Skip to main content

Full text of "USPTO Patents Application 10849551"

See other formats


1 



50229-435 

AN ORGANIC CATION TRANSPORTER 
PREFERENTIALLY EXPRESSED IN 
HEMATOPOIETIC CELLS AND LEUKEMIAS 
AND USES THEREOF 

Cross Reference to Related Applications 

[01] This application claims the benefit of U.S. Provisional Application No. 60/471,709, 
filed May 20, 2003. 

Field of the Invention 

[02] The invention relates to a gene encoding an organic cation transporter, 0CT6, and its 
use as a target for the treatment of hematological malignancies, and in particular, leukemia. 
The invention fiirther relates to screening methods for identifying agonists and antagonists/ 
binding partners of 0CT6 transport activity. 

Background of the Invetion 

[03] The lipid bilayer of the cellular membrane insulates the intracellular milieu fi-om 
exposure to hydrophilic compounds. Unlike lipophilic compounds that can diffuse through 
cellular membranes, water-soluble compounds usually require specific transport mechanisms 
to gain access to the intracellular space. The regulation of the traffic of polar compounds in 
both directions across the cellular membrane is a complex process involving several large 
families of transport proteins. 



2 

[04] Most often in cancer research, drug transport is thought of as a mechanism of cellular 
drug resistance, as drug efflux pumps such as the products of the MDRl and MRP genes have 
been shown to be mechanisms of resistance to iipid-soiuble anticancer drugs. However, drug 
transport is a two-way street, and mechanisms also exist for pmnping drugs into cells. For 
polar, water-soluble anticancer agents, drug uptake, and not drug efflux, is the critical 
determinant of cellular drug accumulation. 

[05] Most cancer chemotherapy employs drugs that are lipid-soluble that can easily 
penetrate the cell membrane of cancer cells. One advantage of using lipid-soluble drugs is 
that they easily gain intracellular access to different types of cancer cells, so many cancer 
cells appear to be initially sensitive to these drugs. The disadvantage is that cancer cells 
leam to increase the activity of drug efflux pumps in the cell membrane to pump lipid- 
soluble drugs out of the cell, resulting in drug resistance. 

[06] In contrast, potential water-soluble anticancer drugs may not survive the preclinical 
screening process since there is a great deal of variability in the expression of drug transport 
genes in different types of cancer cells. Variability in transport gene expression may result in 
variability in accumulation of polar, water-soluble drugs. One approach to more effectively 
utilize water-soluble anticancer drugs is to identify which of the dozens of transport genes are 
actually expressed in tumors. 

[07] The importance of carrier-mediated anticancer drug uptake is exempHfied in reduced 
folate carrier (RFC) mediated uptake of methotrexate (MTX). Methotrexate (MTX), a 
reduced folate analogue, is scavenged and retained in cells by mechanisms designed to secure 
folates from the environment. The major mechanism of MTX uptake at pharmacologic 
concentrations is the reduced folate carrier (RFC), an OAT transporter with a Km for MTX 
between approximately 0,8-26 \xM. Decreased RFC activity has been observed in several in 
vitro models of transport-mediated MTX resistance (Biochem. Pharmacol. 11: 1233-1234, 
1960). Once rodent and human genes encoding proteins with RFC activity were isolated, the 
molecular explanations for decreased RFC activity emerged. RFCl transfection into the 
transport-deficient MTX^ ZR75 cell line resulted in a 20-fold increase in 6-hour MTX uptake 
and a concomitant 250-fold increase in sensitivity to MTX relative to control cell clones. 



3 

showing that the RFCl gene reconstitutes RFC activity and has a significant impact on MTX 
cytotoxicity (Moscow, et al., Cancer Res. 55: 3790-3794, 1995). 

[08] In different ceil iines, MTX transport deficiency has been ascribed either to mutations 
in the RFC gene or in decreased expression of the RFC gene product. Several studies haye 
demonstrated that RFCl gene expression is an important determinant of sensitivity to MTX. 
In in vitro studies, we have found that RFCl RNA levels correlate with MTX sensitivity in a 
panel of non-selected cell lines, including breast cancer cell lines (Moscow et al., Int J 
Cancer. 72: 184-190, 1997). 

[09] A plethora of genes with the ability to transport MTX out of the cell have been 
reported, including MRPl, MRP2, MRP3, MRP4, the organic anion transporters hOAT2 and 
hOAT3, and the mitoxantrone-resistance protein (BCRP/MXR). However, despite the 
multitude of MTX export genes, clinical studies have shown a relationship between the 
expression of RFCl, the mechanism of MTX uptake, and prognosis in Acute Lymphoid 
Leukemia (ALL) and osteosarcoma. As a result, RFCl expression and MTX uptake are now 
imphcated as determinants of clinical sensitivity in several types of tumors. Thus, the role of 
RFCl in mediating sensitivity of its cytotoxic drug substrates has become a prototype that 
illustrates the potential role of transporters, like OAT and OCT genes, in determination of 
anticancer drug selectivity and toxicity. 

[10] However, there is a need to identify additional channels, or transporters, that are 
found in specific cancers, to enable the targeting of different cancers with anticancer agents 
that are substrates for those transporters. 

Summary of the Invention 

[11] The present invention is directed towards a membrane protein that functions to 
transport hydrophilic substances across cellular membranes. The protein, 0CT6, is a new 
member of the organic cation transporter (OCT) family (SLC22 gene family). Tissue 
distribution of this protein is distinct from other OCT protein family members; being 
detected in leukemia, leukemia blast cells and CD34+ cells. 

[12] In one aspect, the present invention provides a novel target for hematological 
malignancies such as leukemia, an 0CT6 transporter. 



4 



[13] In another aspect of the present invention there is a method for screening potential 
substrates that selectively bind the 0CT6 transporter. The method involves contacting a cell 
which overexpresses an 0CT6 transporter gene with a test compound and determining 
whether the test compoxmd is a substrate for the 0CT6 transporter. 

[14] In another aspect, there is a method for screening potential anti-cancer agents in a cell 
overexpressing an 0CT6 transporter gene. The method comprises determining viability of a 
cell which expresses 0CT6 transporter gene incubated in the presence and absence of a test 
compound and identifying the test compound as a potential anti-cancer agent if there is 
cellular influx of the test compound and cell death. 

[15] In another aspect of the invention, a test kit is provided for screening candidate drugs 
for hematologic malignancies comprising a mammalian cell line or cells which overexpress 
0CT6, a control substrate and a detectable substance. 

[16] In still another aspect of the invention, there are immunogenic compositions for 
treating hematological malignancies. In a preferred embodiment, immunogenic 
compositions for treating leukemia comprise a substrate that binds selectively to a leukemia 
cell expressing the 0CT6 transporter gene. In another preferred embodiment of the 
invention, the substrate comprises an antibody that selectively binds to the 0CT6 transporter 
protein. Preferably, the 0CT6 transporter protein allows cellular uptake of the substrate 
which then causes cell death. In one embodiment the substrate is cytotoxic and in another 
preferred embodiment the substrate is coupled with a cytotoxic agent. 
[17] In still another aspect, the present invention provides a method for impairing a 
leukemia cell comprising contacting the cell with a cytotoxic 0CT6 transporter protein. In 
one embodiment the substrate is a cytotoxin and in another embodiment the substrate is 
coupled to a cytotoxic agent. 

[18] In yet another aspect, the present invention provides a method for treating 
hematological malignancies comprising administering to a subject in need thereof an 
immunogenic composition comprising a substrate that binds selectively to a cell expressing 
the 0CT6 transporter gene. In a preferred embodiment the 0CT6 transporter protein allows 
cellular uptake of the substrate which then causes cell death. In another preferred 



5 

embodiment the substrate is cytotoxic. In another preferred embodiment, the substrate is 
coupled with a cytotoxic agent. 

Brief Description of the Drawings 

[ 1 9] Figure 1 . A. shows the predicted hydropathy profile of 0CT6. 

[20] Figure !• is a dendrogram showing phylogenic relationship between 0CT6 (SEQ 

ID N0:3) and other OCT and OAT proteins, including, OCTNl (SEQ ID N0:4), 0CT3 

(SEQ ID N0:5), 0CTN2 (SEQ ID N0:6), 0CT2 (SEQ ID N0:7), OCT! (SEQ ID N0:8), 

OATS (SEQ ID N0:9), 0AT4 (SEQ ID NO:10), OATS (SEQ ID N0:11), and OATl (SEQ 

IDN0:12). 

[21] Figure 2. is the CLUSTALW aUgnment of 0CT6 and other OCT and OAT proteins. 
The bottom row represents areas of consensus. 

[22] Figure 3, shows the normal tissue distribution of 0CT6 RNA determined by RT-PCR 
using a cDNA panel. Only lOOOX (highest) cDNA concentration is shown. Panel A. 1, 
salivary gland; 2, thyroid; 3, adrenal; 4, pancreas; 5, ovary; 6, uterus; 7, prostate; 8, skins; 9, 
peripheral blood leukocytes; 10, bone marrow; 11, fetal brain; 12, fetal liver. Panel B. 1, 
brain; 2, heart; 3, kidney; 4, spleen; 5, liver; 6, colon; 7, lung; 8, small intestine; 9, muscle; 
10, stomach, 11, testis; 12, placenta. 

[23] Figure 4. shows quantitative RT-PCR for the transporter gene 0CT6 performed with 
RNA extracted from peripheral blood leukocytes, CD34+ cells and additional hematopoietic 
cell lines. Fresh discarded buffy coats that were twice sorted by FACS using CD 14 
(monocytes), CD15 (granulocytes), CD3 (T-cells) and CD20 (B-cells). Purities of 99% or 
better were obtained. For peripheral WBC and sorted subsets, the average ± SD represent 
pooled results from samples from 2 individuals performed in triplicate or quadruplicate. For 
CD34-selected mobilized peripheral blood (MPB), the results from each of 3 individuals are 
shown. For CD34-selected bone marrow (CD34+-BM), the results are from one individual. 
0CT6 levels were normalized to the expression of actin RNA, as a control for equivalence of 
mRNA template. The units, in log scale, are arbitrary and based on a standard curve of 
0CT6 RT-PCR in serially diluted HL60 RNA. Unity is defined as the level of 0CT6 RNA 
found in M0LT4 cells. 



6 

[24] Figure 5. shows quantitative RT-PCR for the gene 0CT6 using RNA extracted from 
leukemic blasts obtained from patients at the time of initial diagnosis. 0CT6 levels were 
normalized to the expression of actin RNA, as a control for equivalence of mRNA lemplate. 
The 0CT6 RNA levels in placenta, liver, kidney and MOLT-4 cell line were determined 
concurrently and shown for comparison. The units, in log scale, are arbitrary and based on a 
standard curve of 0CT6 RT-PCR in serially diluted HL60 RNA. Unity is defined as the 
level of 0CT6 RNA found in M0LT4 cells. 

Detailed Description of the Invention 

[25] The present invention is based on the discovery and isolation of a new member of the 
SLC22 gene family (the OCT family of proteins) that is unusual for its distinct pattern of 
tissue distribution. Rather than the typical high levels of expression in liver, kidney or 
placenta, high levels of RNA for this transporter were found in some leukemia cell lines, in 
CD34+ cells, and in circulating leukemia blast cells. 

[26] All patents, patent applications and literature cited in this description are incorporated 
herein by reference in their entirety. In the case of inconsistencies, the present disclosure, 
including definitions, will prevail. 

OCT Familv 

[27] Two families of proteins involved in maintaining homeostasis of charged organic 
compounds are the organic anion transporters (OATs) which carry the SLC21 designation 
and the organic cation transporters (OCTs), which carry the SLC22 designation {See Table 
1). OATs and OCTs each have characteristic patterns of tissue expression, with predominant 
expression in a tissue involved in the transport of xenobiotics, i.e., liver, kidney or placenta. 



7 



[28] Table 1. Organic anion and cation transported genes 



SLC21 



SLC22 



Gene Name 


Locus Link 


Alternative Names 


SLC21A1 


6577 




SLC21A2 


6578 


PGT 


SLC21A3 


6579 


OATP, 0ATP1. OATPIb, OATP-A 


SLC21A4 


28237 


0AT-K1,0AT-K2 


SLC21A5 


28236 


0ATP2, OATP-2 


SLC21A6 


10599 


LST-1,0ATP-C 


SLC21A7 


28235 


0ATP3. OATP-3 


SLC21A8 


28234 


LST2, OATP8. SLC21A8, OATP-8 


SLC21A9 


11309 


OATP-B 


SLC21A10 


28233 


0ATP4 


SLC21A11 


28232 


OATP-D 


SLC21A12 


28231 


LOC51737. OATP-E. POAT 


SLC21A13 


28230 


0ATP5. OATP-5 


SLC21A14 


53919 


OATP-F 


SLC22A1 


6580 


0CT1 


SLC22A2 


6582 


0CT2 


SLC22A3 


6581 


0CT3 


SLC22A4 


6583 


0CTN1 


SLC22A5 


6584 


0CTN2, CDSP, SCO 


SLC22A6 


9356 


NKT, 0AT1.0AT-1 


SLC22A7 


10864 


NLT. 0AT2. OAT-2 


SLC22A8 


9376 


0AT3. OAT-3 


SLC22A9 




0AT4, OAT-4 



[29] The OAT and OCT carriers result in increased cellular accumulation of their 
respective substrates, despite the fact that they are carriers that mediate facilitative diffusion. 
For carriers, the degree of intracellular accumulation may not exceed the extracellular 
concentration. However, the presence of the carrier allows uptake in comparison to no 
uptake in the absence of the carrier, and drugs that bind an intracellular target or which are 
chemically modified in the cells, e.g., by phosphorylation or polyglutamylation, may be 
eliminated from the substrate pool and not available for transport back across the cellular 
membrane. 

[30] The first five members of the SLC22 family of transporters, OCTl, 0CT2, 0CT3, 
OCTNl, and 0CTN2, have been characterized as organic cation transporters. The uptake of 
many cations, such as tetraethylammonium (TEA), N-l-methylnicotineamide (NMN), 
choline, procainamide, amantadine and morphine are mediated by these polyspecific 
transporters. In general, these transporters are potential-dependent, but independent of 
sodium and proton gradients. These genes are all characterized by the presence of 1 1 or 12 



8 



transmembrane domains, as predicted by hydrophobicity analysis, and all have a large 
hydrophilic loop between transmembrane domain (TMD)l and TMD2. 
[31] OCT substrates are shown below in Table 2. Tetraethyi ammoniimi (TEA) is the 
classic substrate for OCT transporters. In addition, OCTl, 0CT2 and 0CT3 transport 1- 
methyl-4-phenylpyridinium (MPP). Compared to 0CT2, OCTl has a higher affinity for 
some cations (for example mepiperphenidol and procainamide), a similar affinity for others 
(for example, decynium 22 and quinidine), and a lower affinity for corticosterone (See 
Koepsell et al, Ann. Rev. Physiol. 60: 243-266, 1998.). 0CT3 is an electrogenic transporter 
for TEA and guanidine. Other physiologic substrates for OCT transporters include 
dopamine, histamine, epinephrine and norepinephrine, acetylcholine and 5- 
hydroxytryptamine ( Burckhardt, et al.. Am J Physiol Renal Physiol. 278: F853-66., 2000.), 
suggesting an important role for these transporters in the central nervous system, in addition 
to their role in hepatic and renal clearance. Interestingly, despite its cationic nature, recent 
studies have identified cimetidine as a selective inhibitor, but not a substrate for several 
organic cation transporters, including rOCTl, rOCT2, rOCT3, hOCTNl, and hOCTN2. 



9 



[32] Table 2. OCT Substrates 



Common Name Gene Name 


Cell Tvoe 


Substrate 


KT(uM) 


OCTl 


SLC22A1 


HeLa 


TEA 


229 


OCTl 


SLC22A1 


Xenopus 


MPP 


14.6 


0CT2 


SLC22A2 


Xenopus 


Norepinephrine 


1900 


0CT2 


SLC22A2 


Xenopus 


Histamine 


1300 


0CT2 


SLC22A2 


Xenopus 


Dopamine 


390 


0CT2 


SLC22A2 


Xenopus 


Serotonin 


80 


0CT2 


SLC22A2 


HEK293 


MPP 


16 


0CT2 


SLC22A2 


HEK293 


Dopamine 


330 


0CT2 


SLC22A2 


Xenopus 


Amantadine 


27 


0CT2 


SLC22A2 


Xenopus 


Memantine 


34 


0CT3 


SLC22A3 


HeLa 


TEA . 


2500 


0CT3 


SLC22A3 


HRPE 


MPP 


47 


OCTNl 


SLC22A4 


Fibroblasts 


L-Camitine 


6.6 


0CTN2 


SLC22A5 


HEK293 


L-Camitine 


4.34 


0CTN2 


SLC22A5 


HEK293 


L-Camitine 


4.3 


0CTN2 


SLC22A5 


HEK293 


D-Camitine 


10.9 


0CTN2 


SLC22A5 


HEK293 


Acetyl-L-camitine 


8.5 


0CTN2 


SLC22A5 


Xenopus 


L-Camitine 


4.8 


0CTN2 


SLC22A5 


Xenopus 


D-Camitine 


98 


0CTN2 


SLC22A5 


JAR 


L-Camitine 


3.5 



[33] OCTl and 0CT2 are predominantly expressed in the kidney and liver. These 
transporters are located on the basolateral surface of renal tubules and, therefore, play a role 
in the removal of organic cations from the blood. 0CT3 is most abundantly expressed in 
placenta. In addition, other tissue-specific roles have been implicated for these transporters. 
As noted above, OCTs may play a role in transport of endogenous neuroleptic substrates, and 
0CT3 has been implicated in the disposition of cationic neurotoxins and neurotransmitters in 
the brain( Wu, et al., J Biol Chem. 273: 32776-86, 1998). Dhillon et al (Clin Pharmacol 
Ther. 65: 205, 19996) used RT-PCR followed by functional transport studies (TEA) to 
identify OCTl expression in a human mammary epithelial cell line (MCF12A). Further, the 
OCTl gene has been shown to be up regulated in lactating mammary epithelial cells. 
[34] The OCTNl gene, cloned from a cDNA, shows sequence similarity to organic cation 
transporter genes, which is highly expressed in kidney as well as trachea, bone marrow and 



10 

fetal liver. Recombinant OCTNl expressed in mammalian cells exhibited saturable uptake 
of TEA that was pH sensitive. Several others suggest that OCTNl is a renal proton/organic 
cation antiporter functioning at the epithelial apical membrane. The uptake of pyriiamine, 
quinidine, verapamil and L-camitine were increased by expression of OCTNl in Xenopus 
oocytes. 

[35] Another OCT protein family member, 0CTN2, cloned from a human placental 
trophoblast cell line, is expressed widely in human tissues including kidney, placenta and 
heart. 0CTN2 is more closely related to OCTNl than to OCTl, 0CT2 and 0CT3 (Biochem 
Biophys Res Commun. 246: 589-95, 1998). Transfection of 0CTN2 has demonstrated its 
role in the transport of TEA and carnitine. 0CTN2-mediated transport of TEA is sodium 
independent, whereas transport of carnitine is sodium-dependent. The role of sodium in 
0CTN2-mediated carnitine transport not only involves the electrogenic gradient, but the 
presence of sodium also alters the affinity of 0CTN2 for camitine. Germline mutations of 
0CTN2 result in primary camitine deficiency, a syndrome of progressive cardiomyopathy 
and skeletal myopathy. The symptoms associated with this syndrome are thought to result 
not only from generalized camitine deficiency from decreased renal camitine reabsorbtion, 
but also from inability of cardiac and skeletal myocytes, which ordinarily express 0CTN2, to 
accumulate camitine. This syndrome demonstrates that tissue-specific OCT-mediated 
transport is essential for accumulation of required cations in specific tissues. 
[36] The present invention identifies a new transport protein in the OCT family, 0CT6, 
preferentially expressed in leukemia cell lines, leukemia blast cells and CD34+ cells. The 
cell surface localization and the transporter function of the 0CT6 gene product suggest its 
usefulness as a target in the diagnosis and treatment of hematologic malignancies. 
[37] As used herein, the term "antibody" refers to an immunoglobulin molecule with a 
specific amino acid sequence evoked in by an antigen, and characterized by reacting 
specifically with the antigen in some demonstrable way. 

[38] As used herein, the term "carrier" refers to a diluent, adjuvant, excipient, or vehicle 
with which the compositions of the present invention are administered. 



11 

[39] As used herein, "compound" refers to any agent, chemical, substance, or substrate, 
whether organic or inorganic, or any protein including antibodies, peptides, polypeptides, 
peptoids, and the like. 

[40] As used herein, the term cytotoxin" or cytoxic agent includes any specific substance, 
which may or may not be antibody, that inhibits or prevents the functions of cells, causes 
destruction of cells, or both. 

[41] As used herein, the term "derivative" refers to something produced by modification of 
something pre-existing; for example, a substance or chemical compound that may be 
produced from another substance or compound of similar structure in one or more steps. 
[42] As used herein, the term "fragment" refers to a part of a larger entity, said larger 
entity comprising by non-limiting example, an antibody, compound or substance. 
[43] As used herein, the term "leukemia blast" or "leukemic blast" refers to lymphoblasts, 
the abnormal immature white blood cells associated with leukemia. 

[44] As used herein, the term "monoclonal antibody" is not limited to antibodies produced 
through hybridoma technology. The term "monoclonal antibody" refers to an antibody that is 
derived from a single clone, including any eukaryotic, prokaryotic, or phage clone, and not 
the method by which it is produced. 

[45] As used herein, the term "pharmaceutically acceptable carrier" refers to a carrier that 
may be administered to a subject, together with one or more liver protecting agents and one 
or more mushroom powder or extract of the present invention, and which does not destroy 
the pharmacological activity thereof and is nontoxic when administered in doses sufficient to 
deliver a therapeutic amount of the compound. 

[46] As used herein, the term "substrate" refers to a substance, compound, agent, antibody 
or derivatives and/or fragment thereof, acted upon by the OCT6 transporter protein (e.g., a 
substance that is taken across the cellular membrane by action of the 0CT6 transporter 
protein). 

[47] 0CT6 (SEQ ID N0:1) was first identified as a potential OCT gene by assembling and 
sequencing ESTs as described in Example 1 (amino acid sequence of 0CT6 is SEQ ID 
N0:2). The gene sequence proved to be identical to the recently submitted cDNA 0KB 1 
(GenBank AF268892) submitted by M. Okabe and T, Abe, incorporated herein in its entirety. 



12 



It is also contained within the submitted BAG clone CTA-331P3 (SEQ ID NO: 3) (GenBank 
AG002464) located at chromosome 6q21, incorporated herein in its entirety. The gene has a 
predicted protein structure typical of transport proteins with two groups of six 
transmembrane domains separated by a hydrophilic region (Figure lA). CLUSTALW 
alignment produced a dendrogram showing the phylogenic relationship between 0CT6 and 
other OAT and OCT proteins (Figure IB). This dendrogram suggests that the distinction 
between OAT and OCT genes, based on functional studies, obscures the conamon origin of 
both families of transporters. The actual CLUSTALW alignment of these genes is shown in 
Figure 2 and demonstrates multiple regions of conservation among all of these genes. 
[48] Next, according to the methods described in Example 3, quantitative RT PCR 
analysis of the expression of 0CT6 was performed, along with the expression of other OCT 
genes, in 50 cell lines. The results are shown in Table 3. The two highest expressing cell 
lines for 0CT6 in this panel were two leukemia cell lines, HL60, a human promyelocytic 
leukemia cell line, and M0LT4, a human acute lymphoblastic leukemia (T-cell) cell line. 
There was only a low level of expression detected in most of the other cell lines. 



13 

Table 3. OCT expression in 50 cell lines of the NCI Drug Screen 



■NO. 


oeii Line 


source 


UU 1 1 


1 ^ 


1 o 


1 IN £. 


LIU 1 0 


1 




Leukemia 


D.f 


U.r 


n 9 


n 1 


K 7 
O.f 




ML-DU 


Leukemia 


U.D 


1 1 

1 .o 


0 n 


n 4 


#10 






LeuKemia 


1.4 




0 9 


1.4 


^^ 9 
O.Z 


4 


IVIUL I -4 


Leukemia 


A t 

\J.l 


1 .1 


n 


0 ft 

U.O 


AA Q 
40.0 


5 




Leukemia 




^.U 


n 1 


7 


o.U^ 


A 

D 


CD 


Leukemia 


i.y 


1 .1 


0.0 


0.3 


9 ft 
^.0 


7 


ARiiQ/ATr^r' 
A04y/A 1 LrO 


Lung cancer 


4 7 

1 .f 




161 




1 9 


o 
o 


nUr-OZ 


LunQ cancer 


n Q 
U.o 


A ft 

4.0 


n 


2 4 

46.. *t 


A i 


A 

9 




Lung cancer 


4.0 


U.O 


0 1 


21.1 


A A 


1U 




Lung cancer 


U.O 


U.f 


0 0 


0 


9 


•f I 
11 


iNUI-n4DU 


Lung cancer 


U.r 


n .u 


0.0 


1.7 


1 A 
1 .0 






oolon ua. 


4.y 


o.o 


30.9 


2.2 


ft 
O.O 


lo 




oolon oa. 


1.0 


i n 
1 .u 


0 0 


2.6 


o.*f 


14 


UOT "lift 


ooion oa. 


l.f 




n 1 


9 ft 


Q 7 

y./ 


15 


no 1 -lo 


oolon ua. 


u.y 


1 7 

l.f 


n 1 




A 9 


1o 


LIT OO 

n 1 -zy 


uoion ua. 


I.y 


1.^ 


ifi 1 


1 

1 .o 


1 .0 


17 


Ifftk AO 

Wvi-I^ 


oolon ua. 


u.o 


1.U 


15 7 


7 


9 1 
Z. 1 


1o 


Q\A/ Ron 


ouion oa. 


1 r) 


9 ft 


40.4 


1.9 


0. 1 


19 


Or-ZD<5 


UNo 1 umor 


n A 
U.4 


U.O 


0 n 








oc one 


ONo 1 umor 


U.D 






1 1 


9 R 
Z.O 


21 


SF-539 


CNS Tumor 


0.5 


A £5 
0.0 




n 9 

U.Z 


O.o 


22 


SNB-75 


CNS Tumor 


U.O 


1.0 


n n 


n ft 

U.O 


Z.O 


23 


U251 


CNS Tumor 


0.8 


A A 

0.9 


0.0 


0.6 


(A 


24 


LOCIMVI 


Melanoma 


2.9 


2.1 


U.l 


n A 

U.H 


o.o 


25 


MALME-SM 


Melanoma 


1.5 


1.5 


u.u 


9 '5 


o 
0 


26 


M14 


Melanoma 


1.9 


1.4 


n n 
u.u 


1 Q 

1 .y 


4. A 


27 


SK-MEL-z 


Melanoma 


2.1 


4 A 

1 .9 


0 n 
u.u 


9 9 


o.y 


28 


SK-MEL-5 


Melanoma 


2.6 


1 .5 


u.u 


1 .y 


ZJ 


29 


UACC-257 


Melanoma 


3.2 


3.6 


0.0 


1 .1 


C /I 

0.4 


30 


IGROV 1 


Ovarian Ca. 


4.9 


5015 


17 Q 


1 A 
1 .0 


^.0 


31 


OVCAR-3 


Ovarian Ca. 


1.4 


0.1 


u.u 


9 9 


14 


32 


UVt/AK-4 


Ovarian Ca. 


^.0 


i A 
1.4 






A 




UVOAK-0 


ijvarian oa. 


0.0 


Z. r 


105 


10.0 


A A 


'S>l 

o4 


VJVOAK-O 


L^varian oa. 


1 . 1 


1 n 

1 .u 


0.0 


0.8 


1 ft 






uvarian oa. 


Q 


1 QQ^ 


9.2 


8.5 


Q ft 


36 


A498 


Renal Ca. 




1o.4 


1 An 

1 ou 




1 .o 


37 


ACHN 


Renal Ca. 


1.1 


1.1 


n 7 

U, f 


1 9 


1 .1 


38 


CAKI_1 


Renal Ca. 


3.5 


2.5 


A O 

4.0 


4 Q 
1 .O 


2.8 


39 


RXF-393 


Renal Ca. 


1.7 


1.2 


3.0 


0.6 


1.2 


40 


TK-10 


Renal Ca. 


3.6 


5.0 


16.8 


2.5 


8 


41 


UO-31 


Renal Ca. 


4.4 


1.6 


31.2 


1.2 


2.3 


42 


PC-3 


Prostate Ca. 


2.1 


0.8 


9.6 


3.3 


4.7 


43 


DU-145 


Prostate Ca. 


1.1 


1.1 


3.4 


1.6 


3 


44 


MCF-7 


Breast Ca. 


0,8 


1.8 


0.0 


10.4 


3.5 


45 


NCI/ADR-RES 


Breast Ca. 


1.4 


1.3 


1.1 


2.0 


2.1 


46 


MDA-MB-231 


Breast Ca. 


1.2 


0.4 


3.9 


4.8 


1.8 


47 


HS578T 


Breast Ca. 


1.0 


1.5 


0.0 


1.2 


8.3 


48 


MDA-MB-435 


Breast Ca. 


1.9 


0.6 


0.1 


0.7 


2.7 


49 


BT-549 


Breast Ca. 


1.2 


0.8 


0.1 


0.3 


2.6 


50 


T-47D 


Breast Ca. 


0.7 


1.1 


0.1 


4.2 


8.7 



14 

[50] 0CT6 is unique among the known members of OCT and OAT genes because of its 
pattem of tissue distribution. The pattern of expression of the 0CT6 gene in the 50 cell Unes 
suggested that its expression miglit be restricted to hematopoietic tissues. Tlie restricted 
pattem of expression observed for 0CT6 also suggests that therapies using 0CT6-specific 
substrates are unlikely to have widespread toxicity to normal tissues. Therefore, we 
examined 0CT6 expression in a cDNA panel representing a wide cross-section of normal 
tissues according to the methods of Example 4 (Figure 3). This study revealed that 0CT6 
RNA levels are highest in testis and fetal liver, with lower but detectable levels in peripheral 
blood leukocytes and bone marrow. Since fetal hematopoiesis occurs in the liver, it is 
possible that the fetal liver sample may have included both hepatocytes and hematopoietic 
cells. 0CT6 RNA levels were also barely detectable in pancreatic and adrenal tissue. Unlike 
other OCT genes, expression was not detectable in liver, kidney or placenta. 
[51] To determine whether 0CT6 RNA expression in hematopoietic cells was lineage- 
specific, leukocytes were sorted from discarded buffy coat specimens by flow cytometry, and 
purified subpopulations were examined for 0CT6 RNA expression according to the methods 
described in Example 5. 0CT6 expression was also examined in a population of CD34+ 
cells. As can be seen in Figure 4, the expression of 0CT6 was highly enriched in CD34+ 
cells in comparison to the other cell populations. Also,significant levels of 0CT6 expression 
(relative to M0LT4) were found in other hematopoietic cell lines: U937, a human histiocytic 
lymphoma cell line; THP-1, a human acute monocytic leukemia cell line; KG-1, a human 
erythroleukemia cell line; and MV-4-1 1, a hxmian biphenotypic (B-cell and myelomonocytic) 
leukemia cell line. 

[52] The high levels of 0CT6 RNA in some leukemia cell lines and CD34+ cells also 
raised the question as to whether this gene was highly expressed in actual leukemias. To 
address this issue, the RNA levels of 0CT6 in 25 samples of peripheral leukemic cells were 
measured according to the methods set out in Example 6. The FAB classification of these 
samples are shown in Table 4. These results are shown in Figure 5, and demonstrate that the 
majority of specimens contained RNA levels for 0CT6 that exceeded the level found in 
M0LT4 cell line, the second highest expressing cell line among those examined, and exceed 
by orders of magnitude the levels found in placenta, kidney and liver. 



15 



[53] Table 4. Phenotypes of leukemia specimens 

Sample Number Description 



1 


CML, blast crisis 


2 


CML, blast crisis 


3 


CML, stable phase 


4 


CML, probably stable phase 


5 


CML, accelerated phase 


6 


ALL 


7 


ALL 


8 


AML 


9 


ALL 


10 


ALL 


11 


ALL 


12 


AML 


13 


AML 


14 


AML 


15 


AML 


16 


ALL, biphenotypic 


17 


ALL, biphenotypic 


18 


AML 


19 


AML, M2 


20 


AML, M2 


21 


AML, M4 


22 


AML, M4 


23 


AML, M1 


24 


AML 


25 


AML, M4 



[54] Due to the 0CT6 protein's location on the cellular membrane and its function as an 
intracellular transporter, the 0CT6 transporter protein has been identified as a therapeutic 
target. Basic principles of cellular pharmacology suggest that increase in intracellular 
accumulation will lead to increased intracellular effect. For anticancer drugs, this principle 
has been studied extensively in the context of lipophilic drugs, which require no specific 
mechanism for cellular uptake, and export pumps such as the product of the multidrug 
resistance gene, MDRl, whose overexpression of MDRl leads to increased cellular 
resistance by decreasing intracellular concentrations of drug ( Moscow, J. A., Schneider, E. 
S., Ivy, S. P., and Cowan, K. H. Multidrug resistance. In: H. M. Pinedo, D. L. Longo, and B. 
A. Chabner (eds.), Cancer chemotherapy and biological response modifiers. Annual 17. New 
York: Elsevier, 1997). The same principle applies to charged, hydrophilic drugs of the 



16 



present invention, except that the determinants of sensitivity depend on uptake as opposed to 
efflux. As such, cells overexpressing an 0CT6 transporter are likely to be highly sensitive to 
cytotoxic 0CT6 substrates. 

Drug Screening 

[55] Accordingly, the present invention provides methods for screening potential 
substrates of, and potential therapeutic agents against hematological malignancies like 
leukemia that overexpress, the 0CT6 transporter. In particular, potential therapeutic agents 
are screened for the ability to be a substrate recognized by an 0CT6 transporter protein. 
Preferably, potential substrates are screened for the ability to confer cytotoxic effects on a 
cell overexpressing 0CT6 transporter protein. More preferably, agents are screened for the 
abihty to preferentially cause cellular uptake into, and cell death of, cells overexpressing the 
0CT6 transporter. Most preferably, the agents are screened for the ability to cause cell death 
of cancer cells such as leukemia overexpressing the 0CT6 transporter as compared to normal 
cells. 

[56] A method for screening potential substrates of the 0CT6 transporter protein 
comprises providing a cell or cell line which expresses 0CT6 and a test compound, 
incubating the test compound and cell line and analyzing the cell or cell line to determine if 
there was a cellular influx of the test compound. Analysis of the cell line to determine 
whether cellular uptake of the test compound occurred can be accomplished by any means 
known in the art. For example, a test compound can be tagged with a detectable label prior 
to contact with a cell and then observed under microscopy or by other means for its location. 
Non-limiting examples of labels include green fluorescent protein, alkaline phosphatase, 
horseradish peroxidase, rease, f3-galactosidase, CAT, luciferase, an immunogenic tag peptide 
sequence, an extrinsically activatable enzyme, an extrinsically activatable toxin, an 
extrinsically activatable fluor, an extrinsically activatable quenching agent, a radioactive 
element or an antibody. 

[57] A method for screening candidate anti-cancer agents comprises determining the 
viability of a mammalian cell which expresses 0CT6 incubated in the presence and absence 
of a test compound and identifying the test compound as a potential anti-leukemia agent if 



17 

there is a cellular uptake of the test compound and cell death. Analysis of cell viability can 
be accomplished by any means known in the art. 

[58] It is well known in the art that viability of a cell caii be determined by contacting the 
cell with a dye and viewing it under a microscope. Viable cells can be observed to have an 
intact membrane and do not stain, whereas dying or dead cells having "leaky" membranes do 
stain. Incorporation of the dye by the cell indicates the death of the cell. The most common 
dye used in the art for determining viability is trypan blue. Viability of cells can also be 
determined by detecting DNA synthesis. Cells can be cultured in cell medium with labeled 
nucleotides (e.g., thymidine). The uptake or incorporation of the labeled nucleotides 
indicates DNA synthesis and cell viability. In addition, colonies formed by cells cultured in 
medium indicate cell growth and is another means to test viability of the cells. 
[59] Identification and/or observation of cells undergoing apoptosis can be another method 
of determining cell viability. Apoptosis is a specific mode of cell death recognized by a 
characteristic pattern of morphological, biochemical, and molecular changes. Cells going 
through apoptosis appear shrunken, and roimded; they also can be observed to become 
detached from culture dish. Thermophological changes involve a characteristic pattern of 
condensation of chromatin and cytoplasm which can be readily identified by microscopy. 
When stained with a DNA-binding dye, such as H33258, apoptotic cells display classic 
condensed and punctate nuclei instead of homogeneous and round nuclei. 
[60] The hallmark of apoptosis is the endonucleolysis, a molecular change in which 
nuclear DNA is initially degraded at the linker sections of nucleosomes to give rise to 
fragments equivalent to single and multiple nucleosomes. When these DNA fragments are 
subjected to gel electrophoresis, they reveal a- series of DNA bands which are positioned 
approximately equally distant from each other on the gel. The size difference between the 
two bands next to each other is about the length of one nucleosome (i.e., 20 base pairs). This 
characteristic display of the DNA bands is called a DNA ladder and it indicates apoptosis of 
the cell. Apoptotic cells can be identified by flow cytometric methods based on 
measurement of cellular DNA content, increased sensitivity of DNA to denaturation, or 
altered light scattering properties. These methods are well known in the art and are within 
the contemplation of the invention. 



18 

[61] Abnormal DNA breaks are also characteristic of apoptosis and can be detected by any 
means known in the art. In one embodiment, DNA breaks are labeled with biotinylated 
dUTP (b-dUTP). Ceils are fixed and incubated in the presence of biotinylated dUTP with 
either exogenous terminal transferase (terminal DNA transferase assay; tdT assay) or DNA 
polymerase (nick translation assay; NT assay). The biotinylated dUTP is incorporated into 
the chromosome at the places where abnormal DNA breaks are repaired, and are detected 
with fluorescein conjugated to avidin under fluorescence microscopy. 

Kits 

[62] The present invention provides kits that can be used in the above screening methods. 
In one embodiment, a kit comprises a substantially isolated polypeptide comprising an 0CT6 
epitope which is specifically immunoreactive with only test compound(s) that are substrates 
of the OCT6 transporter protein. Binding of a test compound to the 0CT6 epitope is 
indicative that the test compound is a 0CT6 substrate. In another embodiment, a kit 
comprises a cell line that overexpresses an 0CT6 transporter protein. Binding and/or cellular 
uptake of a test compound via the 0CT6 protein is indicative that the test compound is a 
0CT6 substrate. Preferably, the kits of the present invention further comprise a control 
compound or antibody which does not react with the 0CT6 transporter protein. In another 
specific embodiment, the kits of the present invention contain a means for detecting the 
binding of a test compound to an 0CT6 epitope and/or cellular uptake of a test compound. 
For example, the test compound may be conjugated to a detectable substrate such as a 
fluorescent compound, an enzymatic substrate, a radioactive compound or a luminescent 
compound, or a second antibody which recognizes the first antibody may be conjugated to a 
detectable substrate, 

[63] The detectable substance may be coupled or conjugated either directly to the test 
compound (or fi-agment thereof) or indirectly, through an intermediate (such as, for example, 
a linker known in the art) using techniques known in the art. See, for example, U.S. Pat. No. 
4,741,900 for metal ions which can be conjugated to antibodies for use as diagnostics 
according to the present invention. Further non-limiting examples of detectable substances 
include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, 



19 



bioluminescent materials, radioactive materials, positron emitting metals using various 
positron emission tomographies, nonradioactive paramagnetic metal ions, immunogenic tag 
peptide sequences, extrinsically activatable toxins, extfinsicaiiy activatabie quenching agents, 
or antibodies. Non-limiting examples of suitable enzymes include horseradish peroxidase, 
alkaline phosphatase, beta-galactosidase, or acetylcholinesterase; examples of suitable 
prosthetic group complexes include streptavidin/biotin and avidin/biotin; examples of 
suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, 
rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example 
of a luminescent material includes luminol; examples of bioluminescent materials include 
luciferase, luciferin, and aequorin; and examples of suitable radioactive material include 
'^'l,^"lnor^^Tc. 

Inununo genie Compositions 

[64] The present invention also provides immunogenic compositions for the treatment of 
hematological malignancies. Non-limiting exemplary hematological malignancies include, 
but are not limited to, Hodgkin's disease, leukemia such as, acute lymphoid (lymphocytic or 
lymphoblastic) leukemia (ALL), acute myeloid (myelogenous or myeloblastic) leukemia 
(AML), acute lymphoid leukemia, biphenotypic (ALL, biphentoypic), acute undifferentiated 
leukemia (AUL), chronic myeloid (myelogenous or granulocytic) leukemia (CML), 
erythroleukemia, granuloxytic leukemia, lymphoma, monocytic leukemia, myleoma, 
myelomonocytic leukemia, myelodysplastic syndromes, non-Hodgkin lymphoma, 
progranulocytic leukemia. 

[65] According to the invention immunogenic compositions for the treatment of 
hematological malignancies comprise a substrate recognized by an 0CT6 transporter protein. 
Preferably, the substrate is a compound that binds selectively or specifically to a 0CT6 
transporter protein. In a preferred embodiment, the compound binds selectively to the 0CT6 
transporter protein encoded by a nucleotide sequence of SEQ ID N0:1. The compound may 
be a cytotoxin or coupled or conjugated with a cytoxic agent. Preferably the cytoxin or 
cytotoxic agent is a chemotherapeutic agent. 



20 



[66] The present invention also provides pharmaceutical compositions. Such compositions 
comprise a therapeutically effective amount of a compound, and a pharmaceutically 
acceptable carrier. 

[67] Cell surface proteins like the 0CT6 transporter can be utilized in antibody-based 
targeting strategies. In still another aspect of the invention, antibodies can be developed by 
known methods in the art against the external epitope of 0CT6 transporter protein. In a 
preferred embodiment, antibodies are substrates of the 0CT6 protein. The antibodies may be 
polyclonal antibodies or monoclonal antibodies. 

[68] Polyclonal antibodies to an antigen-of-interest can be produced by various procedures 
well known in the art. For example, a polypeptide of the invention can be administered to 
various host animals including, but not limited to, rabbits, mice, rats, etc. to induce the 
production of sera containing polyclonal antibodies specific for the antigen. Various 
adjuvants may be used to increase the immunological response, depending on the host 
species, and include but are not limited to, Freund's (complete and incomplete), mineral gels 
such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, 
polyanions, peptides, oil emulsions, keyhole Umpet hemocyanins, dinitrophenol, and 
potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and 
corynebacterium parvum. Such adjuvants are also well known in the art. 
[69] Monoclonal antibodies can be prepared using a wide variety of techniques known in 
the art including the use of hybridoma, recombinant, and phage display technologies, or a 
combination thereof For example, monoclonal antibodies can be produced using hybridoma 
techniques including those known in the art and taught, for example, in Harlow et al., 
Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988); 
Hammerling, et al., in: Monoclonal Antibodies and T-Cell Hybridomas 563-681 (Elsevier, 
N.Y., 1981) (said references incorporated by reference in their entireties). 
[70] The present invention further encompasses antibodies or fragments thereof 
conjugated to a diagnostic or therapeutic agent. The antibodies can be used diagnostically to, 
for example, monitor the development or progression of a tumor as part of a clinical testing 
procedure to, e.g., determine the efficacy of a given treatment regimen. Detection can be 
facilitated by coupling the antibody to a detectable substance. Examples of detectable 



21 



substances include various enzymes, prosthetic groups, fluorescent materials, luminescent 
materials, bioluminescent materials, radioactive materials, positron emitting metals using 
various positron emission tomographies, and noruadioactive paiwiagnetic metal ions. The 
detectable substance may be coupled or conjugated either directly to the antibody (or 
fragment thereof) or indirectly, through an intermediate, such as, for example, a linker known 
in the art, using techniques known in the art. (See, for example, U.S. Pat. No. 4,741,900 for 
metal ions which can be conjugated to antibodies for use as diagnostics according to the 
present invention.) Examples of suitable enzymes include horseradish peroxidase, alkaline 
phosphatase, beta-galactosidase, or acetylchoUnesterase; examples of suitable prosthetic 
group complexes include streptavidin/biotin and avidin/biotin; examples of suitable 
fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, 
rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example 
of a luminescent material includes luminol; examples of bioluminescent materials include 
luciferase, luciferin, and aequorin; and examples of suitable radioactive material include ^^^I, 
'^'l.'%or^'Tc. 

[71] Further, an antibody or fragment thereof may be conjugated to a therapeutic moiety 
such as a cytotoxin, e.g., a cytostatic or cytocidal agent, a therapeutic agent or a radioactive 
metal ion, e.g., alpha-emitters such as, for example, Bi. Non-limiting examples include 
paclitaxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, 
tenoposide, vincristine, vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxy 
anthracin dione, mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone, 
glucocorticoids, procaine, tetracaine, lidocaine, propranolol, and puromycin and analogs or 
homologs thereof Therapeutic agents include, but are not limited to, antimetabolites (e.g., 
methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil decarbazine), 
alkylating agents (e.g., mechlorethamine, thioepa chlorambucil, melphalan, carmustine 
(BSNU) and lomustine (CCNU), cyclothosphamide, busulfan, dibromomannitol, 
streptozotocin, mitomycin C, and cis-dichlorodiamine platinum (II) (DDP) cisplatin), 
anthracycUnes (e.g., daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (e.g., 
dactinomycin (formerly actinomycin), bleomycin, mithramycin, and anthramycin (AMC)), 
and anti-mitotic agents (e.g., vincristine and vinblastine). 



22 



[72] The conjugates of the invention can be used for modifying a given biological 
response such as inducing cell death for the treatment and prevention of hematological 
malignancies like leukemia. The therapeutic agent or drag moiety is not lo be construed as 
limited to classical chemical therapeutic agents. For example, the drug moiety may be a 
protein or polypeptide possessing a desired biological activity for inducing cell death. Such 
proteins may include, for example, a toxin such as abrin, ricin A, pseudomonas exotoxin, or 
diphtheria toxin; a protein such as tumor necrosis factor, a-interferon, .beta.-interferon, nerve 
growth factor, platelet derived growth factor, tissue plasminogen activator, an apoptotic 
agent, e.g., TNF-alpha, TNF-beta, AIM I (See, International Publication No. WO 97/33899), 
AIM II (See, International Publication No. WO 97/34911), Fas Ligand (Takahashi et al., Int. 
Immunol., 6:1567-1574 (1994)), VEGI (See, Intemational Publication No. WO 99/23105), a 
thrombotic agent or an anti-angiogenic agent, e.g., angiostatin or endostatin; or, biological 
response modifiers such as, for example, lymphokines, interleukin-1 ("IL-T'), interleukin-2 
C'IL-2"), interleukin-6 ('TL-6"), granulocyte macrophage colony stimulating factor ("GM- 
CSF"), granulocyte colony stimulating factor ("G-CSF"), or other growth factors. 

Therapeutic Treatment 

[73] The present invention is further directed to methods for preventing and treating 
hematological malignancies such as leukemia. According to the invention, hematological 
malignancies comprise without limitation, Hodgkin's disease, leukemia such as, acute 
lymphoid (lymphocytic or lymphoblastic) leukemia (ALL), acute myeloid (myelogenous or 
myeloblastic) leukemia (AML), acute lymphoid leukemia, biphenotypic (ALL, 
biphentoypic), acute undifferentiated leukemia (AUL), chronic myeloid (myelogenous or 
granulocytic) leukemia (CML), erythroleukemia, granuloxytic leukemia, lymphoma, 
monocytic leukemia, myleoma, myelomonocytic leukemia, myelodysplastic syndromes, non- 
Hodgkin lymphoma, progranulocytic leukemia. 

[74] Methods of treatment of the present invention comprise administering to a subject in 
need thereof an immunogenic composition of the present invention. The compositions may 
be administered with a pharmaceutically acceptable carrier. 



23 

[75] Such pharmaceutical carriers can be sterile liquids, such as water and oils, including 
those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, 
mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical 
composition is administered intravenously. Saline solutions and aqueous dextrose and 
glycerol solutions can also be employed as liquid carriers, particularly for injectable 
solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, 
gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, 
sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. 
The composition, if desired, can also contain minor amounts of wetting or emulsifying 
agents, or pH buffering agents. These compositions can take the form of solutions, 
suspensions, emulsion, tablets, pills, capsules, powders, sustained-release formulations and 
the like. The composition can be formulated as a suppository, with traditional binders and 
carriers such as triglycerides. Oral formulation can include standard carriers such as 
pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, 
cellulose, magnesium carbonate, etc. Examples of suitable pharmaceutical carriers are 
described in "Remington's Pharmaceutical Sciences" by E. W. Martin. Such compositions 
will contain a therapeutically effective amoxmt of the compound, preferably in purified form, 
together with a suitable amount of carrier so as to provide the form for proper administration 
to the patient. The formulation should suit the mode of administration. 
[76] In a preferred embodiment, the composition is formulated in accordance with routine 
procedures as a pharmaceutical composition adapted for intravenous administration to human 
beings. Typically, compositions for intravenous administration are solutions in sterile 
isotonic aqueous buffer. Where necessary, the composition may also include a solubilizing 
agent and a local anesthetic such as lignocaine to ease pain at the site of the injection. 
Generally, the ingredients are supplied either separately or mixed together in unit dosage 
form, for example, as a dry lyophilized powder or water free concentrate in a hermetically 
sealed container such as an ampoule or sachette indicating the quantity of active agent. 
Where the composition is to be administered by infusion, it can be dispensed with an infusion 
bottle containing sterile pharmaceutical grade water or saline. Where the composition is 



24 

administered by injection, an ampoule of sterile water for injection or saline can be provided 
so that the ingredients may be mixed prior to administration. 

[77] The compGunds of the invention can be fonnulated as neutral or salt forms. 
Pharmaceutically acceptable salts include those formed with anions such as those derived 
from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those formed with 
cations such as those derived from sodium, potassium, ammonium, calcium, ferric 
hydroxides, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine, procaine, etc. 
[78] The amount of the compound of the invention which will be effective in the 
treatment, inhibition and prevention of hematological malignancies can be determined by 
standard clinical techniques. In addition, in vitro assays may optionally be employed to help 
identify optimal dosage ranges. The precise dose to be employed in the formulation will also 
depend on the route of administration, and the seriousness of the disease or disorder, and 
should be decided according to the judgment of the practitioner and each patient*s 
circumstances. Effective doses may be extrapolated from dose-response curves derived from 
in vitro or animal model test systems. 

[79] Various other deHvery systems are known and can be used to administer a 
composition of the invention, e.g., encapsulation in liposomes, microparticles, microcapsules, 
recombinant cells capable of expressing the compound, receptor-mediated endocytosis (See, 
e.g., Wu and Wu, J. Biol. Chem. 262:4429-4432 (1987)), construction of a nucleic acid as 
part of a retroviral or other vector, etc. Methods of introduction include but are not limited to 
intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, 
and oral routes. The compounds or compositions may be administered by any convenient 
route, for example by infiision or bolus injection, by absorption through epithelial or 
mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.) and may be 
administered together with other biologically active agents. Administration can be systemic 
or local. In addition, it may be desirable to introduce the pharmaceutical compounds or 
compositions of the invention into the central nervous system by any suitable route, including 
intraventricular and intrathecal injection; intraventricular injection may be facilitated by an 
intraventricular catheter, for example, attached to a reservoir, such as an Ommaya reservoir. 



25 



Pulmonary administration can also be employed, e.g., by use of an inhaler or nebulizer, and 
formulation with an aerosolizing agent. 

[80] in a specific embodiment, it may be desirable to administer the pharmaceutical 
compounds or compositions of the invention locally to the area in need of treatment; this may 
be achieved by, for example, and not by way of limitation, local infusion during surgery, 
topical application, e.g., in conjunction with a wound dressing afler surgery, by injection, by 
means of a catheter, by means of a suppository, or by means of an implant, said implant 
being of a porous, non-porous, or gelatinous material, including membranes, such as sialastic 
membranes, or fibers. Preferably, when administering a protein, including an antibody, of 
the invention, care must be taken to use materials to which the protein does not absorb. 
[81] In another embodiment, the compound or composition can be delivered in a vesicle, 
in particular a liposome (See Langer, . Science 249:1527-1533 (1990); Treat et al., in 
Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler 
(eds.), Liss, New York, pp. 353-365 (1989); Lopez-Berestein, ibid., pp. 317-327; see 
generally ibid.) 

[82] In yet another embodiment, the compovmd or composition can be delivered in a 
controlled release system. In one embodiment, a pump may be used (see Langer, supra; 
Seflon, CRC Crit. Ref. Biomed. Eng. 14:201 (1987); Buchwald et al., Surgery 88:507 (1980); 
Saudek et al., N. Engl. J. Med. 321:574 (1989)). In another embodiment, polymeric materials 
can be used (see Medical Applications of Controlled Release, Langer and Wise (eds.), CRC 
Pres., Boca Raton, Fla. (1974); Controlled Drug Bioavailability, Drug Product Design and 
Performance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger and Peppas, J., 
Macromol. Sci. Rev, Macromol. Chem. 23:61 (1983); see also Levy et al.. Science 228:190 
(1985); During et al., Ann. Neurol. 25:351 (1989); Howard et al., J. Neurosurg. 71:105 
(1989)). In yet another embodiment, a controlled release system can be placed in proximity 
of the therapeutic target, i.e., the brain, thus requiring only a fraction of the systemic dose 
(see, e.g., Goodson, in Medical Applications of Controlled Release, supra, vol. 2, pp. 115- 
138(1984)). 

[83] In a specific embodiment where the compound of the invention is a nucleic acid 
encoding a protein, the nucleic acid can be administered in vivo to promote expression of its 



26 



encoded protein, by constructing it as part of an appropriate nucleic acid expression vector 
and administering it so that it becomes intracellular, e.g., by use of a retroviral vector (see 
U.S. Pat. No. 4,980,286), or by direct injection, or by use of microparticle bombardment 
(e.g., a gene gun; Biolistic, Dupont), or coating with lipids or cell-surface receptors or 
transfecting agents, or by administering it in linkage to a homeobox-like peptide which is 
known to enter the nucleus (see e.g., Joliot et al., Proc. Natl. Acad. Sci. USA 88:1864-1868 
(1991)), etc. Alternatively, a nucleic acid can be introduced intracellularly and incorporated 
within host cell DNA for expression, by homologous recombination. 

Examples 

[84] The following examples are presented for the illustrative purposes and it is to be 
understood that the present invention is not limited to those precise embodiments, and that 
various changes and modifications can be effected therein by one skilled in the art without 
departing from the scope and spirit of the invention as defined by the appended claims. 

[85] Example 1. 0CT6 Nucleotide Sequence Identification and Analysis 
[86] 0CT6 was first identified as a potential OCT gene by assembling and sequencing 
ESTs. BLAST searches of human ESTs in GenBank data base identified AI040384 (654 bp), 
AA033971 (714 bp) and H70190 (474 bp) sequences from three fetal liver IMAGE clones, 
1656502, 429904 and 212935 respectively. IMAGE clone 1656502 (3', insert 1337 bp) 
ended the predicted 3' stop codon, whereas IMAGE clone 429904 (5', insert 996 bp) and 
IMAGE clone 212935 (5', insert 966 bp) aUgned with the 5 -coding region. All clones were 
obtained from the IMAGE Consortium through the American Type Culture Collection 
(Manassas, VA). Each clone was sequenced in both directions. The sequences were 
determined using ABI Prism TM 377 DNA sequencer (Perkin-Ehner). Our assemblage 
proved to be identical to the recently submitted cDNA 0KB 1 (AF268892) submitted by M. 
Okabe and T. Abe. We have dubbed this gene 0CT6 as OCTNl and 0CTN2 may be 
considered as 0CT4 and 0CT5 respectively. 

[87] The 0CT6 gene (SEQ ID N0:1) is also contained within BAG clone CTA-331P3 
(SEQ ID N0:3) (GenBank AC002464) located at chromosome 6q21. It is divided into 6 



27 



exons that span 42 kb on the human genome, from nucleotide 79,570 to nucleotide 120490 
onCTA-331P3. 

[88] The gene has a predicted protein stracture typical of transport proteins with 2 groups 
of 6 transmembrane domains separated by a hydrophilic region (Figure lA). The large 
hydrophilic region between TMDl and TMD2 is typical of OCT and OAT genes and . is 
presumed to be located on the outside surface of the cell membrane. The 0CT6 protein 
contains potential sites for N-glycosylation and phosphorylation, which will be described 
below in Methods. Of interest, the protein sequence also contains a 22 amino acid leucine 
zipper motif, starting at amino acid 146, suggesting that there may be a physical interaction 
between 0CT6 and ion channels or other membrane-associated proteins. 
[89] CLUSTALW alignment produced a dendrogram showing the phylogenic relationship 
between 0CT6 and other OAT and OCT proteins (Figure IB). This dendrogram suggests 
that the distinction between OAT and OCT genes, based on functional studies, obscures the 
common origin of both famiUes of transporters. The actual CLUSTALW alignment of these 
genes is shown in Figure 2 and demonstrates multiple regions of conservation among all of 
these genes. 

[90] The hydropathy profile analysis, multiple sequence alignments of amino acid 
sequences using CLUSTALW and the phylogenetic tree were all produced with Mac Vector 
software. 

[91] Example 2 . Molecular cloning of 0CT6 

[92] BLAST searches of human ESTs in GenBank data base identified AI040384 (654 
bp), AA033971 (714 bp) and H70190 (474 bp) sequences from three fetal liver IMAGE 
clones, 1656502, 429904 and 212935 respectively. IMAGE clone 1656502 (3', insert 1337 
bp) ended the predicted 3' stop codon, whereas IMAGE clone 429904 (5', insert 996 bp) and 
IMAGE clone 212935 (5', insert 966 bp) aligned with the 5'-coding region. All clones were 
obtained from the IMAGE Consortium through the American Type Culture Collection 
(Manassas, VA). Each clone was sequenced in both directions. The sequences were 
determined using ABI Prism TM 377 DNA sequencer (Perkin-Elmer). 



28 



[93] Example 3. Quantitative RT-PCR of 0CT6 RNA levels in cancer cell lines 
[94] Total RNA isolated from 50 cell lines used in the NCI drug screen program was 
provided by Ihe Developmental Therapeutics Program, NCI. Quantitative RT-PCR for 
detecting OAT-X transporter gene expression was performed by using a Roche LightCycler, 
which uses real time fluorescence detection for quantitative measurement of PCR products. 
A gene-specific primer pair was designed with Oligo 4.0 software and purchased from 
Integrated DNA Technologies, Inc. (Coralville, lA) (F: 5'- 
GGCACATTTATTCACCAAGACCAG-3') (SEQ ID N0:13) and (F: 5'- 
TGTGGACCTCAGCAGCATTTGGAT -3') (SEQ ID NO: 14). The specificity of the PCR 
reaction was confirmed by directly determining the DNA sequence of the PCR product. 
First, cDNA was synthesized from total RNA using Superscript First-Strand Synthesis 
System (GIBCO/BRL) in a 20 ^il volume following the instructions suppUed by the 
manufacturer. The cDNA treated with RNAse H for 20 minutes at 37°C and stored at - 
20°C. Then, 2ul of cDNA reaction was amplified in a standard PCR reaction condition, 
using 0.3 |xM primer concentration, with the addition of SYBR Green I Dye. After 30 
seconds denature at 95°C, the amplification reaction proceeded through 45-50 cycles of 95°C 
denature for 0 second, 62-65 °C annealing for 10 seconds and a 72°C extension for 40 
seconds, with slopes of 20^C/s, 20°C/s and 2°C/s, respectively, 

[95] Fluorescence was acquired during each cycle after heating to a temperature just below 
the product melting temperature. Quantification was performed using the LightCycler 
analysis software. The log-linear portion of the standard amplification curve was identified, 
and the 'crossing point', a threshold of relative fluorescence, was determined as the best fit 
through the log-linear region above the background fluorescence (noise) band. The 
quantification of PCR product then was derived by plotting fluorescence data in the log linear 
region of each sample to determine a calculated number of cycles needed to reach the 
fluorescence crossing point. The calculated number of cycles required to reach the crossing 
point is proportional to the amount of target RNA in the sample. The relative amount of 
product was described in arbitrary units by interpolation of the data using a standard curve of 
a series of dilutions of a standard cell line RNA. The quantitative measurement of each gene 
in each cell Une was normalized to the relative amount of actin RNA in each cell line, as a 



29 



control for equivalent cDNA loading in each sample. The results represent the average of 3 
independent determinations performed in duplicate. 

[96] A melting curve analysis was peffomied with positive control RNA prior analysis of 
the cell lines to enhance sensitivity and the specificity of the data. Amplified products 
usually melt quickly at a temperature characteristic for the products. The fluorescence signal 
was acquired at a temperature just below the Tm of the specific PCR product and above the 
Tm of the primer dimers. All specific PCR products displayed a single, sharply melting 
curve with a narrow peak. In addition, PCR products were confirmed for specificity and 
correct size by visualization of the LightCycler products on a 1% agarose gel. 

[97] Example 4. Tissue distribution 

[98] First strand cDNAs derived fi"om 24 aduh and fetal tissues (RAPID-SCAN gene 
expression panel, OriGene Technologies, Rockville, MD). The PCR primers used in this 
study were the same as used in the quantitative RT-PCR studies. The PCR reaction samples 

o o 

were denatured at 94 C for 30 seconds, annealed and extended at 64 C for 30 sec for 35 
cycles. The PCR products were then visualized on 1% agarose gels. 

[99] Example 5. Cell sorting 

[100] All human specimens were obtained in accordance with institutional IRB guidelines. 
Leukocytes from fresh discarded buffy coats were isolated after RBC lysis with ammonium 
chloride and labeled with lineage specific antibodies (CD 14, monocytes; CD 15, 
granulocytes; CD3, T-cells; and CD20, B-cells), and isolated using a FACSVantage flow 
cytometer. Each population was sorted twice to ensure purities of at least 99%. CD34 cells 
were obtained fi-om discarded aliquots of G-CSF-mobilized peripheral blood stem cell 
collections fi-om cancer patients. For each sample, the PCR results represent the pooled 
average of cells fi-om 2 individuals performed in triplicate or quadruplicate. 

[101] Example 6. 0CT6 RNA levels in leukemic blasts 

[102] Total RNA was extracted fi:om leukemia specimens using QIAGEN RNeasy midi kit. 
150ng of total RNA were used as a template for the first strand cDNA synthesis with the 



30 



Oligo(dT) primer using the super script system (GEBCO BRL) according to the 
manufacturer's protocol. Quantitative real-time RT-PCR was performed using an iCycler 
tliermal cycler wltli methods similar to those described above for the Roche LightCycier. 
The results represent the average of 3 independent determination performed in duplicate. 
[103] Although illustrative embodiments of the present invention have been described in 
detail, it is to be imderstood that the present invention is not limited to those precise 
embodiments, and that various changes and modifications can be effected therein by one 
skilled in the art without departing from the scope and spirit of the invention as defined by 
the appended claims.