. 

Stinchcomb, et al, (1979) Nature 282:39. 

Srivastava, A. K., Morita, K., Matsuo, S., Tanaka, M. & Igarashi, A. (1991) Japanese 
encephalitis virus fusion protein expressed in Escherichia coli confers protective immunity in 
mice. Microbiological Immunology 35, 863-870. 

Srivastava, A. K., Putnak, J. R., Warren, R. L. & Hoke, C. H. (1995) Mice immunized 
with a dengue type 2 virus E and NS 1 fusion protein made in Escherichia coli are protected 
against lethal dengue virus infection. Vaccine 13, 1251-1258. 

Sugden, B. et al, (1985) Mol Cell. Biol. 5:410-413 

Sugrue, R. J., Bahadur, G., Zambon, M. C, Hall-Smith, M., Douglas, A. R. & Hay, A. 
J. (1990) Specific structural alteration of the influenza hemagglutinin by amantadine. Embo 
Journal 9, 3469-3476. 

Summers, R.G., et al (1989) J.Biol.Chem. 264:20082-20088. 

Tosteson, M. T., Pinto, L. H., Holsinger, L. J. & Lamb, R. A. (1994) Reconstitution of 
the influenza virus M2 channel in lipid bilayers. Journal of Membrane Biology 142, 1 17-126. 



27 



WO 99/28478 PCT/US98/16379 
Treanor, J. J., Tierney, E. L., Zebedee, S. L., Lamb, R. A. & Murphy, B. R. (1990) 

Passively transferred monoclonal antibody to the M2 protein inhibits influenza A virus 

replication in mice. Journal of Virology 64, 1375-1377. 

Tschemper et al. 9 (1980) Gene K):157. 

von Heijne, G. (1990) J. Membrane Biol. H5: 195-201 

Wilson, I. A. & Cox, N. J. (1990) Structural basis of immune recognition of influenza 
hemagglutinin. Annual Reviews in Immunology 8, 737-771. 

Yamane, K., et al (1988) J.Biol.Chem. 263:19690-19696. 

Zebedee, S. L. & Lamb, R. A. (1988) Influenza A virus M2 protein: monoclonal 
antibody restriction of virus growth and detection of M2 in virions. Journal of Virology 62, 
2762-2772. 



28 



WO 99/28478 



PCT/US98/I6379 



We claim: 

1. A modified M2 polypeptide with reduced hydrophobicity and enhanced recombinant 
expression relative to a native M2, the modified M2 polypeptide comprising a sequence 
of amino acids identical to a native M2 protein in which the transmembrane region and 
from 0 to 12 amino acid residues adjacent to the transmembrane region on the C-terminal 
side have been deleted. 

2. The modified M2 polypeptide of claim 1, wherein the transmembrane region and none of 
the adjacent residues on the C-terminus side of the transmembrane region have been 
deleted. 

3. The modified M2 polypeptide of claim 1, wherein the transmembrane region and the 
adjacent 12 amino acids on the C-terminal side of the transmembrane region have been 
deleted. 

4. The modified M2 polypeptide of claim 1, wherein the native M2 protein is from the 
A/Aichi/2/68 (H3N2) virus. 

5. The modified M2 polypeptide of claim 4, wherein amino acids 26-43 have been deleted. 

6. The modified M2 polypeptide of claim 4, wherein amino acids 26-55 have been deleted. 

7. The modified M2 polypeptide of any one of claims 1 to 6, wherein the deleted amino acid 
residues are replaced one or more neutral or hydrophilic amino acid residues, provided 
that the total number of amino acid residues in the modified M2 polypeptide is less than 
or equal to the number in the native M2 polypeptide. 

8. The modified M2 polypeptide of claim 7, wherein all of the deleted amino acids are 
replaced with from one to six glycine residues. 

9. A modified M2 polypeptide with reduced hydrophobicity and enhanced recombinant 
expression relative to a native M2, the modified M2 polypeptide comprising a sequence 
of amino acids identical to a native M2 protein in which from one to all of the amino acid 
residues of the transmembrane region and from 0 to 12 amino acid residues adjacent to 
the transmembrane region on the C-terminal side have substituted with neutral or 
hydrophilic amino acid residues. 



29 



WO 99/28478 PCT/US98/ 16379 

10. The modified M2 polypeptide of claim 9, wherein all of the amino acid residues of the 

transmembrane region have been substituted with neutral or hydrophilic residues. 

11. The modified M2 polypeptide of claim 9, wherein all of the amino acid residues of the 
transmembrane region and from one to twelve amino acids adjacent to the transmembrane 
region on the C-terminal side have been substituted with neutral or hydrophilic residues. 

12. The modified M2 polypeptide of any one of claims 9 to 1 1, wherein the native M2 protein 
is from the A/Aichi/2/68 (H3N2) virus. 

13. A modified M2 polypeptide fusion protein comprising a modified M2 polypeptide fusion 
protein according to and one of claims 1 to 6. 

14. A modified M2 polypeptide fusion protein comprising a modified M2 polypeptide fusion 
protein according to claim 7. 

15. A modified M2 polypeptide fusion protein comprising a modified M2 polypeptide fusion 
protein according to claim 8. 

16. A modified M2 polypeptide fusion protein comprising a modified M2 polypeptide fusion 
protein according to and one of claims 9-11. 

17. A modified M2 polypeptide fusion protein comprising a modified M2 polypeptide fusion 
protein according to claim 12. 

18. A DNA molecule comprising a sequence of nucleotides encoding a modified M2 
polypeptide according to any one of claims 1 to 6. 

19. A DNA molecule comprising a sequence of nucleotides encoding a modified M2 
polypeptide according to claim 7. 

20. A DNA molecule comprising a sequence of nucleotides encoding a modified M2 
polypeptide according to claim 8. 

21. A DNA molecule comprising a sequence of nucleotides encoding a modified M2 
polypeptide according to any one of claims 9 to 11. 

22. A DNA molecule comprising a sequence of nucleotides encoding a modified M2 
polypeptide according to claim 12. 



30 



WO 99/28478 PCT/US98/1 6379 

23. A vector capable of expressing a modified M2 polypeptide, the vector comprising the 

DNA molecule of claim 18. 

24. A vector capable of expressing a modified M2 polypeptide, the vector comprising the 
DNA molecule of claim 19. 

25. A vector capable of expressing a modified M2 polypeptide, the vector comprising the 
DNA molecule of claim 21. 

26. A vector capable of expressing a modified M2 polypeptide, the vector comprising the 
DNA molecule of claim 22. 

27. A vector capable of expressing a modified M2 polypeptide, the vector comprising the 
DNA molecule of claim 22. 

28. A host cell capable of expressing a modified M2 polypeptide, the host cell comprising a 
vector according to claim 23. 

29. A host cell capable of expressing a modified M2 polypeptide, the host cell comprising a 
vector according to claim 24. 

30. A host cell capable of expressing a modified M2 polypeptide, the host cell comprising a 
vector according to claim 25 . 

31. A host cell capable of expressing a modified M2 polypeptide, the host cell comprising a 
vector according to claim 26. 

32. A host cell capable of expressing a modified M2 polypeptide, the host cell comprising a 
vector according to claim 27. 

33. The host cell according to claim 28, wherein the host is a prokaryote. 

34. The host cell according to claim 29, wherein the host is a prokaryote. 

35. The host cell according to claim 30, wherein the host is a prokaryote. 

36. The host cell according to claim 31, wherein the host is a prokaryote. 

37. The host cell according to claim 28, wherein the prokaryote is E. coli. 



31 



WO 99/28478 PCT/US98/16379 

38. The host cell according to claim 29, wherein the prokaryote is E, coli. 

39. The host cell according to claim 30, wherein the prokaryote is E. coli, 

40. The host cell according to claim 31, wherein the prokaryote is E. coli. 

41 . The host cell according to claim 32, wherein the prokaryote is E. coli. 

42. A composition comprising a modified M2 polypeptide of any one of claims 1 to 6 and a 
pharmaceutically acceptable carrier. 

43. A composition comprising a modified M2 polypeptide of claim 7 and a pharmaceutical^ 
acceptable carrier. 

44. A composition comprising a modified M2 polypeptide of claim 8 and a pharmaceutically 
acceptable carrier. 

45. A composition comprising a modified M2 polypeptide of any one of claims 9 to 11 and a 
pharmaceutically acceptable carrier. 

46. A composition comprising a modified M2 polypeptide of claim 1 2 and a 
pharmaceutically acceptable carrier. 

47. An antibody to a modified M2 polypeptide of any one of claims 1 to 6. 

48. An antibody to a modified M2 polypeptide of claim 7. 

49. An antibody to a modified M2 polypeptide of claim 8. 

50. An antibody to a modified M2 polypeptide of any one of claims 9 to 11. 

5 1 . An antibody to a modified M2 polypeptide of claim 12. 

52. A method of preventing or treating a subject suffering from viral influenza A infection, 
the method comprising administering a prophylactic or viral load-reducing amount of an 
antibody according to claim 47. 

53. A method of preventing or treating a subject suffering from viral influenza A infection, 
the method comprising administering a prophylactic or viral load-reducing amount of an 
antibody according to claim 48. 

32 



WO 99/28478 PCT/US98/16379 

54. A method of preventing or treating a subject suffering from viral influenza A infection, 

the method comprising administering a prophylactic or viral load-reducing amount of an 
antibody according to claim 49. 

55. A method of preventing or treating a subject suffering from viral influenza A infection, 
the method comprising administering a prophylactic or viral load-reducing amount of an 
antibody according to claim 50. 

56. A method of preventing or treating a subject suffering from viral influenza A infection, 
the method comprising administering a prophylactic or viral load-reducing amount of an 
antibody according to claim 51. 

57. A method for determining current or previous exposure of a subject to influenza virus, the 
method comprising contacting a sample from the subject with a modified M2 protein 
according to any one of claims 1 to 6 and detecting the binding of antibodies to the 
modified M2 protein. 

58. A method for determining current or previous exposure of a subject to influenza virus, the 
method comprising contacting a sample from the subject with a modified M2 protein 
according to claim 7 and detecting the binding of antibodies to the modified M2 protein. 

59. A method for determining current or previous exposure of a subject to influenza virus, the 
method comprising contacting a sample from the subject with a modified M2 protein 
according to claim 8 and detecting the binding of antibodies to the modified M2 protein. 

60. A method for determining current or previous exposure of a subject to influenza virus, the 
method comprising contacting a sample from the subject with a modified M2 protein 
according to any one of claims 9 to 1 1 and detecting the binding of antibodies to the 
modified M2 protein. 

61. A method for determining current or previous exposure of a subject to influenza virus, the 
method comprising contacting a sample from the subject with a modified M2 protein 
according to claim 1 2 and detecting the binding of antibodies to the modified M2 protein. 

62. A method of preparing an M2 antibody, the method comprising immunization of a subject 
with a composition according to claim 42. 



33 



WO 99/28478 PCT/US98/16379 

63. A method of preparing an M2 antibody, the method comprising immunization of a subject 

with a composition according to claim 43. 

64. A method of preparing an M2 antibody, the method comprising immunization of a subject 
with a composition according to claim 44. 

65. A method of preparing an M2 antibody, the method comprising immunization of a subject 
with a composition according to claim 45. 

66. A method of preparing an M2 antibody, the method comprising immunization of a subject 
with a composition according to claim 46. 



34 



WO 99/28478 



PCT7US98/16379 



1/4 




SUBSTITUTE SHEET (RULE 26) 



WO 99/28478 PCT/US98/16379 

2JU 



o, 



cm- 



CM 



CO 



i O co co 
*€3 



□ 
OH 



CM 

♦ <»4- 



in 



CO 



CM 



0) CD 
E LL 



CM IO t- tO 



(lA|u 009) eoueqjosqv 



SUBSTITUTE SHEET (RULE 26) 



WO 99/28478 



PCT/US98/16379 



0> 




FIG. 3B 

SUBSTITUTE SHEET (RULE 26) 

BEST AVAILABLE COPY ^ AVA |labLE <X 



WO 99/28478 



PCTAJS98/16379 




SUBSTITUTE SHEET (RULE 26) 



WO 99/28478 



SEQUENCE LISTING 



PCT/US98/16379 



<110> Frace, Michael 

Klimov, Alexander 
Katz, Jaquelline 

Centers for Disease Control and Prevention 

<12 0> PREPARATION AND USE OF RE COMB INANANT INFLUENZA A VIRUS 
M2 CONSTRUCTS AND VACCINES 

<130> Modified M2 Protein 

<140> 
<141> 

<150> U.S. 08/906,930 
<151> 1997-08-06 

<160> 5 

<17 0> Patent In Ver. 2.0 

<210> 1 
<211> 62 
<212> DNA 

<213> Artificial Sequence 
<220> 

<223> Description of Artificial Sequence: Forward 7 l 

primer specific for the 5 ' coding region of the M2 
gene 

<400> 1 

cccgaattct tatgagcctt ctaaccgagg tcgaaacgcc tatcagaaac gaatggggat 60 
gc 62 

<210> 2 
<211> 52 
<212> DNA 

<213> Artificial Sequence 
<220> 

<223> Description of Artificial Sequence: reverse-1 

primer coding for 3 1 amplification from nucleotide 
75 of M2 protein. 

<400> 2 

gtctttgctt acccctacgt ctacgttgct aagttcacta ggacctcctc cc 52 

<210> 3 
<211> 41 
<212> DNA 

<213> Artificial Sequence 
<220> 

<223> Description of Artificial Sequence: Forward-2 
primer for sM2 containing a 5 ' region homologous 
to the reverse-1 primer 

<400> 3 

caagtgatcc tggaggagga gatcgtctct tcttcaaatg c 41 



1 / 2 



WO 99/28478 



PCT/US98/16379 



<210> 4 
<211> 41 
<212> DNA 

<213> Artificial Sequence 
<220> 

<223> Description of Artificial Sequence: reverse-2 
primer coding for the 3 ' end of M2 . 

<400> 4 

ctatcagtaa agcagtcgta tctcgacctc atcagctgcc c 

<210> 5 
<211> 43 
<212> DNA 

<213> Artificial Sequence 
<220> 

<223> Description of Artificial Sequence: Forward-2 

primer for ssM2 containing a 5 ' region homologous 
to the reverse -1 primer 

<400> 5 

caagtgatcc tggaggagga aaacacggtc tgaaaagagg gcc 



2 / 2 



INTERNATIONAL SEARCH REPORT 


intei *nal Application No 




PCT/US 98/16379 



A. CLASSIFICATION OF SUBJECT MATTER , , . 

IPC 6 C12N15/44 C07K14/08 C07K19/00 C12N15/62 C12N15/70 
C12N1/21 A61K39/145 C07K16/10 A61K39/42 G01N33/569 



According to International Patent Classification (IPC) Of to both national classification and IPC 

B. FIELDS SEARCHED 

Minimum documentation searched (classification system followed by classification symbols) 

IPC 6 C12N C07K A61K G01N 



Documentation searched other than minimum documentation to the extent that such documents are included in the fields searched 



Electronic data base consulted during the international search (name of data base and. where practical, search terms used) 



C. DOCUMENTS CONSIDERED TO BE RELEVANT 



Category * 


Citation of document, with indication, where appropriate, of the relevant passages 


Relevant to claim No. 


X 


GRAMBAS S ET AL: "Influence of amantadine 
resistance mutations on the pH regulatory 
function of the M2 protein of influenza A 
viruses . " 

VIROLOGY, (1992 DEC) 191 (2) 541-9. 
JOURNAL CODE: XEA. ISSN: 0042-6822., 
XP002085466 
United States 
see abstract 

see page 541, right-hand column, paragraph 
3 - page 542, left-hand column, paragraph 
2 


9,16,21, 
25,30 




see page 543, left-hand column, paragraph 
3 - page 545, left-hand column, paragraph 
1 

see page 548, left-hand column, paragraph 
3 - page 549, left-hand column, paragraph 
2 










-/~ 





Further documents are listed in the continuation of box C. 



|)( j Patent family members are listed in annex. 



° Special categories of cited documents : 

"A" document defining the general state of the art which is not 

considered to be of particular relevance 
"E" earlier document but published on or after the international 

filing date 

"L" document which may throw doubts on priority daim(s) or 
which is cited to establish the publication date of another 
citation or other special reason (as specified) 

"O" document referring to an oral disclosure, use, exhibition or 
other means 

"P" document published prior to the international filing date but 
later than the priority date claimed 



T" later document published after the international filing date 
or priority date and not in conflict with the application but 
cited to understand the principle or theory underlying the 
invention 

•X" document of particular relevance: the claimed invention 
cannot be considered novel or cannot be considered to 
involve an inventive step when the document is taken alone 

V document of particular relevance: the claimed invention 

cannot be considered to involve an inventive step when the 
document is combined with one or more other such docu- 
ments, such combination being obvious to a person skilled 
in the art. 

document member of the same patent family 



Date of the actual completion of the international search 

24 November 1998 


Date of mailing of the international search report 

08/12/1998 


Name and mailing address of the ISA 

European Patent Office. P.8. 5818 Patentiaan 2 
NL • 2280 HV Rijswijk 
Tel. (+31-70) 340-2040, Tx. 31 651 epo nl. 
Fax: (+31-70) 340-3016 


Authorized officer 

Montero Lopez, B 



Form PCT/lSA/210 (second sheet) (July 1992) 



page 1 of 2 



INTERNATIONAL SEARCH REPORT 



Intt .onal Application No 

PCT/US 98/16379 



Category 



.(Continuation) DOCUMENTS CONSIDERED TO BE RELEVANT 



Citation of document, with indication. where appropriate, of the relevant passages 



Relevant to claim No. 



HOLSINGER L J ET AL: "Influenza A virus 
M2 ion channel protein: a 
structure-function analysis." 
JOURNAL OF VIROLOGY, (1994 MAR) 68 (3) 
1551-63. JOURNAL CODE: KCV. ISSN: 
0022-538X. , XP002085467 
United States 
see abstract 

see page 1553, left-hand column, last 
paragraph - right-hand column, paragraph 3 
see page 1557, right-hand column, 
paragraph 2 - page 1559, right-hand 
column, paragraph 1 
see page 1559, right-hand column, 
paragraph 3 - page 1562, left-hand column, 
paragraph 1 

WANG C ET AL: "Activation of the M2 ion 
channel of influenza virus: a role for the 
transmembrane domain hlstidine residue." 
BIOPHYSICAL JOURNAL, (1995 OCT) 69 (4) 
1363-71. JOURNAL COOE: ASS. ISSN: 
0006-3495. , XP002085468 
United States 
see abstract 

see page 1364, left-hand column, paragraph 
2 

WO 93 03173 A (THE UNITED STATES OF 
AMERICA) 18 February 1993 
see the whole document 

WANG C ET AL: "Direct measurement of the 
influenza A virus M2 protein ion channel 
activity in mammalian cells." 
VIROLOGY, (1994 NOV 15) 205 (1) 133-40. 
JOURNAL CODE: XEA. ISSN: 0042-6822., 
XP002085469 
United States 
see abstract 
see page 134, 
1 

see page 138, right-hand column, paragraph 
2 - page 139, right-hand column, paragraph 
2 



left-hand column, paragraph 



9,16,21, 
25,30 



9,16,21, 
25,30 



1-66 



1-66 



Form PCT/ISA/210 (continuation of second sheet) (July 1992) 



page 2 of 2 



. national application No. 



INTERNATIONAL SEARCH REPORT 



PCT/US 98/ 16379 



Box I Observations where certain claims were found unsearchable (Continuation of item 1 of first sheet) 



This International Search Report has not been established in respect of certain ciaims under Article 17(2)(a) for the following reasons: 



because they relate to subject matter not required to be searched by this Authority, namely: 

Remark: Although claim(s) 52-56 and 62-66 

Is(are) directed to a method of treatment of the human/animal 
body, the search has been carried out and based on the alleged 
effects of the compound/composition. 



because they relate to parts of the international Application that do not comply with the prescribed requirements tosuch 
an extent that no meaningful International Search can be carried out, specifically: 



because they are dependent claims and are not drafted in accordance with the second and third sentences of Rule 6.4(a). 



Box tl Observations where unity of invention is lacking (Continuation of item 2 of first sheet) 



This International Searching Authority found multiple inventions in this international application, as follows: 



1. X 



Claims Nos.: 





1. 



□ 



As all required additional search fees were timely paid by the applicant, this International Search Report covers all 
searchable claims. 



2. 



□ 



As all searchable claims could be searched without effort justifying an additional fee. this Authority did not invite payment 
of any additional fee. 



3. 



□ 



As only some of the required additional search fees were timely paid by the applicant, this International Search Report 
covers only those ciaims for which fees were paid, specifically claims Nos.: 



4. 



□ 



No required additional search fees were timely paid by the applicant. Consequently, this International Search Report is 
restricted to the invention first mentioned in the claims: it is covered by claims Nos.: 



Remark on Protest 





No protest accompanied me payment of additional search fees. 



Form PCT/ISA/210 (continuation of first sheet (1))(July 1992) 



INTERNATIONAL SEARCH REPORT 

information on patent family members 



inte wal Application No 

PCT/US 98/16379 



Patent document 
cited in search report 



Publication 
date 



Patent family 
member(s) 



Publication 
date 



WO 9303173 



18-02-1993 



US 
AU 
AU 
CA 
EP 
JP 



5290686 A 
659867 B 
2405692 A 
2111116 A 
0597008 A 
6509710 T 



01-03-1994 

01- 06-1995 

02- 03-1993 
18-02-1993 
18-05-1994 
02-11-1994 



Foim PCT71SA/210 (patent family annex) (July 1992)